NEET 2004 To 23 Chapterwise PYQs - Biology

Published by
Vedantu Innovations Pvt. Ltd.

D. No. 1081, 3rd Floor, Vistar Arcade,
14th Main Rd, Sector 3, HSR Layout
Bangalore, Karnataka, India 560 102
www.vedantu.com
All rights reserved. No part of this book may be reproduced or utilized in any form or by any
means, electronic or mechanical, including photocopying, recording, or by any information
storage and retrieval system, without permission in writing from the publishers.
Notice: Vedantu is committed to serving students with the best resources and knowledge.
Bearing that in mind, we have obtained all the information in this book from sources regarded
as reliable, and taken utmost care in editing and printing this book. However, as authors and
publishers, we are not to be held responsible for unintentional mistakes that might have crept
in. Having stated that, errors (if any) brought to our notice shall be gratefully acknowledged
and rectiﬁed in upcoming editions.
Printed by
LASERPRINTS
Quality - Ethics - Service
H-4 (a), Electronic Complex, Road No.1 IPIA, Kota
(Rajasthan) INDIA
Phones : 0744-2436941Mobile : 9829037941
*Mail ID : [email protected], [email protected]
Founder's Massage
Aspiring medical professionals, welcome! As the founder of Vedantu, it is with immense

pride that I present to you this comprehensive collection of NEET previous year
questions.
This book is not just another compilation of past papers. We understand the vital role
that thorough preparation plays in your journey towards securing a coveted seat in a
medical college. That's why, unlike other publications, we haven't omitted a single
question from the past 20 years of NEET examinations.
This unparalleled collection, meticulously categorized chapter-wise across Physics,
Chemistry, and Biology, provides you with an invaluable resource for:
 Exam pattern familiarization: Immerse yourself in the actual questions asked

year after year, gaining a deep understanding of the format, weightage, and
difficulty level of the NEET exam.
 Comprehensive revision: Revisit and practice questions from every single

chapter, ensuring that no concept remains untouched in your preparation.
 Identifying recurring trends: Analyze the repeated themes and question types,
allowing you to strategically focus your study efforts on crucial areas.
This extensive volume serves as a testament to our unwavering commitment to your

success. We believe that by equipping you with the most complete and authentic practice
material, we are empowering you to confidently conquer the NEET exam.
So, dive into this treasure trove of past year questions, and embark on your NEET
journey with unwavering determination. Remember, at Vedantu, we are dedicated to
being your partner in achieving your medical aspirations.
With best wishes,

The Founder, Vedantu
3
TABLE OF CONTENTS
BIOLOGY
The Living World................................................................................................................................................. 6
Answer Key ........................................................................................................................................................... 145
Solutions ................................................................................................................................................................ 151
Biological Classification....................................................................................................................................... 8
Answer Key ........................................................................................................................................................... 145
Solutions ................................................................................................................................................................ 152
Plant Kingdom ..................................................................................................................................................... 12
Answer Key ........................................................................................................................................................... 145
Solutions ................................................................................................................................................................ 155
Animal Kingdom ................................................................................................................................................. 16
Answer Key ........................................................................................................................................................... 145
Solutions ................................................................................................................................................................ 158
Morphology of Flowering Plants........................................................................................................................ 22
Answer Key ........................................................................................................................................................... 145
Solutions ................................................................................................................................................................ 161
Anatomy of Flowering Plants............................................................................................................................. 27
Answer Key ........................................................................................................................................................... 145
Solutions ................................................................................................................................................................ 164
Structural Organisation in Animals................................................................................................................... 31
Answer Key ........................................................................................................................................................... 146
Solutions ................................................................................................................................................................ 166
Cell: The Unit of Life........................................................................................................................................... 35
Answer Key ........................................................................................................................................................... 146
Solutions ................................................................................................................................................................ 168
Biomolecules.......................................................................................................................................................... 41
Answer Key ........................................................................................................................................................... 146
Solutions ................................................................................................................................................................ 171
Cell Cycle and Cell Division................................................................................................................................ 45
Answer Key ........................................................................................................................................................... 146
Solutions ................................................................................................................................................................ 174
Photosynthesis in Higher Plants.......................................................................................................................... 49
Answer Key ........................................................................................................................................................... 146
Solutions ................................................................................................................................................................ 177
Respiration in Plants............................................................................................................................................ 52
Answer Key ........................................................................................................................................................... 146
Solutions ................................................................................................................................................................ 179
Plant Growth and Development.......................................................................................................................... 54
Answer Key ........................................................................................................................................................... 147
Solutions ................................................................................................................................................................ 181
Breathing and Exchange of Gases....................................................................................................................... 57
Answer Key ........................................................................................................................................................... 147
Solutions ................................................................................................................................................................ 183
Body Fluids and Circulation................................................................................................................................ 60
Answer Key ........................................................................................................................................................... 147
4
Solutions ................................................................................................................................................................ 185

Excretory Products and Elimination.................................................................................................................. 64
Answer Key ........................................................................................................................................................... 147
Solutions ................................................................................................................................................................ 187
Locomotion and Movement................................................................................................................................. 67
Answer Key ........................................................................................................................................................... 147
Solutions ................................................................................................................................................................ 189
Neural Control and Coordinaton........................................................................................................................ 70
Answer Key ........................................................................................................................................................... 147
Solutions ................................................................................................................................................................ 191
Chemical Coordination and Integration…........................................................................................................ 74
Answer Key ........................................................................................................................................................... 147
Solutions ................................................................................................................................................................ 193
Sexual Reproduction in Flowering Plants.......................................................................................................... 79
Answer Key ........................................................................................................................................................... 148
Solutions ................................................................................................................................................................ 196
Human Reproduction.......................................................................................................................................... 84
Answer Key ........................................................................................................................................................... 148
Solutions ................................................................................................................................................................ 199
Reproductive Health............................................................................................................................................ 90
Answer Key ........................................................................................................................................................... 148
Solutions ................................................................................................................................................................ 202
Principles of Inheritance and Variation............................................................................................................. 93
Answer Key ........................................................................................................................................................... 148
Solutions ................................................................................................................................................................ 204
Molecular Basis of Inheritance.......................................................................................................................... 102
Answer Key ........................................................................................................................................................... 148
Solutions ................................................................................................................................................................ 209
Evolution............................................................................................................................................................... 109
Answer Key ........................................................................................................................................................... 149
Solutions ................................................................................................................................................................ 214
Human Health and Diseases ............................................................................................................................... 115
Answer Key ........................................................................................................................................................... 149
Solutions ................................................................................................................................................................ 217
Microbes in Human Welfare................................................................................................................................ 120
Answer Key ........................................................................................................................................................... 149
Solutions ................................................................................................................................................................ 220
Biotechnology Principles and Processes............................................................................................................. 124
Answer Key ........................................................................................................................................................... 149
Solutions ................................................................................................................................................................ 222
Biotechnology: and its Application....................................................................................................................... 129
Answer Key ........................................................................................................................................................... 149
Solutions ................................................................................................................................................................ 225
Organisms and Population .................................................................................................................................. 133
Answer Key ........................................................................................................................................................... 149
Solutions ................................................................................................................................................................ 228
Ecosystem............................................................................................................................................................... 137
Answer Key ........................................................................................................................................................... 150
Solutions ................................................................................................................................................................ 231
Biodiversity and Conservation............................................................................................................................ 141
Answer Key ........................................................................................................................................................... 150
Solutions ................................................................................................................................................................ 233
BIOLOGY
THE LIVING WORLD 6
THE LIVING WORLD

1. In the taxonomic categories which hierarchical 5. The label of a herbarium sheet DOES NOT carry
arrangement in descending order is correct in the case of information on
animals? (a) Name of collector
(a) Kingdom, Phylum, Class, Order, Family, Genus, (b) Local names
Species (c) Height of the plant
(b) Kingdom, Class, Phylum, Family, Order, Genus, (d) Date of collection
Species [NEET (2016-ii)]
(c) Kingdom, Order, Class, Phylum, Family, Genus, 6. Nomenclature is governed by certain universal rules.
Species Which one of the following is contrary to the rules of
(d) Kingdom, Order, Phylum, Class, Family, Genus, nomenclature?
Species (a) Biological names can be written in any language
(b) The first word in a biological name represents
[NEET (2022)]
the genus name, and the second is a specific
2. Which one of the following belongs to the family epithet
Muscidae? (c) The names are written in Latin and are italicized
(a) Cockroach (b) Housefly (d) When written by hand, the names are to be
(c) Firefly (d) Grasshopper underlined
[NEET (2021)] [NEET (2016-i)]
3. Select the correctly written scientific name of Mango 7. Which one of the following is not a correct
which was first described by Carolus Linnaeus. statement?
(a) Mangifera indica Linn. (a) Flora contains an actual account of the habitat and
(b) Mangifera indica distribution of plants in a given area
(c) Mangifera Indica (b) Botanical gardens have collections of living plants
(d) Mangifera indica Car. Linn for reference
[NEET (2019)] (c) A museum has a collection of photographs of plants
4. Match the items given in Column I with those in Column and animals
II and select the correct option given below. (d) Key is a taxonomic aid for identiﬁcation of
specimens
Column I Column II [NEET (2013)]
(a) Herbarium (i) It is a place having a 8. Which one of the following animals is correctly
collection of preserved matched with its particular named taxonomic
plants and animals category ?
(b) Key (ii) A list that enumerates (a) Housefly – Musca, an order
methodically all the species (b) Tiger –tigris, the species
(c) Cuttlefish- Mollusca, a class
found in an area with brief
(d) Humans – Primata, the family
description aiding
identification. [NEET (2011)]
9. Two plants can be conclusively said to belong to the
(c) Museum (iii) Is a place where dried and same species if they :
pressed plant specimens (a) Have same number of chromosomes
mounted on sheets are kept. (b) Can reproduce freely with each other and form
(d) Catalogue (iv) A booklet containing a list seeds
of characters and their (c) Have more than 90 percent similar genes
alternatives which are (d) Look similar and possess identical secondary
helpful in identification of metabolites.
various taxa [NEET (2007)]
10. ICBN stands for :
(a) a → (iii); b → (ii); c → (i); d → (iv) (a) Indian Code of Botanical Nomenclature
(b) a → (ii); b → (iv); c → (iii); d → (i) (b) Indian Congress of Biological Names
(c) a → (i); b → (iv); c → (iii); d → (ii (c) International code of Botanical Nomenclature
(d) a → (iii); b → (iv); c → (i); d → (ii) (d) International Congress of Biological Names
[NEET (2018)] [NEET (2007)]
THE LIVING WORLD 7
11. The living basis of their ability for:- organisms can be 12. One of the most important functions of botanical
unexceptionally distinguished from the non-living gardens is that
things on the (a) They allow ex-situ conservation of germplasm
(a) Growth and movement (b) They provide the natural habitat for wild
(b) Responsiveness to touch life
(c) Interaction with the environment and progressive (c) One can observe tropical plants there
evolution (d) They provide a beautiful area for recreation
(d) Reproduction [NEET (2005)]
[NEET (2007)]
BIOLOGICAL CLASSIFICATION 8
BIOLOGICAL CLASSIFICATION
1. Given below are two statements: 8. Ciliates differ from all other protozoans in
Statement I: Mycoplasma can pass through less than 1 (a) Using pseudopodia for capturing prey
micron filter size. (b) Having a contractile vacuole for removing excess
Statement II: Mycoplasma are bacteria with a cell wall. water
In the light of the above statements, choose the most (c) Using flagella for locomotion
appropriate answer from the options given below: (d) Having two types of nuclei
(a) Both Statement I and Statement II are correct [NEET (2018)]
(b) Both Statement I and Statement II are incorrect 9. Select the wrong statement.
(c) Statement I is correct but Statement II is incorrect (a) Mushrooms belong to Basidiomycetes
(d) Statement I is incorrect but Statement II is correct (b) Pseudopodia are locomotory and feeding structures
in Sporozoans
[NEET (2022)]
(c) Cell wall is present in members of Fungi and
2. Which of the following is a correct statement? Plantae
(a) Cyanobacteria are a group of autotrophic organisms (d) Mitochondria are the powerhouse of the cell in all
classified under Kingdom Monera. kingdoms except monera
(b) Bacteria are exclusively heterotrophic organisms [NEET (2018)]
(c) Slime moulds are saprophytic organisms classified 10. Which among the following is not a prokaryote?
under Kingdom Monera. (a) Nostoc (b) Mycobacterium
(d) Mycoplasma have DNA, Ribosome and cell wall (c) Saccharomyces (d) Anabaena
[NEET (2022)] [NEET (2018)]
3. Which of the following statements is correct? 11. Which of the following are found in extreme saline
(a) Organisms that depend on living plants are called conditions?
saprophytes (a) Cyanobacteria (b) Mycobacteria
(b) Some of the organisms can fix atmospheric (c) Archaebacteria (d) Eubacteria
nitrogen in specialized cells called sheath cells [NEET (2017)]
(c) Fusion of two cells is called Karyogamy 12. Viroids differ from viruses having
(d) Fusion of protoplasms between two motile or non- (a) RNA molecules with a protein coat
motile gametes is called plasmogamy (b) RNA molecules without a protein coat
[NEET (2021)] (c) DNA molecules with a protein coat
4. Which of the following is correct about viroids? (d) DNA molecules without a protein coat
(a) They have DNA with a protein coat [NEET (2017)]
(b) They have free DNA without a protein coat 13. Study the four statements (A-D) given below and select
(c) They have RNA with a protein coat the two CORRECT ones out of them
(d) They have free RNA without a protein coat A. Definition of biological species was given by Ernst
[NEET (2020)] Mayr.
5. Which of the following statements is incorrect? B. Photoperiod does not affect reproduction in plants.
(a) Viruses are obligate parasites C. Binomial nomenclature system was given by R.H.
(b) Infective constituent in viruses is the protein coat Whittaker.
(c) Prions consist of abnormally folded proteins D. In unicellular organisms, reproduction is
(d) Viroids lack a protein coat synonymous with growth.
[NEET (2019)] The two correct statements are
6. Which of the following statements is incorrect? (a) C and D (b) A and D
(a) Claviceps is a source of many alkaloids and LSD (c) A and B (d) B and C
(b) Conidia are produced exogenously and ascospores [NEET (2016-II)]
endogenously 14. Select the WRONG statement.
(c) Yeasts have filamentous bodies with long thread- (a) ‘Diatomaceous earth’ is formed by the cell walls of
like hyphae diatoms
(d) Morels and truffles are edible delicacies (b) Diatoms are chief producers in the oceans
[NEET (2019)] (c) Diatoms are microscopic and float passively in
7. Which of the following organisms are known as chief water
producers in the oceans? (d) The walls of diatoms are easily destructible
(a) Cyanobacteria (b) Diatoms [NEET (2016-II)]
(c) Dinoflagellates (d) Euglenoids
[NEET (2018)]
15. Methanogens belong to 25. Choose the wrong statement.

(a) Archaebacteria (b) Dinoflagellates (a) Penicillium is multicellular and produces
(c) Slime moulds (d) Eubacteria antibiotics.
[NEET (2016-II)] (b) Neurospora is used in the study of biochemical
16. Which one of the following is WRONG for fungi? genetics.
(a) All fungi possess a purely cellulosic cell wall (c) Morels and truffles are poisonous mushrooms.
(b) They are heterotrophic (d) Yeast is unicellular and useful in fermentation.
(c) They are both unicellular and multicellular [NEET (2015)]
(d) They are eukaryotic 26. Cell wall is absent in:
[NEET (2016-II)] (a) Aspergillus
17. Select the WRONG statement. (b) Funaria
(a) Pili and fimbriae are mainly involved in motility of (c) Mycoplasma
bacterial cells (d) Nostoc
(b) Cyanobacteria lack flagellated cells [NEET (2015)]
(c) Mycoplasma is a wall-less microorganism 27. Select the wrong statement.
(d) Bacterial cell wall is made up of peptidoglycan (a) The viroids were discovered by D.J. Ivanowski.
[NEET (2016-II)] (b) W.M. Stanley showed that viruses could be
18. Chrysophytes, Euglenoids, Dinoflagellates and Slime crystallised.
moulds are included in the kingdom (c) The term 'contagium vivum fluidum' was coined by
(a) Monera (b) Protista M.W. Beijerinck.
(c) Fungi (d) Animalia (d) Mosaic disease in tobacco and AIDS in human
[NEET (2016-I)] beings are caused by viruses.
19. Which one of the following statements is wrong? [NEET (2015)]
(a) Cyanobacteria are also called blue-green-algae. 28. The imperfect fungi which are decomposers of litter
(b) Golden algae are also called desmids. and help in mineral cycling belong to
(c) Eubacteria are also called false bacteria. (a) Deuteromycetes
(d) Phycomycetes are also called algal fungi. (b) Basidiomycetes
[NEET (2016-I)] (c) Phycomycetes
20. One of the major components of cell wall of most fungi (d) Ascomycetes
is [NEET (2015)]
(a) Chitin (b) Peptidoglycan 29. Which of the following shows coiled RNA strand and
(c) Cellulose (d) Hemicellulose capsomeres?
[NEET (2016-I)] (a) Tobacco mosaic virus (b) Measles virus
21. Which of the following statements is wrong for (c) Retrovirus (d) Polio virus
viroids? [NEET (2014)]
(a) They lack a protein coat 30. The motile bacteria are able to move by:
(b) They are smaller than viruses (a) Flagella (b) Cilia
(c) They cause infections (c) Pili (d) Fimbriae
(d) Their RNA is of high molecular weight [NEET (2014)]
[NEET (2016-I)] 31. Archaebacteria differ from other bacteria in:
22. Pick out the wrong statement. (a) Mode of nutrition
(a) Cell wall is absent in Animalia. (b) Cell shape
(b) Protista have photosynthetic and heterotrophic (c) Mode of reproduction
modes of nutrition. (d) Cell wall structure
(c) Some fungi are edible. [NEET (2014)]
(d) Nuclear membrane is present in Monera. 32. Viruses have:
[NEET (2015)] (a) Prokaryotic nucleus
23. In which group of organisms, the cell walls form two (b) Single chromosome
thin overlapping shells which fit together? (c) Both DNA and RNA
(a) Chrysophytes (b) Euglenoids (d) DNA enclosed in a protein coat
(c) Dinoflagellates (d) Slime moulds [NEET (2014)]
[NEET (2015)] 33. Which one of the following living organisms
24. The structures that help some bacteria to attach to rock completely lacks a cell wall?
and/or host tissues are: (a) Sea-fan (Gorgonia)
(a) Rhizoids (b) Fimbriae (b) Saccharomyces
(c) Mesosomes (d) Holdfast (c) Blue-green algae
[NEET (2015)] (d) Cyanobacteria
[NEET (2014)]
34. Which structures perform the function of mitochondria (b) Evolutionary relationships
in bacteria? (c) Morphological features
(a) Cyanobacteria (b) Cell wall (d) Chemical constituents
(c) Mesosomes (d) Nucleoid [NEET (2009)]
[NEET (2014)] 45. Which one is the wrong pairing for the disease and its
35. Five kingdom system of classification suggested by causal organism ?
R.H. Whittaker is not based on (a) Root-knot of vegetables : Meloidogyne sp
(a) Mode of reproduction (b) Late blight of potato : Alternaria solani
(b) Mode of nutrition (c) Black rust of wheat : Puccinia graminis
(c) Complexity of body organisation (d) Loose smut of wheat : Ustilago nuda
(d) Habitat [NEET (2009)]
[NEET (2014)] 46. T.O.Diener discovered a :
36. Which of the following are likely to be present in deep (a) Bacteriophage
seawater? (b) Free infection DNA
(a) Archaebacteria (b) Eubacteria (c) Free infectious RNA
(c) Blue-green algae (d) Saprophytic fungi (d) Infectious protein
[NEET (2013)] [NEET (2009)]
37. Pigment-containing membranous extensions in some 47. In the light of recent classification of living organisms
cyanobacteria are into three domains of life (bacteria, archaea and
(a) Heterocysts eukarya), which one of the following statements is true
(b) Basal bodies about archaea?
(c) Pneumatophores (a) Archaea completely differ from both prokaryotes and
(d) Chromatophore eukaryotes
[NEET (2013)] (b) Archaea completely differ from prokaryotes
38. Besides paddy fields, cyanobacteria are also found (c) Archaea resemble eukarya in all respects
inside vegetative part of (d) Archaea have some novel features that are absent in
(a) Pinus (b) Cycas other prokaryotes and eukaryotes
(c) Equisetum (d) Psilotum [NEET (2008)]
[NEET (2013)] 48. Which one of the following is linked to the discovery of
39. In the five-kingdom classification, Chlamydomonas and Bordeaux mixture as a popular fungicide?
Chlorella have been included in (a) Loose smut of wheat
(a) Algae (b) Plantae (b) Black rust of wheat
(c) Monera (d) Protista (c) Bacterial leaf blight of rice
[NEET (2012)] (d) Downy mildew of grapes
40. Single-celled eukaryotes are included in: [NEET (2008)]
(a) Protista (b) Fungi 49. Which one of the following is a slime mould ?
(c) Archaea (d) Monera (a) Anabaena (b) Rhizopus
[NEET (2010)] (c) Physarum (d) Thiobacillus
[NEET (2007)]
41. Virus envelope is known as –
50. Which one of the following statements about
(a) Capsid (b) Virion
mycoplasma is wrong?
(c) Nucleoprotein (d) Core
(a) They cause diseases in plants
[NEET (2010)]
(b) They are also called PPLO
42. Some hyperthermophilic organisms that grow in highly
(c) They are pleomorphic
acidic (pH2) habitats belong to the two groups –
(d) They are sensitive to penicillin
(a) Eubacteria and archea
[NEET (2007)]
(b) Cyanobacteria and diatoms
51. Which pair of the following belongs to
(c) Protists and mosses
Basidiomycetes?
(d) Liverworts and yeasts (a) Morchella and Mushrooms
[NEET (2010)] (b) Birds' nest fungi and Pufballs
43. Infectious proteins are present in – (c) Pufballs and Claviceps
(a) Gemini viruses (d) Peziza and Stink horns
(b) Prions [NEET (2007)]
(c) Viroids 52. Ergot of rye is caused by a species of:-
(d) Satellite viruses (a) Claviceps (b) Phytophthora
[NEET (2010)] (c) Uncinula (d) Ustilago
44. Phylogenetic system of classification is based on: [NEET (2007)]
(a) Floral characters
53. The thalloid body of a slime mould (Myxomycetes) is (c) Several cyanobacteria and several diatoms
known as- (d) Some diatoms and several cyanobacteria
(a) Protonema [NEET (2005)]
(b) Plasmodium 58. Which of the following is not true for a species -
(c) Fruiting body (a) Members of a species can interbreed
(d) Mycelium (b) Variations occur among members of a species
[NEET (2006)] (c) Gene flow does not occur between the populations
54. Which of the following pairs of an animal and a plant of a species
represents endangered organisms in India- (d) Each species is reproductively isolated from every
(a) Bentinckia nicobarica and Red Panda other species.
(b) Tamarind and Rhesus monkey [NEET (2005)]
(c) Cinchona and Leopard 59. Barophilic prokaryotes -
(d) Banyan and Black buck (a) Grow slowly in highly alkaline frozen lakes at high
[NEET (2006)] altitudes
55. What is common about Trypanosoma, Noctiluca, (b) Grow and multiply in very deep marine sediments
Monocystis and Giardia- (c) Readily grow and divide in sea water enriched in
(a) These are all unicellular protists any soluble salt of barium
(b) They have flagella (d) Occur in water containing high concentrations of
(c) They produce spores barium hydroxide
(d) These are all parasites [NEET (2005)]
[NEET (2006)] 60. Viruses that infect bacteria, multiply and cause their
56. Which of the following environmental conditions are lysis are called -
essential for optimum growth of Mucor on a piece of (a) Lipolytic (b) Lytic
bread ? (c) Lysogenic (d) Lysozymes
A. Temperature of about 25oC [NEET (2004)]
B. Temperature of about 5oC 61. Lichens are well known combination of an alga and a
C. Relative humidity of about5% fungus where fungus has :-
D. Relative humidity of about 95% (a) An epiphytic relationship with the alga
E. A shady place (b) A parasitic relationship with the alga
F. A brightly illuminated place (c) A symbiotic relationship with the alga
Choose the answer from the following options (d) A saprophytic relationship with the alga
(a) A, C and E only [NEET (2004)]
(b) A, D and E only 62. Phenetic classification of organisms is based on:-
(c) B, D and E only (a) The ancestral lineage of existing organisms
(d) B, C and F only (b) Dendogram based on DNA characteristics
[NEET (2006)] (c) Sexual characteristics
57. Auxospores and hormocysts are formed respectively, (d) Observable characteristics of existing organisms
by - [NEET (2004)]
(a) Some cyanobacteria and many diatoms
(b) Several diatoms and a few cyanobacteria
PLANT KINGDOM 12
PLANT KINGDOM
1. Identify the pair of heterosporous pteridophytes among 6. Match the plant with the kind of life cycle it exhibits.
the following: Choose the correct answer from the options given
(a) Selaginella and Salvinia below:
(b) Psilotum and Salvinia
(c) Equisetum and Salvinia List I List II
(d) Lycopodium Selaginella (a) Spirogyra (i) Dominant diploid
[NEET (2023)] sporophyte vascular
2. Given below are two statements: One is labelled as plant, with highly
Assertion A and the other is labelled as Reason R. reduced male or female
Assertion A: In gymnosperms the pollen grains are
released from the microsporangium and carried by air gametophyte
currents. (b) Fern (ii) Dominant haploid free-
Reason R: Air currents carry the pollen grains to the living gametophyte
mouth of the archegonia where the male gametes are (c) Funaria (iii) Dominant diploid
discharged, and pollen tube is not formed. sporophyte alternating
In the light of the above statements, choose the correct with reduced
answer from the options given below:
(a) Both A and R are true, but R is NOT the correct gametophyte called
explanation of A. prothallus
(b) A is true, but R is false. (d) Cycas (iv) Dominant haploid leafy
(c) A is false, but R is true. gametophyte alternating
(d) Both A and R are true, and R is the correct with partially dependent
explanation of A. multicellular sporophyte
[NEET (2023)]
3. Given below are two statements: One is labelled as (a) (a)- (iv); (b) - (i); (c) - (ii);(d) - (iii)
Assertion A and the other is labelled as Reason R: (b) (a)- (ii); (b) - (iii); (c) - (iv);(d) - (i)
Assertion A: The first stage of gametophyte in the life (c) (a)- (iii); (b) - (iv); (c) - (i);(d) - (ii)
cycle of moss is protonema stage. (d) (a)- (ii); (b) - (iv); (c) - (i);(d) - (iii)
Reason R: Protonema develops directly from spores [NEET (2022)]
produced in capsule. 7. Which of the following algae produce Carrageen?
In the light of the above statements, choose the most (a) Red Algae
appropriate answer from the options given below: (b) Blue-Green Algae
(a) Both A and R are correct, but R is NOT the correct (c) Green Algae
explanation of A. (d) Brown Algae
(b) A is correct, but R is not correct. [NEET (2021)]
(c) A is not correct, but R is correct. 8. Gemmae are present in
(d) Both A and R are correct, and R is the correct (a) Some Gymnosperms
explanation of A. (b) Some Liverworts
(c) algae
[NEET (2023)]
(d) Pteridophytes
4. Which of the following is incorrectly matched?
[NEET (2021)]
(a) Ectocarpus - Fucoxanthin
9. Genera like Selaginella and Salvinia produce two kinds
(b) Ulothrix - Mannitol
of spores. Such plants are known as
(c) Porphyra - Floridian Starch
(a) Homosporous
(d) Volvox - Starch (b) Heterosporous
[NEET (2022)] (c) Homosorus
5. Hydrocolloid carrageen is obtained from (d) Heterosorus
(a) Chlorophyceae and Phaeophyceae [NEET (2021)]
(b) Phaeophyceae and Rhodophyceae 10. Which of the following algae contains mannitol as
(c) Rhodophyceae only reserve food material?
(d) Phaeophyceae only (a) Volvox (b) Ulothrix
[NEET (2022)] (c) Ectocarpus (d) Gracilaria
[NEET (2021)]
PLANT KINGDOM 13
11. Floridean starch has structure similar to 20. An example of colonial alga is
(a) Mannitol and algin (a) Ulothrix (b) Spirogyra
(b) Laminarin and cellulose (c) Chlorella (d) Volvox
(c) Starch and cellulose [NEET (2017)]
(d) Amylopectin and glycogen 21. Which one of the following statements is WRONG?
[NEET (2020)] (a) Algin is obtained from red algae and carrageen from
12. Strobili or cones are found in: brown algae
(a) Marchantia (b) Equisetum (b) Agar is obtained from Gelidium and Gracilaria.
(c) Salvinia (d) Pteris (c) Laminaria and Sargassum are used as food.
[NEET (2020)] (d) Algae increases the level of dissolved oxygen in the
13. Which of the following pairs is of unicellular algae? immediate environment.
(a) Anabaena and Volvox [NEET (2016-II)]
(b) Chlorella and Spirulina 22. Conifers are adapted to tolerate extreme environmental
(c) Laminaria and Sargassum conditions because of
(d) Gelidium and Gracilaria (a) Superficial stomata
[NEET (2020)] (b) Thick cuticle
14. From evolutionary point of view, retention of the female (c) Presence of vessels
gametophyte with developing young embryo on the (d) Broad hardy leaves
parent sporophyte for some time, is first observed in [NEET (2016-II)]
(a) Mosses 23. In bryophytes and pteridophytes, transport of male
(b) Pteridophytes gametes requires
(c) Gymnosperms (a) Wind (b) Insects
(d) Liverworts (c) Birds (d) Water
[NEET (2019)] [NEET (2016-I)]
15. Which one is wrongly matched? 24. Select the correct statement:
(a) Biflagellate Zoospores – Brown algae (a) Gymnosperms are both homosporous and
(b) Gemma cups – Marchantia heterosporous
(c) Uniflagellate gametes – Polysiphonia (b) Salvinia, Ginkgo and Pinus all are gymnosperms
(d) Unicellular organism – Chlorella (c) Sequoia is one of the tallest trees
[NEET (2018)] (d) The leaves of gymnosperms are not well adapted to
16. Which of the following statements is correct? extremes of climate
(a) Selaginella is heterosporous, while Salvinia is [NEET (2016-I)]
homosporous. 25. In angiosperms, microsporogenesis and
(b) Sequoia is an angiosperm megasporogenesis:
(c) Ovules are not enclosed by ovary wall in (a) Occur in anther
gymnosperms. (b) Form gametes without further divisions
(d) Stems are usually unbranched in both Cycas and (c) Involve meiosis
Cedrus. (d) Occur in ovule
[NEET (2018)] [NEET (2015)]
17. Zygotic meiosis is characteristic of 26. Which one is a wrong statement?
(a) Funaria (a) Archegonia are found in Bryophyta, Pteridophyta
(b) Chlamydomonas and Gymnosperms.
(c) Marchantia (b) Mucor has biflagellate zoospores.
(d) Fucus (c) Haploid endosperm is a typical feature of
[NEET (2017)] gymnosperms.
18. Life cycle of Ectocarpus and Fucus respectively are: (d) Brown algae have chlorophyll a and c, and
(a) Haplontic, Diplontic fucoxanthin.
(b) Diplontic, Haplodiplontic [NEET (2015)]
(c) Haplodiplontic, Diplontic 27. Which one of the following shows isogamy with non-
(d) Haplodiplontic, Haplontic flagellated gametes?
[NEET (2017)] (a) Ectocarpus (b) Ulothrix
19. Select the mismatch. (c) Spirogyra (d) Sargassum
(a) Salvinia - Heterosporous [NEET (2014)]
(b) Equisetum - Homosporous 28. Which of the following is responsible for peat
(c) Pinus - Dioecious formation?
(d) Cycas - Dioecious (a) Riccia (b) Funaria
[NEET (2017)] (c) Sphagnum (d) Marchantia
[NEET (2014)]
PLANT KINGDOM 14
29. Which one of the following is wrong about Chara? (a) Smaller and to have smaller sex organs
(a) Globule and nucule present on the same plant (b) Smaller but to have larger sex organs
(b) Upper antheridium and lower oogonium (c) Larger but to have smaller sex organs
(c) Globule is the male reproductive structure (d) Larger and to have larger sex organs
(d) Upper oogonium and lower round antheridium
[NEET (2011)]
[NEET (2014)]
37. The gametophyte is not an independent, free living
30. Which among these is an edible alga?
generation in :
(a) Chlorella (b) Funaria
(a) Pinus (b) Polytrichum
(c) Polysiphonia (d) Ulothrix
(c) Adiantum (d) Marchantia
[NEET (2014)]
[NEET (2011)]
31. Monoecious plant of Chara shows occurrence of
38. Male and female gametophytes are independent and
(a) Antheridiophore and archegoniophore on the same
free-living in –
plant
(a) Mustard (b) Castor
(b) Stamen and carpel and on the same plant
(c) Pinus (d) Sphagnum
(c) Upper antheridium and lower oogonium on the
[NEET (2010)]
same plant
39. Alage have cell wall made up of –
(d) Upper oogonium and lower antheridium on the
(a) Cellulose, galactans and mannans
same plant
(b) Hemicellulose, pectins and proteins
[NEET (2013)]
(c) Pectins, cellulose and proteins
32. Read the following statements [A-E] and answer the
(d) Cellulose, hemicellulose and pectins
question which follows them
[NEET (2010)]
(A) In liverworts, mosses, and ferns gametophytes are
40. Which one of the following has haplontic life cycle ?
free-living
(a) Wheat (b) Funaria
(B) Gymnosperms and some ferns are heterosporous
(c) Polytrichum (d) Ustilago
(C) Sexual reproduction in Fucus, Volvox and Albugo is
[NEET (2009)]
oogamous
41. Mannitol is the stored food in -
(D) The sporophyte in liverworts is more elaborate than
(a) Gracillaria (b) Chara
that in mosses
(c) Porphyra (d) Fucus
(E) Both Pinus and Marchantia are dioecious
[NEET (2009)]
How many of the above statements are correct?
42. Which one of the following is a vascular cryptogram ?
(a) One (b) Two
(a) Cedrus (b) Equisetum
(c) Three (d) Four
(c) Ginkgo (d) Marchantia
[NEET (2013)]
[NEET (2009)]
33. Read the following five statements (A-E) and answer as
43. In which one of the following, male and female
asked next to them.
gametophytes do not have free-living independent
(A) In Equisetum the female gametophyte is retained on
existence?
the parent sporophyte
(a) Polytrichum (b) Cedrus
(B) In Ginkgo male gametophyte is not independent
(c) Pteris (d) Funaria
(C) The sporophyte in Riccia is more developed than
[NEET (2008)]
that in Polytrichum
44. Which one of the following is hetero-sporous?
(E) The spores of slime molds lack cell walls
(a) Adiantum (b) Equisetum
How many of the above statements are correct?
(c) Dryoptris (d) Salvinia
(a) Three (b) Four
[NEET (2008)]
(c) One (d) Two
45. If you are asked to classify the various algae into distinct
[NEET (2012)] groups, which of the following characters you should
34. Which one of the following pairs is wrongly matched? choose ?
(a) Salvinia-Prothallus (a) Chemical composition of the cell wall
(b) Viroids-RNA (b) Types of pigments present in the cell
(c) Mustard-Synergids (c) Nature of stored food materials in the cell
(d) Ginkgo-Archegonia (d) Structural organization of thallus
[NEET (2007)]
[NEET (2012)]
46. Flagellated male gametes are present in all the three of
35. Archegoniphore is present in :
which one of the following sets ?
(a) Funaria (b) Marchantia
(a) Riccia, Dryopteris and Cycas
(c) Chara (d) Adiantum
(b) Anthoceros, Funaria and Spirogyra
[NEET (2011)]
(c) Zygnema, Saprolegnia and Hydrilla
36. Compared with the gametophytes of the bryophytes, the
(d) Fucus, Marsilea and Calotropis
gametophytes of vascular plants tend to be
[NEET (2007)]
PLANT KINGDOM 15
47. Spore dissemination in some liverworts is aided by : (a) A –L ; B –J; C –M ; D – N ; E – K

(a) Peristome teeth (b) Elaters (b) A– K ; B – J; C – L ; D –M; E – N
(c) Indusium (d) Calyptra (c) A– J ; B – K; C – N ; D –L; E – K
[NEET (2007)] (d) A– N ; B – L; C – K ; D – N; E –J
48. Moss peat is used as a packing material for sending [NEET (2005)]
flowers and live plants to distant places because- 52. Top-shaped multiciliate male gametes, and the mature
(a) It is easily available seed which bears only one embryo with two cotyledons,
(b) It is hygroscopic are characteristic features of -
(c) It reduces transpiration (a) Gamopetalous angiosperms
(d) It serves as a disinfectant (b) Conifers
[NEET (2006)] (c) Polypetalous angiosperms
49. Conifers differ from grasses in the- (d) Cycads
(a) Production of seeds from ovules [NEET (2005)]
(b) Lack of xylem tracheids 53. Which one of the following pairs in mismatched-
(c) Absence of pollen tubes (a) Savanna - acacia trees
(d) Formation of endosperm before fertilization (b) Coniferous forest - evergreen trees
[NEET (2006)] (c) Tundra - permafrost
50. In a moss the sporophyte- (d) Prairie - epiphytes
(a) Is partially parasitic on the gametophyte [NEET (2005)]
(b) Produces gametes that given rise to the 54. Angiosperms have dominated the land flora primarily
gametophyte because of their -
(c) Arises from a spore produced from the gametophyte (a) Property of producing large number of seeds
(d) Manufactures food for itself, as well as for the (b) Nature of self pollination
gametophyte (c) Domestication by man
[NEET (2006)] (d) Power of adaptability in diverse habitat
51. Match items in Column I with those in Column II – [NEET (2004)]
Column I Column II 55. Diversification in plant life appeared :-
(A) Peritrichous (J) Ginkgo (a) Due to abrupt mutations
flagellation (b) Suddenly on earth
(c) By seed dispersal
(B) Living fossil (K) Macrocystes (d) Due to long periods of evolutionary changes
(C) Rhizophore (L) Escherichia [NEET (2004)]
coli 56. In which one of the following habitats does the diurnal
(D) Smallest flowering (M) Selaginella temperature of soil surface vary most ?
plant (a) Forest (b) Desert
(c) Grassland (d) Shrub land
(E) Largest Perennial (N) Wolffia
[NEET (2004)]
alga
Select the correct answer with the following
ANIMAL KINGDOM 16
ANIMAL KINGDOM
1. Radial symmetry is NOT found in adults of phylum 7. Read the following statements.
______. (a) Metagenesis is observed in Helminths.
(a) Hemichordata (b) Coelenterata (b) Echinoderms are triploblastic and coelomate
(c) Echinodermata (d) Ctenophora animals.
[NEET (2023)] (c) Roundworms have organ-system level of body
organization.
2. The unique mammalian characteristics are
(d) Comb plates present in ctenophores help in digestion
(a) Hairs, pinna and mammary glands
(e) Water vascular system is characteristic of
(b) Hairs, pinna and indirect development
Echinoderms.
(c) Pinna, monocondylic skull and mammary glands
Choose the correct answer from the options given
(d) Hairs, tympanic membrane and mammary glands below.
[NEET (2023)] (a) (a), (d) and (e) are correct
3. Select the correct statements with reference to (b) (b), (c) and (e) are correct
chordates. (c) (c), (d) and (e) are correct
A. Presence of mid-dorsal, solid and double nerve cord. (d) (a), (b) and (c) are correct
B. Presence of closed circulatory system [NEET (2021)]
C. Presence of paired pharyngeal gill slits 8. Match list I with list II.
D. Presence of dorsal heart List I List II
E. Triploblastic pseudocoelomate animals (a) Metamerism (i) Coelenterata
Choose the correct answer from the options given (b) Canal system (ii) Ctenophora
below:
(a) B and C only (c) Comb plates (iii) Annelida
(b) B, D and E only (d) Cnidoblast (iv) Porifera
(c) C, D and E only (a) (a)- (iii); (b) - (iv); (c) - (ii); (d) - (i)
(d) A, C and D only (b) (a)- (iv); (b) - (i); (c) - (ii); (d) - (iii)
(c) (a)- (iv); (b) - (iii); (c) - (i); (d) - (ii)
[NEET (2023)]
(d) (a)- (iii); (b) - (iv); (c) - (i); (d) - (ii)
4. Exoskeleton of arthropods is composed of:
[NEET (2021)]
(a) Cutin (b) Cellulose
9. Which one of the following organisms bears hollow and
(c) Chitin (d) Glucosamine
pneumatic long bones?
[NEET (2022)]
(a) Macropus
5. In which of the following animals, does the digestive
(b) Ornithorhynchus
tract have additional chambers like crop and gizzard?
(c) Neophron
(a) Corvus, Columba, Chameleon
(d) Hemidactylus
(b) Bufo, Balaenoptera, Bangarus
[NEET (2021)]
(c) Catla, Columbia, Crocodilus
10. Match the following:
(d) Pavo, Psittacula, Corvus
List I List II
[NEET (2022)]
6. Given below are two statements: one is labelled as (a) Physalia (i) Pearl oyster
Assertion (A) and the other is labelled as Reason (R). (b) Limulus (ii) Portuguese Man of
Assertion (A): All vertebrates are chordates but all War
chordates are not vertebrates (c) Ancylostoma (iii) Living fossil
Reason (R): Notochord is replaced by the vertebral (d) Pinctada (iv) Hookworm
column in the adult vertebrates.
In the light of the above statements, choose the most (a) (a)- (ii); (b) - (iii); (c) - (iv); (d) - (i)
appropriate answer from the options given below: (b) (a)- (i); (b) - (iv); (c) - (iii); (d) - (ii)
(a) Both (A) and (R) are correct and (R) is the correct (c) (a)- (ii); (b) - (iii); (c) - (i); (d) - (iv)
explanation of (A) (d) (a) - (iv); (b) - (i); (c) - (iii); (d) - (ii)
(b) Both (A) and (R) are correct but (R) is not the [NEET (2021)]
correct explanation of (A) 11. Bilaterally symmetrical and acoelomate animals are
(c) (A) is correct but (R) is not correct exemplified by
(d) (A) is not correct but (R) is correct (a) Aschelminthes (b) Annelida
[NEET (2022)] (c) Ctenophora (d) Platyhelminthes
[NEET (2020)]
ANIMAL KINGDOM 17
12. Which of the following statements are true for the Select the correct option of animal groups which possess
phylum Chordata? all the above characteristics:
(i) In Urochordata, notochord extends from head to tail (a) Annelida, Arthropoda and Mollusca
and it is present throughout their life. (b) Arthropoda, Mollusca and Chordata
(ii) In Vertebrata, the notochord is present during the (c) Annelida, Mollusca and Chordata
embryonic period only. (d) Annelida, Arthropoda and Chordata
(iii) Central nervous system is dorsal and hollow. [NEET (2019)]
(iv) Chordata is divided into 3 subphyla: Hemichordata, 17. Which of the following animals does not undergo
Tunicata, and Cephalochordata. metamorphosis?
(a) (i) and (ii) (b) (ii) and (iii) (a) Moth (b) Tunicate
(c) (iv) and (iii) (d) (iii) and (i) (c) Earthworm (d) Starfish
[NEET (2020)] [NEET (2018)]
13. Match the following columns and select the correct 18. Which one of these animals is not a homeotherm?
option – (a) Camelus (b) Chelone
Column I Column II (c) Macropus (d) Psittacula
(a) Gregarious, polyphagous pest (i) Asterias [NEET (2018)]
19. Identify the vertebrate group of animals characterized by
(b) Adult with radial symmetry (ii) Scorpion
crop and gizzard in its digestive system
and larva with bilateral symmetry (a) Aves (b) Reptilia
(c) Book lungs (iii) Ctenoplana (c) Amphibia (d) Osteichthyes
(d) Bioluminescence (iv) Locusta [NEET (2018)]
(a) a – iii; b – ii; c – i; d – iv 20. In case of poriferans, the spongocoel is linked with
(b) a – ii; b – i; c – iii; d – iv flagellated cells called
(c) a – i; b – iii; c – ii; d – iv (a) Ostia
(d) a – iv; b – i; c – ii; d – iii (b) Oscula
[NEET (2020)] (c) Choanocytes
14. Match the following columns and select the correct (d) Mesenchymal cells
option. [NEET (2017)]
Column I Column II 21. Which among these is the correct combination of
(a) 6-15 pairs of gill slits (i) Trygon aquatic mammals?
(a) Whales, Dolphins, Seals
(b) Trygon, Whales, Seals
(b) Heterocercal caudal fin (ii) Cyclostomes
(c) Seals, Dolphins, Sharks
(c) Air bladder (iii) Chondrichthyes (d) Dolphins, Seals, Trygon
(d) Poison sting (iv) Osteichthyes [NEET (2017)]
(a) a – iv; b – ii; c – iii; d – i 22. An important characteristic that Hemichordates share
(b) a – i; b – iv; c – iii; d – ii with Chordates is
(c) a – ii; b – iii; c – iv; d – i (a) Pharynx with gill slits
(d) a – iii; b – iv; c – i; d – ii (b) Pharynx without gill slits
[NEET (2020)] (c) Absence of notochord
15. Match the following organisms with their respective (d) Ventral tubular nerve cord
characteristics: [NEET (2017)]
Column I Column II 23. Choose the CORRECT statement.
A Pila (i) Flame cells (a) All cyclostomes do not possess jaws and paired fins
(b) All reptiles have a three-chambered heart
B Bombyx (ii) Comb plates
(c) All Pisces have gills covered by an operculum
C Pleurobrachia (iii) Radula (d) All mammals are viviparous
D Taenia (iv) Malpighian tubules [NEET (2016-II)]
(a) A – (iii), B – (iv), C – (ii), D – (i) 24. Match Column-I with Column-II for housefly
(b) A – (ii), B – (iv), C – (iii), D – (i) classification and select the CORRECT option using
(c) A – (iii), B – (ii), C – (iv), D – (i) the codes given below:
(d) A – (iii), B – (ii), C – (i), D – (iv) Column I Column II
[NEET (2019)] A Family (i) Diptera
16. Consider the following features: B Order (ii) Arthropoda
(1) Organ system level of organization
(2) Bilateral symmetry C Class (iii) Muscidae
(3) True coelomates with segmentation on body D Phylum (iv) Insecta
ANIMAL KINGDOM 18
(a) (a)-(iii), (b)-(ii), (c)-(iv), (d)-(i) (b) D-glucosamine

(b) (a)-(iv), (b)-(iii), (c)-(ii), (d)-(i) (c) N-acetyl glucosamine
(c) (a)-(iv), (b)-(ii), (c)-(i), (d)-(iii) (d) Lipoglycans
(d) (a)-(iii), (b)-(i), (c)-(iv), (d)-(ii) [NEET (2015)]
[NEET (2016-II)] 33. A jawless fish, which lays eggs in fresh water and whose
25. Which one of the following characteristics is not shared ammocoetes larvae after metamorphosis return to the
by birds and mammals? ocean is:
(a) Ossified endoskeleton (a) Eptatretus (b) Myxine
(b) Breathing using lungs (c) Neomyxine (d) Petromyzon
(c) Viviparity [NEET (2015)]
(d) Warm blooded nature 34. A marine cartilaginous fish that can produce electric
[NEET (2016-I)] current is
26. Which of the following characteristic features always (a) Torpedo (b) Trygon
holds true for the corresponding group of animals? (c) Scoliodon (d) Pristis
(a) Cartilaginous endoskeleton – Chondrichthyes [NEET (2014)]
(b) Viviparous – Mammalia 35. Select the taxon mentioned that represents both marine
(c) Possess a mouth with an upper and a lower jaw – and freshwater species.
Chordata (a) Ctenophora
(d) One incompletely divided ventricle – Reptilia (b) Cephalochordata
[NEET (2016-I)] (c) Cnidaria
27. Which of the following features is not present in (d) Echinoderms
Periplaneta Americana? [NEET (2014)]
(a) Schizocoelom as body cavity 36. One of the representatives of phylum Arthropoda is
(b) Indeterminate and radial cleavage during (a) Cuttlefish (b) Silverfish
embryonic development (c) Pufferfish (d) Flying fish
(c) Exoskeleton composed of N-acetylglucosamine [NEET (2013)]
(d) Metamerically segmented body 37. Which group of animals belongs to the same phylum?
[NEET (2016-I)] (a) Malarial parasite, Amoeba, Mosquito
28. Which of the following features is not present in the (b) Earthworm, Pinworm, Tapeworm
phylum Arthropoda? (c) Prawn, Scorpion, Locusts
(a) Chitinous exoskeleton (d) Sponge, Sea anemone, Starfish
(b) Metameric segmentation [NEET (2013)]
(c) Parapodia 38. Which of the following are correctly matched with
(d) Jointed appendages respect to their taxonomic classification?
[NEET (2016-I)] (a) Flying fish, cuttlefish, silverfish, scorpion –
29. Body having meshwork of cells, internal cavities lined Insecta
with food filtering flagellated cells and indirect (b) Centipede, millipede, spider, scorpion –
development are the characteristics of phylum Insecta
(a) Coelenterate (b) Porifera (c) House fly, butterfly, tsetse fly, silverfish –
(c) Mollusca (d) Protozoa Insecta
[NEET (2015)] (d) Spiny anteater, sea urchin, sea cucumber -
30. Which one of the following animals has two separate Echinodermata
circulatory pathways? [NEET (2013)]
(a) Frog (b) Lizard 39. Find out the correct option after matching the name of
(c) Whale (d) Shark the animal (Column I) with one characteristic (Column
[NEET (2015)] II) and the phylum/class (Column III) to which it
31. Metagenesis refers to: belongs.
(a) Presence of different morphic forms
(b) Alternation of generation between asexual and Column I Column II Column III
sexual phases of an organism (1) Petromyzon Ectoparasite Cyclostomata
(c) Occurrence of a drastic change in form during post-
(2) Ichthyophis Terrestrial Reptilia
embryonic development
(d) Presence of a segmented body and parthenogenetic (3) Limulus Body Pisces
mode of reproduction covered by
[NEET (2015)] chitinous
32. The chitinous exoskeleton of arthropods is formed by exoskeleton
the polymerisation of: (4) Adamsia Radially Porifera
(a) Keratin sulphate and chondroitin sulphate symmetrical
ANIMAL KINGDOM 19
(a) Petromyzon - Ectoparasite - Cyclostomata (c) Male frog- A copulatory pad on the first digit of the
(b) Ichthyophis - Terrestrial - Reptilia hind limb
(c) Limulus - Body covered by chitinous exoskeleton - (d) Female cockroach – Anal cerci
Pisces [NEET (2011)]
(d) Adamsia - Radially symmetrical - Porifera 45. One example of animals having a single opening to the
[NEET (2013)] outside that serves both as mouth as well as anus is
40. Which one of the following categories of animals, is (a) Octopus
correctly described with no single exception in it? (b) Asterias
(a) All bony fishes have four pairs of gills and an (c) Ascidia
operculum on each side (d) Fasciola
(b) All sponges are marine and have collared cells [NEET (2010)]
(c) All mammals are viviparous and possess diaphragm 46. Which one of the following statements about all the four
for breathing of Spongilla, Leech, Dolphin and Penguin is correct –
(d) All reptiles possess scales, have a three chambered (a) Penguin is homoiothermic while the remaining three
heart and are cold blood (poikilothermal) are poikilothermic
(b) Leech is fresh water form while all others are
[NEET (2012)]
marine
41. Which one of the following pairs of animals are similar (c) Spongilla has special collared cells called
to each other pertaining to the feature stated against choanocytes, not found in the remaining three
them? (d) All are bilaterally symmetrical
(a) Garden lizard and Crocodile – Three chambered [NEET (2010)]
heart 47. Which one of the following kinds of animals are
(b) Ascaris and Ancylostoma – Metameric triploblastic?
segmentation (a) Flat worms (b) Sponges
(c) Sea horse and Flying fish – Cold blooded (c) Ctenophores (d) Corals
(poikilothermal) [NEET (2010)]
(d) Pteropus and Ornithorhyncus - viviparity 48. Which one of the following statements about certain
[NEET (2012)] given animals is correct –
42. In which one of the following the genus name, its two (a) Round worms (Aschelminthes) are
characters and its class/phylum are correctly matched ? pseudocoelomates
(a) Genus name- Ascaris; Two characters-(a) (b) Molluces are acoelomates
Cnidoblasts, (b) Organ level of organization; Class (c) Insects are pseudocoelomates
/Phylum- Coelenterata (d) Flat worms (Platyhelminthes) are coelomates
(b) Genus name- Salamandra; Two characters-(a) Body [NEET (2010)]
segmented, (b) Males and females distinct; Class 49. Which one of the following groups of animals is
/Phylum-Annelida bilaterally symmetrical and triploblastic ?
(c) Genus name- Salamandra; Two characters-(a) A (a) Sponges
tympanum represents ear, (b) Fertilization is external; (b) Coelentrates (Cnidarians)
Class /Phylum-Amphibia (c) Aschelminthes (round worms)
(d) Ctenophores
(d) Genus name- Pteropus; Two characters-(a) Skin
[NEET (2009)]
possesses hair, (b) Oviparous; Class /Phylum-Mammalia
50. Peripatus is a connecting link between :
[NEET (2011)] (a) Coelenterata and Porifera
43. Which one of the following groups of animals is (b) Ctenophora and Platyhelminthes
correctly matched with its one characteristic feature (c) Mollusca and Echinodermata
without even a single exception ? (d) Annelida and Arthropoda
(a) Mammalia : give birth to young ones. [NEET (2009)]
(b) Reptilia : possess 3-chambered heart with one 51. Which one of the following pairs of animals comprises
incompletely divided ventricle 'Jawless fishes' ?
(c) Chordata : possess a mouth provided with an upper (a) Guppies and hag fishes
and a lower jaw (b) Lampreys and eels
(d) Chondrichthyes : possess cartilaginous endoskeleton (c) Mackerals and Rohu
[NEET (2011)] (d) Lampreys and hag fishes
44. What will you look for to identify the sex of the [NEET (2009)]
following ? 52. Which one of the following is NOT a characteristic of
(a) Male shark – Claspers borne on pelvic fins phylum Annelida?
(b) Female Ascaris – Sharply curved posterior end (a) Pseudocoelom
(b) Ventral nerve cord
ANIMAL KINGDOM 20
(c) Closed circulatory system (c) Ventral central nervous system – Leech
(d) Segmentation (d) Pharyngeal gill slits Absent in embryo –
[NEET (2008)] Chamaeleon
53. Which one of the following phyla is correctly matched [NEET (2007)]
with its two general characteristic? 59. What is common between parrot, platypus and
(a) matched with its two general characteristic? (1) kangaroo?
Echinoderamata — Pentamerous radial symmetry and (a) Ovoparity
mostly internal fertilization (b) Homoiothermy
(b) Mollusca — Normally oviparous and development (c) Toothless jaws
through a trochophore or veliger larva (d) Functional post-anal tail
(c) Arthropoda — Body divided into head, thorax and [NEET (2007)]
abdomen and respiration by tracheae 60. What is true about Nereis, Scorpion, Cockroach and
(d) Chordata — Notochord at some stage and separate Silver fish ?
anal and urinary openings to the outside (a) They all belong to the same phylum
[NEET (2008)] (b) They all have jointed paired appendages
54. Which one of the following groups of three animals each (c) They all possess dorsal heart
is correctly matched with their one characteristic (d) None of them is aquatic
morphological feature? [NEET (2007)]
(a) Animals- Scorpion, Spider, Cockroach; 61. Which one of the following is a matching set of phylum
Morphological feature- Ventral solid central nervous and its three examples ?
system (a) Cnidaria – Bonellia, Physalia, Aurelia
(b) Animals- Cockroach, Locust, Taenia; (b) Platyhelminthes-Planaria, Schistosoma,
Morphological feature- Metameric segmentation Enterobius
(c) Animals- Liver fluke, Sea anemone, Sea cucumber; (c) Mollusca-Loligo, Teredo, Octopus
Morphological feature- Bilateral symmetry (d) Porifera-Spongilla, Euplectella, Pennatula
(d) Animals- Centipede, Prawn, Sea urchin; [NEET (2006)]
Morphological feature- Jointed appendages 62. Metameric segmentation is the characteristic of-
[NEET (2008)] (a) Platyhelminthes and Arthropoda
55. Ascaris is characterized by : (b) Echinodermata and Annelida
(a) Presence of true coelom but absence of metamerism (c) Annelida and Arthropoda
(b) Presence of true coelom and metamerism (d) Mollusca and Chordata
(metamerisation) [NEET (2006)]
(c) Absence of true coelom but presence of 63. Which one of the following has an open circulatory
metamerism system ?
(d) Presence of neither true coelom nor metamerism (a) Pheretima (b) Periplaneta
[NEET (2008)] (c) Hirudinaria (d) Octopus
56. What is common to whale, seal and shark ? [NEET (2006)]
(a) Homoeiothermy 64. Biradial symmetry and lack of cnidoblasts are the
(b) Seasonal migration characteristics of-
(c) Thick subcutaneous fat (a) Starfish and sea anemone
(d) Convergent evolution (b) Ctenoplana and Beroe
[NEET (2007)] (c) Aurelia and Paramecium
57. Which of the following pairs are correctly matched ? (d) Hydra and starfish
[NEET (2006)]
Animals Morphologicalfeatures 65. In which one of the following sets of animals do all the
(A) Crocodile 4-chambered heart four give birth to young ones ?
(B) Sea Urchin Parapodia (a) Lion, Bat, Whale, Ostrich
(b) Platypus, Penguin, Bat, Hippopotamus
(C) Obelia Metagenesis (c) Shrew, Bat, Cat, Kiwi
(D) Lemur Thecodont (d) Kangaroo, Hedgehog, Dolphin, Loris
[NEET (2006)]
(a) Only A and B (b) A, C and D 66. Two common characters found in centipede, cockroach,
(c) B, C and D (d) Only A and D and crab are-
[NEET (2007)] (a) Compound eyes and anal cerci
58. Which one of the following is a matching pair of a body (b) Jointed legs and chitinous exoskeleton
feature and the animal possessing it ? (c) Green gland and tracheae
(a) Ventral heart – Scorpion (d) Book lungs and antennae
(b) Post-anal tail – Octopus [NEET (2006)]
ANIMAL KINGDOM 21
67. In contrast to Annelids the Platyhelminths show (a) Mollusca (b) Cnidaria
(a) Absence of body cavity (c) Echinodermata (d) Annelida
(b) Presence of pseudocoel [NEET (2004)]
(c) Radial symmetry 71. In Arthopoda, head and thorax are often fused to form
(d) Bilateral symmetry cephalothorax, but in which one of the following
[NEET (2005)] classes, is the body divided into head, thorax and
68. Which of the following characters is not typical of the abdomen ?
class Mammalia - (a) Myriapoda
(a) Alveolar lungs (b) Crustacea
(b) Ten pairs of cranial nerves (c) Arachnida and Crustacea
(c) Seven cervical vertebrae (d) Insecta
(d) Thecodont dentition [NEET (2004)]
[NEET (2005)] 72. A terrestrial animal must be able to -
69. From the following statements select the wrong one - (a) Conserve water
(a) Prawn has two pairs of antennae (b) Actively pump salts out through the skin
(b) Milliepedes have two pairs of appendages in each (c) Excrete large amounts of salts in urine
segment of the body (d) Excrete large amounts of water in urine
(c) Animals belonging to Phylum porifera are [NEET (2004)]
exclusively marine 73. One of the following is a very unique feature of the
(d) Nematocysts are characteristic of the phylum mammalian body -
cnidaria. (a) Presence of diaphragm
[NEET (2005)] (b) Four chambered heart
70. The animals with bilateral symmetry in young stage and (c) Rib cage
radial pentamerous symmetry in the adult stage, belong (d) Homeothermy
to the phylum - [NEET (2004)]
MORPHOLOGY OF FLOWERING PLANTS 22
MORPHOLOGY OF FLOWERING PLANTS

1. Family Fabaceae differs from Solanaceae and Liliaceae. (e) Chilli
With respect to the stamens, pick out the characteristics Choose the correct answer from the options given
specific to family Fabaceae but not found in Solanaceae below:
or Liliaceae. (a) (a), (b), (c) only (b) (b), (c) only
(a) Polyadelphous and Epipetalous stamens (c) (d), (e) only (d) (c), (d), (e) only
(b) Monadelphous and Monothecous anthers [NEET (2022)]
(c) Epiphyllous and Dithecous anthers 7. Identify the correct set of statements:
(d) Diadelphous and Dithecous anthers (a) The leaflets are modified into pointed hard thorns in
Citrus and Bougainvillea
[NEET (2023)]
(b) Axillary buds form slender and spirally coiled
2. Given below are two statements: One is labelled as tendrils in cucumber and pumpkin
Assertion A and the other is labelled as Reason R. (c) Stem is flattened and fleshy on Opuntia and modified
Assertion A: A flower is defined as modified shoot to perform the function of leaves
wherein the shoot apical meristem changes to floral (d) Rhizophora shows vertically upward growing roots
meristem. that help to get oxygen for respiration
Reason R: Internode of the shoot gets condensed to (e) Subaerially growing stems in grasses and strawberry
produce different floral appendages laterally at help in vegetative propagation
successive nodes instead of leaves. Choose the correct answer from the options given
In the light of the above statements, choose the correct below:
answer from the options given below: (a) (b) and (c) only
(a) Both A and R are true, but R is NOT the correct (b) (a) and (d) only
explanation of A. (c) (b), (c), (d) and (e) only
(b) A is true, but R is false. (d) (a), (b), (d) and (e) only
(c) A is false, but R is true. [NEET (2022)]
(d) Both A and R are true, and R is the correct 8. Polyadelphous stamens are found in
explanation of A. (a) Pea (b) Citrus
[NEET (2023)] (c) China rose (d) Sunflower
3. Axile placentation is observed in [NEET (2021)]
(a) China rose, beans and lupin 9. Match list I with list II.
(b) Tomato, Dianthus and pea
(c) China rose, Petunia and lemon List I List II
(d) Mustard, cucumber and primrose (a) (i) Brassicaceae
[NEET (2023)] (b) (ii) Liliaceae
4. In angiosperm, the haploid, diploid and triploid (c) (iii) Fabaceae
structures of a fertilized embryo sac sequentially are
(a) Antipodals, synergids and primary endosperm (iv) Solanaceae
nucleus (a) (a)- (ii); (b) - (iii); (c) - (iv)
(b) Synergids, zygote and primary endosperm nucleus (b) (a)- (iv); (b) - (ii); (c) - (i)
(c) Synergids, antipodals and polar nuclei (c) (a)- (iii); (b) - (iv); (c) - (ii)
(d) Synergids, primary endosperm nucleus and zygote (d) (a)- (i); (b) - (ii); (c) - (iii)
[NEET (2021)]
[NEET (2023)] 10. In some members of which of the following pairs of
5. Which one of the following plants shows vexillary families, pollen grains retain their viability for months
aestivation and diadelphous stamens? after release?
(a) Colchicum autumnale (a) Poaceae; Solanaceae
(b) Pisum sativum (b) Rosaceae; Leguminosae
(c) Allium cepa (c) Poaceae; Rosaceae
(d) Solanum nigrum (d) Poaceae; Leguminosae
[NEET (2022)] [NEET (2021)]
6. The flowers are Zygomorphic in: 11. The ovary is half inferior in:
(a) Mustard (b) Gulmohar (a) Sunflower (b) Plum
(c) Cassia (d) Datura (c) Brinjal (d) Mustard
[NEET (2020)]
12. The roots that originate from the base of the stem are 23. Radial symmetry is found in the flowers of
(a) Prop roots (b) Lateral roots (a) Gulmohur (b) Canna
(c) Fibrous roots (d) Primary roots (c) Cassia (d) Datura
[NEET (2020)] [NEET (2016-II)]
13. Ray florets have 24. How many plants among Indigofera, Sesbania, Salvia,
(a) Hypogynous ovary Allium, Aloe, mustard, groundnut, radish, gram and
(b) Half inferior ovary turnip have stamens with different lengths in their
(c) Inferior ovary flowers?
(d) Superior ovary (a) Four (b) Five
[NEET (2020)] (c) Six (d) Three
14. Placentation, in which ovules develop on the inner wall [NEET (2016-II)]
of the ovary or in peripheral part is: 25. The term ‘polyadelphous’ is related to
(a) Axile (b) parietal (a) Androecium (b) Corolla
(c) Free central (d) Basal (c) Calyx (d) Gynoecium
[NEET (2019)] [NEET (2016-II)]
15. Sweet potato is a modified 26. Match Colum-I with Column-II and select the
(a) Tap root CORRECT option using the codes given below:
(b) Adventitious root
(c) Stem Column-I Column-II
(d) Rhizome a) Pistils fused together i) Gametogenesis
[NEET (2018)] b) Formation of gametes ii) Pistillate
16. Pneumatophores occur in
(a) Carnivorous plants c) Calyx iii) Syncarpous
(b) Free-floating hydrophytes d) Unisexual female flower iv) Gamosepalous
(c) Halophytes
(d) Submerged hydrophytes (a) a) - ii), b) - i), c) - iv), d) - iii)
[NEET (2018)] (b) a) - i), b) - ii), c) - iv), d) - iii)
17. In Bougainvillea thorns are the modifications of (c) a) - iii), b) - i), c) - iv), d) - ii)
(a) Stem (d) a) - iv), b) - iii), c) - i), d) - ii)
(b) Leaf [NEET (2016-II)]
(c) Stipules 27. Which one of the following statements is NOT
(d) Adventitious root CORRECT?
[NEET (2017)] (a) Microscopic, motile asexual reproductive structures
18. Root hairs develop from the region of are called zoospores.
(a) Root cap (b) In potato, banana and ginger, the plantlets arise
(b) Meristematic activity from the internodes present in the modified stem.
(c) Maturation (c) Water hyacinth, growing in the standing water,
(d) Elongation drains oxygen from water that leads to the death of
[NEET (2017)] fishes.
19. The morphological nature of the edible part of the (d) Offspring produced by the asexual reproduction are
coconut is called clone.
(a) Endosperm (b) Pericarp [NEET (2016-II)]
(c) Perisperm (d) Cotyledon 28. Stems modified into flat green organs performing the
[NEET (2017)] functions of leaves are known as
20. Plants which produce characteristic pneumatophores (a) Cladodes (b) Phyllodes
and show vivipary belong to (c) Phylloclades (d) Scales
(a) Psammophytes (b) Hydrophytes [NEET (2016-I)]
(c) Mesophytes (d) Halophytes 29. Cotyledon of maize grain is called:
[NEET (2017)] (a) Plumule (b) Coleorhiza
21. Coconut fruit is a (c) Coleoptile (d) Scutellum
(a) Nut (b) Capsule [NEET (2016-I)]
(c) Drupe (d) Berry 30. Which of the following is not a stem modification?
[NEET (2017)] (a) Pitcher of Nepenthes
22. Free-central placentation is found in (b) Thorns of citrus
(a) Argemone (b) Brassica (c) Tendrils of cucumber
(c) Citrus (d) Dianthus (d) Flattened structures of Opuntia
[NEET (2016-II)] [NEET (2016-I)]
31. Tricarpellary, syncarpous gynoecium is found in (c) Groundnut (d) Gram

flowers of: [NEET (2013)]
(a) Liliaceae (b) Solanaceae 43. In China rose the flowers are
(c) Fabaceae (d) Poaceae (a) Actinomorphic, hypogynous with twisted aestivation
[NEET (2016-I)] (b) Actinomorphic, epigynous with valvate aestivation
32. The standard petal of a papilionaceous corolla is also (c) Zygomorphic, hypogynous with imbricate
called aestivation
(a) Carina (b) Pappus (d) Zygomorphic, epigynous with imbricate aestivation
(c) Vexillum (d) corona [NEET (2013)]
[NEET (2016-I)] 44. Among bitter gourd, mustard, brinjal, pumpkin, china
33. Among china rose, mustard, brinjal, potato, guava, rose, lupin, cucumber, sunn hemp, gram, guava, bean,
cucumber, petunia, and tulip, how many plants have a chilli, plum, Petunia, tomato, rose, Withania, potato,
superior ovary? onion, aloe and tulip how many plants have hypogynous
(a) Five (b) Six flower?
(c) Three (d) Four (a) Six (b) Ten
[NEET (2015)] (c) Fifteen (d) Eighteen
34. Axile placentation is present in [NEET (2013)]
(a) Dianthus (b) Lemon 45. How many plants in the list given below have marginal
(c) Pea (d) Argemone placentation ?
[NEET (2015)] Mustard, Gram, Tulip, Asparagus, Arhar, Sun hemp,
35. The wheat grain has an embryo with one large, shield- Chilli, Colchicine, Onion, Moong, Pea, Tobacco, Lupin
shaped cotyledon known as (a) Five (b) Six
(a) Epiblast (b) Coleorhiza (c) Three (d) Four
(c) Scutellum (d) Coleoptile [NEET (2012)]
[NEET (2015)]
46. Which one of the following organisms is correctly
36. Non-albuminous seed is produced in
matched with its three characteristics ?
(a) Castor (b) Wheat
(a) Tomato: Twisted aestivation, Axile placentation,
(c) Pea (d) Maize
Bcny
[NEET (2014)]
(b) Onion : Bulb, Imbricate aestivation, Axile
37. Placenta and pericarp are both edible portions in:
placentation
(a) Banana (b) Tomato
(c) Maize: C3 pathway, Closed vascular bundles,
(c) Potato (d) Apple
Scutellum
[NEET (2014)]
(d) Pea : C3 pathway, Endospem1ic seed, Vaxillary
38. An aggregate fruit is the one which develops from
aestivation
(a) Multicarpellary apocarpous gynoecium
[NEET (2012)]
(b) Complete inflorescence
47. Read the following four statements (A-D)
(c) Multicarpellary superior ovary
(A) Both, photophosphorylation and oxidative
(d) Multicarpellary syncarpous gynoecium
phosphorylation involve uphill transport of protons
[NEET (2014)]
across the membrane
39. When the margins of sepals or petals overlap one
(B) In dicot stems, a new cambium originates from cells
another without any particular direction, the condition is
of pericycle at the time of secondary growth
termed as
(C) Stamens in flowers of Gloriosa and Petunia are
(a) Imbricate (b) Twisted
polyandrous
(c) Valvate (d) Vexillary
(D) Symbiotic nitrogen-fixers occur in free-living state
[NEET (2014)]
also in soil
40. Which one of the following statements is correct?
How many of the above statements are right
(a) Mango is a parthenocarpic fruit
(a) Three (b) Four
(b) A proteinaceous aleurone layer is present in maize
(c) One (d) Two
grain
[NEET (2012)]
(c) A sterile pistil is called a staminode
48. The ovary is half inferior in flower of :
(d) The seed in grasses is not endospermic
(a) Guava (b) Peach
[NEET (2014)]
(c) Cucumber (d) Cotton
41. An example of edible underground stem is
[NEET (2011)]
(a) Groundnut (b) Sweet potato
49. The "Eyes" of the potato tuber are :
(c) Potato (d) Carrot
(a) Axillary buds (b) Root buds
[NEET (2014)]
(c) Flower buds (d) Shoot buds
42. Seed coat is not thin, membranous in
[NEET (2011)]
(a) Maize (b) Coconut
50. Which one of the following statements iscorrect ? 60. Coiling of garden pea tendrils around any support is an
(a) Flower of tulip is a modified shoot example of –
(b) In tomato, fruit is a capsule (a) Thigmotaxis (b) Thigmonasty
(c) Seeds of orchids have oil-rich endosperm (c) Thigmotropism (d) Thermotaxis
(d) Placentation in primose is basal [NEET (2010)]
[NEET (2011)] 61. Cotyledons and testa respectively are edible parts in -
51. The correct floral formula of chilli is : (a) Cashew nut and litchi
(a) (b) Groundnut and pomegranate
(c) Walnut and tamarind
(d) French bean and coconut
(b) [NEET (2009)]
62. An example of a seed with endosperm, perisperm and
caruncle is -
(c) (a) Castor (b) Cotton
(c) Coffee (d) Lily
[NEET (2009)]
(d) 63. A fruit developed from hypanthodium inflorescence is
called :
(a) Caryopsis (b) Hesperidium
[NEET (2011)] (c) Sorosis (d) Syconus
52. A drupe develops in : [NEET (2009)]
(a) Tomato (b) Mango
(c) Wheat (d) Pea 64. The floral formula is that of:
[NEET (2011)] (a) Tobacco (b) Tulip
53. Flowers are Zygomorphic in : (c) Soybean (d) Sunnhemp
(a) Datura (b) Mustard [NEET (2009)]
(c) Gulmohur (d) tomato 65. An example of axile placentation is -
[NEET (2011)] (a) Marigold (b) Argemone
54. In unilocular ovary with a single ovule the placentation (c) Dianthus (d) Lemon
is: [NEET (2009)]
(a) Marginal (b) Basal 66. Which one of the following is considered important in
(c) Free Central (d) Axile the development of seed habit ?
[NEET (2010)] (a) Free-living gametophyte
55. The chief water conducting elements of xylem in (b) Dependent sporophyte
gymnosperms are : (c) Heterospory
(a) Vessels (b) Fibres (d) Haplontic life cycle
(c) Transfusion tissue (d) Tracheids [NEET (2009)]
[NEET (2010)] 67. Endosperm is consumed by developing embryo in the
56. Keel is characteristic of the flowers of: seed of:
(a) Gulmohur (b) Cassia (a) Pea (b) Maize
(c) Calotropis (d) Bean (c) Coconut (d) Castor
[NEET (2010)] [NEET (2008)]
57. Ovary is half-inferior in the flowers of – 68. The Replum is present in the ovary of flower of:
(a) Guava (b) Plum (a) Sunflower (b) Pea
(c) Brinjal (d) Cucumber (c) Lemon (d) Mustard
[NEET (2010)] [NEET (2008)]
58. The technical term used for the androecium in a flower 69. The length of different internodes in a culm of sugarcane
of China rose (Hibiscus rosasinensis) is is variable because of:
(a) Monoadelphous (b) Diadelphous (a) Size of leaf lamina at the node below each internode
(c) Polyandrous (d) Polyadelphous (b) Intercalary meristem
[NEET (2010)] (c) Shoot apical meristem
59. The scutellum observed in a grain of wheat or maize is (d) Position of axillary buds
comparable to which part of the seed in other [NEET (2008)]
monocotyledons? 70. The fruit is chambered, developed from inferior ovary
(a) Cotyledon (b) Endosperm and has seeds with succulent testa in :
(c) Aleurone layer (d) Plumule (a) Guava (b) Cucumber
[NEET (2010)] (c) Pomegranate (d) Orange
[NEET (2008)]
71. Dry indehiscent single-seeded fruit formed from 76. Pentamerous, actinomorphic flowers, bicarpellary ovary
bicarpellary, syncarpous, inferior ovary is: with oblique septa, and fruit a capsule or berry, are
(a) Berry (b) Cremocarp characteristic features of-
(c) Caryopsis (d) Cypsela (a) Asteraceae (b) Brassicaceae
[NEET (2008)] (c) Solanaceae (d) Liliaceae
72. Pineapple (ananas) fruit develops from- [NEET (2006)]
(a) A unilocular polycarpellary flower 77. In a cereal grain the single cotyledon of embryo is
(b) A multipistillate syncarpous flower represented by -
(c) A cluster of compactly borne flowers on a common (a) Coleorhiza (b) Scutellum
axis (c) Prophyll (d) Coleoptile
(d) A multilocular monocarpellary flower [NEET (2006)]
[NEET (2006)] 78. Which of the following represents the edible part of the
73. Parthenocarpic tomato fruits can be produced by- fruit of Litchi -
(a) Removing androecium of flowers before pollen (a) Endocarp (b) Pericarp
grains are released (c) Juicy aril (d) Mesocarp
(b) Treating the plants with low concentrations of [NEET (2005)]
gibberellic acid and auxins 79. Edible part of mango is :-
(c) Raising the plants from vernalized seeds (a) Receptacle (b) Epicarp
(d) Treating the plants with phenylmercuric acetate (c) Mesocarp (d) Endocarp
[NEET (2006)] [NEET (2004)]
74. In which of the following fruits is the edible part the aril 80. In a longitudinal section of a root, starting from the tip
? upward, the four zones occur in the following order :-
(a) Custard apple (b) Pomegranate (a) Root cap, cell division, cell maturation, cell
(c) Orange (d) Litchi enlargement
[NEET (2006)] (b) Cell division, cell enlargement, cell maturation,
75. What type of placentation is seen in sweet pea ? root cap
(a) Basal (b) Axile (c) Celldivision,cell maturation, cell enlargement, root
(c) Free central (d) Marginal cap
[NEET (2006)] (d) Root cap, cell division, cell enlargement, cell
maturation
[NEET (2004)]
ANATOMY OF FLOWERING PLANTS 27
ANATOMY OF FLOWERING PLANTS

1. Given below are two statements: One is labelled as 4. The anatomy of springwood shows some peculiar
Assertion A and the other is labelled as Reason R: features. Identify the correct set of statements about
Assertion A: Late wood has fewer xylary elements with springwood.
narrow vessels. (a) It is also called early wood.
Reason R: Cambium is less active in winters. (b) In the spring season cambium produces xylem
In the light of the above statements, choose the correct elements with narrow vessels.
answer from the options given below: (c) It is lighter in colour.
(a) Both A and R are true, but R is NOT the correct (d) The springwood along with autumnwood shows
explanation of A. alternate concentric rings forming annual rings.
(b) A is true, but R is false. (e) It has lower density
(c) A is false, but R is true. Choose the correct answer from the options given
(d) Both A and R are true, and R is the correct below:
explanation of A. (a) (a), (b), (d) and (e) only
(b) (a), (c), (d) and (e) only
[NEET (2023)]
(c) (a), (b), and (d) only
2. In old trees the greater part of secondary xylem is dark
(d) (c), (d) and (e) only
brown and resistant to insect attack due to:
(e) All the options are correct
(a) Secretion of secondary metabolites and their
[NEET (2022)]
deposition in the lumen of vessels.
5. Match list I with list II.
(b) Deposition of organic compounds like tannins and
List I List II
resins in the central layers of the stem.
(c) Deposition of suberin and aromatic substances in the (a) Cells with active cell (i) Vascular
outer layer of the stem. division capacity Tissues
(d) Deposition of tannins, gum, resin and aromatic (b) Tissue having all (ii) Meristematic
substances in the peripheral layers of the stem. cells similar in tissues
(e) Presence of parenchyma cells, functionally active structure and
xylem elements and essential oils.
function
below: (c) Tissue having (iii) Sclereids
(a) (a) and (b) only different type of
(b) (c) and (d) only cells
(c) (d) and (e) only (d) Dead cells with (iv) Simple Tissue
(d) (b) and (d) only highly thickened
[NEET (2022)]
walls and narrow
3. Read the following statements about the vascular
bundles lumen
(a) In roots, xylem and phloem in a vascular bundle are
arranged in an alternate manner along the different radii. (a) (a)- (i); (b) - (ii); (c) - (iii);(d) - (iv)
(b) Conjoint closed vascular bundles do not possess (b) (a)- (iii); (b) - (ii); (c) - (iv);(d) - (i)
cambium (c) (a)- (ii); (b) - (iv); (c) - (i);(d) - (iii)
(c) In open vascular bundles, cambium is present in (d) (a)- (iv); (b) - (iii); (c) - (ii);(d) - (i)
between xylem and phloem [NEET (2021)]
(d) The vascular bundles of dicotyledonous stem 6. Match list I with list II.
possess endarch protoxylem
(e) In monocotyledonous root, usually there are more List I List II
than six xylem bundles present (a) Lenticels (i) Phellogen
Choose the correct answer from the options given (b) Cork cambium (ii) Suberin deposition
below:
(c) Secondary cortex (iii) Exchange of gases
(a) (a), (b) and (d) only
(b) (b), (c), (d) and (e) only (d) Cork (iv) Phelloderm
(c) (a), (b), (c) and (d) only
(d) All the options are correct.
[NEET (2022)]
(a) (a)- (ii); (b) - (iii); (c) - (iv);(d) - (i) (a) Flaccidity of bulliform cells
(b) (a)- (iv); (b) - (ii); (c) - (i);(d) - (iii) (b) Shrinkage of air spaces in spongy mesophyll
(c) (a)- (iv); (b) - (i); (c) - (iii);(d) - (ii) (c) Tyloses in vessels
(d) (a)- (iii); (b) - (i); (c) - (iv);(d) - (ii) (d) Closure of stomata
[NEET (2021)] [NEET (2019)]
7. Select the correct pair. 13. Plant having little or no secondary growth are
(a) Cells of medullary rays that form part of cambial ring (a) Deciduous angiosperms (b) Conifers
- Interfascicular cambium (c) Grasses (d) Cycads
(b) Loose parenchyma cells rupturing the epidermis [NEET (2018)]
and forming a lens-shaped opening in bark – Spongy 14. Casparian strips occur in
parenchyma (a) Pericycle
(c) Large colorless empty cells in the epidermis of (b) Cortex
grass leaves – Subsidiary cells (c) Epidermis
(d) In dicot leaves, vascular bundles are surrounded by (d) Endodermis
large thick-walled cells– Conjunctive tissue [NEET (2018)]
[NEET (2021)] 15. Secondary xylem and phloem in dicot stem are produced
8. The transverse section of a plant shows following by
anatomical features: (a) Phellogen
(i) Large number of scattered vascular bundles (b) Vascular cambium
surrounded by bundle sheath. (c) Apical meristems
(ii) Large conspicuous parenchymatous ground tissue. (d) Axillary meristems
(iii) Vascular bundles conjoint and closed. [NEET (2018)]
(iv) Phloem parenchyma absent. 16. Stomata in grass leaves are
Identify the category of plant and its part: (a) Rectangular
(a) Dicotyledonous stem (b) Kidney shaped
(b) Dicotyledonous root (c) Dumb-bell shaped
(c) Monocotyledonous stem (d) Barrel-shaped
(d) Monocotyledonous root [NEET (2018)]
[NEET (2020)] 17. Identify the wrong statement in the context of
9. Identify the incorrect statement. heartwood.
(a) Sapwood is the innermost secondary xylem and is (a) It conducts water and minerals efficiently
lighter in colour. (b) It comprises dead elements with highly lignified
(b) Due to deposition of tannins, resins, oils etc., heart walls
wood is dark in colour. (c) Organic compounds are deposited in it
(c) Heart wood does not conduct water but gives (d) It is highly durable
mechanical support. [NEET (2017)]
(d) Sapwood is involved in conduction of water and 18. Which of the following is made up of dead cells?
minerals from root to leaf. (a) Phellem
[NEET (2020)] (b) Phloem
10. Which of the statements given below is not true about (c) Xylem parenchyma
formation of Annual Rings in trees: (d) Collenchyma
(a) Differential activity of cambium causes light and [NEET (2017)]
dark bands of tissue-early and late wood respectively 19. The vascular cambium normally gives rise to
(b) Activity of cambium depends upon variation in (a) Secondary xylem
climate (b) Periderm
(c) Annual rings are not prominent in trees of (c) Phelloderm
temperate regions (d) Primary phloem
(d) Annual ring is a combination of spring wood and [NEET (2017)]
autumn wood produced in a year 20. The balloon- shaped structures called tyloses
[NEET (2019)] (a) Characterize the sapwood
11. Phloem of gymnosperms lacks (b) Are extensions of xylem parenchyma cells into
(a) Sieve tubes only vessels
(b) Companion cells only (c) Are linked to the ascent to sap through xylem
(c) Both sieve tubes and companion cells vessels
(d) Albuminous cells and sieve cells (d) Originate in the lumen of vessels
[NEET (2019)] [NEET (2016-II)]
12. Grass leaves curl inwards during very dry weather.
Select the most appropriate reason from the following:
21. Cortex is the region found between 29. In land plants, the guard cells differ from other
(a) Pericycle and endodermis epidermal cells in having :
(b) Endodermis and pith (a) Chloroplasts
(c) Endodermis and vascular bundle (b) Cytoskeleton
(d) Epidermis and stele (c) Mitochondria
[NEET (2016-II)] (d) Endoplasmic reticulum
22. Read the different components from (a) to (d) in the list
[NEET (2011)]
given below and tell the correct order of the components
30. The cork cambium, cork and secondary cortex are
with reference to their arrangement from outer side to
collectively called :
inner side in a woody dicot stem:
(a) Phellem (b) Phelloderm
(1) Secondary cortex (2) Wood
(c) Phellogen (d) Periderm
(3) Secondary phloem (4) Phellem The correct order is:
[NEET (2011)]
(a) (3), (4), (2), (1)
31. Which one of the folliwng is not a lateral meristem ?
(b) (1), (2), (4), (3)
(a) Intrafascicular cambium
(c) (4), (1), (3), (2)
(b) Interfascicular cambium
(d) (4), (3), (1), (2)
(c) Phellogen
[NEET (2015)]
(d) Intercalary meristem
23. Tracheids differ from other tracheary elements in
[NEET (2010)]
(a) Being imperforate
32. Heartwood differs from sapwood in –
(b) Lacking nucleus
(a) Presence of rays and fibres
(c) Being lignified
(b) Abscence of vessels and parenchyma
(d) Having casparian strips
(c) Having dead and non-conducting elements
[NEET (2014)]
(d) Being susceptible to pests and pathogens
24. You are given a fairly old piece of dicot stem and a dicot
[NEET (2010)]
root. Which of the following anatomical structures will
33. The annular and spirally thickened conducting elements
you use to distinguish between the two?
generally develop in the protoxylem when the root or
(a) Secondary phloem
stem is -
(b) Protoxylem
(a) Differentiating (b) Maturing
(c) Cortical cells
(c) Elongating (d) Widening
(d) Secondary xylem
[NEET (2009)]
[NEET (2014)]
34. In barley stem vascular bundles are -
25. Age of a tree can be estimated by
(a) Closed and radial
(a) Its height and girth
(b) Open and scattered
(b) Biomass
(c) Closed and scattered
(c) Number of annual rings
(d) Open and in a ring
(d) Diameter of its heartwood
[NEET (2009)]
[NEET (2013)]
35. Palisade parenchyma is absent in leaves of -
26. Interfascicular cambium develops from the cells of
(a) Gram (b) Sorghum
(a) Medullary rays
(c) Mustard (d) Soybean
(b) Xylem parenchyma
[NEET (2009)]
(c) Endodermis
36. Reduction in vascular tissue, mechanical tissue and
(d) Pericycle
cuticle is characteristic of :
[NEET (2013)]
(a) Hydrophytes
27. As compared to a dicot root, a monocot root has :
(b) Xerophytes
(a) Many xylem bundles
(c) Mesophytes
(b) Inconspicuous annual rings
(d) Epiphytes
(c) Relatively thicker periderm
[NEET (2009)]
(d) More abundant secondary xylem 37. Anatomically fairly old dicotyledonous root is
[NEET (2012)] distinguished from the dicotyledonous stem by :
28. Ground tissue includes : (a) Position of protoxylem
(a) All tissues internal to endodermis (b) Absence of secondary xylem
(b) All tissues external to endodermis (c) Absence of secondary phloem
(c) All tissues except epidermis and vascular bundles (d) Presence of cortex
[NEET (2009)]
(d) Epidermis and cortex
38. Vascular tissues in flowering plants develop from:
[NEET (2011)] (a) Periblem (b) Dermatogen
(c) Phellogen (d) Plerome
[NEET (2008)]
39. For a critical study of secondary growth in plants, which (a) Root pressure and transpiration pull
one of the following pairs is suitable? (b) P-proteins
(a) Wheat and maiden hair fern (c) Mass flow involving a carrier and ATP
(b) Sugarcane and sunflower (d) Cytoplasmic streaming
(c) Teak and pine [NEET (2006)]
(d) Deodar and fern 42. In a woody dicotyledonous tree, which of the following
[NEET (2007)] parts will mainly consist of primary tissues -
40. A common structural feature of vessel elements and (a) Stem and root
sieve tube elements is- (b) All parts
(a) Thick secondary walls (c) Shoot tips and root tips
(b) Pores on lateral wall (d) Flowers, fruit and leaves
(c) Presence of p-protein [NEET (2005)]
(d) Enucleate condition
[NEET (2006)]
41. The translocation of organic solutes in sieve tube
members is supported by-
STRUCTURAL ORGANISATION IN ANIMALS 31
STRUCTURAL ORGANISATION IN ANIMALS

1. Given below are two statements: 5. Tegmina in cockroach arises from
Statement I: Ligaments are dense irregular tissue. (a) Prothorax
Statement II: Cartilage is dense regular tissue. (b) Mesothorax
In the light of the above statements, choose the correct (c) Metathorax
answer from the options given below: (d) Prothorax and Mesothorax
(a) Both Statement I and Statement II are false. [NEET (2022)]
(b) Statement I is true, but Statement II is false. 6. Which of the following is not a connective tissue?
(c) Statement I is false, but Statement II is true. (a) Blood (b) Adipose tissue
(d) Both Statement I and Statement II are true. (c) Cartilage (d) Neuroglia
[NEET (2022)]
[NEET (2023)]
2. In cockroach, excretion is brought about by
A. Phallic gland List I List II
B. Uricose gland
C. Nephrocytes (a) Bronchioles (i) Dense Regular
D. Fat body
Connective Tissue
E. Collateral glands
(b) Goblet Cell (ii) Loose Connective
below:
(a) A, B and E only Tissue
(b) B, C and D only
(c) B and D only (c) Tendons (iii) Glandular Tissue
(d) A and E only
(d) Adipose (iv) Ciliated Epithelium
[NEET (2023)]
Tissue
3. Match List I with List II.
List I List II
(a) (a)- (iv); (b) - (iii); (c) - (i);(d) - (ii)
(b) (a)- (i); (b) - (ii); (c) - (iii);(d) - (iv)
A. Mast cells I. Ciliated epithelium (c) (a)- (ii); (b) - (i); (c) - (iv);(d) - (iii)
(d) (a)- (iii); (b) - (iv); (c) - (ii);(d) - (i)
B. Inner surface of II. Areolar connective [NEET (2022)]
bronchiole tissue 8. Which of the following statements wrongly represents
the nature of smooth muscle?
C. Blood III. Cuboidal (a) Communication among the cells is performed by
epithelium intercalated discs
(b) These muscles are present in the wall of blood
D. Tubular parts of IV. Specialised vessels
nephron connective tissue (c) These muscle have no striations
(d) They are involuntary muscles
Choose the correct answer from the options give below: [NEET (2021)]
(a) A–II, B–III, C–I, D–IV 9. Which of the following characteristics is incorrect with
(b) A–II, B–I, C–IV, D–III respect to cockroaches?
(c) A–III, B–IV, C–II, D–I (a) In females, the 7th -9th sterna together form a genital
pouch
(d) A–I, B–II, C–IV, D–III (b) 10th abdominal segment in both sexes bears a pair
[NEET (2023)] of anal cerci
4. Which of the following is characteristic feature of (c) A ring of gastric caeca is present at the junction of
cockroach regarding sexual dimorphism? the midgut and hindgut
(a) Presence of anal styles (d) Hypopharynx lies within the cavity enclosed by the
(b) Presence of sclerites mouthparts
(c) Presence of anal cerci [NEET (2021)]
(d) Dark brown body colour and anal cerci 10. Identify the types of cell junctions that help to stop the
[NEET (2023)] leakage of the substances across tissue and facilitation
of communication with neighbouring cells via rapid (c) Pharynx → Oesophagus → Ileum → Crop →
transfer of ions and molecules. Gizzard → Colon → Rectum
(a) Adhering junctions and Tight junctions, respectively (d) Pharynx → Oesophagus → Crop → Gizzard →
(b) Adhering junctions and Gap junctions, respectively Ileum → Colon → Rectum
(c) Gap junctions and Adhering junctions, respectively [NEET (2019)]
(d) Tight junctions and Gap junctions, respectively 17. Which of the following features is used to identify a
[NEET (2021)] male cockroach from a female cockroach?
11. Following are the statements about the prostomium of (a) Forewings with darker tegmina
earthworms. (b) Presence of caudal styles
(a) It serves as a covering for the mouth (c) Presence of a boat-shaped sternum on the 9th
(b) It helps to open cracks in the soil into which it can abdominal segment
crawl (d) Presence of anal cerci
(c) It is one of the sensory structures [NEET (2018)]
(d) It is the first body segment 18. The frog’s heart when taken out of the body continues
Choose the correct answer from the options given below to beat for some time. Select the best option from the
(a) (a), (b), (c) and (d) are correct following statements.
(b) (b), (c) are correct (a) Frog is a poikilotherm
(c) (a), (b) and (c) are correct (b) Frog does not have any coronary circulation
(d) (a), (b) and (d) are correct (c) Heart is "myogenic" in nature.
[NEET (2021)] (d) Heart is autoexcitable.
12. Cuboidal epithelium with brush border of microvilli is (a) (a) and (b)
found in (b) (c) and (d)
(a) Proximal convoluted tubule of nephron (c) Only (c)
(b) Eustachian tube (d) Only (d)
(c) Lining of intestine [NEET (2017)]
(d) Ducts of salivary glands 19. In male cockroaches, sperms are stored in which part of
[NEET (2020)] the reproductive system?
13. Goblet cells of alimentary canal are modified from (a) Mushroom glands
(a) Chondrocytes (b) Testes
(b) Compound epithelial cells (c) Vas deferens
(c) Squamous epithelial cells (d) Seminal vesicles
(d) Columnar epithelial cells [NEET (2016-II)]
[NEET (2020)] 20. Which type of tissue correctly matches with its location?
14. If the head of cockroach is removed, it may live for few (a) Tissue- Smooth muscle; Location- Wall of intestine
days because (b) Tissue- Areolar tissue; Location- Tendons
(a) The head holds a small proportion of a nervous (c) Tissue- Transitional epithelium; Location- Tip of
system while the rest is situated along the ventral part of nose
its body. (d) Tissue- Cuboidal epithelium; Location- Lining of
(b) The head holds a 1/3rd of a nervous system while stomach
the rest is situated along the dorsal part of its body. [NEET (2016-I)]
(c) The supra-oesophageal ganglia of the cockroach are 21. Choose the correctly matched pair.
situated in the ventral part of the abdomen. (a) Adipose tissue – Dense connective tissue
(d) The cockroach does not have a nervous system. (b) Areolar tissue – Loose connective tissue
[NEET (2020)] (c) Cartilage – Loose connective tissue
15. The ciliated epithelial cells are required to move (d) Tendon – Specialized connective tissue
particles or mucus in a specific direction. In humans, [NEET (2014)]
these cells are mainly present in 22. Choose the correctly matched pair.
(a) Fallopian tubes and Pancreatic duct (a) Moist surface of buccal cavity – Glandular
(b) Eustachian tube and Salivary duct epithelium
(c) Bronchioles and Fallopian tubes (b) Tubular parts of nephrons – Cuboidal epithelium
(d) Bile duct and Bronchioles (c) Inner surface of bronchioles – Squamous epithelium
[NEET (2019)] (d) Inner lining of salivary ducts – Ciliated epithelium
16. Select the correct sequence of organs in the alimentary [NEET (2014)]
canal of cockroach starting from mouth. 23. What external changes are visible after the last moult of
(a) Pharynx → Oesophagus → Gizzard → Crop → a cockroach nymph?
Ileum → Colon → Rectum (a) Mandibles become harder
(b) Pharynx → Oesophagus → Gizzard → Ileum → (b) Anal cerci develop
Crop → Colon → Rectum
(c) Both forewings and hind wings develop (b) (D) Tissue-Smooth muscle tissue; Location-Heart;
(d) Labium develops Function-Heart contraction
[NEET (2013)] (c) (A) Tissue-Columnar epithelium; Location-
24. The supportive skeletal structures in the human extemal Nephron; Function-Secretion and absorption
ears and in the nose tip are examples of: (d) (B) Tissue-Glandular epithelium; Location-
(a) Areolar tissue (b) Bone Intestine; Function-Secretion
(c) Cartilage (d) Ligament
[NEET (2012)]
[NEET (2012)] 27. The ciliated columnar epithelial cells in humans are
25. Given below is the diagrammatic sketch of a certain type known to occur in :
of connective tissue. identify the parts labeled A, B, C (a) Fallopian tubes and urethra
and D and select the right option about them (b) Eustachian tube and stomach lining
(c) Bronchioles and Fallopian tubes
(d) Bile duct and oesophagus
[NEET (2011)]
28. Which of the following is correctly stated as it happens
in the common cockroach ?
(a) The food is ground by mandibles and gizzard
(b) Malpighian tubules are excretory organs projecting
(a) Part-A- Mast cell; Part-B- Marco phage; Part-C-
out from the colon
Fibroblast; Part-D- Collagen fibres
(c) Oxygen is transported by haemoglobin in blood
(b) Part-A- Macrophage; Part-B- Collegen fibres;
(d) Nitrogenous excretory product is urea
Part-C- Fibroblast; Part-D- Mast cell
[NEET (2011)]
(c) Part-A- Mast cell; Part-B- Collegen fibres; Part-
29. One very special feature in the earthworm pheretima is
C- Fibroblast; Part-D- Macrophage
that :
(d) Part-A- Macrophage; Part-B- Fibroblast; Part-C- (a) It has a long dorsal tubular heart
Collegen fibres; Part-D- Mast cell (b) Fertilisation of eggs occurs inside the body
[NEET (2012)] (c) The typhlosole greatly increases the effective
26. T he four sketches (A, B, C and D) given below, absorption area of the digested food in the intestine
represent four different types of animal tissues. Wl1ich (d) The S-shaped state embedded in the integument are
one of these is correctly identified in the options given, the defensive weapons used against the enemies
along with its correct location and function ? [NEET (2011)]
(a) 30. The kind of epithelium which forms the inner walls of
blood vessels is:
(a) Cuboidal epithelium
(b) Columnar epithelium
(b) (c) Ciliated columnar epithelium
(d) Squamous epithelium
[NEET (2010)]
31. If a live earthworm is pricked with a needle on its outer
surface without damaging its gut, the fluid that comes
out is :
(a) Slimy mucus
(c)
(b) Excretory fluid
(c) Coelomic fluid
(d) Haemolymph
[NEET (2009)]
32. The cell junctions called tight, adhering and gap
(d) junctions are found in :
(a) Neural tissue (b) Muscular tissue
(c) Connective tissue (d) Epithelial tissue
[NEET (2009)]
33. The kind of tissue that forms the supportive structure in
our pinna (external ears) is also found in -
(a) Tip of the nose (b) Vertebrae
(a) (C) Tissue-Collagen fibres; Location-Cartilage; (c) Nails (d) Ear ossicles
Function-Attach skeletal muscles to bones [NEET (2009)]
34. The epithelial tissue present on the inner surface of (c) Social insects
bronchioles and fallopian tubes is : (d) Camouflage
(a) Squamous [NEET (2006)]
(b) Cuboidal 39. Areolar connective tissue joins-
(c) Glandular (a) Fat body with muscles
(d) Ciliated (b) Integument with muscles
[NEET (2009)] (c) Bones with muscles
35. Which one of the following correctly described the (d) Bones with bones
location of some body parts in the earthworm Pheretima [NEET (2006)]
? 40. Earthworms are -
(a) Two pairs of accessory glands in 16–18 segments (a) Ureotelic when plenty of water is available
(b) Two pairs of testes in 10th and 11th segments. (b) Uricotelic when plenty of water is available
(c) Four pairs of spermathecae in 4–7 segments (c) Uricotelic under conditions of water scarcity
(d) One pair of ovaries attached at intersegmental (d) Ammonotelic when plenty of water is available.
septum of 14th and 15th segments. [NEET (2006)]
[NEET (2009)] 41. Grey crescent is the area -
36. Earthworms have no skeleton but during burrowing the (a) At the point of entry of sperm into ovum
anterior end becomes turgid and acts as a hydraulic (b) Just opposite to the site of entry of sperm into ovum
skeleton. It is due to: (c) At the animal pole
(a) Gut peristalsis (b) Setae (d) At the vegetal pole
(c) Coelomic fluid (d) Blood [NEET (2005)]
[NEET (2008)] 42. Epithelial cells of the intestine involved in food
37. Which one of the following is the true description about absorption have on their surface -
an animal concerned? (a) Zymogen granules
(a) Rat — Left kidney is slightly higher in position than (b) Pinocytic vesicles
the right one (c) Phagocytic vesicles
(b) Cockroach — 10 pairs of spiracles (2 pairs on (d) Microvilli
thorax and 8 pairs on abdomen) [NEET (2005)]
(c) Earthworm — The alimentary canal consists of a 43. Mast cells of connective tissue contain -
sequence of pharynx, oesophagus, stomach, gizzard (a) Heparin and histamine
and intestine (b) Heparin and calcitonin
(d) Frog — Body divisible into three regions-head, (c) Serotonin and melanin
neck and trunk (d) Vasopressin and relaxin
[NEET (2008)] [NEET (2004)]
38. Praying mantis is a good example of-
(a) Mullerian mimicry
(b) Warning colouration
CELL: THE UNIT OF LIFE 35
CELL: THE UNIT OF LIFE

1. Which of the following are NOT considered as the part (c) In prokaryotes only RER are present
of endomembrane system? (d) SER are the sites for lipid synthesis
A. Mitochondria
[NEET (2022)]
B. Endoplasmic Reticulum
5. Which of the following is an incorrect statement?
C. Chloroplasts
(a) The perinuclear space forms a barrier between the
D. Golgi complex
materials present inside the nucleus and that of the
E. Peroxisomes
cytoplasm.
Choose the most appropriate answer from the options
(b) Nuclear pores act as passages for proteins and RNA
given below:
molecules in both directions between nucleus and
(a) A, C and E only
cytoplasm
(b) A and D only
(c) Mature sieve tube elements possess a conspicuous
(c) A, D and E only
nucleus and usual cytoplasmic organelles
(d) B and D only
(d) Microbodies are present both in plant and animal
[NEET (2023)] cells
2. Which of the following functions is carried out by [NEET (2021)]
cytoskeleton in a cell? 6. When the centromere is situated in the middle of two
(a) Protein synthesis equal arms of chromosomes, the chromosome is referred
(b) Motility to as
(c) Transportation (a) Sub-metacentric (b) Acrocentric
(d) Nuclear division (c) Metacentric (d) Telocentric
[NEET (2021)]
[NEET (2023)]
7. Match List-I with List-II.
3. Match List - I with List - II. Choose the correct answer
from the options given below:
List - I List – II
List - I List – II
(a) Cristae (i) Primary constriction in
(a) Metacentric (i) Centromere situated
chromosome
chromosome close to the end
(b) Thylakoids (ii) Disc-shaped sacs in Golgi
forming one
apparatus
extremely short and
(c) Centromere (iii) Infolding in mitochondria
one
(b) Acrocentric (ii) Centromeres at the (d) Cisternae (iv) Flattened membranous
chromosome terminal end sacs in stroma of plastids
(c) Sub- (iii) Centromere in the
(a) (a)-(iii), (b)-(iv), (c)- (i), (d)-(ii)
metacentric middle forming two (b) (a)-(ii), (b)-(iii), (c)- (iv), (d)-(i)
equal arms of (c) (a)-(iv), (b)-(iii), (c)- (ii), (d)-(i)
chromosomes (d) (a)-(i), (b)-(iv), (c)- (iii), (d)-(ii)
(d) Telocentric (iv) Centromere slightly [NEET (2021)]
chromosome away from the middle 8. The organelles that are included in the endomembrane
forming one shorter system are
(a) Golgi complex, Mitochondria, Ribosomes and
arm and one longer
Lysosomes
arm (b) Golgi complex, Endoplasmic reticulum,
(a) (a)- (iii); (b) - (i); (c) - (iv);(d) - (ii) Mitochondria and Lysosomes
(b) (a)- (i); (b) - (iii); (c) - (ii);(d) - (iv) (c) Endoplasmic reticulum, Mitochondria, Ribosomes
(c) (a)- (ii); (b) - (iii); (c) - (iv);(d) - (i) and Lysosomes
(d) (a)- (i); (b) - (ii); (c) - (iii);(d) - (iv) (d) Endoplasmic reticulum, Golgi complex, Lysosomes
[NEET (2022)] and Vacuoles
4. Which of the following statements with respect to [NEET (2021)]
Endoplasmic Reticulum is incorrect? 9. Which of the following statements about inclusion
(a) RER has ribosomes attached to ER bodies is incorrect?
(b) SER is devoid of ribosomes (a) They lie free in the cytoplasm
(b) These represent reserve material in cytoplasm.
(c) They are not bound by any membrane. 18. Which of the following is true for nucleolus?
(d) These are involved in ingestion of food particles. (a) It takes part in spindle formation
[NEET (2020)] (b) It is a membrane-bound structure
10. Which is the important site of formation of (c) Larger nucleoli are present in dividing cells
glycoproteins and glycolipids in eukaryotic cells? (d) It is a site for active ribosomal RNA synthesis
(a) Golgi bodies [NEET (2018)]
(b) Polysomes 19. The Golgi complex participates in
(c) Endoplasmic reticulum (a) Respiration in bacteria
(d) Peroxisomes (b) Formation of secretory vesicles
[NEET (2020)] (c) Fatty acid breakdown
11. The concept of “Omnis Cellula-e-cellula” regarding cell (d) Action of amino acid
division was first proposed by: [NEET (2018)]
(a) Theodore Schwann 20. Which of the following cell organelles is responsible for
(b) Schleiden extracting energy from carbohydrates to form ATP?
(c) Aristotle (a) Chloroplast
(d) Rudolf Virchow (b) Mitochondrion
[NEET (2019)] (c) Lysosome
12. The shorter and longer arms of a submetacentric (d) Ribosome
chromosome are referred to as: [NEET (2017)]
(a) p-arm and q-arm respectively 21. Which among the following are the smallest living cells,
(b) q-arm and p-arm respectively known without a definite cell wall, pathogenic to plants
(c) m-arm and n-arm respectively as well as animals and can survive without oxygen?
(d) s-arm and l-arm respectively (a) Mycoplasma (b) Nostoc
[NEET (2019)] (c) Bacillus (d) Pseudomonas
13. Which of the following statements is not correct? [NEET (2017)]
(a) The hydrolytic enzymes of lysosomes are active 22. A cell organelle containing hydrolytic enzymes is
under acidic pH (a) Microsome (b) Ribosome
(b) Lysosomes are membrane bound structures (c) Mesosome (d) Lysosome
(c) Lysosomes are formed by the process of packaging [NEET (2016-II)]
in the endoplasmic reticulum 23. Select the mismatch.
(d) Lysosomes have numerous hydrolytic enzymes (a) Large central vacuoles- Animal cells
[NEET (2019)] (b) Protists- Eukaryotes
14. Which of the following pairs of organelles does not (c) Methanogens-Prokaryotes
contain DNA? (d) Gas vacuoles- Green bacteria
(a) Chloroplast and Vacuoles [NEET (2016-II)]
(b) Lysosomes and Vacuoles 24. Water soluble pigments found in plant cell vacuoles are:
(c) Nuclear envelope and Mitochondria (a) Xanthophylls (b) Chlorophylls
(d) Mitochondria and Lysosomes (c) Carotenoids (d) Anthocyanins
[NEET (2019)] [NEET (2016-I)]
15. Many ribosomes may be associated with a single mRNA 25. Which one of the following cell organelles is enclosed
to form multiple copies of a polypeptide simultaneously. by a single membrane?
Such strings of ribosomes are termed as (a) Mitochondria (b) Chloroplasts
(a) Polyhedral bodies (b) Plastidome (c) Lysosomes (d) Nuclei
(c) Polysome (d) Nucleosome [NEET (2016-I)]
[NEET (2018)] 26. A complex of ribosome attached to a single strand of
16. Which of the following events does not occur in rough RNA is known as
endoplasmic reticulum? (a) Polysome
(a) Protein glycosylation (b) Polymer
(b) Cleavage of signal peptide (c) Polypeptide
(c) Protein folding (d) Okazaki fragment
(d) Phospholipid synthesis [NEET (2016-I)]
[NEET (2018)] 27. Microtubules are the constituents of:
17. Select the incorrect match: (a) Cilia, flagella and peroxisomes
(a) Allosomes – Sex chromosomes (b) Spindle fibres, centrioles and cilia
(b) Submetacentric – L-shaped chromosomes (c) Centrioles, spindle fibres and chromatin
(c) Lampbrush chromosomes – Diplotene bivalents (d) Centrosome, nucleosome and centrioles
(d) Polytene chromosomes – Oocytes of amphibians [NEET (2016-I)]
[NEET (2018)]
28. Mitochondria and chloroplast are (c) Mesosome

(1) semi-autonomous organelles (d) Plasma membrane
(2) formed by division of pre-existing organelles and [NEET (2015)]
they contain DNA but lack protein synthesizing 36. Match the following and select the correct answer:
machinery Column I Column II
Which of the following options is correct? A Centriole (i) Infoldings in
(a) Both (1) and (2) are correct mitochondria
(b) (2) is true but (1) is false
(c) (1) is true but (2) is false B Chlorophyll (ii) Thylakoids
(d) Both (1) and (2) are false. C Cristae (iii) Nucleic acids
[NEET (2016-I)] D Ribozymes (iv) Basal body cilia or
29. Chromatophores take part in flagella
(a) Photosynthesis (b) Growth
(c) Movement (d) Respiration (a) A – (i), B – (ii), C – (iv), D – (iii)
[NEET (2015)] (b) A – (i), B – (iii), C – (ii), D – (iv)
30. Cellular organelles with membranes are (c) A – (iv), B – (iii), C – (i), D – (ii)
(a) Nuclei, ribosomes and mitochondria (d) A – (iv), B – (ii), C – (i), D – (iii)
(b) Chromosomes, ribosomes and endoplasmic [NEET (2014)]
(c) Endoplasmic reticulum, ribosomes and nuclei 37. The osmosis of a cell kept in water is chiefly regulated
(d) Lysosomes, Golgi apparatus and mitochondria by
[NEET (2015)] (a) Vacuoles (b) Plastids
31. A protoplast is a cell: (c) Ribosomes (d) Mitochondria
(a) Without plasma membrane [NEET (2014)]
(b) Without nucleus 38. The solid linear cytoskeletal elements having a diameter
(c) Undergoing division of 6 nm and made up of a single type of monomer are
(d) Without cell wall known as
[NEET (2015)] (a) Microfilaments
32. Which of the following are not membrane-bound? (b) Intermediate filaments
(a) Vacuoles (b) Ribosomes (c) Lamins
(c) Lysosomes (d) Mesosomes (d) Microtubules
[NEET (2015)] [NEET (2014)]
33. The function of gap junction is to: 39. Which one of the following organelle in the figure
(a) Perform cementing to keep neighbouring cells correctly matches with its functions?
together.
(b) Facilitate communication between adjoining cells
by connecting the cytoplasm for rapid transfer of ions,
small molecules and some large molecules.
(c) Separate two cells from each other.
(d) Stop substance from leaking across a tissue.
[NEET (2015)]
34. Match the columns and identify the correct option.
Column-I Column-II
1. (i) Disc-shaped sacs in Golgi
Thylakoids apparatus
2. Cristae (ii) Condensed structure of DNA
3. Cisternae (iii) Flat membranous sacs in stroma
4. Chromatin (iv) Infoldings in mitochondria
(a) Rough endoplasmic reticulum, formation of
(a) 1-iv, 2-iii, 3-i, 4-ii glycoproteins
(b) 1-iii, 2-iv, 3-i, 4-ii (b) Golgi apparatus, protein synthesis
(c) 1-iii, 2-i, 3-iv, 4-ii (c) Golgi apparatus, formation of glycolipids
(d) 1-iii, 2-iv, 3-ii, 4-i (d) Rough endoplasmic reticulum, protein synthesis
[NEET (2015)] [NEET (2013)]
35. Which of the following structures is not found in a 40. The Golgi complex plays a major role
prokaryotic cell? (a) In trapping the light and transforming it into
(a) Nuclear envelope chemical energy
(b) Ribosome (b) In digesting proteins and carbohydrates
(c) As energy transferring organelles 50. Which one of the following has its own DNA?
(d) In post-translational modification of proteins and (a) Mitochondria (b) Dictyosome
glycosidation of lipid (c) Lysosome (d) Peroxisome
[NEET (2013)] [NEET (2010)]
41. A major site for synthesis of lipids is 51. The main arena of variuos types of activites of a cell is
(a) RER (b) SER –
(c) Symplast (d) Nucleoplasm (a) Plasma membrane
[NEET (2013)] (b) Mitochondrian
42. Which one of the following cellular parts is correctly (c) Cytoplasm
described ? (d) Nucleus
(a) Centrioles- sites for active RNA synthesis [NEET (2010)]
(b) Ribosomes- those on chloroplasts are larger (80s) 52. The plasma membrane consists mainly of –
·while those in the cytoplasm are smaller (70s) (a) Phospholipids embedded in a protein bilayer
(c) Lysosomes - optimally active at a pH of about 8.5 (b) Proteins embedded in a phospholipid bilayer
(d) Thylakoids- flattened membranous sacs fanning the (c) Proteins embedded in a polymer of glucose
grana of chloroplasts molecules
(d) Proteins embedded in a carbohydrate bilayer
[NEET (2012)]
[NEET (2010)]
43. Which one of the following structures is an organe lle 53. Plasmodesmata are :
within an organelle? (a) Connection between adjacent cells
(a) Peroxisome (b) ER (b) Lignified cemented layers between cells
(c) Mesosome (d) Ribosome (c) Locomotory structures
[NEET (2012)] (d) Membranes connecting the nucleus with
44. Important site for formation of glycoproteins and plasmalemma
glycolipids is : [NEET (2009)]
(a) Lysosome (b) Vacuole 54. Stroma in the chloroplast of higher plant contains :
(c) Golgi apparatus (d) Plastid (a) Chlorophyll
[NEET (2011)] (b) Light-independent reaction enzymes
45. Peptide synthesis inside a cell takes place in : (c) Light-dependent reaction enzymes
(a) Ribosomes (b) Chloroplast (d) Ribosomes
(c) Mitochondria (d) Chromoplast [NEET (2009)]
[NEET (2011)] 55. Middle lamella is composed mainly of :
46. In eubacteria, a cellular component that resembles (a) Phosphoglycerides (b) Hemicellulose
eukaryotic cell is : (c) Muramic acid (d) Calcium pectate
(a) Cell wall [NEET (2009)]
(b) Plasma membrane 56. Cytoskeleton is made up of :
(c) Nucleus (a) Proteinaceous filaments
(d) Ribosomes (b) Calcium carbonate granules
[NEET (2011)] (c) Callose deposits
47. Which one of the following organisms is not an example (d) Cellulose microfibrils
of eukaryotic cells ? [NEET (2009)]
(a) Amoeba proteus 57. In germinating seeds fatty acids are degraded
(b) Paramccium caudatum exclusively in the:
(c) Escheria coli (a) Peroxisomes (b) Mitochondria
(d) Euglena viridis (c) Proplastids (d) Glyoxysomes
[NEET (2011)] [NEET (2008)]
48. Which one of the following structures between two 58. Polysome is formed by:
adjacent cells is an effective transport pathway? (a) A ribosome with several subunits
(a) Plasmodesmata (b) Ribosomes attached to each other in a linear
(b) Plastoquinones arrangement
(c) Endoplasmic reticulum (c) Several ribosomes attached to a single mRNA
(d) Plasmalemma (d) Many ribosomes attached to a strand of
[NEET (2010)] endoplasmic reticulum
49. Membrane-bound organelles are absent in: [NEET (2008)]
(a) Saccharomyces 59. Vacuole in a plant cell:
(b) Streptococcus (a) Lacks membrane and contains air
(c) Chalamydomonas (b) Lacks membrane and contains water and excretory
(d) Plasmodium substances
[NEET (2010)]
(c) Is membrane-bound and contains storage proteins (a) The outer membrane is permeable to all kinds of
and lipids molecules
(d) Is membrane-bound and contains water and (b) The enzymes of the electron transfer chain are
excretory substances embedded in the outer membrane
[NEET (2008)] (c) The inner membrane is highly convoluted forming a
60. Cellulose is the major component of cell walls of : series of infoldings
(a) Pseudomonas (b) Saccharomyces (d) The outer membrane resembles a sieve
(c) Pythium (d) Xanthomonas [NEET (2006)]
[NEET (2008)] 68. A major breakthrough in the studies of cells came with
61. Keeping in view the "fluid mosaic model" for the the development of electron microscope. This is
structure of cell membrane, which one of thefollowing because-
statements is correct with respect to the movement of (a) The resolution power of the electron microscope is
lipids and proteins from one lipid monolayer to the other much higher than that of the light microscope
(described as flip-flop movement)? (b) The resolving power of the electron microscope is
(a) While proteins can flip-flop, lipids cannot 200-350 nm as compared to 0.1-0.2 nm for the light
(b) Neither lipids, nor proteins can flip-flop microscope
(c) Both lipids and proteins can flip-flop (c) Electron beam can pass through thick materials,
(d) While lipids can rarely flip-flop proteins cannot whereas light microscopy requires thin sections
[NEET (2008)] (d) The electron microscope is more powerful than the
62. Biological organization starts with:- light microscope as it uses a beam of electrons which
(a) Atomic level has wavelength much longer than that of photons
(b) Submicroscopic molecular level [NEET (2006)]
(c) Cellular level 69. Which of the following statements regarding cilia is not
(d) Organismic level correct -
[NEET (2007)] (a) The organized beating of cilia is controlled by fluxes
63. Which one of the following is not a constituent of cell of Ca2+ across the membrane
membrane ? (b) Cilia are hair-like cellular appendages
(a) Phospholipids (b) Cholesterol (c) Microtubules of cilia are composed of tubulin
(c) Glycolipids (d) Proline (d) Cilin contain an outer ring of nine doublet
[NEET (2007)] microtubules surrounding two single microtubules
64. Select the wrong statement from the following: [NEET (2006)]
(a) The chloroplasts are generally much larger than 70. Protein synthesis in an animal cell occurs -
mitochondria (a) On ribosomes presents in cytoplasm as well as in
(b) Both chloroplasts and mitochondria contain an mitochondria
inner and an outer membrane (b) On ribosomes present in the nucleolus as well as in
(c) Both chloroplasts and mitochondria have an internal cytoplasm
compartment, the thylakoid space bounded by the (c) Only on ribosomes attached to the nuclear envelope
thylakoid membrane and endoplasmic reticulum
(d) Both chloroplasts and mitochondria contain (d) Only on the ribosomes present in cytosol
DNA [NEET (2005)]
[NEET (2007)] 71. Centromere is required for -
65. In which one of the following preparations are you likely (a) Movement of chromosomes towards poles
to come across cell junctions most frequently ? (b) Cytoplasmic cleavage
(a) Hyaline cartilage (c) Crossing over
(b) Ciliated epithelium (d) Transcription
(c) Thrombocytes [NEET (2005)]
(d) Tendon 72. According to widely accepted "fluid mosaic model" cell
[NEET (2007)] membranes are semi-fluid, where lipids and integral
66. Lysozyme that is present in perspiration, saliva and proteins can diffuse randomly. In recent years, this
tears, destroys: model has been modified in several respects. In this
(a) Most virus – infected cells regard, which of the following statements are incorrect
(b) Certain fungi -
(c) Certain types of bacteria (a) Proteins can also undergo flip-flop movements in the
(d) All viruses lipid bilayer
[NEET (2007)] (b) Many proteins remain completely embedded within
67. Which of the following statements regarding the lipid bilayer
mitochondrial membrane is not correct ? (c) Proteins in cell membranes can travel within the
lipid bilayer
(d) Proteins can remain confined within certain (c) Microtubular organization and function
domains of the membranes (d) Type of movement & placement in cell
[NEET (2005)] [NEET (2004)]
73. The main organelle involved in modification and 76. Extranuclear inheritance is a consequence of presence of
routing of newly synthesized proteins to their genes in -
destinations is - (a) Endoplasmic reticulum & mitochondria
(a) Endoplasmic Reticulum (b) Lysosome (b) Ribosomes and chloroplast
(c) Mitochondria (d) Chloroplast (c) Lysosomes and ribosomes
[NEET (2005)] (d) Mitochondria and chloroplasts
74. Chlorophyll in chloroplasts is located in - [NEET (2004)]
(a) Grana (b) Pyrenoid 77. In chloroplasts, chlorophyll is present in the :-
(c) Stroma (d) Both (a) and (c) (a) Inner membrane
[NEET (2005)] (b) Thylakoids
75. Flagella of prokaryotic and eukaryotic cells differ in :- (c) Stroma
(a) Location in cell and mode of functioning (d) Outer membrane
(b) Microtubular organization and type of movement [NEET (2004)]
BIOMOLECULES 41
BIOMOLECULES
1. Cellulose does not form blue colour with iodine because (d) Lipids are generally insoluble in water but soluble in
(a) It is a helical molecule. some organic solvents
(b) It does not contain complex helices and hence (e) When fatty acid is esterified with glycerol,
cannot hold iodine molecules. monoglycerides are formed.
(c) It breaks down when iodine reacts with it. Choose the correct answer from the options given below
(d) It is a disaccharide. (a) (a), (b) and (c) only
(b) (a), (d) and (e) only
[NEET (2023)]
(c) (c), (d) and (e) only
2. Malonate inhibits the growth of pathogenic bacteria by (d) (a), (b) and (d) only
inhibiting the activity of [NEET (2022)]
(a) Amylase 6. A dehydration reaction links two glucose molecules to
(b) Lipase produce maltose. If the formula for glucose is C6H12O6
(c) Dinitrogenase then what is the formula for maltose?
(d) Succinic dehydrogenase (a) C12H20O10
[NEET (2023)] (b) C12H24O12
3. Given below are two statements: (c) C12H22O11
Statement I: Low temperature preserves the enzyme in a (d) C12H24O11
temporarily inactive state, whereas high temperature [NEET (2022)]
destroys enzymatic activity because proteins are 7. Match list I with list II. Choose the correct answer from
denatured by heat. the options given below :
Statement II: When the inhibitor closely resembles the List I List II
substrate in its molecular structure and inhibits the
(a) Glycogen (i) Hormone
activity of the enzyme, it is known as competitive
inhibitor. (b) Globulin (ii) Biocatalyst
In the light of the above statements, choose the correct (c) Steroids (iii) Antibody
answer from the options given below: (d) Thrombin (iv) Storage product
(a) Both Statement I and Statement II are false. (a) (a)- (iii); (b) - (ii); (c) - (iv);(d) - (i)
(b) Statement I is true, but Statement II is false. (b) (a)- (iv); (b) - (ii); (c) - (i);(d) - (iii)
(c) Statement I is false, but Statement II is true. (c) (a)- (ii); (b) - (iv); (c) - (iii);(d) - (i)
(d) Both Statement I and Statement II are true. (d) (a)- (iv); (b) - (iii); (c) - (i);(d) - (ii)
[NEET (2023)] [NEET (2022)]
4. Given below are two statements: 8. Which of the following are not secondary metabolites in
Statement I: A protein is imagined as a line, the left end plants?
represented by first amino acid (C-terminal) and the (a) Vinblastin, curcumin
right end represented by last amino acid (N-terminal). (b) Rubber, gums
Statement II: Adult human haemoglobin, consists of 4 (c) Morphine, codeine
subunits (two subunits of α type and two subunits β (d) Amino acids, glucose
type.). [NEET (2021)]
In the light of the above statements, choose the correct 9. Match list I with list II.
answer from the options given below:
(a) Both statement I and Statement II are false. List I List II
(b) Statement I is true, but Statement II is false. (a) Protein (i) C=C double bonds
(c) Statement I is false, but Statement II is true. (b) Unsaturated fatty (ii) Phosphodiester
(d) Both statement I and Statement II are true. acid bonds
[NEET (2023)] (c) Nucleic acid (iii) Glycosidic bonds
5. Read the following statements on lipids and find out (d) Polysaccharide (iv) Peptide bonds
correct set of statements:
(a) Lecithin found in the plasma membrane is a (a) (a)- (ii); (b) - (i); (c) - (iv);(d) - (iii)
glycolipid (b) (a)- (iv); (b) - (iii); (c) - (i);(d) - (ii)
(b) Saturated fatty acids possess one or more c = c bonds (c) (a)- (iv); (b) - (i); (c) - (ii);(d) - (iii)
(c) Gingely oil has lower melting point, hence remains (d) (a)- (i); (b) - (iv); (c) - (iii);(d) - (ii)
as oil in winter [NEET (2021)]
BIOMOLECULES 42
10. Identify the incorrect pair. 17. Concanavalin A is

(a) Lectins - Concanavalin A (a) An essential oil (b) A lectin
(b) Drugs - Ricin (c) A pigment (d) An alkaloid
(c) Alkaloids - Codeine [NEET (2019)]
(d) Toxin - Abrin 18. Consider the following statements:
[NEET (2021)] (a) Coenzyme or metal ion that is tightly bound to
11. Following are the statements with reference to 'lipids'. enzyme protein is called prosthetic group.
(a) Lipids having only single bonds are called (b) A complete catalytic active enzyme with its bound
unsaturated fatty acids. prosthetic group is called apoenzyme.
(b) Lecithin is a phospholipid (a) (a) is true but (b) is false
(c) Trihydroxy propane is glycerol. (b) Both (a) and (b) are false.
(d) Palmitic acid has 20 carbon atoms including (c) (a) is false but (b) is true
carboxyl carbon (d) Both (a) and (b) are true.
(e) Arachidonic acid has 16 carbon atoms [NEET (2019)]
Choose the correct answer from the options given below 19. The two functional groups characteristic of sugars are
(a) (b) and (c) only (a) Carbonyl and phosphate
(b) (b) and (e) only (b) Carbonyl and methyl
(c) (a) and (b) only (c) Hydroxyl and methyl
(d) (c) and (d) only (d) Carbonyl and hydroxyl
[NEET (2021)] [NEET (2018)]
12. Secondary metabolites such as nicotine, strychnine and 20. Which one of the following statements is correct with
caffeine are produced by plants for their reference to enzyme?
(a) Defence action (a) Apoenzyme = Holoenzyme + Coenzyme
(b) Effect on reproduction (b) Holoenzyme = Apoenzyme + Coenzyme
(c) Nutritive value (c) Coenzyme = Apoenzyme + Holoenzyme
(d) Growth response (d) Holoenzyme = Coenzyme +Cofactor
[NEET (2020)] [NEET (2017)]
13. Which one of the following is the most abundant protein 21. Which of the following are not polymeric?
in the animals? (a) Polysaccharides (b) Lipids
(a) Lectin (b) Insulin (c) Nucleic acids (d) Proteins
(c) Haemoglobin (d) Collagen [NEET (2017)]
[NEET (2020)] 22. Which of the following describes the given graph
14. Identify the substances having glycosidic bond and CORRECTLY?
peptide bond, respectively in their structure.
(a) Cellulose, lecithin
(b) Inulin, Insulin
(c) Chitin, cholesterol
(d) Glycerol, trypsin
[NEET (2020)]
15. Match the following
Column I Column II (a) Exothermic reaction with energy A in presence of

(a) Inhibitor of catalytic Activity (i) Ricin enzyme and B in absence of enzyme
(b) Possess peptide bonds (ii) Malonate (b) Endothermic reaction with energy A in absence of
enzyme and B in presence of enzyme
(c) Cell wall material in fungi (iii) Chitin
(c) Exothermic reaction with energy A in absence of
(d) Secondary metabolite (iv) Collagen enzyme and B in presence of enzyme
(d) Endothermic reaction with energy A in presence of
(a) a – iii; b – iv; c – i; d – ii enzyme and B in absence of enzyme
(b) a – ii; b – iii; c – i; d – iv [NEET (2016-II)]
(c) a – ii; b – iv; c – iii; d – i 23. Which of the following is the least likely to be involved
(d) a – iii; b – i; c – iv; d – ii in stabilizing the three-dimensional folding of most
[NEET (2020)] proteins?
16. Identify the basic amino acid from the following. (a) Electrostatic interaction
(a) Lysine (b) Valine (b) Hydrophobic interaction
(c) Tyrosine (d) Glutamic acid (c) Ester bonds
[NEET (2020)] (d) Hydrogen bonds
[NEET (2016-II)]
BIOMOLECULES 43
24. A non-proteinaceous enzyme is (c) A aturated or unsaturated fatty acid esterified to a

(a) Ribozyme (b) Ligase glycerol molecule to which a phosphate group is also
(c) Deoxyribonuclease (d) Lysozyme attached.
[NEET (2016-II)] (d) A saturated or unsaturated fatty acid esterified to a
25. A typical fat molecule is made up of phosphate group which is also attached to a glycerol
(a) Three glycerol molecules and one fatty acid molecule.
molecule [NEET (2013)]
(b) One glycerol and three fatty acid molecules 33. Transition state structure of the substrate formed during
(c) One glycerol and the fatty acid molecule an enzymatic reaction is
(d) Three glycerol and three fatty acid molecules (a) Transient but stable
[NEET (2016-I)] (b) Permanent but unstable
26. Which one of the following statements is wrong? (c) Transient and unstable
(a) Sucrose is a disaccharide. (d) Permanent and stable
(b) Cellulose is a polysaccharide. [NEET (2013)]
(c) Uracil is a pyrimidine. 34. Which one of the following biomolecules is correctly
(d) Glycine is a sulphur containing amino acid. characterised ?
[NEET (2016-I)] (a) Palmitic acid - an unsaturated fatty acid with 18
27. Which of the following biomolecules does have a carbon atoms
phosphodiester bond? (b) Adenylic acid - adenosine ·with a glucose
(a) Fatty acids in a diglyceride phosphate molecule
(b) Monosaccharides in a polysaccharide (c) Alanine amino acid- Contains an amino group and
(c) Amino acids in a polypeptide an acidic group anywhere in the molecule
(d) Nucleotides in nucleic acids (d) Lecithin - a phosphorylated glyceride found in cell
[NEET (2015)] membrane
28. Which one of the following is a non-reducing
[NEET (2012)]
carbohydrate?
(a) Sucrose 35. For its activity, carboxypeptidase requires:
(b) Lactose (a) Iron (b) Niacin
(c) Ribose-5-phosphate (c) Copper (d) Zinc
(d) Maltose [NEET (2012)]
[NEET (2014)] 36. The curve given below shows enzymatic activity with
29. Select the option which is not correct with respect to relation to three conditions (pH, temperature and
enzyme action: substrate concentration)
(a) Addition of lot of succinate does not reverse the
inhibition of succinic dehydrogenase by malonate
(b) A noncompetitive inhibitor binds the enzyme at a
site distinct from that which binds the substrate
(c) Malonate is a competitive inhibitor of succinic
dehydrogenase What do the two axises (x and y) represent ?
(d) Substrate binds with the enzyme at its active site (a) x-axis- enzymatic activity,; y-axis- temperature
[NEET (2014)] (b) x-axis- enzymatic activity,; y-axis- pH
30. The essential chemical components of many coenzymes (c) x-axis- temperature; y-axis- enzyme activity
are
(a) Proteins (b) Nucleic acids (d) x-axis- substrate concentration; y-axis- enzymatic
(c) Carbohydrates (d) Vitamins activity
[NEET (2013)] [NEET (2011)]
31. Macromolecule chitin is 37. Which one of the following structural formulae of two
(a) Nitrogen containing polysaccharide organic compounds is correctly identified along with its
(b) Phosphorus containing polysaccharide related function ?
(c) Sulphur containing polysaccharide
(d) Simple polysaccharide
[NEET (2013)]
32. A phosphoglyceride is always made up of
(a) Only a saturated fatty acid esterified to a glycerol
molecule to which a phosphate group is also attached (a) A : Lecithin-a component of cell membrane
(b) Only an unsaturated fatty acid esterified to a (b) B : Adenine-a nucleotide that makes up nucleic
glycerol molecule to which a phosphate group is also acids
attached.
BIOMOLECULES 44
(c) A : Triglyceride-major source of energy (b) Non-competitive inhibitors often bind to the
(d) B : Uracil-a component of DNA enzyme irreversibly
(c) Competitive inhibition is seen when the substrate
[NEET (2011)]
and the inhibitor compete for the active site on the
38. A competitive inhibitor of succinic dehydrogenase is :
enzyme
(a) α-ketoglutarate (b) Malate
(d) Non-competitive inhibition of an enzyme can be
(c) Malonate (d) Oxaloacetate
overcome by adding large amount of substrate
[NEET (2008)]
[NEET (2005)]
39. Carbohydrates are commonly found as starch in plant
43. Enzymes, vitamins and hormones can be classified into
storage organs. Which of the following five (1-5)
a single category of biologicalchemicals, because all of
properties of starch make it useful as a storage material?
these -
(1) Easily translocated
(a) Are exclusively synthesized in the body of a living
(2) Chemically non-reactive
organism as at present
(3) Easily digested by animals
(b) Enhance oxidative metabolism
(4) Osmotically inactive
(c) Are conjugated proteins
(5) Synthesized during photosynthesis
(d) Help in regulating metabolism
(a) (1), (3) and (5) (b) (1) and (5)
[NEET (2005)]
(c) (2) and (3) (d) (2) and (4)
44. The catalytic efficiency of two different enzymes can be
[NEET (2008)]
compared by the -
40. An organic substance bound to an enzyme and essential
(a) The Km value
for its activity is called -
(b) The pH optimum value
(a) Coenzyme (b) Holoenzyme
(c) Molecular size of the enzyme
(c) Apoenzyme (d) isoenzyme
(d) Formation of the product
[NEET (2006)]
[NEET (2005)]
41. Which of the following is the simplest amino acid -
45. Carbohydrates, the most abundant biomolecules on
(a) Alanine (b) Asparagine
earth, are produced by -
(c) Glycine (d) Tyrosine
(a) Some bacteria, algae and green plant cells
[NEET (2005)]
(b) All bacteria, fungi and algae
42. Which of the following statements regarding enzyme
(c) Fungi, algae and green plants cells
inhibition is correct -
(d) Viruses, fungi and bacteria
(a) Competitive inhibition is seen when a substrate
[NEET (2005)]
competes with an enzyme for binding to an inhibitor
protein
CELL CYCLE AND CELL DIVISION 45
CELL CYCLE AND CELL DIVISION

1. Which of the following stages of meiosis involves (a) B and D only (b) A, C and E only
division of centromere? (c) B and E only (d) A and C only
(a) Metaphase II (b) Anaphase II [NEET (2023)]
(c) Telophase (d) Metaphase I 7. Which one of the following never occurs during mitotic
[NEET (2023)] cell division?
(a) Spindle fibres attach to kinetochores of
2. The process of appearance of recombination nodules
chromosomes
occurs at which substage of prophase I in meiosis?
(b) Movement of centrioles towards opposite poles
(a) Pachytene (b) Diplotene
(c) Pairing of homologous chromosomes
(c) Diakinesis (d) Zygotene
(d) Coiling and condensation of the chromatids
[NEET (2023)]
[NEET (2022)]
3. Among eukaryotes, replication of DNA takes place in
8. The appearance of recombination nodules on
(a) S phase (b) G1 phase
homologous chromosomes during meiosis
(c) G2 phase (d) M phase
characterizes:
[NEET (2023)]
(a) Synaptonemal complex
4. Match List I with List II:
(b) Bivalent
List I List Ii
(c) Sites at which crossing over occurs
A. M Phase I. Proteins are synthesized (d) Terminalization
B. G2 Phase II. Inactive phase [NEET (2022)]
C. Quiescent III. Interval between mitosis 9. Select the incorrect statement with reference to mitosis:
stage and initiation of DNA (a) All the chromosomes lie at the equator at metaphase
(b) Spindle fibres attach to centromere of chromosomes
replication
(c) Chromosomes decondense at the telophase stage
D. G1 Phase IV. Equational division (d) Splitting of centromere occurs at anaphase
Choose the correct answer from the options given [NEET (2022)]
below: 10. Regarding Meiosis, which of the statement(s) is
(a) A–IV, B–II, C–I, D–III incorrect?
(b) A–IV, B–I, C–II, D–III (a) There are two stages in Meiosis, Meiosis-I and II
(c) A–II, B–IV, C–I, D–III (b) DNA replication occurs in S phase of Meiosis-II
(d) A–III, B–II, C–IV, D–I (c) Pairing of homologous chromosomes and
[NEET (2023)] recombination occurs in Meiosis-I
5. Given below are two statements: (d) Four haploid cells are formed at the end of Meiosis-
Statement I: During G0 phase of cell cycle, the cell is II
metabolically inactive. [NEET (2022)]
Statement II: The centrosome undergoes duplication 11. Which of the following stages of meiosis involves the
during S phase of interphase. division of centromere?
In the light of the above statements, choose the most (a) Anaphase II (b) Telophase II
appropriate answer from the options given below: (c) Metaphase I (d) Metaphase II
(a) Both Statement I and Statement II are incorrect. [NEET (2021)]
(b) Statement I is correct, but Statement II is incorrect. 12. Match List -I with LIst – II
(c) Statement I is incorrect, but Statement II is correct. List I List Ii
(d) Both Statement I and Statement II are correct. (a) S Phase (i) Proteins are synthesized
[NEET (2023)] (b) G2 Phase (ii) Inactive phase
6. Select the correct statements: (c) Quiescent (iii) Interval between
A. Tetrad formation is seen during Leptotene. stage mitosis and initiation of
B. During Anaphase, the centromeres split and
chromatids separate. DNA replication
C. Terminalization takes place during Pachytene. (d) G1 Phase (iv) DNA replication
D. Nucleolus, Golgi complex and ER are reformed (a) (a)-(iv), (b)-(i), (c)- (ii), (d)-(iii)
during Telophase. (b) (a)-(ii), (b)-(iv), (c)- (iii), (d)-(i)
E. Crossing over takes place between sister chromatids (c) (a)-(iii), (b)-(ii), (c)- (i), (d)-(iv)
of homologous chromosome. (d) (a)-(iv), (b)-(ii), (c)- (iii), (d)-(i)
Choose the correct answer from the options given [NEET (2021)]
below:
13. The centriole undergoes duplication during: (d) Chromosomes will be fragmented
(a) Metaphase (b) G2 phase [NEET (2017)]
(c) S-phase (d) Prophase 23. Which of the following options gives the correct
[NEET (2021)] sequence of events during mitosis?
14. The fruit fly has 8 chromosomes (2n) in each cell. (a) Condensation → crossing over → nuclear membrane
During the interphase of Mitosis if the number of disassembly → segregation → telophase
chromosomes at the G1 phase is 8, what would be the (b) Condensation → arrangement at equator →
number of chromosomes after the S phase? centromere division → segregation → telophase
(a) 4 (b) 32 (c) Condensation → nuclear membrane disassembly →
(c) 8 (d) 16 crossing over → segregation → telophase
[NEET (2021)] (d) Condensation → nuclear membrane disassembly →
15. Which stage of meiotic prophase shows terminalisation arrangement at equator → centromere division →
of chiasmata as its distinctive feature? segregation → telophase
(a) Diakinesis (b) Pachytene [NEET (2017)]
(c) Leptotene (d) Zygotene 24. When a cell has stalled DNA replication, which
[NEET (2021)] checkpoint should be predominantly activated?
16. Some dividing cells exit the cell cycle and enter (a) G2 /M (b) M
vegetative inactive stage. This is called quiescent stage (c) Both G2 /M and M (d) G1 /S
(G0 ). This process occurs at the end of : [NEET (2016-II)]
(a) S phase (b) G2 Phase 25. Match the stages of meiosis in Column-I to their
(c) M phase (d) G1 phase characteristic features in Column-II and select the
[NEET (2020)] CORRECT option using the codes given below:
17. Dissolution of the synaptonemal complex occurs during:
(a) Diplotene (b) Leptotene Column-I Column-II
(c) Pachytene (d) Zygotene
[NEET (2020)] a) Pachytene i) Homologous chromosomes
18. Identify the correct statement with regard to G 1 phase separate
(Gap I) of interphase.
(a) Cell is metabolically active, grows but does not b) Metaphase- ii) Terminalization of
replicate its DNA
I chiasmata
(b) Nuclear division takes place
(c) DNA synthesis or replication takes place
c) Diakinesis iii) Crossing-over takes place
(d) all of these
[NEET (2020)]
19. The correct sequence of phases of cell cycle is d) Anaphase I iv) Chromosomes align at
(a) G1 → G2 → S → M equatorial plate
(b) S → G1 → G2 → M
(c) G1 → S → G2 → M (a) a) - i) , b) - iv), c) - ii), d) - iii)
(d) M → G1 → G2 → S (b) a) - ii) , b) - iv), c) - iii), d) - i)
[NEET (2019)] (c) a) - iv) , b) - iii), c) - ii), d) - i)
20. Cells in G0 phase (d) a) - iii) , b) - iv), c) - ii), d) - i)
(a) Enter the cell cycle [NEET (2016-II)]
(b) Suspend the cell cycle 26. During cell growth, DNA synthesis takes place in
(c) Terminate the cell cycle (a) G1 phase (b) G2 phase
(d) Exit the cell cycle (c) M phase (d) S phase
[NEET (2019)] [NEET (2016-II)]
21. The stage during which separation of the paired 27. A cell at telophase stage is observed by a student in a
homologous chromosomes begins is plant brought from the field. He tells his teacher that
(a) Diakinesis (b) Diplotene these cells are not like other cells at telophase stage.
(c) Pachytene (d) Zygotene There is no formation of a cell plate and thus the cell
[NEET (2018)] contains more number of chromosomes as compared to
22. Anaphase Promoting Complex (APC) is a protein other dividing cells. This would result in:
degradation machinery necessary for proper mitosis of (a) Aneuploidy
animal cells. If APC is defective in a human cell, which (b) Polyploidy
of the following is expected to occur? (c) Somaclonal variation
(a) Chromosomes will not segregate (d) Polyteny
(b) Recombination of chromosome arms will occur [NEET (2016-I)]
(c) Chromosomes will not condense
28. Which of the following is not a characteristic feature (b) Late Anaphase- Chromosomes move away from
during mitosis in somatic cells? equatorial plate, golgi complex not present
(a) Spindle fibres (c) Cytokinesis- Cell plate formed, mitochondria
(b) Disappearance of nucleolus distributed between two daughter cells
(c) Chromosome movement (d) Telophase- Endoplasmic reticulum and nucleolus
(d) Synapsis not reformed yet
[NEET (2016-I)] [NEET (2013)]
29. In meiosis, crossing over is initiated at 36. The complex formed by a pair of synapsed homologous
(a) Pachytene (b) Leptotene chromosomes is called
(c) Zygotene (d) Diplotene (a) Equatorial plate (b) Kinetochore
[NEET (2016-I)] (c) Bivalent (d) Axoneme
30. Spindle fibre attach on to [NEET (2013)]
(a) Telomere of the chromosome 37. Identify the meiotic stage in which the homologous
(b) Kinetochore of the chromosome chromosomes separate while the sister chromatids
(c) Centromere of the chromosome remain associated at their centromeres:
(d) Kinetosome of the chromosome (a) Metaphase-II (b) Aaphase-I
[NEET (2016-I)] (c) Anaphase-II (d) Metaphase-I
31. Arrange the following events of meiosis in correct [NEET (2012)]
sequence.
38. Select the correct option with respect to mitosis.
a. Crossing over
(a) Chromosomes move to the spindle equator and get
b. Synapsis
aligned along equatorial plate in metaphase
c. Terminalisation of chiasmata
(b) Chromatids separate but remain in the centre of the
d. Disappearance of nucleolus
cell in anaphase
(a) b, a, d, c (b) b, a, c, d
(c) Chromatids start moving towards opposite poles in
(c) a, b, c, d (d) b, c, d, a
telophase
[NEET (2015)]
32. During which phase(s) of cell cycle, amount of DNA in (d) Golgi complex and endoplasmic reticulum are still
a cell remains at 4C level if the initial amount is denoted visible at the end of prophase
as 2C? [NEET (2011)]
(a) G1 and S (b) Only G2 39. During mitosis ER and nucleolus begin to disappear at
(c) G2 and M (d) G0 and G1 –
[NEET (2014)] (a) Late prophase
33. The enzyme recombinase is required at which stage of (b) Early metaphase
meiosis (c) Late metaphase
(a) Zygotene (b) Diplotene (d) Early prophase
(c) Diakinesis (d) Pachytene
[NEET (2010)]
[NEET (2014)]
40. Which stages of cell division do the following figures A
34. In ‘S’ phase of the cell cycle
(a) The amount of DNA remains same in each cell and B represent respectively ?
(b) The chromosome number is increased
(c) The amount of DNA is reduced to half in each cell
(d) The amount of DNA doubles in each cell
[NEET (2014)]
35. A stage in cell division is shown in the figure. Select the
answer which gives correct identification of the
(a) Metaphase - Telophase
(b) Telophase - Metaphase
(c) Late Anaphase - Prophase
(d) Prophase - Anaphase
[NEET (2010)]
41. Synapsis occurs between :
(a) Two homolog chromosomes
(b) A male and a female gamete
(c) mRNA and ribosomes
(a) Telophase - Nuclear envelope reforms, golgi (d) Spindle fibres and centromere
complex reforms [NEET (2009)]
42. Given below is a schematic break-up of the phases / 45. Which one of the following preceeds re-formation of the
stages of cell cycle : nuclear envelope during Mphase of the cell cycle :-
(a) Transcription from chromosomes and reassembly of
the nuclear lamina
(b) Formation of the contractile ring and formation of
the phragmoplast
(c) Formation of the contractile ring and transcription
from chromosomes
(d) Decondensation from chromosomes and reassembly
of the nuclear lamina
[NEET (2004)]
Which one of the following is the correct indication of 46. Crossing over that results in geneticrecombination in
the stage / phase in the cell cycle ? higher organisms occurs between :-
(a) A-Cytokinesis (a) Non-sister chromatids of a bivalent
(b) B-Metaphase (b) Two daughter nuclei
(c) C-Karyokinesis (c) Two different bivalents
(d) D-Synthetic phase (d) Sister chromatids of a bivalents
[NEET (2009)] [NEET (2004)]
43. In humans, at the end of the first meiotic division, the 47. In the somatic cell cycle :-
male germ cells differentiate into the: (a) DNA replication takes place in S-phase
(a) Spermatids (b) A short interphase is followed by a long mitotic
(b) Spermatogonia phase
(c) Primary spermatocytes (c) G2 phase follows mitotic phase
(d) Secondary spermatocytes (d) In G1 phase DNA content is double the amount of
[NEET (2008)] DNA present in the original cell
44. At what stage of the cell cycle are histone proteins [NEET (2004)]
synthesized in a eukaryotic cell - 48. If you are provided with root-tips of onion in your class
(a) During telophase and are asked to count the chromosomes which of the
(b) During S-phase following stages can you most conveniently look into :-
(c) During G-2 stage of prophase (a) Telophase (b) Anaphase
(d) During entire prophase (c) Prophase (d) Metaphase
[NEET (2005)] [NEET (2004)]
PHOTOSYNTHESIS IN HIGHER PLANTS 49
PHOTSYNTHESIS IN HIGHER PLANTS

1. How many ATP and NADPH2 are required for the (c) Statement I is correct but Statement II is incorrect
synthesis of one molecule of glucose during Calvin (d) Statement I is incorrect but Statement II is correct
cycle? [NEET (2022)]
(a) 18 ATP and 12 NADPH2 7. What is the role of large bundle sheath cells found
(b) 12 ATP and 16 NADPH2 around the vascular bundles in C4 plants?
(c) 18 ATP and 16 NADPH2 (a) To provide the site of photorespiratory pathway
(d) 12 ATP and 12 NADPH2 (b) To increase the number of chloroplast for the
operation of Calvin cycle
[NEET (2023)]
(c) To enable the plant to tolerate high temperature
2. The reaction centre in PS II has an absorption maximum
(d) To protect the vascular tissue from high light
at
intensity
(a) 700 nm (b) 660 nm
[NEET (2022)]
(c) 780 nm (d) 680 nm
8. The first stable product of CO2 fixation in sorghum is
[NEET (2023)]
(a) Succinic acid
3. Which micronutrient is required for splitting of water
(b) Phosphoglyceric acid
molecule during photosynthesis?
(c) Pyruvic acid
(a) Molybdenum (b) Magnesium
(d) Oxaloacetic acid
(c) Copper (d) Manganese
[NEET (2021)]
[NEET (2023)]
9. Which of the following statements is incorrect?
4. Identify the correct statements:
(a) Grana lamellae have both PS I and PS II
A. Lenticels are the lens-shaped openings permitting the
(b) Cyclic photophosphorylation involves both PS I
exchange of gases.
and PS II.
B. Bark formed early in the season is called hard bark.
(c) Both ATP and NADPH + H+ are synthesized during
C. Bark is a technical term that refers to all tissues
non-cyclic photophosphorylation.
exterior to vascular cambium.
(d) Stroma lamellae have PS I only and lack NADP
D. Bark refers to periderm and secondary phloem.
reductase
E. Phellogen is single layered in thickness.
[NEET (2021)]
10. In light reaction, plastoquinone facilitates the transfer of
below:
electrons from
(a) A and D only (b) A, B and D only
(a) PS-I to NADP+
(c) B and C only (d) B, C and E only
(b) PS-I to ATP synthase
[NEET (2023)]
(c) PS-II to Cytb6 f complex
5. Which one of the following is not true regarding the
(d) Cytb6 complex to PS-I
release of energy during ATP synthesis through
[NEET (2020)]
chemiosmosis? It involves:
11. The oxygenation activity of RuBisCO enzyme in
(a) Development of proton gradient
photorespiration leads to the formation of
(b) Development of electron gradient
(a) 1 molecule of 6-C compound
(c) Movement of protons across the membrane to the
(b) 1 molecule of 4-C compound and 1 molecule of 2-
stroma
C compound
(d) Reduction of NADP to NADPH2 on the stroma side (c) 2 molecules of 3-C compound
of the membrane (d) 1 molecule of 3-C compound and 1 molecule of 2-
[NEET (2022)] C compound
6. Given below are two statements: [NEET (2020)]
Statement I : The primary CO2 acceptor in C4 plants is 12. Which of the following is not a product of the light
phosphoenolpyruvate and is found in the mesophyll reaction of photosynthesis?
cells. (a) NADPH (b) NADH
Statement II : Mesophyll cells of C4 plants lack RuBisCo (c) ATP (d) Oxygen
enzyme. [NEET (2018)]
In the light of the above statements, choose the correct 13. Oxygen is not produced during photosynthesis by
answer from the options given below: (a) Cycas
(a) Both Statement I and Statement II are correct (b) Nostoc
(b) Both Statement I and Statement II are incorrect (c) Green sulphur bacteria
(d) Chara
[NEET (2018)]
14. Phosphoenolpyruvate (PEP) is the primary CO2 21. Emerson’s enhancement effect and Red drop have been
acceptor in instrumental in the discovery of:
(a) C2 plants (b) C3 and C4 plants (a) Photophosphorylation and non-cyclic electron
(c) C3 plants (d) C4 plants transport
[NEET (2017)] (b) Two photosystems operating simultaneously
15. With reference to factors affecting the rate of (c) Photophosphorylation and cyclic electron transport
photosynthesis, which of the following statements is not (d) Oxidative phosphorylation
correct? [NEET (2016-I)]
(a) C3 plants respond to higher temperatures with 22. In photosynthesis, the light-independent reactions take
enhanced photosynthesis while C4 plants have much place at
lower temperature optimum (a) Thylakoid lumen
(b) Tomato is a greenhouse crop that can be grown in (b) Photosystem I
CO2 enriched atmosphere for higher yield (c) Photosystem II
(c) Light saturation for CO2 fixation occurs at 10% of (d) Stromal matrix
full sunlight [NEET (2015)]
(d) Increasing atmospheric CO2 concentration up to 23. The oxygen evolved during photosynthesis comes from
0.05% can enhance CO2 fixation rate water molecules. Which one of the following pairs of
[NEET (2017)] elements is involved in this reaction?
16. Phytochrome is a (a) Manganese and chlorine
(a) Glycoprotein (b) Lipoprotein (b) Manganese and potassium
(c) Chromoprotein (d) Flavoprotein (c) Magnesium and molybdenum
[NEET (2016-II)] (d) Magnesium and chlorine
17. The process which makes major difference between C3 [NEET (2015)]
and C4 plants is 24. Anoxygenic photosynthesis is characteristic of
(a) Calvin cycle (a) Spirogyra (b) Chlamydomonas
(b) Photorespiration (c) Ulva (d) Rhodospirillum
(c) Respiration [NEET (2014)]
(d) Glycolysis 25. CAM helps the plants in :
[NEET (2016-II)] (a) Reproduction
18. Water vapour comes out from the plant leaf through the (b) Conserving water
stomatal opening. Through the same stomatal opening, (c) Secondary growth
carbon dioxide diffuses into the plant during (d) Disease resistance
photosynthesis. Reason out the above statements using
[NEET (2011)]
one of following options:
(a) Both processes cannot happen simultaneously. 26. PGA as the first CO2 fixation product was discovered in
(b) Both processes can happen together because the photosynthesis of –
diffusion coefficient of water and CO2 is different. (a) Bryophyte (b) Gymnosperm
(c) The above processes happen only during night time. (c) Angiosperm (d) Algae
(d) One process occurs during day time and the other at [NEET (2010)]
night. 27. C4 plants are more efficient in photosynthesis than C3
[NEET (2016-I)] plants due to –
19. A plant in your garden avoids photorespiratory losses, (a) Higher leaf area
has improved water use efficiency, shows high rates of (b) Presence of large number of chloroplasts in the leaf
photosynthesis at high temperatures and has improved cells
efficiency of nitrogen utilization. In which of the (c) Presence of thin cuticle
following physiological groups would you assign this (d) Lower rate of photorespiration
plant? [NEET (2010)]
(a) C3 (b) C4 28. Oxygenic photosynthesis occurs in :
(c) CAM (d) Nitrogen fixer (a) Chlorobium (b) Chromatium
[NEET (2016-I)] (c) Oscillatoria (d) Rhodospirillum
20. In a chloroplast, the highest number of protons are found [NEET (2009)]
in 29. Cyclic photophosphorylation results in the formation
(a) Stroma of :
(b) Lumen of thylakoids (a) ATP
(c) Inter-membrane space (b) NADPH
(d) Antennae complex (c) ATP and NADPH
[NEET (2016-I)] (d) ATP, NADPH and O2
[NEET (2009)]
30. In leaves of C-4 plants malic acid synthesi during CO2 37. In the leaves of C4 plants, malic acid formation during
fixation occurs in: CO2 fixation occurs in the cells of :
(a) Bundle sheath (b) Guard cells (a) Epidermis (b) Mesophyll
(c) Epidermal cells (d) Mesophyll cells (c) Bundle Sheath (d) Phloem
[NEET (2008)] [NEET (2007)]
31. The chemiosmotic coupling hypothesis of oxidative 38. In photosystem-I, the first electron acceptor is-
phosphorylation proposes that Adenosine Tri-Phosphate (a) Ferredoxin
(ATP) is formed because: (b) Cytochrome
(a) A proton gradient forms across the inner membrane (c) Plastocyanin
(b) There is a change in the permeability of the inner (d) An iron sulphur protein
mitochondrial membrane toward Adenosine Di- [NEET (2006)]
Phosphate (ADP) 39. During photorespiration the oxygen consuming reaction
(c) High energy bonds are formed in mitochondrial (s) occur in-
proteins (a) Stroma of chloroplasts and mitochondria
(d) ADP is pumped out of the matrix into the (b) Stroma of chloroplasts and peroxisomes
intermembrane space (c) Grana of chloroplasts and peroxisomes
[NEET (2008)] (d) Stroma of chloroplasts
32. The C4 plants are photosynthetically more efficient than [NEET (2006)]
C3 plants because: 40. As compared to a C3-plant, how many additional
(a) The CO2 efflux is not prevented molecules of ATP are needed for net production of one
(b) They have more chloroplasts molecule of hexose sugar by C4-plants -
(c) The CO2 compensation point is more (a) Zero (b) Six
(d) CO2 generated during photorespiration istrapped (c) Two (d) Twelve
and recycled through PEP carboxylase [NEET (2005)]
[NEET (2008)] 41. Photosynthesis in C4 plants is relatively less limited by
33. Electrons from excited chlorophyll molecule of atmospheric CO2 levels because
photosystem II are accepted first by: (a) The primary fixation of CO2 is mediated via PEP
(a) Quinone (b) Ferredoxin carboxylase
(c) Cytochrome-b (d) Cytochrome-f (b) Effective pumping of CO2 into bundle sheath cells
[NEET (2008)] (c) Four carbon acids are the primary initial CO2
34. The first acceptor of electrons from an excited fixation products
chlorophyll molecule of photosystem II is:- (d) Rubisco in C4 plants has higher affinity for CO2
(a) Quinone (b) Cytochrome [NEET (2005)]
(c) Iron-sulphur protein (d) Ferredoxin 42. Photosynthetic Active Radiation (PAR) has the
[NEET (2007)] following range of wavelengths
35. All enzymes of TCA cycle are located in the (a) 340-450 nm (b) 450-950 nm
mitochondrial matrix except one which is located in (c) 500-600 nm (d) 400-700 nm
inner mitochondrial membranes in eukaryotes and in [NEET (2005)]
cytosol in prokaryotes. This enzyme is:- 43. In C3 plants, the first stable product of photosynthesis
(a) Succinate dehydrogenase during the dark reaction is :-
(b) Lactate dehydrogenase (a) Oxaloacetic acid
(c) Isocitrate dehydrogenase (b) 3-phosphoglyceric acid
(d) Malate dehydrogenase (c) Phosphoglyceraldehyde
[NEET (2007)] (d) Malic acid
36. The wavelength of light absorbed by Pr form of [NEET (2004)]
phytochrome is:- 44. Photosynthetically active radiation (PAR) represents the
(a) 620 nm (b) 640 nm following range of wave length
(c) 680 nm (d) 720 nm (a) 450-950 nm (b) 340-450 nm
[NEET (2007)] (c) 400-700 nm (d) 500-600 nm
[NEET (2004)]
RESPIRATION IN PLANTS 52
RESPIRATION IN PLANTS
1. Given below are two statements: One is labelled as (c) Mitochondrial matrix contains single circular DNA
Assertion A and the other is labelled as Reason R. molecule and ribosomes
Assertion A: ATP is used at two steps in glycolysis. (d) Outer membrane is permeable to monomers of
Reason R: First ATP is used in converting glucose into carbohydrates, fats and proteins
glucose-6-phosphate and second ATP is used in [NEET (2019)]
conversion of fructose-6-phosphate into fructose-1-6- 8. Respiratory Quotient (RQ) value of tripalmitin is
diphosphate. (a) 0.7 (b) 0.07
In the light of the above statements, choose the correct (c) 0.09 (d) 0.9
answer from the options given below: [NEET (2019)]
(a) Both A and R are true, but R is NOT the correct 9. Which of these statements is incorrect?
explanation of A. (a) Glycolysis occurs in cytosol
(b) A is true, but R is false. (b) Glycolysis operates as long as it is supplied with
(c) A is false, but R is true. NAD that can pick up hydrogen atoms
(d) Both A and R are true, and R is the correct (c) Enzymes of TCA cycle are present in mitochondrial
explanation of A. matrix
(d) Oxidative phosphorylation takes place in the outer
[NEET (2023)]
mitochondrial membrane
2. What amount of energy is released from glucose during
[NEET (2018)]
lactic acid fermentation?
10. What is the role of NAD+ in cellular respiration?
(a) Approximately 15%
(a) It is a nucleotide source for ATP synthesis
(b) More than 18%
(b) It functions as an electron carrier
(c) About 10%
(c) It functions as an enzyme
(d) Less than 7% (d) It is the final electron acceptor for anaerobic
[NEET (2022)] respiration
3. What is the net gain of ATP when each molecule of [NEET (2018)]
glucose is converted to two molecules of pyruvic acid? 11. Which statement is wrong for Krebs' cycle?
(a) Four (b) Six (a) During the conversion of succinyl CoA to succinic
(c) Two (d) Eight acid, a molecule of GTP is synthesised
[NEET (2022)] (b) The cycle starts with the condensation of an acetyl
4. Which of the following statements is incorrect? group (acetyl CoA) with pyruvic acid to yield citric
(a) ATP is synthesized through complex V acid
(b) Oxidation-reduction reactions produce proton (c) There are three points in the cycle where NAD+ is
gradients in respiration. reduced to NADH + H+
(c) During aerobic respiration, role of oxygen is limited (d) There is one point in the cycle where FAD+ is
to the terminal stage reduced to FADH2
(d) In ETC (Electron Transport Chain), one molecule of [NEET (2017)]
NADH gives rise to 2 ATP molecules, and one FADH2 12. Which of the following biomolecules is common to
gives rise to 3 ATP molecules respiration mediated breakdown of fats, carbohydrates
[NEET (2021)] and proteins?
5. The number of substrate-level phosphorylations in one (a) Fructose 1, 6-bisphosphate
turn of citric acid cycle is (b) Pyruvic acid
(a) Two (b) Three (c) Acetyl CoA
(c) Zero (d) One (d) Glucose-6-phosphate
[NEET (2020)] [NEET (2016-II)]
6. Conversion of glucose to glucose-6-phosphate, the first 13. Oxidative phosphorylation is
irreversible reaction of glycolysis, is catalyzed by (a) Oxidation of phosphate group in ATP
(a) Hexokinase (b) Enolase (b) Addition of phosphate group to ATP
(c) Phosphofructokinase (d) Aldolase (c) Formation of ATP by energy released from
[NEET (2019)] electrons removed during substrate oxidation
7. Which of the following statements regarding (d) Formation of ATP by transfer of phosphate group
mitochondria is incorrect: from a substrate to ADP
(a) Enzymes of electron transport are embedded in outer [NEET (2016-II)]
membrane
(b) Inner membrane is convoluted with infoldings
14. Which of the following biomolecules is common to 20. Aerobic respiratory pathway is appropriately termed :-
respiration mediated breakdown of fats, carbohydrates (a) Anabolic (b) Catabolic
and proteins? (c) Parabolic (d) Amphibolic
(a) Fructose 1, 6-bisphosphate [NEET (2009)]
(b) Pyruvic acid 21. The energy-releasing process in which the substrate is
(c) Acetyl CoA oxidized without an external electron acceptor is called:
(d) Glucose-6-phosphate (a) Aerobic respiration
[NEET (2016-II)] (b) Glycolysis
15. In which one of the following processes CO2 is not (c) Fermentation
released? (d) Photorespiration
(a) Aerobic respiration in animals [NEET (2008)]
(b) Alcoholic fermentation 22. The overall goal of glycolysis, Krebs cycle and the
(c) Lactate fermentation electron transport system is the formation of:-
(d) Aerobic respiration in plants (a) Nucleic acids
[NEET (2014)] (b) ATP in small stepwise units
16. In which one of the following processes CO2 is not (c) ATP in one large oxidation reaction
released? (d) Sugars
(a) Aerobic respiration in animals [NEET (2007)]
(b) Alcoholic fermentation 23. How many ATP molecules could maximally be
(c) Lactate fermentation generated from one molecule of glucose, if the complete
(d) Aerobic respiration in plants oxidation of one mole of glucose to CO2 and H2O yields
[NEET (2014)] 686 kcal and the useful chemical energy available in the
17. Which of the metabolites is common to respiration high energy phosphate bond of one mole of ATP is 12
mediated breakdown of fats, carbohydrates and kcal ?
proteins? (a) Two (b) Thirty
(a) Glucose-6-phosphate (c) Fifty-seven (d) One
(b) Fructose 1, 6-bisphosphate [NEET (2006)]
(c) Pyruvic acid 24. During which stage in the complete oxidation of glucose
(d) Acetyl CoA are the greatest number of ATP molecules formed from
[NEET (2013)] ADP -
18. The three boxes in this diagram represent the three major (a) Glycolysis
biosynthetic pathways in aerobic respiration. Arrows (b) Krebs cycle
represent net reactants or products (c) Electron transport chain
(d) Conversion of pyruvic acid to acetyl CoA
[NEET (2005)]
25. G-6-P dehydrogenase deficiency is associated with
haemolysis of -
(a) Leucocytes (b) Lymphocytes
Arrows numbered 4, 8, and 12 can all be
(c) Platelets (d) RBCs
(a) NADH (b) ATP
[NEET (2005)]
(c) H2O (d) FAD+ or FADH2
26. In glycolysis, during oxidation electrons are removed
[NEET (2013)]
by -
19. The energy-releasing metabolic process in which
(a) Glyceraldehyde-3-phosphate
substrate is oxidised without an external electron
(b) NAD+
acceptor is called –
(c) Molecular oxygen
(a) Glycolysis
(d) ATP
(b) Fermentation
[NEET (2004)]
(c) Aerobic respiration
(d) Photorespiration
[NEET (2010)]
PLANT GROWTH AND DEVELOPMENT 54
PLANT GROWTH AND DEVELOPMENT

1. Spraying of which of the following phytohormone or (b) Para-ascorbic acid
juvenile conifers helps in hastening the maturity period, (c) Gibberellic acid
that leads to early seed production? (d) Abscisic acid
(a) Gibberellic acid [NEET (2020)]
(b) Zeatin 10. The process of growth is maximum during
(c) Abscisic acid (a) Senescence (b) Dormancy
(d) Indole-3-butyric acid (c) Log phase (d) Lag phase
[NEET (2020)]
[NEET (2023)]
11. Name the plant growth regulators which upon spraying
2. Which hormone promotes internode/petiole elongation
on sugarcane crop, increases the length of stem, thus
in deep water rice?
increasing the yield of sugarcane crop.
(a) Kinetin (b) Ethylene
(a) Ethylene (b) Abscisic acid
(c) 2,4-D (d) GA3
(c) Cytokinin (d) Gibberellin
[NEET (2023)]
[NEET (2020)]
3. The gaseous plant growth regulator is used in plants to:
12. It takes a very long time for pineapple plants to produce
(a) Speed up the malting process
flowers. Which combination of hormones can be applied
(b) Promote root growth and root hair formation to
to artificially induce flowering in pineapple plants
increase the absorption surface
throughout the year to increase yield?
(c) Help overcome apical dominance
(a) Gibberellin and Cytokinin
(d) Kill dicotyledonous weeds in the fields (b) Gibberellin and Abscisic acid
[NEET (2022)] (c) Cytokinin and Abscisic acid
4. Which one of the following plants does not show (d) Auxin and Ethylene
plasticity? [NEET (2019)]
(a) Cotton 13. What is the site of perception of photoperiod necessary
(b) Coriander for induction of flowering in plants?
(c) Buttercup (a) Pulvinus (b) Shoot apex
(d) Maize (c) Leaves (d) Lateral buds
[NEET (2022)] [NEET (2019)]
5. Production of Cucumber has increased manifold in 14. Fruit and leaf drop at early stages can be prevented by
recent years. Application of which of the following the application of
phytohormones has resulted in this increased yield as the (a) Auxins
hormone is known to produce female flowers in the (b) Gibberellic acid
plants? (c) Cytokinins
(a) ABA (b) Gibberellin (d) Ethylene
(c) Ethylene (d) Cytokinin [NEET (2017)]
[NEET (2022)] 15. You are given a tissue with its potential for
6. The plant hormone used to destroy weeds in a field is differentiation in an artificial culture. Which of the
(a) 2, 4-D (b) IBA following pairs of hormones would you add to the
(c) IAA (d) NAA medium to secure shoots as well as roots?
[NEET (2021)] (a) Cytokinin and auxin
7. Plants follow different pathways in response to the (b) Auxin and abscisic acid
environment or phases of life to form different kinds of (c) Gibberellin and abscisic acid
structures. This ability is called (d) IAA and gibberellin
(a) Plasticity (b) Maturity [NEET (2016-II)]
(c) Elasticity (d) Flexibility 16. The Avena curvature is used for bioassay of:
[NEET (2021)] (a) ABA (b) GA3
8. The site of perception of light in plants during (c) IAA (d) ethylene
photoperiodism is [NEET (2016-I)]
(a) Axillary bud (b) Leaf 17. Auxin can be bioassayed by
(c) Shoot apex (d) Stem (a) Avena coleoptile curvature
[NEET (2021)] (b) Hydroponics
9. Which of the following is not an inhibitory substance (c) Potometer
governing seed dormancy? (d) Lettuce hypocotyl elongation
(a) Phenolic acid [NEET (2015)]
18. Dr.F. Went noted that if coleoptile tips were removed 28. Which one of the following acids is a derivative of
and placed on agar for one hour, the agar would produce carotenoids ?
a bending when placed on one side of freshly cut (a) Abscisic acid
coleoptile stumps. Of what significance is this (b) Indole butyric acid
experiment? (c) Indole-3-acetic acid
(a) It is the basis for quantitative determination of small (d) Gibberellic acid
amounts of growth promoting substances [NEET (2009)]
(b) It supports the hypothesis that IAA is auxin 29. Senescence as an active developmental cellular process
(c) It demonstrated polar movement of auxins in the growth and functioning of a flowering plant, is
(d) It made possible the isolation and exact indicated in:
identification of auxin (a) Annual plants
[NEET (2014)] (b) Floral parts
19. Which one of the following growth regulators is known (c) Vessels and tracheid differentiation
as ‘stress hormone’? (d) Leaf abscission
(a) Ethylene (b) GA3 [NEET (2008)]
(c) Indole acetic acid (d) Abscisic acid 30. Importance of day length in flowering of plants was first
[NEET (2014)] shown in:
20. A few normal seedlings of tomato were kept in a dark (a) Cotton (b) Petunia
room. After a few days they were found to have become (c) Lemna (d) Tobacco
white-coloured lime albinos. Which of the following [NEET (2008)]
terms will you use to describe them? 31. "Foolish Seedling" disease of rice led to the discovery
(a) Embolised (b) Etiolated of :-
(c) Defoliated (d) Mutated (a) IAA (b) GA
[NEET (2014)] (c) ABA (d) 2, 4-D
21. During seed germination, its stored food is mobilized by [NEET (2007)]
(a) Ethylene (b) Cytokinin 32. Opening of floral buds into flowers, is a type of:
(c) ABA (d) Gibberellin (a) Autonomic movement of growth
[NEET (2013)] (b) Autonomic movement of locomotion
22. Through their effect on plant growth regulators, what do (c) Autonomic movement of variation
the temperature and light control in the plants? (d) Paratonic movement of growth
(a) Flowering [NEET (2007)]
(b) Closure of stomata 33. Which one of the following pairs, is not correctly
(c) Fruit elongation matched ?
(d) Apical dominance (a) IAA – Cell wall elongation
(b) Abscissic acid – Stomatal closure
[NEET (2012)]
(c) Gibberellic acid – Leaf fall
23. Vernalisation stimulates flowering in- (d) Cytokinin – Cell division
(a) Turmeric (b) Carrot [NEET (2007)]
(c) Ginger (d) Zamikand 34. Differentiation of organs and tissues in a developing
[NEET (2012)] organism, is associated with-
24. Which one of the following generally acts as an (a) Deletion of genes
antagonist to gibberellins ? (b) Developmental mutations
(a) Ethylene (b) ABA (c) Differential expression of genes
(c) IAA (d) Zeatin (d) Lethal mutations
[NEET (2012)] [NEET (2007)]
25. Phototropic curvature is the result of uneven distribution 35. How does pruning help in making the hedge dense ?
of – (a) It induces the differentiation of new shoots from the
(a) Gibberellin (b) Phytochrome rootstock
(c) Cytokinins (d) Auxin (b) It frees axillary buds from apical dominance
[NEET (2010)] (c) The apical shoot grows faster after pruning
26. Photoperiodism was first characterised in – (d) It released wound hormones
(a) Tobacco (b) Potato [NEET (2006)]
(c) Tomato (d) Cotton 36. Farmers in a particular region were concerned that pre-
[NEET (2010)] mature yellowing of leaves of a pulse crop might cause
27. One of the synthetic auxin is : decrease in the yield. Which treatment could be most
(a) IBA (b) NAA beneficial to obtain maximum seed yield ?
(c) IAA (d) GA (a) Frequent irrigation of the crop
[NEET (2009)]
(b) Treatment of the plants with cytokinins alongwith a 40. One set of a plant was grown at 12 hours day and 12
small dose of nitrogenous fertilizer hours night period cycles and it flowered while in the
(c) Removal of all yellow leaves and spraying the other set night phase was interrupted by flash of light
remaining green leaves with 2,4,5-trichlorophenoxy and it did not produce flower. Under which one of the
acetic acid following categories will you place this plant ?
(d) Application of iron and magnesium to promote (a) Darkness neutral (b) Day neutral
synthesis of chlorophyll (c) Short day (d) Long day
[NEET (2006)] [NEET (2004)]
37. Treatment of seed at low temperature under moist 41. Cell elongation in internodal regions of the green plants
conditions to break its dormancy is called - takes place due to :-
(a) Sclarification (b) Vernalization (a) Cytokinins
(c) Chelation (d) Stratification (b) Gibberellins
[NEET (2006)] (c) Ethylene
38. An enzyme that can stimulate germination of barley (d) Indole acetic acid
seeds is- [NEET (2004)]
(a) α- amylase (b) Lipase 42. Plants adapted to low light intensity have :-
(c) Protease (d) Invertase (a) Higher rate of CO2 fixation than the sun plants
[NEET (2006)] (b) More extended root system
39. Anthesis is a phenomenon which refers to - (c) Leaves modified to spines
(a) Formation of pollen (d) Larger photosynthetic unit size than the sun plants
(b) Development of anther [NEET (2004)]
(c) Opening of flower bud
(d) Reception of pollen by stigma
[NEET (2004)]
BREATHING AND EXCHANGE OF GASES 57
BREATHING AND EXCHANGE OF GASES

1. Vital capacity of lung is______. (a) (i), (ii) and (iv)
(a) IRV + ERV + TV + RV (b) Only (iv)
(b) IRV + ERV + TV - RV (c) (i) and (ii)
(c) IRV + ERV + TV (d) (iii) and (iv)
(d) IRV + ERV [NEET (2020)]
8. Tidal Volume and Expiratory Reserve Volume of an
[NEET (2023)]
athlete is 500 mL and 1000 mL respectively. What will
2. Which of the following is not the function of the be his Expiratory Capacity if the Residual Volume is
conducting part of the respiratory system? 1200 mL?
(a) It clears inhaled air from foreign particles (a) 1700 mL (b) 2200 mL
(b) Inhaled air is humidified (c) 2700 mL (d) 1500 mL
(c) Temperature of inhaled air is brought to body [NEET (2019)]
temperature 9. Which of the following is an occupational respiratory
(d) Provides surface for diffusion of O2 and CO2 disorder?
[NEET (2022)] (a) Silicosis
3. Under normal physical conditions in human beings (b) Botulism
every 100 ml oxygenated blood can deliver____ml of O2 (c) Anthracis
to the tissues. (d) Emphysema
(a) 2 ml (b) 5 ml [NEET (2018)]
(c) 4 ml (d) 10 ml 10. Match the items given in Column I with those in Column
[NEET (2022)] II and select the correct option given below:
4. The partial pressures (in mmHg) of oxygen (O 2 ) and
carbon dioxide (CO2 ) at alveoli (the site of diffusion) Column I Column II
are: a Tidal Volume (i) 2500-3000
(a) pO2 = 95 and pCO2 = 40 mL
(b) pO2 = 159 and pCO2 = 0.3 b Inspiratory Reserve (ii) 1100-1200
(c) pO2 = 104 and pCO2 = 40 volume mL
(d) pO2 = 40 and pCO2 = 45 c Expiratory Reserve (iii) 500-550 mL
[NEET (2021)] volume
5. Select the favourable conditions required for the
d Residual Volume (iv) 1000-1100
formation of oxyhaemoglobin at the alveoli.
(a) High pO2, high pCO2, less H+, higher temperature mL
(b) Low pO2 , low pCO2 , more H+ , higher temperature
(c) High pO2 , low pCO2 , less H+ , lower temperature (a) a → (iii); b → (i); c → (iv); d → (ii)
(d) Low pO2 , high pCO2 , more H+ , higher (b) a → (i); b → (iv); c → (ii); d → (iii)
temperature (c) a → (iii); b → (ii); c → (i); d → (iv)
[NEET (2021)] (d) a → (iv); b → (iii); c → (ii); d → (i)
6. Identify the wrong statement with reference to transport [NEET (2018)]
of oxygen. 11. Which of the following options correctly represents the
(a) Higher H+ conc. in alveoli favours the formation of lung conditions in asthma and emphysema,
oxyhaemoglobin respectively?
(b) Low pCO2 in alveoli favours the formation of (a) Increased respiratory surface; Inflammation of
oxyhaemoglobin bronchioles
(c) Binding of oxygen with haemoglobin is mainly (b) Increased number of bronchioles; Increased
related to partial pressure of O2 respiratory surface
(d) Partial pressure of CO2 can interfere with O2 binding (c) Inflammation of bronchioles; Decreased respiratory
with haemoglobin surface
[NEET (2020)] (d) Decreased respiratory surface; Inflammation of
7. Select the correct events that occur during inspiration. bronchioles
(i) Contraction of diaphragm [NEET (2018)]
(ii) Contraction of external inter-costal muscles 12. Lungs are made up of air-filled sacs, the alveoli. They
(iii) Pulmonary volume decreases do not collapse even after forceful expiration, because
(iv) Intra pulmonary pressure increases of
(a) Tidal Volume

(b) Expiratory Reserve Volume
(c) Residual Volume
(d) Inspiratory Reserve Volume
[NEET (2017)]
13. Lungs do not collapse between breaths and some air
always remains in the lungs which can never be expelled
because
(a) There is a negative intrapleural pressure pulling at
the lung walls
(b) There is a positive intrapleural pressure
(c) Pressure in the lungs is higher than the atmospheric (a) A – trachea-long tube supported by complete
pressure cartilaginous rings for conducting inspired air
(d) There is a negative pressure in the lungs (b) B – pleural membrane – surround ribs on both sides
[NEET (2016-II)] to provide cushion against rubbing
14. The partial pressure of oxygen in the alveoli of the lungs (c) C – Alveoli – thin walled vascular bag like
is structures for exchange of gases
(a) More than that in the blood (d) D – Lower end of lungs – diaphragm pulls it down
(b) Less than that in the blood during inspiration
(c) Less than that of carbon dioxide [NEET (2013)]
(d) Equal to that in the blood 20. The figure given below shows a small part of human
[NEET (2016-II)] lung where exchange of gases takes place. In which one
15. Asthma may be attributed to of the options given below, the one part A, B, C or D is
(a) Bacterial infection of the lungs correctly identified along with its function,
(b) Allergic reaction of the mast cells in the lungs
(c) Inflammation of the trachea
(d) Accumulation of fluid in the lungs
[NEET (2016-I)]
16. Name the chronic respiratory disorder caused mainly by
cigarette smoking.
(a) Emphysema (a) B : red blood cell – transport of CO2 mainly
(b) Asthma (b) C : arterial capillary – passes oxygen to tissues
(c) Respiratory acidosis (c) A : alveolar cavity – main site of exchange of
(d) Respiratory alkalosis respiratory gases
[NEET (2016-I)] (d) D : Capillary wall – exchange of O2 and CO2 takes
17. Name the pulmonary disease in which alveolar surface place here
area involved in gas exchange is drastically reduced due
[NEET (2011)]
to damage in the alveolar walls.
(a) Pleurisy 21. Listed below are four respiratory capacities (a-d) and
(b) Emphysema four jumbled respiratory volumes of a normal human
(c) Pneumonia adult:
(d) Asthma
[NEET (2015)] Respiratory capacities Respiratory
18. Approximately seventy percent of carbon dioxide volumes
absorbed by the blood will be transported to the lungs (a) Residual volume 2500 mL.
(a) In the form of dissolved gas molecules (b) Vital capacity 3500 mL
(b) By binding to RBC
(c) Inspiratory reserve 1200 mL
(c) As carbamino haemoglobin
(d) As bicarbonate ions volume
[NEET (2014)] (d) Inspiratory capacity 4500 mL
19. The figure shows a diagrammatic view of the human Which one of the following is the correct matching of
respiratory system with labels A, B, C and D. Select the two capacities and volumes?
option which gives correct identification and main (a) (b) 2500 mL, (c) 4500 mL
function and/ or characteristic. (b) (c) 1200 mL, (d) 2500 mL
(c) (d) 3500 mL, (a) 1200 mL
(d) (a) 4500 mL, (b) 3500 mL
[NEET (2010)]
22. What is vital capacity of our lungs? (b) The presence of non-respiratory air sacs, increases
(a) Inspiratory reserve volume plus expiratory reserve the efficiency of respiration in birds
volume (c) In insects, circulating body fluids serve to distribute
(b) Total lung capacity minus residual volume oxygen to tissues
(c) Inspiratory reserve volume plus tidal volume (d) The principle of countercurrent flow facilitates
(d) Total lung capacity minus expiratory reserve volume efficient respiration in gills of fishes
[NEET (2006)]
[NEET (2008)]
26. The majority of carbon dioxide produced by our body
23. The haemoglobin of a human foetus:
cells is transported to the lungs-
(a) Has only 2 protein subunits instead of 4
(a) Dissolved in the blood
(b) Has a higher affinity for oxygen than that of an
(b) As bicarbonates
adult
(c) As carbonates
(c) Has a lower affinity for oxygen than that of an adult
(d) Attached to hemoglobin
(d) Its affinity for oxygen is the same as that of an adult [NEET (2006)]
[NEET (2008)] 27. When CO2 concentration in blood increases, breathing
24. People living at sea level have around 5 million RBC per becomes -
cubic millimeter of their blood whereas those living at (a) There is no effect on breathing
an altitude of 5400 metres have around 8 million. This (b) Slow and deep
is because at high altitude- (c) Faster and deeper
(a) People get pollution-free air to breathe and more (d) Shallower and slow
oxygen is available [NEET (2004)]
(b) Atmospheric O2 level is less and hence more RBCs 28. Blood analysis of a patient reveals an unusually high
are needed to absorb the required amount of O2 to quantity of carboxy-haemoglobin content. Which of the
survive following conclusions is most likely to be correct ? The
(c) There is more UV radiation which enhances RBC patient has been inhaling polluted air containing
production unusually high content of -
(d) People eat more nutritive food, therefore more (a) Chloroform
RBCs are formed (b) Carbon dioxide
[NEET (2006)] (c) Carbon monoxide
25. Which one of the following statements is incorrect ? (d) Carbon disulphide
(a) The residual air in lungs slightly decreases the [NEET (2004)]
efficiency of respiration in mammals
BODY FLUIDS AND CIRCULATION 60
BODY FLUIDS AND CIRCULATION

1. Match List I with List II: (d) Increased ventricular pressure causes closing of the
semilunar valves
List I List II [NEET (2022)]
A. P-wave I. Beginning of systole 5. Which enzyme is responsible for the conversion of
B. Q-wave II. Repolarisation of ventricles inactive fibrinogens to fibrins?
C. QRS III. Depolarisation of complex (a) Epinephrine
(b) Thrombokinase
atria
(c) Thrombin
D. T-wave IV. Depolarisation of ventricles (d) Renin
[NEET (2021)]
Choose the correct answer from the options given 6. Persons with “AB” blood group are called “Universal
below: recipients”. This is due to
(a) A–IV, B–III, C–II, D–I (a) Presence of antibodies, anti-A and anti-B, on RBCs
(b) A–II, B–IV, C–I, D–III (b) Absence of antibodies, anti-A and anti-B, in plasma
(c) A–I, B–II, C–III, D–IV (c) Absence of antigens A and B on the surface of
(d) A–III, B–I, C–IV, D–II RBCs
[NEET (2023)] (d) Absence of antigens A and B in plasma
[NEET (2021)]
2. Which of the following statements are correct? 7. Match the following columns and select the correct
A. Basophils are the most abundant cells of the total option.
WBCs.
B. Basophils secrete histamine, serotonin and heparin. Column I Column II
C. Basophils are involved in inflammatory response.
(a) Eosinophils (i) Immune response
D. Basophils have kidney-shaped nucleus.
E. Basophils are agranulocytes. (b) Basophils (ii) Phagocytosis
Choose the correct answer from the options given (c) Neutrophils (iii) Release histaminases,
below: destructive Enzymes
(a) C and E only (d) (iv) Release granules containing
(b) B and C only
Lymphocytes histamine
(c) A and B only
(d) D and E only
[NEET (2023)] (a) a – i; b – ii; c – iv; d – iii
3. Given below are two statements: (b) a – ii; b – i; c – iii; d – iv
Statement I: The coagulum is formed of a network of (c) a – iii; b – iv; c – ii; d – i
threads called thrombins. (d) a – iv; b – i; c – ii; d – iii
Statement II: Spleen is the graveyard of erythrocytes. [NEET (2020)]
In the light of the above statements, choose the most 8. The QRS complex in a standard ECG represents
appropriate answer from the options given below: (a) Depolarisation of ventricles
(a) Both Statement I and Statement II are correct (b) Repolarisation of ventricles
(b) Both Statement I and Statement II are incorrect (c) Repolarisation of auricles
(c) Statement I is correct but Statement II is incorrect (d) Depolarisation of auricles
[NEET (2020)]
(d) Statement I is incorrect but Statement II is correct 9. What would be the heart rate of a person if the cardiac
[NEET (2022)] output is 5L, blood volume in the ventricles at the end
4. Which one of the following statements is correct? of diastole is 100 mL and at the end of ventricular
(a) The atrioventricular node (AVN) generates an action systole is 50 mL.
potential to stimulate atrial contraction (a) 75 beats per minute
(b) The tricuspid and the bicuspid valves open due to (b) 100 beats per minute
the pressure exerted by the simultaneous contraction of (c) 125 beats per minute
the atria (d) 50 beats per minute
(c) Blood moves freely from atrium to the ventricle [NEET (2019)]
during joint diastole
10. Match the Column-I with Column-II 14. The hepatic portal vein drains blood to the liver from
Column-I Column-II (a) Kidneys (b) Intestine
A P-wave (i) Depolarisation of (c) Heart (d) Stomach
ventricles [NEET (2017)]
15. Serum differs from blood in
B QRS complex (ii) Repolarisation of (a) Lacking albumins
ventricles (b) Lacking clotting factors
C T-wave (iii) Coronary ischemia (c) Lacking antibodies
D Reduction in the (iv) Depolarisation of (d) Lacking globulins
size of T-wave atria [NEET (2016-II)]
16. Name the blood cells, whose reduction in number can
(v) Repolarisation of
cause clotting disorder, leading to excessive loss of
atria blood from the body.
Select the correct option. (a) Leucocytes (b) Neutrophils
(a) A – (iv), B – (i), C – (ii), D – (v) (c) Thrombocytes (d) Erythrocytes
(b) A – (ii), B – (i), C – (v), D – (iii) [NEET (2016-II)]
(c) A – (ii), B – (iii), C – (v), D – (iv) 17. Blood pressure in the pulmonary artery is:
(d) A – (iv), B – (i), C – (ii), D – (iii) (a) Same as that in the aorta
[NEET (2019)] (b) More than that in the carotid
11. Match the items given in column I with those in Column (c) More than that in the pulmonary vein
II and select the correct option given below. (d) Less than that in the venae cavae.
Column I Column II [NEET (2016-I)]
(a) Fibrinogen (i) Osmotic balance 18. Reduction in pH of blood will:
(b) Globulin (ii) Blood clotting (a) Reduce the rate of heart beat.
(b) Reduce the blood supply to the brain.
(c) Albumin (iii) Defence mechanism
(c) Decrease the affinity of hemoglobin with oxygen.
(a) a → (i); b → (ii); c → (iii) (d) Increase the affinity of hemoglobin with oxygen.
(b) a → (i); b → (iii); c → (ii) [NEET (2016-I)]
(c) a → (iii); b → (ii); c → (i) 19. Doctors use stethoscopes to hear the sounds produced
(d) a → (ii); b → (iii); c → (i) during each cardiac cycle. The second sound is heard
[NEET (2018)] when
12. Match the items given in Column I with those in Column (a) AV valves open up.
II and select the correct option given below. (b) Ventricular walls vibrate due to gushing in of blood
Column I Column II from atria.
(a) Tricuspid (i) Between left atrium and (c) Semilunar valves close down after the blood flows
valve left ventricle into vessels from ventricles.
(b) Bicuspid (ii) Between right ventricle (d) AV node receives signal from SA node.
valve and pulmonary artery [NEET (2015)]
20. Person with blood group AB is considered as universal
(c) Semilunar (iii) Between right atrium and recipient because he has:
valve right ventricle (a) Both A and B antibodies in the plasma.
(b) No antigen on the RBC and no antibody in the
(a) a → (i); b → (iii); c → (ii) plasma.
(b) a → (i); b → (ii); c → (iii) (c) Both A and B antigens in the plasma but no
(c) a → (iii); b → (i); c → (ii) antibodies.
(d) a → (ii); b → (i); c → (iii) (d) Both A and B antigens on the RBC but no
[NEET (2018)] antibodies in the plasma.
13. Adult human RBCs are enucleated. Which of the [NEET (2014)]
following statement(s) is/are the most appropriate 21. The diagram given here is the standard ECG of a normal
explanation for this feature? person. The P-wave represents the
(a) They do not need to reproduce
(b) They are somatic cells
(c) They do not metabolize
(d) All their internal space is available for oxygen
transport
(a) (a), (c) and (d) (b) (b) and (c)
(c) Only (d) (d) Only (a)
[NEET (2017)] (a) Contraction of both the atria
(b) Initiation of the ventricular contraction
(c) Beginning of the systole 28. Which one of the following statements is correct
(d) End of systole regarding blood pressure :
[NEET (2013)] (a) 190/110 mm Hg may harm vital organs like brain and
22. Figure shows schematic plan of blood circulation in kidney
humans with labels A to D. Identify the label and give (b) 130/90 mm Hg is considered high and requires
its function/s. treatment
(c) 100/55 mm Hg is considered an ideal blood
pressure
(d) 105/50 mm Hg makes one very active
[NEET (2011)]
29. If due to some injury the chordae tendinae of the
tricuspid value of the human heart is partially non-
functional, what will be the immediate effect –
(a) The flow of blood into the arota will be slowed down
(b) The pacemaker will stop working
(c) The blood will tend to flow back into the left atrium
(d) The flow of blood into the pulmonary artery will be
(a) A – Pulmonary vein – takes impure blood from body
reduced
parts, PO2 = 60 mm Hg
[NEET (2010)]
(b) B – Pulmonary artery – takes blood from heart to
30. What is true about RBCs in humans ?
lungs, PO2 = 90 mm Hg
(a) They carry about 20-25 per cent of CO2
(c) C – Vena Cava – takes blood from body parts to
(b) They transport 99.5 per cent of O2
right auricle, PCO2 = 45 mm Hg
(c) They transport about 80 per cent oxygen only and
(d) D – Dorsal aorta – takes blood from heart to body
the rest 20 per cent of its transported in dissolved state
parts, PO2 = 95 mm H
in blood plasma
[NEET (2013)]
(d) They do not carry CO2 at all
23. Which one of the following human organs is often called
[NEET (2010)]
the “graveyard” of RBCs?
31. Which two of the following changes (a – d) usualy tend
(a) Kidney (b) Spleen
to occur in the plain dvellers when they move to high
(c) Liver (d) Gall bladder
altitudes (3,500 m or more) ?
[NEET (2012)] (a) Increase in red blood cell size
24. A large proportion of oxygen is left unused in the human (b) Increase in red blood cell production
blood even after its uptakes by the body tissues. This O2 (c) Increased breathing rate
: (d) Incrase in thrombocyte count
(a) Helps in releasing more O2 to the epithelial tissues Changes occurring are –
(b) Acts as a reserve during muscular exercise (a) (b) and (c)
(c) Raises the pCO2 of blood to 75 mm of Hg (b) (c) and (d)
(d) Is enough to keep oxyhaemoglobin saturation at 96% (c) (a) and (d)
(d) (a) and (b)
[NEET (2011)] [NEET (2010)]
25. Arteries are best defined as the vessel which : 32. In a standard ECG which one of the following alphabets
(a) carry blood from one visceral organ to another is the correct represention of the respective activity of
visceral organ] the human heart ?
(b) Supply oxygenated blood to the different organs (a) P-depolarisation of the atria
(c) Carry blood away from the heart to different organs (b) R-repolarisation of ventricles
(d) Break up into capillaries which reunite to form a vein (c) S-start of systole
[NEET (2011)] (d) T-end of diastole
26. 'Bundle of Hiss' is a part of which one of the following [NEET (2009)]
organs in humans ? 33. Compared to blood our lymph has :
(a) Pancreas (b) Brain (a) More RBCs and less WBCs
(c) Heart (d) Kidney (b) No plasma
[NEET (2011)] (c) Plasma without proteins
27. Which one of the following plasma proteins is involved (d) More WBCs and no RBCs
in the coagulation of blood ? [NEET (2009)]
(a) Fibrinogen (b) an albumin 34. Globulins contained in human blood plasma are
(c) Serum amylase (d) A globulin primarily involved in -
[NEET (2011)] (a) Clotting of blood
(b) Defence mechanisms of body
(c) Osmotic balance of body fluids (b) White blood cells

(d) Oxygen transport in the blood (c) Unstriated muscle cells
[NEET (2009)] (d) Liver cells
35. Use of anti-histamines and steroids give a quick relief [NEET (2007)]
from - 42. A drop of each of the following, is placed separately on
(a) Headache (b) Allergy four slides. Which of them will not coagulate ?
(c) Nausea (d) Cough (a) Whole blood from pulmonary vein
[NEET (2009)] (b) Blood plasma
36. There is no DNA in : (c) Blood serum
(a) Hair root (d) Sample from the thoracic duct of lymphatic system
(b) An enucleated ovum [NEET (2007)]
(c) Mature RBCs 43. Examination of blood of a person suspected of having
(d) A mature spermatozoan anemia, shows large, immature, nucleated erythrocytes
[NEET (2009)] without haemoglobin. Supplementing his diet with
37. The letter T in T-lymphocyte refers to : which of the following is likely to alleviate his
(a) Thymus symptoms ?
(b) Thyroid (a) Thiamine
(c) Thalamus (b) Folic acid and cobalamine
(d) Tonsil (c) Riboflavin
[NEET (2009)] (d) Iron compounds
38. Which type of white blood cells are concerned with the [NEET (2006)]
release of histamine and the natural anti-coagulant 44. Which of the following substances, if introduced into the
heparin? blood stream, would cause coagulation of blood at the
(a) Eosinophils site of its introduction -
(b) Monocytes (a) Thromboplastin (b) Fibrinogen
(c) Neutrophils (c) Heparin (d) Prothrombin
(d) Basophils [NEET (2005)]
[NEET (2008)] 45. You are required to draw blood from a patient and to
39. The most active phagocytic white blood cells are: keep it in a test tube for analysis of blood corpuscles and
(a) Eosinophils and lymphocytes plasma. You are also provided with the following four
(b) Neutrophils and monocytes types of test tubes. Which of them will you not use for
(c) Neutrophils and eosinophils the purpose?
(d) Lymphocytes and macrophages (a) Chilled test tube
[NEET (2008)] (b) Test tube containing heparin
40. In humans, blood passes from the post caval to the (c) Test tube containing sodium oxalate
diastolic right atrium of heart due to: (d) Test tube containing calcium bicarbonate
(a) Stimulation of the sino auricular node [NEET (2004)]
(b) Pressure difference between the post caval and 46. The cardiac pacemaker in a patient fails to function
atrium normally. The doctors find that an artificial pacemaker
(c) Pushing open of the venous valves is to be grafted in him. It is likely that it will be grafted
(d) Suction pull at the site of -
[NEET (2008)] (a) Purkinje system
41. Which one of the following mammalian cells is not (b) Sinuatrial node
capable of metabolizing glucose to carbon-dioxide (c) Atrioventricular node
aerobically ? (d) Atrioventricular bundle
(a) Red blood cells [NEET (2004)]
EXCRETORY PRODUCTS AND THEIR ELIMINATION 64
EXCRETORY PRODUCTS AND THEIR ELIMINATION

1. Match List I with List II. (a) Atrial natriuretic factor causes vasoconstriction
(b) Decrease in secretion of renin by JG cells
List I List II (c) Angiotensin II causes the vasodilation
A. Taenia I. Nephridia (d) Reabsorption of Na+ and water from renal tubules
B. Paramoecium II. Contractile vacuole due to aldosterone
[NEET (2020)]
C. Periplaneta III. Flame cells 6. Which of the following factors is responsible for the
D. Pheretima IV. Uricose gland formation of concentrated urine?
(a) Maintaining hyperosmolarity towards inner
Choose the correct answer from the options give below: medullary interstitium in the kidneys
(a) A–I, B–II, C–IV, D–III (b) Secretion of erythropoietin by Juxtaglomerular
(b) A–III, B–II, C–IV, D–I complex
(c) A–II, B–I, C–IV, D–III (c) Hydrostatic pressure during glomerular filtration
(d) A–I, B–II, C–III, D–IV (d) Low levels of antidiuretic hormone
[NEET (2019)]
[NEET (2023)]
7. Use of an artificial kidney during hemodialysis may
2. Given below are statements: one is labelled as Assertion result in:
A and the other is labelled as Reason R. (a) Nitrogenous waste build up in the body
Assertion A: Nephrons are of two types: cortical and (b) Non-elimination of excess potassium ions
juxtamedullary, based on their relative position in cortex (c) Reduced absorption of calcium ions from gastro-
and medulla. intestinal tract
Reason R: Juxtamedullary nephrons have short loop of (d) Reduced RBC production
Henle, whereas cortical nephrons have longer loop of Which of the following options is the most appropriate?
Henle. (a) (b) and (c) are correct
In the light of the above statements, choose the correct (b) (c) and (d) are correct
answer from the options given below: (c) (a) and (d) are correct
(a) Both A and R are true, but R is NOT the correct (d) (a) and (b) are correct
explanation of A. [NEET (2019)]
(b) A is true, but R is false. 8. Match the items given in column I with those in Column
(c) A is false, but R is true. II and select the correct option given below.
(d) Both A and R are true, and R is the correct
explanation of A. Column 1 Column II (Part of
[NEET (2023)] (Function) Excretory system)
3. Which of the following statements are correct? (a) Ultrafiltration (i) Henle’s loop
A. An excessive loss of body fluid from the body (b) Concentration of (ii) Ureter
switches off osmoreceptors. urine
B. ADH facilitates water reabsorption to prevent
diuresis. (c) Transport of (iii) Urinary bladder
C. ANF causes vasodilation. urine
D. ADH causes an increase in blood pressure. (d) Storage of urine (iv) Malpighian
E. ADH is responsible for a decrease in GFR. corpuscle
Choose the correct answer from the options given (v) Proximal convoluted
below:
tubule
(a) B, C and D only (b) A, B and E only
(c) C, D and E only (d) A and B only
[NEET (2023)] (a) a → (iv); b → (i); c → (ii); d → (iii)
4. Nitrogenous waste is excreted in the form of pellet or (b) a → (v); b → (iv); c → (i); d → (ii)
paste by: (c) a → (iv); b → (v); c → (ii); d → (iii)
(a) Ornithorhynchus (b) Salamandra (d) a → (v); b → (iv); c → (i); d → (iii)
(c) Hippocampus (d) Pavo [NEET (2018)]
[NEET (2022)] 9. Match the items given in column I with those in Column
5. Which of the following would help in prevention of II and select the correct option given below.
diuresis?
Column I Column II 16. The body cells in cockroach discharge their nitrogenous
(a) Glycosuria (i) Accumulation of waste in the haemolymph mainly in the form of
uric acid in joints (a) Ammonis
(b) Potassium urate
(b) Gout (ii) Mass of (c) Uric acid
crystallised salts (d) Calcium carbonate
within the kidney [NEET (2015)]
(c) Renal calculi (iii) Inflammation in 17. Which of the following causes an increase in sodium
Glomeruli reabsorption in the distal convoluted tubule?
(d) Glomerulonephritis (iv) Presence of (a) Increase in antidiuretic hormone levels
(b) Decrease in aldosterone levels
Glucose in urine (c) Decrease in antidiuretic hormone levels
(a) a → (i); b → (ii); c → (iii); d → (iv) (d) Increase in aldosterone levels
(b) a → (ii); b → (iii); c → (i); d → (iv) [NEET (2014)]
(c) a → (iii); b → (ii); c → (iv); d → (i) 18. Figure shows human urinary system with structures
(d) a → (iv); b → (i); c → (ii); d → (iii) labelled A to D. Select option which correctly identifies
[NEET (2018)] them and given their characteristics and / or functions:
10. A decrease in blood pressure/ volume will not cause the
release of
(a) Aldosterone
(b) ADH
(c) Renin
(d) Atrial Natriuretic Factor
[NEET (2017)]
11. Which of the following statements is correct?
(a) The ascending limb of the loop of Henle is permeable
to water
(b) The descending limb of the loop of Henle is
permeable to electrolytes (a) A – Adrenal gland – located at the anterior part of the
(c) The ascending limb of the loop of Henle is kidney. Secrete Catecholamines which stimulate
impermeable to water glycogen breakdown
(d) The descending limb of the loop of Henle is (b) B – Pelvis-broad funnel shaped space inner to
impermeable to water hilum, directly connected to loops of Henle
[NEET (2017)] (c) C – Medulla – inner zone of kidney and contains
12. The part of nephron involved in active reabsorption of complete nephrons
sodium is (d) D – Cortex – outer part of kidney and do not
(a) Proximal convoluted tubule contain any part of nephrons
(b) Bowman’s capsule [NEET (2013)]
(c) Descending limb of Henle’s loop 19. A fall in glomerular filtration rate (GFR) activates -
(d) Distal convoluted tubule (a) Adrenal cortex to release aldosterone
[NEET (2016-II)] (b) Adrenal medulla to release adrenaline
13. In mammals, which blood vessel would normally carry (c) Posterior pituitary to release vasopressin
the largest amount of urea? (d) Juxta glomerular cells to release renin
(a) Renal Vein (b) Dorsal Aorta [NEET (2012)]
(c) Hepatic Vein (d) Hepatic Portal Vein
[NEET (2016-I)] 20. Which one of the following option gives the correct
14. Grafted kidney may be rejected in a patient due to: categorization of six animals according to the type of
(a) Humoral immune response nitrogenous wastes (A, B, C), they give out?
(b) Cell-mediated immune response (a) A-AMMONOTELIC-Frog, Lizards; B-
(c) Passive immune response UREOTELIC- Aquatic Amphibia, Humans; C-
(d) Innate immune response URICOTELIC- Cockroach, Pigeon
[NEET (2015)] (b) A-AMMONOTELIC-Aquatic Amphibia; B-
15. Human urine is usually acidic because UREOTELIC-Frog, Humans; C-URICOTELIC-
(a) The sodium transporter exchanges one hydrogen ion Pigeon, Lizards, Cockroach
for each sodium ion, in peritubular capillaries. (c) A-AMMONOTELIC- Aquatic Amphibia; B-
(b) Excreted plasma proteins are acidic. UREOTELIC-Cockroach, Humans; C-
(c) Potassium and sodium exchange generates acidity. URICOTELIC- Frog, Pigeon, Lizards
(d) Hydrogen ions are actively secreted into the filtrate.
[NEET (2015)]
(d) A-AMMONOTELIC-Pigeon, Humans; B- (d) Ascending limb of Loop of Henly is impermeable

UREOTELIC-Aquatic Amphibia, Lizards; C- to electrolytes
URICOTELIC- Cockroach, Frog [NEET (2010)]
[NEET (2012)] 27. The principal nitrogenous excretory compound in
21. Which one of the following characteristics is common humans is synthesised –
both in humans and adult frogs? (a) In kidneys but eliminated mostly through liver
(a) Internal fertilization (b) In kidneys as well as eliminated by kidneys
(b) Nucleated RBCs (c) In liver and also eliminated by the same through
(c) Ureotelic mode of excretion bile
(d) In the liver, but eliminated mostly through kidneys
(d) Four – chambered heart
[NEET (2010)]
[NEET (2012)] 28. Uric acid is the chief nitrogenous component of the
22. Which one of the following is not a part of a renal excretory products of -
pyramid ? (a) Frog (b) Man
(a) Loops of Henle (c) Earthworm (d) Cockroach
(b) Peritubular capillaries [NEET (2009)]
(c) Convoluted tubules 29. What will happen if the stretch receptors of the urinary
(d) Collecting ducts bladder wall are totally removed ?
[NEET (2011)] (a) There will be no micturition
23. Which one of the following correctly explains the (b) Urine will continue to collect normally in bladder
function of a specific part of a human nephron ? (c) Micturition will continue
(a) Afferent arteriole : carries the blood away from the (d) Urine will not collect in the bladder
glomerulus towards renal vein [NEET (2009)]
(b) Podocytes : Create minute spaces (slit pores) for the 30. A person who is on a long hunger strike and is surviving
filtration of blood into the Bowman's capsule only on water, will have:-
(c) Henle's loop : most reabsorption of the major (a) Less urea in his urine
substances from the glomerular filtrate (b) More sodium in his urine
(d) Distal convoluted tubule : re-absorption of K+ ions (c) Less amino acids in his urine
into the surrounding blood capillaries (d) More glucose in his blood
[NEET (2011)] [NEET (2007)]
24. Uricotelic mode of passing out nitrogenous wastes is 31. Angiotensinogen is a protein produced and secreted by-
found in : (a) Macula densa cells
(a) Insects and Amphibians (b) Endothelial cells (cells lining the blood vessels)
(b) Reptiles and Birds (c) Liver cells
(c) Birds and Annelids (d) Juxtaglomerular (JG) cells
(d) Amphibians and Reptiles [NEET (2006)]
[NEET (2011)] 32. In ornithine cycle which of the following wastes are
25. Which one of the following statements is correct with removed form the blood -
respect to kidney function regulation ? (a) CO2 and ammonia
(a) During summer when body loses of lot of water by (b) Ammonia and urea
evaporation, the release of ADH is suppressed (c) CO2 and urea
(b) When someone drinks lot of water, ADH release is (d) Urea and urine
suppressed [NEET (2005)]
(c) Exposure to cold temperature stimulates ADH 33. The net pressure gradient that causes the fluid to filter
release out of the glomeruli into the capsule is -
(d) An increase in glomerular blood flow stimulates (a) 20 mm Hg (b) 50 mm Hg
formation of Angiotensin II. (c) 75 mm Hg (d) 30 mm Hg
[NEET (2011)] [NEET (2005)]
26. Which one of the following statements regards to the 34. Uricotelism is found in -
excretion by the human kidneys is correct – (a) Fishes and Fresh water protozoans
(a) Descending limb of Loop of Henly is impermeable (b) Birds, reptiles and insects
to water (c) Frogs and toads
(b) Distal convoluted tubule is incapable in reabsorbing (d) Mammals and birds
HCO3 [NEET (2004)]
(c) Nearly 99 percent of the glomerular filtrate is
reabsorbed by the renal tube
LOCOMOTION AND MOVEMENT 67
LOCOMOTION AND MOVEMENT

1. Match List I with List II. Reason (R): Common cause of osteoporosis is increased
levels of oestrogen.
List I (Type of List II (Found In the light of the above statements, choose the most
Joint) between) appropriate answer from the options given b
A. Cartilaginous I. Between flat skull (a) Both (A) and (R) are correct and (R) is the correct
explanation of (A)
Joint bones
(b) Both (A) and (R) are correct but (R) is not the
B. Ball and Socket II. Between adjacent correct explanation of (A)
Joint vertebrae in vertebral (c) (A) is correct but (R) is not correct
column (d) (A) is not correct but (R) is correct
C. Fibrous Joint III. Between carpal and [NEET (2022)]
metacarpal of thumb 5. Which of the following is present between the adjacent
D. Saddle Joint IV. Between humerus and bones of the vertebral column?
pectoral girdle (a) Intercalated discs (b) Cartilage
Choose the correct answer from the options given (c) Areolar tissue (d) Smooth muscle
below: [NEET (2022)]
(a) A–II, B–IV, C–I, D–III 6. Chronic autoimmune disorder affecting neuromuscular
(b) A–I, B–IV, C–III, D–II junction leading to fatigue, weakening, and paralysis of
(c) A–II, B–IV, C–III, D–I skeletal muscle is called
(a) Myasthenia gravis
(d) A–III, B–I, C–II, D–IV (b) Gout
[NEET (2023)] (c) Arthritis
2. Which of the following statements are correct regarding (d) Muscular dystrophy
skeletal muscle? [NEET (2021)]
A. Muscle bundles are held together by collagenous 7. Match list I with list II.
connective tissue layer called fascicle. List I List II
B. Sarcoplasmic reticulum of muscle fibre is a store (a) Scapula (i) Cartilaginous joints
house of calcium ions. (b) Cranium (ii) Ventral part of the rib
C. Striated appearance of skeletal muscle fibre is due to cage
distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction (c) Sternum (iii) Part of the skull
called sarcomere. (d) Vertebral (iv) triangular flat bone
Choose the most appropriate answer from the options column
given below: (a) (a)- (iv); (b) - (ii); (c) - (iii);(d) - (i)
(a) B and C only (b) (a)- (iv); (b) - (iii); (c) - (ii);(d) - (i)
(b) A, C and D only (c) (a)- (i); (b) - (iii); (c) - (ii);(d) - (iv)
(c) C and D only (d) (a)- (ii); (b) - (iii); (c) - (iv);(d) - (i)
(d) A, B and C only [NEET (2021)]
[NEET (2023)] 8. During the muscular contraction which of the following
3. Which of the following is a correct match for disease events occur?
and its symptoms? (a) ‘H’ zone disappears
(a) Arthritis - Inflamed joints (b) ‘A’ band widens
(b) Tetany - high Ca2+ level causing rapid spasms (c) ‘I’ band reduces in width
(c) Myasthenia gravis - Genetic disorder resulting in (d) Myosin hydrolyzes ATP, releasing the ADP and Pi.
weakening and paralysis of skeletal muscle (e) Z-lines attached to actins are pulled inwards
(d) Muscular dystrophy - An autoimmune disorder below.
causing progressive degeneration of skeletal muscle (a) (b), (c), (d), (e) only
[NEET (2022)] (b) (b), (d), (e), (a) only
4. Given below are two statements: one is labelled as (c) (a), (c), (d), (e) only
Assertion (A) and the other is labelled as Reason (R). (d) (a), (b), (c), (d) only
Assertion (A): Osteoporosis is characterised by [NEET (2021)]
decreased bone mass and increased chances of fracture.
9. Match the following columns and select the correct [NEET (2016-II)]
option 15. Name the ion responsible for unmasking of active sites
Column I Column II for myosin for cross-bridge activity during muscle
(a) Floating ribs (i) Located between second and contraction.
seventh ribs (a) Magnesium (b) Sodium
(c) Potassium (d) Calcium
(b) Acromion (ii) Head of the Humerus [NEET (2016-II)]
(c) Scapula (iii) Clavicle 16. Lack of relaxation between successive stimuli in
(d) Glenoid (iv) Do not connect with the sustained muscle contraction is known as
cavity sternum (a) Spasm (b) Fatigue
(a) a – iii; b – ii; c – iv; d – i (c) Tetanus (d) Tonus
(b) a – iv; b – iii; c – i; d – ii [NEET (2016-I)]
(c) a – ii; b – iv; c – i; d – iii 17. Which of the following is not a function of the skeletal
(d) a – i; b – iii; c – ii; d – iv system?
[NEET (2020)] (a) Production of erythrocytes
10. Select the correct option. (b) Storage of minerals
(a) 11th and 12th pairs of ribs are connected to the (c) Production of body heat
sternum with the help of hyaline cartilage (d) Locomotion
(b) Each rib is a flat thin bone and all the ribs are [NEET (2015)]
connected dorsally to the thoracic vertebrae and 18. Which of the following joints would allow no
ventrally to the sternum movement?
(c) There are seven pairs of vertebrosternal, three pairs (a) Fibrous joint
of vertebrochondral and two pairs of vertebral ribs (b) Cartilaginous joint
(d) 8th , 9th and 10th pairs of ribs articulate directly with (c) Synovial Joint
the sternum (d) Ball and socket joint
[NEET (2019)] [NEET (2015)]
11. Calcium is important in skeletal muscle contraction 19. Select the correct matching of the type of joint with the
because it example in human skeletal system:
(a) Activates the myosin ATPase by binding to it (a) Type of Joint - Pivot joint; Example - Between third
(b) Detaching the myosin head from the actin filament and fourth cervical vertebrae
(c) Binds to troponin to remove the masking of active (b) Type of Joint - Hinge joint; Example - Between
sites on actin for myosin humerus
(d) Prevents the formation of bonds between the (c) Type of Joint - Gliding joint; Example - Between
myosin cross-bridges and the actin filament carpals
[NEET (2018)] (d) Type of Joint - Cartilaginous joint; Example -
12. The pivot joint between the atlas and axis is a type of Between frontal and parietal
(a) Synovial joint [NEET (2014)]
(b) Saddle joint 20. The characteristics and an example of a synovial joint in
(c) Fibrous joint humans is
(d) Cartilaginous joint (a) Characteristics - Fluid cartilage between two bones,
[NEET (2017)] limited movements, Examples - Knee joints
13. Out of 'X' pairs of ribs in humans only "Y' pairs are true (b) Characteristics - Fluid filled between two joints,
ribs. Select the option that correctly represents values of provides cushion, Examples - Skull bones
X and Y and provides their explanation. (c) Characteristics - Fluid filled synovial cavity
(a) X = 24, Y = 7 - True ribs are dorsally attached to between two bones, Examples - Joint between atlas and
vertebral column but are free on ventral side. axis
(b) X = 24, Y = 12 - True ribs are dorsally attached to (d) Characteristics - L carpals ymph filled between two
vertebral column but are free on ventral side. bones, limited movement, Examples - Gliding joint
(c) X = 12, Y = 7 - True ribs are attached dorsally to between carpals
vertebral column and ventrally to the sternum. [NEET (2013)]
(d) X = 12, Y=5 - True ribs are attached dorsally to the 21. Select the correct statement with respect to locomotion
vertebral column and sternum on the two ends. in humans.
[NEET (2017)] (a) A decreased level of progesterone causes
14. Smooth muscle fibers are osteoporosis in old people
(a) Voluntary, multinucleate, cylindrical (b) Accumulation of uric acid crystals in joints causes
(b) Involuntary, cylindrical, striated their inflammation
(c) Voluntary, spindle-shaped, uninucleate (c) The vertebral column has 10 thoracic vertebrae
(d) Involuntary, fusiform, non-striated
(d) The joint between adjacent vertebrae is a fibrous (b) Pivot joint
joint (c) Hinge joint
[NEET (2013)] (d) Gliding joint
22. The H-zone in the skeletal muscle fibre is due to
[NEET (2009)]
(a) The absence of myofibrils in the central portion of
27. In human body, which one of the following is
A-band
anatomically correct ?
(b) The central gap between myosin filaments in the A-
(a) Cranial nerve – 10 pairs
band
(b) Floating ribs – 2 pairs
(c) The central gap between actin filaments extending
(c) Collar bones – 3 pairs
through myosin filaments in the A-band
(d) Salivary glands – 1 pair
(d) Extension of myosin filaments in the central portion
[NEET (2007)]
of the A-band
28. The contractile protein of skeletal muscle involving
[NEET (2013)]
ATPase activity is-
23. Low Ca++ in the body fluid may be the cause of
(a) Tropomyosin
(a) Tetany (b) Anaemia
(b) Myosin
(c) Angina pectoris (d) Gout
(c) α-Actin
[NEET (2010)]
(d) Troponin
24. Which one of the following is correct pairing of a body
[NEET (2006)]
part and like kind of muscle tissue that moves it ?
29. An acromian process is characteristically found in the -
(a) Iris – Involuntary smooth muscle
(a) Skull of frog
(b) Heart wall – Involuntary unstriated muscle
(b) Sperm of mammals
(c) Biceps of upper arm – smooth muscle fibres
(c) Pelvic girdle of mammals
(d) Abdominal wall – smooth muscle (d) Pectoral girdle of mammals
[NEET (2009)] [NEET (2005)]
25. Which one of the following is the correct matching of 30. Which of the following pairs, is correctly matched -
three items and their grouping category ? (a) Fibrous joint – between phalanges
(a) Items- Cytosine, uracil, thiamine; Groups- (b) Cartilaginous joint – skull bones
Pyrimidines (c) Gliding joint – between zygapophyses of the
(b) Items- Malleus, incus, cochlea; Groups- Ear successive vertebrae
ossicles (d) Hinge joint – between vertebrae
(c) Items- ilium, ischium pubis; Groups- Coxal bones [NEET (2005)]
of pelvic girdle 31. ATPase enzyme needed for muscle contraction is
located in -
(d) Items- Actin, myosin, rodopsin; Groups- Muscle
(a) Troponin (b) Myosin
proteins
(c) Actin (d) Actinin
[NEET (2009)] [NEET (2004)]
26. Elbow joint is an example of :
(a) Ball and socket joint
NEURAL CONTROL AND COORDINATION 70
NEURAL CONTROL AND COORDINATION

1. Match List I with List II with respect to human eye. (c) a – ii; b – iii; c – i; d - iv
(d) a – iii; b – i; c – iv; d - ii
List I List II
[NEET (2020)]
A. Fovea I. Visible coloured portion of eye 5. Which of the following statements is correct?
that regulates diameter of pupil. (a) Cornea consists of dense connective tissue of elastin
B. Iris II. External layer of eye formed of and can repair itself
dense connective tissue. (b) Cornea is convex, transparent layer which is highly
C. Blind III. Point of greatest visual acuity or vascularised
(c) Cornea consists of a dense matrix of collagen and is
spot resolution.
the most sensitive portion of the eye
D. Sclera IV. Point where optic nerve leaves (d) Cornea is an external, transparent and protective
the eyeball and photoreceptor proteinaceous covering of the eye-ball
cells are absent. [NEET (2019)]
Choose the correct answer from the options given 6. Which part of the brain is responsible for
below: thermoregulation?
(a) A–IV, B–III, C–II, D–I (a) Hypothalamus
(b) A–I, B–IV, C–III, D–II (b) Corpus callosum
(c) A–II, B–I, C–III, D–IV (c) Medulla oblongata
(d) Cerebrum
(d) A–III, B–I, C–IV, D–II
[NEET (2019)]
[NEET (2023)] 7. Nissl bodies are mainly composed of
2. The parts of human brain that helps in regulation of (a) DNA and RNA
sexual behaviour, expression of excitement, pleasure, (b) Nucleic acids and SER
rage, fear, etc., are (c) Proteins and lipids
(a) Corpora quadrigemina and hippocampus (d) Free ribosomes and RER
(b) Brain stem and epithalamus [NEET (2018)]
(c) Corpus callosum and thalamus 8. Which of the following structures or regions is
(d) Limbic system and hypothalamus incorrectly paired with its functions?
(a) Hypothalamus: production of releasing hormones
[NEET (2023)]
and regulation of temperature, hunger and thirst
3. Select the incorrect statement regarding synapses :
(b) Limbic system: consists of fibre tracts that
(a) The membranes of presynaptic and postsynaptic
interconnect dif movement ferent regions of the brain;
neurons are in close proximity in an electrical synapse.
controls movement
(b) Electrical current can flow directly from one neuron
(c) Medulla oblongata: controls respiration and
into the other across the electrical synapse.
cardiovascular reflexes
(c) Chemical synapse use neurotransmitters
(d) Corpus callosum: band of fibers connecting left and
(d) Impulse transmission across a chemical synapse is right cerebral hemispheres
always faster than that across an electrical synapse [NEET (2018)]
[NEET (2022)] 9. The transparent lens in the human eye is held in its place
4. Match the following columns and select the correct by
option. (a) Ligaments attached to the iris
(b) Smooth muscles attached to the iris
Column I Column II (c) Ligaments attached to the ciliary body
(a) Organ of Corti (i) Connects middle ear and (d) Smooth muscles attached to the ciliary body
[NEET (2018)]
pharynx
10. Myelin sheath is produced by
(b) Cochlea (ii) Coiled part of the labyrinth (a) Oligodendrocytes and Osteoclasts
(c) Eustachian (iii) Attached to the oval window (b) Osteoclasts and Astrocytes
tube (c) Schwann Cells and Oligodendrocytes
(d) Stapes (iv) Located on the basilar (d) Astrocytes and Schwann Cells
membrane [NEET (2017)]
11. Receptor sites for neurotransmitters are present on
(a) a – iv; b – ii; c – i; d - iii
(a) Tips of axons
(b) a – i; b – ii; c – iv; d - iii
(b) Post-synaptic membrane [NEET (2014)]

(c) Membranes of synaptic vesicles 19. Which one of the following statements is not correct?
(d) Pre-synaptic membrane (a) In retina the rods have the photopigment rhodopsin
[NEET (2017)] while cones have three different photopigments
12. Good vision depends on adequate intake of carotene- (b) Retinal is a derivative of Vitamin (C)
rich food. Select the best option from the following (c) Rhodopsin is the purplish red protein present in
statements rods only
(a) Vitamin A derivatives are formed from carotene (d) Retinal is the light absorbing portion of visual
(b) The photopigments are embedded in the membrane photo pigment
discs of the inner segment [NEET (2014)]
(c) Retinal is a derivative of vitamin A. 20. Parts A, B, C and D of the human eye are shown in the
(d) Retinal is a light-absorbing part of all the visual diagram. Select the option which gives correct
photopigments identification along with its functions/characteristics.
(a) (a) and (c) (b) (b), (c) and (d)
(c) (a) and (b) (d) (a), (c) and (d)
[NEET (2017)]
13. Choose the CORRECT statement
(a) Meissner’s corpuscles are thermoreceptors
(b) Photoreceptors in the human eye are depolarized
during darkness and become hyperpolarized in
response to the light stimulus
(c) Receptors do not produce graded potentials
(a) A – Retina – contains photoreceptors – rods and
(d) Nociceptors respond to changes in pressure
cones
[NEET (2016-II)]
(b) B – Blind spot – has rods and cones
14. Photosensitive compound in human eye is made up of
(c) C – Aqueous chamber – reflects the light which
(a) Guanosine and Retinol
does not pass through the lens
(b) Opsin and Retinal
(d) D – Choroid – its anterior part forms the ciliary
(c) Opsin and Retinol
body
(d) Transducing and Retinene
[NEET (2013)]
[NEET (2016-I)]
21. A diagram showing axon terminal and synapse is given.
15. In mammalian eye, the 'fovea' is the center of the visual
Identify correctly at least two of A-D.
field, where
(a) High density of cones occur, but has no rods.
(b) The optic nerve leaves the eye.
(c) Only rods are present.
(d) More rods than cones are found.
[NEET (2015)]
16. Destruction of the anterior horn cells of the spinal cord
would result in loss of:
(a) Sensory impulses
(b) Voluntary motor impulses (a) A - Receptor, C - Synaptic vesicles
(c) Commissural impulses (b) B - Synaptic connection, D - K+
(d) Integrating impulses (c) A - Neurotransmitter, B - Synaptic cleft
[NEET (2015)] (d) C - Neurotransmitter, D - Ca++
17. How do parasympathetic neural signals affect the [NEET (2013)]
working of the heart? 22. The purplish red pigment rhodopsin contained in the
(a) Heart rate is increased without affecting the cardiac rods type of photo receptor cells of the human eye, is a
output derivative of :
(b) Both heart rate and cardiac output increase (a) Vitamin A
(c) Heart rate decreases but cardiac output increases (b) Vitamin B1
(d) Reduces both heart rate and cardiac output (c) Vitamin C
[NEET (2014)] (d) Vitamin D
18. Stimulation of a muscle fibre by a motor neuron occurs [NEET (2011)]
at the: 23. When a neuron is in resting state i.e. not conducting any
(a) Transverse tubules impulse, the axonal membrane is :
(b) Myofibril (a) Comparatively more permeable of K+ Ions and
(c) Sarcoplasmic reticulum nearly impermeable to Na+ ions
(d) Neuromuscular junction
(b) Comparatively more permeable to Na+ ions and (c) Visual acuity- Rod cells-High; Cone cells-Low
nearly impermeable to K+ ions (d) Visual pigment contained- Rod cells-lodopsin;
(c) Equally permeable to both Na+ and K+ ions Cone cells-Rhodopsin
(d) Impermeable to both Na+ and K+ ions [NEET (2008)]
30. During the propagation of a nerve impulse, the action
[NEET (2011)]
potential results from the movement of:
24. The nerve centres which control the body temperature
(a) K+ ions from intracellular fluid to extracellular fluid
and the urge for eating are contained in –
(b) Na+ ions from extracelluar fluid to intracellular
(a) Hypothalamus (b) Pons
fluid
(c) Cerebellum (d) Thalamus
(c) K+ ions from extracellular fluid to intracellular fluid
[NEET (2010)]
(d) Na+ ions from intracellular fluid to extracellular
25. Which part of human brain is concerned with the
fluid
regulation of body temperature ?
[NEET (2008)]
(a) Hypothalamus
31. Cornea transplant in humans is almost never rejected.
(b) Medulla Oblongata
This is because:
(c) Cerebellum
(a) It is composed of enucleated cells
(d) Cerebrum
(b) It is a non-living layer
[NEET (2009)]
(c) Its cells are least penetrable by bacteria
26. Alzhimer disease in humans is associated with the
(d) It has no blood supply
deficiency of :
[NEET (2008)]
(a) Gamma aminobutyric acid (GABA)
32. Which one of the following pairs of structures
(b) Dopamine
distinguishes a nerve cell from other types of cell ?
(c) Glutamic acid
(a) Nucleus and mitochondria
(d) Acetylcholine
(b) Perikaryon and dendrites
[NEET (2009)]
(c) Vacuoles and fibres
27. Which one of the following items gives its correct total
(d) Flagellum and medullary sheath
number?
[NEET (2007)]
(a) Types of diabetes — 3
33. During the transmission of nerve impulse through a
(b) Cervical vertebrae in humans — 8
nerve fibre, the potential on the inner side of the plasma
(c) Floating ribs in humans — 4
membrane has which type of electric charge ?
(d) Amino acids found in proteins — 16
(a) First positive, then negative and again back to
[NEET (2008)]
positive
28. Given below is a diagrammatic cross section of a single
(b) First negative, then positive and again back to
loop of human cochlea:
negative
(c) First positive, then negative and continue to be
negative
(d) First negative, then positive and continue to be
positive
[NEET (2007)]
34. Which one of the following does not act as a
neurotransmitter ?
Which one of the following options correctly represents (a) One strand turns anti-clockwise
the names of three different parts? (b) The phosphate groups of two DNA stands, at their
(a) D:Sensory hair cells, A:Endolymph, B:Tectorial ends, share the same position
membrane (c) The phosphate groups at the start of two DNA
(b) A: Perilymph, B: Tectorial membrane, C: strands are in opposite position (pole)
Endolymph (d) One strand turns clockwise
(c) B:Tectorial membrane, C:Perilymph, D:Secretory [NEET (2006)]
cells 35. Four healthy people in their twenties got involved in
(d) C:Endolymph, D:Sensory hair cells, A:Serum injuries resulting in damage and death of a few cell of
[NEET (2008)] the following. Which of the cells are least likely to be
29. Which one of the following is the correct difference replaced by new cells -
between Rod cells and Cone cells of our retina? (a) Osteocytes
(a) Overall function- Rod cells-Vision in poor light; (b) Liver cells
Cone cells-Colour vision and detailed vision in bright (c) Neurons
light (d) Malpighian layer of the skin
(b) Distribution- Rod cells-More concentrated in centre [NEET (2005)]
of retina; Cone cells-Evenly distributed all over retina
36. One of the examples of the action of the autonomous 39. In a man, abduncens nerve is injured. Which one of the
nervous system is - following functions will be affected
(a) Knee-jerk reponse (a) Swallowing
(b) Pupillary reflex (b) Movement of the eye ball
(c) Peristalsis of the intestines (c) Movement of the neck
(d) Swallowing of food (d) Movement of the tongue
[NEET (2005)] [NEET (2005)]
37. Damage to thymus in a child may lead to 40. In the resting state of the neural membrane, diffusion
(a) A reduction in haemoglobin content of blood due to concentration gradients, if allowed, would drive
(b) A reduction in stem cell production :-
(c) Loss of antibody mediated immunity (a) K+ and Na+ out of the cell
(d) Loss of cell mediated immunity (b) Na+ into the cell
[NEET (2005)] (c) Na+ out of the cell
38. Parkinson's disease (characterized by tremors and (d) K+ into the cell
progressive rigidity of limbs) is caused by degeneration [NEET (2004)]
of brain neurons that are involved in movement control 41. Injury to vagus nerve in humans is not likely to affect -
and make use of neurotransmitter - (a) Gastrointestinal movements
(a) Norepinephrine (b) Pancreatic secretion
(b) Acetylcholine (c) Cardiac movements
(c) GABA (d) Tongue movements
(d) Dopamine [NEET (2004)]
[NEET (2005)]
CHEMICAL COORDINATION AND INTEGRATION 74
CHEMICAL COORDINATION AND INTEGRATION

1. Match List I with List II. 5. Select the correct statement.
(a) Insulin acts on pancreatic cells and adipocytes
List I List I (b) Insulin is associated with hyperglycemia
(A) CCK (I) Kidney (c) Glucocorticoids stimulate gluconeogenesis
(B) GIP (II) Heart (d) Glucagon is associated with hypoglycemia
[NEET (2020)]
(C) ANF (III) Gastric gland 6. Match the following columns and select the correct
(D) ADH (IV) Pancreas option.
Choose the correct answer from the options given Column I Column II
below: (a) Pituitary gland (i) Grave’s disease
(a) A–III, B–II, C–IV, D–I (b) Thyroid gland (ii) Diabetes mellitus
(b) A–II, B–IV, C–I, D–III
(c) A–IV, B–II, C–III, D–I (c) Adrenal gland (iii) Diabetes insipidus
(d) Pancreas (iv) Addison’s disease
(d) A–IV, B–III, C–II, D–I
[NEET (2023)]
(a) a – iii; b – i; c – iv; d – ii
2. Which of the following are NOT under the control of (b) a – ii; b – i; c – iv; d – iii
thyroid hormone? (c) a – iv; b – iii; c – i; d – ii
A. Maintenance of water and electrolyte balance. (d) a – iii; b – ii; c – i; d – iv
B. Regulation of basal metabolic rate. [NEET (2020)]
C. Normal rhythm of sleep–wake cycle. 7. Presence of which of the following conditions in urine
D. Development of immune system. are indicative of diabetes mellitus?
E. Support the process of RBCs formation. (a) Ketonuria and Glycosuria
Choose the correct answer from the options given (b) Renal calculi and Hyperglycaemia
below: (c) Uremia and Ketonuria
(a) B and C only (d) Uremia and Renal Calculi
(b) C and D only [NEET (2020)]
(c) D and E only 8. Which of the following glucose transporters is insulin-
(d) D and E only dependent?
[NEET (2023)] (a) GLUT II (b) GLUT III
3. Which of the following are not the effects of Parathyroid (c) GLUT IV (d) GLUT I
hormone ? [NEET (2019)]
a. Stimulates the process of bone resorption, 9. Match the following hormones with the respective
b. Decreases Ca2+ level in blood, disease:
c. Reabsorption of Ca2+ by renal tubules, Column-I Column-II
d. Decreases the absorption of Ca2+ from digested food, A Insulin (i) Addison’s
e. Increases metabolism of carbohydrates. disease
Choose the most appropriate answer from the options B Thyroxin (ii) Diabetes
given below insipidus
(a) (a) and (c) only
(b) (b), (d) and (e) only C Corticoids (iii) Acromegaly
(c) (a) and (e) only D Growth (iv) Goitre
(d) (b) and (c) only Hormones
[NEET (2022)] (v) Diabetes mellitus
4. Erythropoietin hormone which stimulates RBC
formation is produced by Select the correct option:
(a) The cells of bone marrow (a) A – (ii), B – (iv), C – (iii), D – (i)
(b) Juxtaglomerular cells of the kidney (b) A – (v), B – (iv), C – (i), D – (iii)
(c) Alpha cells of pancreas (c) A – (ii), B – (iv), C – (i), D – (iii)
(d) A – (v), B – (i), C – (ii), D – (iii)
(d) The cells of rostral adenohypophysis
[NEET (2019)]
[NEET (2021)]
10. How does steroid hormone influence the cellular (c) Accumulation of uric acid leading to inflammation
activities: of joints
(a) Binding to DNA and forming a gene-hormone (d) Immune disorder affecting neuromuscular junction
complex leading to fatigue
(b) Activating cyclic AMP located on the cell [NEET (2016-II)]
membrane 18. Name a peptide hormone which acts mainly on
(c) Using aquaporin channels as second messenger hepatocytes, adipocytes and enhances cellular glucose
(d) Changing the permeability of the cell membrane uptake and utilization.
[NEET (2019)] (a) Glucagon (b) Secretin
11. Which of the following hormones can play a significant (c) Gastrin (d) Insulin
role in osteoporosis? [NEET (2016-II)]
(a) Progesterone and Aldosterone 19. Grave's disease is caused due to
(b) Estrogen and Parathyroid hormone (a) Hypersecretion of thyroid gland
(c) Aldosterone and Prolactin (b) Hyposecretion of adrenal gland
(d) Parathyroid hormone and Prolactin (c) Hypersecretion of adrenal gland
[NEET (2018)] (d) Hyposecretion of thyroid gland
12. Which of the following is an amino acid derived [NEET (2016-II)]
hormone? 20. The amino acid Tryptophan is the precursor for the
(a) Ecdysone (b) Estradiol synthesis of:
(c) Epinephrine (d) Estriol (a) Melatonin and Serotonin
[NEET (2018)] (b) Thyroxine and Triiodothyronine
13. Hypersecretion of Growth Hormone in adults does not (c) Estrogen and Progesterone
cause a further increase in height, because (d) Cortisol and Cortisone
(a) Bones lose their sensitivity to Growth Hormone in [NEET (2016-I)]
adults 21. Identify the correct statement on ‘inhibin’.
(b) Muscle fibres do not grow in size after birth. (a) Inhibits the secretion of LH, FSH and prolactin.
(c) Growth Hormone becomes inactive in adults. (b) Is produced by granulosa cells in the ovary and
(d) Epiphyseal plates close after adolescence. inhibits the secretion of FSH.
[NEET (2017)] (c) Is produced by granulosa cells in the ovary and
14. GnRH, a hypothalamic hormone, needed in inhibits the secretion of LH.
reproduction, acts on (d) Is produced by nurse cells is testes and inhibits the
(a) The posterior pituitary gland and stimulates the secretion of LH.
secretion of oxytocin and FSH [NEET (2016-I)]
(b) The posterior pituitary gland and stimulates the 22. Changes in GnRH pulse frequency in females is
secretion of LH and relaxin controlled by circulating levels of :
(c) The anterior pituitary gland and stimulates the (a) Estrogen and progesterone
secretion of LH and oxytocin (b) Estrogen and inhibin
(d) The anterior pituitary gland and stimulates the (c) Progesterone only
secretion of LH and FSH (d) Progesterone and inhibin
[NEET (2017)] [NEET (2016-I)]
15. A temporary endocrine gland in the human body is 23. Select the incorrect statement :
(a) Corpus luteum (a) FSH stimulates the sertoli cells which help in
(b) Corpus allatum spermiogenesis
(c) Pineal gland (b) LH triggers ovulation in ovary
(d) Corpus cardiacum (c) LH and FSH decrease gradually during the
[NEET (2017)] follicular phase
16. The posterior pituitary gland is not a ‘true’ endocrine (d) LH triggers secretion of androgens from the Leydig
gland because _____. cells
(a) It only stores and releases hormones [NEET (2016-I)]
(b) It is under the regulation of hypothalamus 24. Which of the following pairs of hormones are not
(c) It secretes enzymes antagonistic (having opposite effects) to each other?
(d) It is provided with a duct (a) Parathormone-Calcitonin
[NEET (2016-II)] (b) Insulin-Glucagon
17. Osteoporosis, an age-related disease of skeletal system, (c) Aldosterone-Atrial Natriuretic factor
may occur due to (d) Relaxin-Inhibin
(a) High concentration of Ca++ and Na+ [NEET (2016-I)]
(b) Decreased level of estrogen
25. Which one of the following hormones though (d) Endocrine gland - Corpus luteum, Hormone -
synthesised elsewhere, is stored and released by the Testosterone, Function/deficiency symptoms –
master gland? Stimulates spermatogenesis
(a) Antidiuretic hormone [NEET (2013)]
(b) Luteinising hormone 31. Which of the following statements is correct in relation
(c) Prolactin to the endocrine system?
(d) Melanocyte stimulating hormone (a) Adenohypophysis is under direct neural regulation of
[NEET (2015)] the hypothalamus
26. Which one of the following hormones is not involved in (b) Organs in the body like gastrointestinal tract, heart,
sugar metabolism? kidney and liver do not produce any hormones
(a) Cortisone (c) Non-nutrient chemicals produced by the body in
(b) Aldosterone trace amount that act as intercellular messenger are
(c) Insulin hormones
(d) Glucagon (d) Releasing and inhibitory hormones of
[NEET (2015)] hypothalamus are produced by the pituitary gland
27. Injury localised to the hypothalamus would most likely [NEET (2013)]
disrupt: 32. A pregnant female delivers a baby who suffers from
(a) Coordination during locomotion stunted growth, mental retardation, low intelligence
(b) Executive functions such as decision making quotient and abnormal skin. This is the result of
(c) Regulation of body temperature (a) Deficiency of iodine in diet
(d) Short term memory (b) Low secretion of growth hormone
[NEET (2014)] (c) Cancer of the thyroid gland
28. Fight-or-flight reactions cause activation of (d) Over secretion of pars distalis
(a) The kidney, leading to suppression of renin [NEET (2013)]
angiotensin-aldosterone pathway 33. Match the source gland with its respective hormone as
(b) The adrenal medulla, leading to increased secretion well as the function.
of epinephrine and norepinephrine (a) Source gland- Thyroid; Hormone- Thyroxine;
(c) The pancreas, leading to a reduction in the blood Function- Regulates blood calcium level
sugar levels (b) Source gland- Anterior pituitary; Hormone-
(d) The parathyroid glands, leading to an increased Oxytocin; Function- Contraction of uterus muscles
metabolic rate during child birth
[NEET (2014)] (c) Source gland- Posterior pituitary; Hormone-
29. Identify the hormone with its correct matching of source Vasopressin; Function- Stimulates resorption of water
and function. in the distal tubules in the nephron
(a) Melatonin – Pineal gland – regulates the normal (d) Source gland- Corpus luteum; Hormone- Estrogen;
rhythm of sleep-wake cycle Function- Supports pregnancy
(b) Progesterone – corpus callosum – secondary sex
[NEET (2011)]
organs
(c) Atrial natriuretic factor –ventricular wall – 34. Given below is an incomplete table certain hormones,
increases the blood pressure their source glands and one major effect of each on the
(d) Oxytocin – anterior pituitary – growth and body in humans. Identify the correct option for the three
maintenance of mammary glands blanks A, B and C.
[NEET (2014)]
30. Select the answer which correctly matches the endocrine Glands Secretion Effect on Body
gland with the hormone it secretes and its
function/deficiency symptom A Oestrogen Maintenance of
(a) Endocrine gland - Anterior pituitary, Hormone – secondary sexual
Oxytocin, Function/deficiency symptoms – Stimulates characters
uterus contraction during childbirth
(b) Endocrine gland - Posterior pituitary symptoms - Alpha cells of B Raises blood sugar
Oversecretion stimulates abnormal growth , Hormone - Islets of level
Growth Hormone (GH), Function/deficiency symptoms
Langerhans
- Oversecretion stimulates abnormal growth
(c) Endocrine gland - Thyroid gland, Hormone –
Thyroxine, Function/deficiency symptoms - Lack of Anterior C Over section leads
iodine in diet result in goiter pituitary to gigantism
(a) A- Placenta; B- Glucagon; C- Calcitionin (c) Higher levels of cortisone

(b) A- Ovary; B- Glucagon; C- Growth (d) Lower levels of blood testosterone
(c) A- Placenta; B- Insulin; C- Vasopressin [NEET (2007)]
(d) A- Ovary; B- Insulin; C- Calcitonin 43. Feeling the tremors of an earthquake a scared resident of
seventh floor of a multistoried building starts climbing
[NEET (2011)]
down the stairs rapidly.
35. Injury to adrenal cortex is not likely to affect the
Which hormone initiated this action ?
secretion of which one of the following ?
(a) Gastrin (b) Thyroxin
(a) Aldosterone
(c) Adrenaline (d) Glucagon
(b) Both Androstenedione and Dehydroepiandrosterone
[NEET (2007)]
(c) Adrenaline
44. Bowman's glands are located in the
(d) Cortisol
(a) Olfactory epithelium of our nose
[NEET (2010)]
(b) Proximal end of uriniferous tubules
36. Which one of the following pairs is incorrectly matched
(c) Anterior pituitary
–
(d) Female reproductive system of cockroach
(a) Glucagon – Beta cells (source)
[NEET (2007)]
(b) Somatostatin – Delta cells (source)
45. Which one of the following statements is correct ?
(c) Corpus luteum – Relaxin (secretion)
(a) Neurons regulate endocrine activity, but not vice
(d) Insuling – Diabetes mellitus (disease) verse
[NEET (2010)] (b) Endocrine glands regulate neural activity, and
37. Toxic agents present in food which interfere with nervous system regulates endocrine glands
thyroxine synthesis lead to the development of – (c) Neither hormones control neural activity nor the
(a) Toxic goitre neurons control endocrine activity
(b) Cretinism (d) Endocrine glands regulate neural activity, but not
(c) Simple goitre vice versa
(d) Thyrotoxicosis [NEET (2006)]
46. Sertoli cells are regulated by the pituitary hormone
[NEET (2010)] known as-
38. Which of the following hormones contains iodine ?
(a) FSH (b) GH
(a) Thyroxine
(c) Prolactin (d) LH
(b) Insuline
[NEET (2006)]
(c) Testosterone
47. A steroid hormone which regulates glucose metabolism
(d) Adrenaline is-
[NEET (2009)] (a) Cortisol (b) Corticosterone
39. A health disorder that results from the deficiency of
(c) 11-deoxycorticosterone (d) Cortisone
thyroxine in adults and characterized by (i) a low
[NEET (2006)]
metabolic rate (ii) increase in body weight and (iii)
48. Which one of the following is not a second messenger
tendency to retain water in tissues is :
in hormone action ?
(a) Cretinism (a) cGMP (b) Calcium
(b) Hypothyroidism (c) Sodium (d) cAMP
(c) Simple goiter
[NEET (2006)]
(d) Myxoedema
49. Which of the following is an accumulation and release
[NEET (2009)]
centre of neurohormones ?
40. Which one of the following pairs of organs includes only (a) Posterior pituitary lobe
the endocrine glands? (b) Intermediate lobe of the pituitary
(a) Thymus and testes
(c) Hypothalamus
(b) Adrenal and ovary
(d) Anterior pituitary lobe
(c) Parathyroid and adrenal
[NEET (2006)]
(d) Pancreas and parathyroid
50. Which hormone causes dilation of blood vessels,
[NEET (2008)] increased oxygen consumption an glucogenesis ?
41. The blood calcium level is lowered by the deficiency of: (a) ACTH (b) Insulin
(a) Both calcitonin and parathormone
(c) Adrenalin (d) Glucagon
(b) Calcitonin
[NEET (2006)]
(c) Parathormone
51. Which one of the following hormones is a modified
(d) Thyroxine
amino acid ?
[NEET (2008)] (a) Progesterone (b) Prostaglandin
42. Compared to a bull a bullok is docile because of:- (c) Estrogen (d) Epinephrine
(a) Lower levels of adrenalin/noradrenalin in its blood
[NEET (2004)]
(b) Higher levels of thyroxin
52. Which one of the following pair's correctly matches a 53. Chemically hormones are :-
hormone with a disease resulting from its deficiency :- (a) Proteins, steroids & biogenic amines
(a) Insulin – Diabetes insipidus (b) Proteins only
(b) Thyroxine – Tetany (c) Steroids only
(c) Parathyroid hormone – Diabetes mellitus (d) Biogenic amines only
(d) Luteinizing hormone – Failure of ovulation [NEET (2004)]
[NEET (2004)]
SEXUAL REPRODUCTION IN FLOWERING PLANTS 79
SEXUAL REPRODCTION IN FLOWERING PLANTS

1. Large, colourful, fragrant flowers with nectar are seen in 6. A typical angiosperm embryo sac at maturity is
(a) Bird pollinated plants (a) 7-nucleate and 7-celled
(b) Bat pollinated plants (b) 8-nucleate and 8-celled
(c) Wind pollinated plants (c) 8-nucleate and 7-celled
(d) Insect pollinated plants (d) 7-nucleate and 8-celled
[NEET (2021)]
[NEET (2023)]
7. The term used for transfer of pollen grains from anthers
2. What is the function of tassels in the corn cob? of one plant to stigma of a different plant which, during
(a) To trap pollen grains. pollination, brings genetically different types of pollen
(b) To disperse pollen grains. grains to stigma, is
(c) To protect seeds. (a) Chasmogamy
(d) To attract insects. (b) Cleistogamy
[NEET (2023)] (c) Xenogamy
(d) Geitonogamy
3. Identify the incorrect statement related to Pollination:
[NEET (2021)]
(a) Pollination by water is quite rare in flowering plants
8. In water hyacinth and water lily, pollination takes place
(b) Pollination by wind is more common amongst
by:
abiotic pollination (a) Wind and water
(c) Flowers produce foul odours to attract flies and (b) Insects and water
beetles to get pollinated
(c) Insects or wind
(d) Moths and butterflies are the most dominant
(d) Water currents only
pollinating agents among insects
[NEET (2020)]
[NEET (2022)] 9. The body of the ovule is fused within the funicle at
4. Given below are two statements: (a) Nucellus (b) Chalaza
Statement I : Cleistogamous flowers are invariably
(c) Hilum (d) Micropyle
autogamous
[NEET (2020)]
Statement II : Cleistogamy is disadvantageous as there
10. The plant parts which consist of two generations one
is no chance for cross pollination
within the other:
In the light of the above statements, choose the correct (i) Pollen grains inside the anther
answer from the options given below: (ii) Germinated pollen grain with two male gametes
(a) Both Statement I and Statement II are correct
(iii) Seed inside the fruit
(b) Both Statement I and Statement II are incorrect
(iv) Embryo sac inside the ovule
(c) Statement I is correct but Statement II is incorrect
(a) (iii) and (iv)
(d) Statement I is incorrect but Statement II is correct
(b) (i) and (iv)
[NEET (2022)] (c) (i) only
5. Which part of the fruit, labelled in the given figure (d) (ii) only
makes it a false fruit?
[NEET (2020)]
11. In some plants, the female gamete develops into embryo
without fertilization. This phenomenon is known as:
(a) Parthenocarpy
(b) Syngamy
(c) Parthenogenesis
(d) Autogamy
[NEET (2019)]
12. Persistent nucellus in the seed is known as:
(a) Perisperm
(b) Hilum
(c) Tegmen
(d) Chalaza
(a) A - Mesocarp [NEET (2019)]
(b) B - Endocarp 13. Which one of the following statements regarding post
(c) C - Thalamus fertilization development in flowering plants is
(d) D - Seed incorrect?
[NEET (2022)] (a) Zygote develops into embryo
(b) Central cell develops into endosperm 24. The ovule of an angiosperm is technically equivalent to
(c) Ovules develop into embryo sac (a) Megasporophyll
(d) Ovary develops into fruit (b) Megaspore mother cell
[NEET (2019)] (c) Megaspore
14. What is the fate of the male gametes discharged in the (d) Megasporangium
synergid? [NEET (2016-II)]
(a) All fuse with the egg 25. Pollination in water hyacinth and water lily is brought
(b) One fuses with the egg, the other(s) fuse(s) with a about by the agency of:
synergid nucleus (a) Birds
(c) One fuses with the egg and other fuses with central (b) Bats
cell nuclei (c) Water
(d) One fuses with the egg other(s) degenerate(s) in the (d) Insects or wind
synergid [NEET (2016-II)]
[NEET (2019)] 26. In majority of angiosperms
15. Winged pollen grains are present in (a) There are numerous antipodal cells
(a) Cycas (b) Mango (b) Reduction division occurs in the megaspore mother
(c) Mustard (d) Pinus cells
[NEET (2018)] (c) A small central cell is present in the embryo sac
16. Which of the following has proved helpful in preserving (d) Egg has a filiform apparatus
pollen as fossils? [NEET (2016-II)]
(a) Oil content (b) Cellulosic intine 27. Which of the following statements is not correct?
(c) Pollenkitt (d) Sporopollenin (a) Pollen grains of many spices can germinate on the
[NEET (2018)] stigma of a flower, but only one pollen tube of the same
17. Pollen grains can be stored for several years in liquid species grows into the style.
nitrogen having a temperature of (b) Insects that consume pollen or nectar without
(a) -196oC (b) -80oC bringing about pollination are called pollen/nectar
(c) -120oC (d) -160oC robbers.
[NEET (2018)] (c) Pollen germination and pollen tube growth are
18. Double fertilization is regulated by chemical components of pollen interacting
(a) Fusion of two male gametes with one egg with those of the pistil.
(b) Fusion of one male gamete with two polar nuclei (d) Some reptiles have also been reported as pollinators
(c) Fusion of two male gametes of a pollen tube with in some plant species.
two different eggs [NEET (2016-I)]
(d) Syngamy and triple fusion 28. Seed formation without fertilization in flowering plants
[NEET (2018)] involves the process of
19. A dioecious flowering plant prevents both (a) Sporulation
(a) Geitonogamy and xenogamy (b) Budding
(b) Cleistogamy and xenogamy (c) Somatic hybridization
(c) Autogamy and xenogamy (d) Apomixis
(d) Autogamy and geitonogamy [NEET (2016-I)]
[NEET (2017)] 29. Which of the following statements is NOT true?
20. Attractants and rewards are required for (a) Tapetum helps in the dehiscence of anther
(a) Hydrophily (b) Cleistogamy (b) Exine of pollen grain is made up of sporopollenin
(c) Anemophily (d) Entomophily (c) Pollen grains of many species cause severe
[NEET (2017)] allergies
21. Functional megaspore in an angiosperm, develops into (d) Stored pollen in liquid nitrogen can be used in the
(a) Embryo sac (b) Embryo crop breeding programmes
(c) Ovule (d) Endosperm [NEET (2016-I)]
[NEET (2017)] 30. Proximal end of the filament of stamen is attached to the
22. Flowers that have a single ovule in the ovary and are (a) Anther
packed into inflorescence are usually pollinated by (b) Connective
(a) Wind (b) Bat (c) Placenta
(c) Water (d) Bee (d) Thalamus or petal
[NEET (2017)] [NEET (2016-I)]
23. Double fertilization is exhibited by
(a) Fungi (b) Angiosperms 31. The coconut water from tender coconut represents :
(c) Gymnosperms (d) Algae (a) Endocarp
[NEET (2017)] (b) Fleshy mesocarp
(c) Free nuclear proembryo (c) Ex situ conservation

(d) Free nuclear endosperm (d) In vitro fertilisation
[NEET (2016-I)] [NEET (2014)]
32. Male gametophyte in angiosperms produces 41. Function of filiform apparatus is to
(a) Two sperms and a vegetative cell (a) Stimulate division of generative cell
(b) Single sperm and a vegetative cell (b) Produce nectar
(c) Single sperm and two vegetative cells (c) Guide entry of pollen tube
(d) Three sperms (d) Recognise the suitable pollen at stigma
[NEET (2015)] [NEET (2014)]
33. Which one of the following fruits is parthenocarpic? 42. Perisperm differs from endosperm in
(a) Brinjal (b) Apple (a) Being a haploid tissue
(c) Jackfruit (d) Banana (b) Having no reserve food
[NEET (2015)] (c) Being a diploid tissue
34. Coconut water from a tender coconut is (d) Its formation by fusion of secondary nucleus with
(a) Immature embryo several sperms
(b) Free nuclear endosperm [NEET (2013)]
(c) Innermost layers of the seed coat 43. Advantage of cleistogamy is
(d) Degenerated nucellus (a) Higher genetic variability
[NEET (2015)] (b) More vigorous offspring
35. Which of the following pairs is not correctly matched? (c) No dependence on pollinators
(a) Mode of reproduction- Offset; Example- Water (d) Vivipary
hyacinth [NEET (2013)]
(b) Mode of reproduction- Rhizome; Example- Banana 44. Which one of the following statements is correct?
(c) Mode of reproduction- Binary fission; Example - (a) Hard outer layer of pollen is called intine
Sargassum (b) Sporogenous tissue is haploid
(d) Mode of reproduction- Conidia; Example - (c) Endothecium produces the microspores
Penicillium (d) Tapetum nourishes the developing pollen
[NEET (2015)] [NEET (2013)]
36. Flowers are unisexual in: 45. Megasporangium is equivalent to
(a) Pea (b) Cucumber (a) Embryo sac
(c) China rose (d) Onion (b) Fruit
[NEET (2015)] (c) Nucellus
37. Filiform apparatus is a characteristic feature of (d) Ovule
(a) Generative cell [NEET (2013)]
(b) Nucellar embryo 46. Plants with ovaries having only one or a few ovules, are
(c) Aleurone cell generally pollinated by :
(d) Synergids (a) Butterflies
[NEET (2015)] (b) Birds
38. Male gametophyte with least number of cells is present (c) Wind
in: (d) Bees
(a) Funaria [NEET (2012)]
(b) Lilium
47. What is the function of genu pore ?
(c) Pinus
(a) Absorption of water for seed germination
(d) Pteris
(b) Initiation of pollen tube
[NEET (2014)]
(c) Release of male gametes
39. Geitonogamy involves
(d) Emergence of radicle
(a) Fertilisation of a flower by the pollen from the same
flower [NEET (2012)]
(b) Fertilisation of a flower by the pollen from a flower 48. Which one of the following statements is wrong ?
of another plant in the same population (a) Vegetative cell is larger than generative cell
(c) Fertilisation of a flower by the pollen from another (b) Pollen grains in some plants remain viable for
flower of plant belonging to a distant population months
(d) Fertilisation of a flower by the pollen from another (c) Intine is made up of cellulose and pectin
flower of the same plant (d) Wl1en pollen is shed at two-called stage, doubl e
[NEET (2014)] fertilization does not take place
40. Pollen tablets are available in the market for [NEET (2012)]
(a) Breeding programmes
(b) Supplementing food
49. Nucellar polyembryony is reported in species of : 60. What does the filiform apparatus do at the entrance into
(a) Brassica (b) Citrus ovule?
(c) Gossypium (d) Triticum (a) It brings about opening of the pollen tube
[NEET (2011)] (b) It guides pollen tube from a synergid to egg
50. Filiform apparatus is a characteristic feature of (c) It helps in the entry of pollen tube into a synergid
(a) Zygote (b) Suspensor (d) It prevents entry of more than one pollen tube into
(c) Egg (d) Synergid the embryo sac
[NEET (2011)] [NEET (2008)]
51. What would be the number of chromosomes of the 61. Which one of the following pairs of plant structures has
aleurone cells of a plant with 42 chromosomes in its root haploid number of chromosomes?
tip cells ? (a) Nucellus and antipodal cells
(a) 21 (b) 42 (b) Egg nucleus and secondary nucleus
(c) 63 (d) 84 (c) Megaspore mother cell and antipodal cells
[NEET (2011)] (d) Egg cell and antipodal cells
52. Wind pollination is common in : [NEET (2008)]
(a) Orchids (b) Legumes 62. In the prothallus of a vascular cryptogam, the
(c) Lilies (d) Grasses antherozoids and eggs mature at different times. As a
[NEET (2011)] result:
53 In which one of the following pollination is autogamous (a) Self fertilization is prevented
? (b) There is no change in success rate of fertilization
(a) Cleistogamy (b) Geitonogamy (c) There is high degree of sterility
(c) Xenogamy (d) Chasmogamy (d) One can conclude that the plant is apomictic
[NEET (2011)] [NEET (2007)]
54. Apomictic embryos in citrus arise from : 63. In gymnosperms, the pollen chamber represents:
(a) Synergids (a) The microsporangium in which pollen grains
(b) Maternal sporophytic tissue in ovule develop
(c) Antipodal cells (b) A cell in the pollen grain in which the sperms are
(d) Diploid egg formed
[NEET (2010)] (c) A cavity in the ovule in which pollen grains are
55. Transfer of pollen grains from the anther to the stigma stored after pollination
of another flower of the same plant is called : (d) An opening in the megagametophyte through which
(a) Xenogamy (b) Geitonogamy the pollen tube approaches the egg
(c) Karyogamy (d) Autogamy [NEET (2007)]
[NEET (2010)] 64. Male gametes in angiosperms are formed by the division
56. Wind pollinated flowers are – of:
(a) Small, brightly coloured, producing large number of (a) Microspore mother cell (b) Microspore
pollen grains (c) Generative cell (d) Vegetative cell
(b) Small, proudcing large number of dry pollen grains [NEET (2007)]
(c) Large producing abundant nectar and pollen 65. What would be the number of chromosomes in the cells
(d) Small, producing nectar and dry pollen of the aleurone layer in a plant species with 8
[NEET (2010)] chromosomes in its synergids ?
57. Which one of the following plants is monoecios ? (a) 16 (b) 24
(a) Papaya (b) Marchantia (c) 32 (d) 8
(c) Pinus (d) Cycas [NEET (2006)]
[NEET (2009)] 66. Long filamentous threads protruding at the end of a
58. Unisexuality of flowers prevents: young cob of maize are-
(a) Geitonogamy, but not xenogamy (a) Anthers (b) Styles
(b) Autogamy and geitonogamy (c) Ovaries (d) Hairs
(c) Autogamy, but not geitonogamy [NEET (2006)]
(d) Both geitonogamy and xenogamy 67. The arrangement of the nuclei in a normal embryo sac
[NEET (2008)] in the dicot plants is-
59. Which one of the following is resistant to enzyme (a) 2 + 4 + 2 (b) 3 + 2 + 3
action? (c) 2 + 3 + 3 (d) 3 + 3 + 2
(a) Pollen exine [NEET (2006)]
(b) Leaf cuticle 68. Through which cell of the embryo sac, does the pollen
(c) Cork tube enter the embryo sac-
(d) Wood fibre (a) Persistant synergid
[NEET (2008)] (b) Egg cell
(c) Central cell (a) Amphitropous (b) Anatropous

(d) Degenerated synergid (c) Circinotropous (d) Atropous
[NEET (2005)] [NEET (2005)]
69. In a type of apomixis known as adventive embryony, 71. An ovule which becomes curved so that the nucellus and
embryos develop directly from the - embryo sac lie at right angles to the funicle is :-
(a) Synergids or antipodals in an embryo sac (a) Campylotropous
(b) Nucellus or integuments (b) Anatropous
(c) Zygote (c) Orthotropous
(d) Accessory embryo sacs in the ovule (d) Hemitropous
[NEET (2005)] [NEET (2004)]
70. Which one of the following represents an ovule, where
the embryo sac becomes horse- shoe shaped and the
funiculus and micropyle are close to each other -
HUMAN REPRODUCTION 84
HUMAN REPRODUCTION
1. Given below are two statements: (e) It is initiated at puberty
Statement I: Vas deferens receives a duct from seminal Choose the most appropriate answer from the options
vesicle and opens into urethra as the ejaculatory duct. given below:
Statement II: The cavity of the cervix is called cervical (a) (c) and (e) only
canal which along with vagina forms birth canal. (b) (b) and (c) only
In the light of the above statements, choose the correct (c) (b), (d) and (e) only
answer from the options given below: (d) (b), (c) and (e) only
(a) Both Statement I and Statement II are false.
[NEET (2022)]
(b) Statement I is correct, but Statement II is false.
5. At which stage of life the oogenesis process is initiated?
(c) Statement I is incorrect, but Statement II is true.
(a) Puberty
(d) Both Statement I and Statement II are true. (b) Embryonic development stage
[NEET (2023)] (c) Birth
2. Given below are two statements: one is labelled as (d) Adult
Assertion A and the other is labelled as Reason R. [NEET (2022)]
Assertion A: Endometrium is necessary for implantation 6. The number of autosomes in human primary
of blastocyst. spermatocyte is
Reason R: In the absence of fertilization, the corpus (a) 46
luteum degenerates that causes disintegration of (b) 44
endometrium. (c) 23
In the light of the above statements, choose the correct (d) 22
answer from the options given below: [NEET (2021)]
(a) Both A and R are true, but R is NOT the correct 7. Which of the following secretes the hormone, relaxin,
explanation of A. during the later phase of pregnancy?
(b) A is true, but R is false. (a) Foetus
(c) A is false, but R is true. (b) Uterus
(c) Graafian follicle
(d) Both A and R are true, and R is the correct
(d) Corpus luteum
explanation of A.
[NEET (2021)]
[NEET (2023)] 8. Which of these is not an important component of
3. Given below are two statements: initiation of parturition in humans?
Statement I: The release of sperms into the seminiferous (a) Release of oxytocin
tubules is called spermiation. (b) Release of prolactin
Statement II: Spermiogenesis is the process of formation (c) Increase in estrogen and progesterone ratio
of sperms from spermatogonia. (d) Synthesis of prostaglandins
In the light of the above statements, choose the most [NEET (2021)]
appropriate answer from the options given below: 9. Which of the following hormone levels will cause
(a) Both Statement I and Statement II are correct release of ovum (ovulation) from the graafian follicle ?
(b) Both Statement I and Statement II are incorrect (a) Low concentration of LH
(c) Statement I is correct but Statement II is incorrect (b) Low concentration of FSH
(d) Statement I is incorrect but Statement II is correct (c) High concentration of Estrogen
[NEET (2022)] (d) High concentration of Progesterone
4. Which of the following statements are true for [NEET (2020)]
spermatogenesis but do not hold true for Oogenesis? 10. Meiotic division of the secondary oocyte is
completed
(a) It results in the formation of haploid gametes (a) After zygote formation
(b) Differentiation of gamete occurs after the completion (b) At the time of fusion of a sperm with an ovum
of meiosis (c) Prior to ovulation
(c) Meiosis occurs continuously in a mitotically dividing (d) At the time of copulation
stem cell population [NEET (2020)]
(d) It is controlled by the Luteinizing hormone (LH) and 11. Match the following columns and select the correct
Follicle Stimulating Hormone (FSH) secreted by the option
anterior pituitary
Column I Column II (a) a → (i); b → (iii); c → (ii)

(b) a → (ii); b → (iii); c → (i)
(a) Placenta (i) Androgens (c) a → (iii); b → (ii); c → (i)
(d) a → (iii); b → (i); c → (ii)
(b) Zona pellucida (ii) Human Chorionic [NEET (2018)]
Gonadotropin (hCG) 16. The difference between spermiogenesis and spermiation
is
(c) Bulbo-urethral (iii) Layer of the ovum (a) In spermiogenesis spermatozoa from Sertoli cells are
released into the cavity of seminiferous tubules, while in
glands
spermiation spermatozoa are formed
(b) In spermiogenesis spermatozoa are formed, while
(d) Leydig cells (iv) Lubrication of the penis in spermiation spermatids are formed
(c) In spermiogenesis spermatids are formed, while in
spermiation spermatozoa are formed
(a) a – iii; b – ii; c – iv; d - i (d) In spermiogenesis spermatozoa are formed, while
(b) a – ii; b – iii; c – iv; d – i in spermiation spermatozoa are released from Sertoli
(c) a – iv; b – iii; c – i; d – ii cells into the cavity of seminiferous tubules
(d) a – i; b – iv; c – ii; d – iii [NEET (2018)]
[NEET (2020)] 17. The amnion of mammalian embryo is derived from
12. Select the correct sequence for transport of sperm cells (a) Mesoderm and trophoblast
in male reproductive system. (b) Endoderm and mesoderm
(a) Seminiferous tubules → Rete testis → duct Urethra (c) Ectoderm and mesoderm
→ Urethral meatus Vasa efferentia → Epididymis → (d) Ectoderm and endoderm
Vas deferens → Ejaculatory duct Urethra → Urethral [NEET (2018)]
meatus 18. Capacitation occurs in
(b) Seminiferous tubules → Vasa efferentia → (a) Vas deferens
Epididymis → Inguinal canal → Urethra (b) Female Reproductive tract
(c) Testis → Epididymis → Vasa efferentia → Vas (c) Rete testis
deferens → Ejaculatory duct → Inguinal canal → (d) Epididymis
Urethra → Urethral meatus [NEET (2017)]
(d) Testis → Epididymis → Vasa efferentia → Rete 19. Match Column-I with Column-II and select the
testis → Inguinal canal → Urethra CORRECT option using the codes given below:
[NEET (2019)]
13. Extrusion of second polar body from egg nucleus occurs Column-I Column-II
(a) After fertilization
(b) Before entry of sperm into ovum
a) Mons pubis i) Embryo formation
(c) Simultaneously with first cleavage
(d) After entry of sperm but before fertilization
b) Antrum ii) Sperm
[NEET (2019)]
14. Hormones secreted by the placenta to maintain
pregnancy are c) Trophectoderm iii) Female external
(a) hCG, hPL, progestogens, estrogens genitalia
(b) hCG, hPL, estrogens, relaxin, oxytocin
(c) hCG, hPL, progestogens, prolactin d) Nebenkern iv) Graafian follicle
(d) hCG, progestogens, estrogens, glucocorticoids
[NEET (2018)]
15. Match the items given in column I with those in Column (a) a) - iii), b) - iv), c) - i), d) - ii)
II and select the correct option given below (b) a) - iii), b) - i), c) - iv), d) - ii)
Column I Column II (c) a) - i), b) - iv), c) - iii), d - ii)
(d) a) - iii), b) - iv), c) - ii), d) - i)
(a) Proliferative (i) Breakdown of [NEET (2016-II)]
phase endometrial lining 20. Which of the following depicts the CORRECT pathway
of transport of sperms?
(a) Rete testis → Epididymis → Efferent ductules →
(b) Secretory phase (ii) Follicular phase
Vas deferens
(b) Rete testis → Vas deferens → Efferent ductules →
(c) Menstruation (iii) Luteal phase
Epididymis
(c) Efferent ductules → Rete testis → Vas deferens →
Epididymis
(d) Rete testis → Efferent ductules → Epididymis → 29. Menstrual flow occurs due to lack of
Vas deferens (a) Progesterone (b) FSH
[NEET (2016-II)] (c) Oxytocin (d) Vasopressin
21. Fertilization in human is practically feasible only if : [NEET (2013)]
(a) The sperms are transported into vagina just after the 30. What is the correct sequence of sperm formation?
release of ovum in fallopian tube (a) Spermatid, Spermatocyte, Spermatogonia,
(b) The ovum and sperms are transported Spermatozoa
simultaneously to ampullary-isthmic junction of the (b) Spermatogonia, Spermatocyte, Spermatozoa,
fallopian tube Spermatid
(c) The ovum and sperms are transported (c) Spermatogonial, Spermatozoa, Spermatocyte,
simultaneously to ampullary-isthmic junction of the Spermatia
cervix (d) Spermatogonia, Spermatocyte, Spermatid,
(d) The sperms are transported into cervix within 48 Spermatozoa
hrs of release of ovum in uterus [NEET (2013)]
[NEET (2016-I)] 31. The secretory phase in the human menstrual cycle is also
22. In human females, meiosis-II is not completed until? called :
(a) Puberty (b) Fertilisation (a) Follicular phase lasting for about 6 days
(c) Uterine implantation (d) Birth (b) Luteal phase and lasts for about 13 days
[NEET (2015)] (c) Follicular phase and lasts for about 13 days
23. Which of the following layers in an antral follicle is (d) Luteal phase and lasts for about 6 days
acellular?
[NEET (2012)]
(a) Granulosa (b) Theca interna
(c) Stroma (d) Zona pellucida 32. Identify the human development stage shown below as
[NEET (2015)] well as the related right place of its occurrence in a
24. Which of the following events is not associated with nonnal pregnant women and select the right option for
ovulation in human females? the two together –
(a) Decrease in estradiol
(b) Full development of Graafian follicle
(c) Release of secondary oocyte
(d) LH surge
[NEET (2015)]
25. Ectopic pregnancies are referred to as:
(a) Pregnancies with genetic abnormality. (a) Developmental stage-Blastula; Site of occurrence-
(b) Implantation of embryos at sites other than the End part of Fallopian tube
uterus. (b) Developmental stage-Blastocyst; Site of
(c) Implantation of defective embryos in the uterus. occurrence-Uterine wall
(d) Pregnancies terminated due to hormonal imbalance. (c) Developmental stage-8-celled morula; Site of
[NEET (2015)] occurrence-Starting point of Fallopian tube
26. The shared terminal duct of the reproductive and urinary
(d) Developmental stage-Late morula; Site of
system in the human male is
occurrence-Middle part of Fallopian tube
(a) Ureter (b) Vas deferens
(c) Vasa efferentia (d) Urethra [NEET (2012)]
[NEET (2014)] 33. The figure given below depicts a diagrammatic sectional
27. The main function of mammalian corpus luteum is to view of the female reproductive system of humans.
produce Which one set of three parts out of I- VI have been
(a) Progesterone correctly identified ?
(b) Human chorionic gonadotropin
(c) Relaxin only
(d) Estrogen only
[NEET (2014)]
28. Which one of the following is not a function of placenta?
(a) Facilitates supply of oxygen and nutrients to the
embryo.
(b) Secretes estrogen.
(c) Facilitates removal of carbon dioxide and waste (a) (I) Perimetrium, (II) Myometrium, (III) Fallopian
material from embryos. tube
(d) Secretes oxytocin during parturition. (b) (II) Endometrium, (III) Infundibulum, (IV)
[NEET (2013)] Fimbriage
(c) (III) Infundibulum, (IV) Fimbriae, (V) Cervix 41. Which one of the following statements about human
(d) (IV) Oviducal funnel, (V) Uterus (VI) Cervix sperm is correct –
(a) Acrosome has a conical pointed structure used for
[NEET (2011)]
piercing and penetrating the egg, resulting in
34. If for some reason, the vasa efferentia in the human
fertilisation
reproductive system get blocked, the gametes will not
(b) The sperm lysins in the acrosome dissolve th egg
be transported from :
envelope facilitating fertilisation
(a) Vagina to uterus
(c) Acrosome serves as a sensory structure leading the
(b) Testes to epididymis
sperm towards the ovum
(c) Epididymis to vas deferens
(d) Acrosome serves no particular function
(d) Ovary to uterus [NEET (2010)]
[NEET (2011)] 42. Which one of the following statements about morula in
35. Sertoli cells are found in : humans is correct –
(a) Ovaries and secrete progesterone (a) It has almost equal quantity of cytoplasm as an
(b) Adrenal cortex and secrete adrenaline uncleaved zygote but much more DNA
(c) Seminiferous tubules and provide nutrition to germ (b) It has far less cytoplasm as well as less DNA than
cells in an uncleaved zygote
(d) Pancreas and secrete cholecystokinin (c) It has more or less equal quantity of cytoplasm and
[NEET (2010)] DNA as in uncleaved zygote
36. Vasa efferentia are the ductules leading from: (d) It has more cytoplasm and more DNA than an
(a) Testicular lobules to rete testis uncleaved zygote
(b) Rete testis to vas deferens [NEET (2010)]
(c) Vas deferens to epididymis 43. The part of Fallopian tube closest to the voary is
(d) Epididymis to urethra (a) Isthmus
[NEET (2010)] (b) Infundibulum
37. Seminal plasma in human males is rich in – (c) Cervix
(a) Fructose and calcium (d) Ampulla
(b) Glucose and calcium [NEET (2010)]
(c) DNA and testosterone 44. A young infant may be feeding entirely on mother's milk
(d) Ribose and potassium which is white in colour but the stools which the infant
[NEET (2010)] passes out is quite yellowish. What is this yellow colour
38. The signals for parturition orginate from – due to ?
(a) Placenta only (a) Pancreatic juice poured into duodenum
(b) Placenta as well as fully developed foetus (b) Intestinal juice
(c) Oxytocin released from maternal pituitary (c) Bile pigments passed through bile juice
(d) Fully developed foetus only (d) Undigested milk protein casein
[NEET (2010)] [NEET (2009)]
39. The first movements of the foetus and appearance of hair 45. Seminal plasma in humans is rich in :
on its head are usually observed during which month of (a) Fructose and certain enzymes but poor calcium
pregnancy? (b) Fructose and calcium but has no enzyme
(a) Fourth month (c) Fructose, calcium and certain enzymes
(b) Fifth month (d) Glucose and certain enzymes but has no calcium
(c) Sixth month [NEET (2009)]
(d) Third month 46. Given below is a diagrammatic sketch for a portion of
[NEET (2010)] human male reproductive system. Select the correct set
40. The second maturation division of the mammalian ovum of the names of the parts labelled A, B, C, D.
occurs –
(a) Shortly after ovulation before the ovum makes entry
into the Fallopian tube
(b) Until after the ovum has been penetrated by a
sperm
(c) Until the nucleus of the sperm has fused with that of
the ovum
(d) In the Grafian follicle following the first maturation
(a) A- Ureter; B- Seminal vesicle; C- Prostate; D-
division
Bulbourethral gland
[NEET (2010)]
(b) A- Ureter; B- Prostate; C- Seminal vesicle; D-
Bulbourethral gland
(c) A- Vas deferens; B- Seminal vesicle; C- Prostate; (b) The beginning of the cycle of menstruation is called
D- Bulbourethral gland menarche
(d) A- Vas deferens; B- Seminal vesicle; C- (c) During normal menstruation about 40 ml blood is
Bulbourethral gland; D- Prostate lost
[NEET (2009)] (d) The menstrual fluid can easily clot
[NEET (2008)]
47. Foetal ejection reflex in human female is induced by 54. Which extraembryonic membrane in humans prevents
(a) Differentiation of mammary glands desiccation of the embryo inside the uterus?
(b) Pressure exerted by amniotic fluid (a) Yolk sac (b) Amnion
(c) Release of oxytocin from pituitary (c) Chorion (d) Allantois
(d) Fully developed foetus and placenta [NEET (2008)]
[NEET (2009)] 55. In human adult females oxytocin:
48. Which of the following is the correct matching of the (a) Stimulates pituitary to secrete vasopressin
events occurring during menstrual cycle ? (b) Causes strong uterine contractions during
(a) Menstruation - Breakdown of myometrium and parturition
ovum not fertilized (c) Is secreted by anterior pituitary
(b) Ovulation - LH and FSH attain peak level and sharp (d) Stimulates growth of mammary glands
fall in the secretion of progesterone [NEET (2008)]
(c) Proliferative phase - Rapid regeneration of 56. Match the disease in Column I with the appropriate
myometrium and maturation of Grafian follicle items (pathogen/ prevention/treatment) in Column II.
(d) Development of corpus luteum- Secretory phase
and increased secretion of progesterone. Column I Column II
[NEET (2009)]
49. Which one of the following is the most likely root cause (A) Amoebiasis (i) Treponema pallidium
why menstruation is not taking place in regularly
cycling human female ? (B) Diphtheria (ii) Use only sterilized food
(a) Retention of well-developed corpus luteum and water
(b) Fertilization of the ovum
(c) Maintenance of the hypertrophical endometrial (C) Cholera (iii) DPT Vaccine
lining
(d) Maintenance of high concentration of sex-
(D) Syphilis (iv) Use oval rehydration
hormones in the blood stream
[NEET (2009)] therapy
50. The correct sequence of spermatogenetic stages leading
to the formation of sperms in a mature human testis is : (a) A = (ii), B = (i), C = (iii), D = (iv)
(a) Spermatogonia-spermatid-spermatocyte-sperms (b) A = (ii), B = (iii), C = (iv), D = (i)
(b) Spermatocyte-spermatogonia-spermatid-sperms (c) A = (ii), B = (iii), C = (iv), D = (i)
(c) Spermatogonia-spermatocyte-spermatid-sperms (d) A = (ii), B = (iii), C = (iv), D = (i)
(d) Spermatid-spermatocyte-spermatogonia-sperms [NEET (2008)]
[NEET (2009)] 57. In the human female, menstruation can be deferred by
51. A change in the amount of yolk and its distribution in the administration of:-
the egg will effect : (a) FSH only
(a) Fertilization (b) LH only
(b) Formation of zygote (c) Combination of FSH and LH
(c) Pattern of cleavage (d) Combination of estrogen and progesterone
(d) Number of blastomeres produced [NEET (2007)]
[NEET (2009)] 58. Which part of ovary in mammals acts as an endocrine
52. When breast feeding is replaced by less nutritive food gland after ovulation ?
low in proteins and calories, the infants below the age of (a) Vitelline membrane
one year are likely to suffer from : (b) Graffian follicle
(a) Pellagra (b) Marasmus (c) Stroma
(c) Rickets (d) Kwashiorkor (d) Germinal epithelium
[NEET (2009)] [NEET (2007)]
53. Which one of the following statements is incorrect about 59. Withdrawal of which of the following hormones is the
menstruation? immediate cause of menstruation ?
(a) At menopause in the female, there is especially (a) Estrogen (b) FSH
abrupt increase in gonadotropic hormones (c) FSH-RH (d) Progesterone
[NEET (2006)]
60. If mammalian ovum fails to get fertilized, which one of (c) At the end of the proliferative phase
the following is unlikely - (d) At the mid secretory phase
(a) Estrogen secretion further decreases [NEET (2004)]
(b) Progesterone secretion rapidly declines 62. Which of the following hormones is not a secretion
(c) Corpus luteum will disintegrate product of human placenta -
(d) Primary follicle starts developing (a) Prolactin
[NEET (2005)] (b) Estrogen
61. Ovulation in the human female normally takes place (c) Progesterone
during the menstrual cycle - (d) Human chorionic gonadotropin
(a) Just before the end of the secretory cycle [NEET (2004)]
(b) At the beginning of the proliferative phase
REPRODUCTIVE HEALTH 90
REPRODUCTIVE HEALTH
1. Given below are two statements: one is labelled as List I List II
Assertion A and the other is labelled as Reason R. (a) Diaphragms (i) Inhibit ovulation and
Assertion A: Amniocentesis for sex determination is one Implantation
of the strategies of Reproductive and Child Health Care
Programme. (b) Contraception (ii) Increase phagocytosis
Reason R: Ban on amniocentesis checks increasing Pills of sperm within
menace of female foeticide. Uterus
In the light of the above statements, choose the correct (c) Intrauterine (iii) Absences of
answer from the options given below: Devices Menstrual cycle and
(a) Both A and R are true, and R is NOT the correct ovulation following
explanation of A.
partition
(b) A is true, but R is false.
(c) A is false, but R is true. (d) Lactational (iv) They cover the cervix
(d) Both A and R are true, and R is the correct Amenorrhea blocking the entry of
explanation of A. sperms
[NEET (2023)]
(a) (a)- (iv); (b) - (i); (c) - (iii);(d) - (ii)
2. Match List I with List II. (b) (a)- (iv); (b) - (i); (c) - (ii);(d) - (iii)
(c) (a)- (ii); (b) - (iv); (c) - (i);(d) - (iii)
List I List II (d) (a)- (iii); (b) - (ii); (c) - (i);(d) - (iv)
A. Vasectomy I. Oral method [NEET (2022)]
B. Coitus interruptus II. Barrier method 6. Match list I with list II.
C. Cervical caps III. Surgical method
D. Saheli IV. Natural method List I List II
(a) Vaults (i) Entry of sperm through
Choose the correct answer from the options given Cervix is blocked
below: (b) IUDs (ii) Removal of Vas deferens
(a) A–III, B–IV, C–II, D–I (c) Vasectomy (iii) Phagocytosis of sperms
(b) A–II, B–III, C–II, D–IV within the Uterus
(c) A–IV, B–II, C–I, D–III
(d) Tubectomy (iv) Removal of fallopian tube
(d) A–III, B–I, C–IV, D–II
(a) (a)- (ii); (b) - (iv); (c) - (iii);(d) - (i)
[NEET (2023)] (b) (a)- (iii); (b) - (i); (c) - (iv);(d) - (ii)
3. Which one of the following common sexually (c) (a)- (iv); (b) - (ii); (c) - (i);(d) - (iii)
transmitted diseases is completely curable when (d) (a)- (i); (b) - (iii); (c) - (ii);(d) - (iv)
detected early and treated properly? [NEET (2021)]
(a) Gonorrhoea 7. Which one of the following is an example of Hormone
(b) Hepatitis B releasing IUD?
(c) HIV infection (a) Cu 7 (b) Multiload 375
(d) Genital herpes (c) CuT (d) LNG-20
[NEET (2023)] [NEET (2021)]
4. Lippes loop is a type of contraceptive used as: 8. Venereal diseases can spread through:
(a) Cervical barrier (a) Using sterile needles;
(b) Vault barrier (b) Transfusion of blood from infected person;
(c) Non-Medicated IUD (c) Infected mother to foetus;
(d) Kissing;
(d) Copper releasing IUD (e) Inheritance
[NEET (2022)] Choose the correct answer from the options below:
5. Match list I with list II with respect to methods of (a) (b) and (c) only
contraception and their respective actions. Choose the (b) (a) and (c) only
correct answer from the options given below : (c) (a), (b) and (c) only
(d) (b), (c) and (d) only
[NEET (2021)]
9. Select the option including all sexually transmitted (b) (a)-(iv); (b)-(iii); (c)-(ii); (d)-(i)
diseases. (c) (a)-(ii); (b)-(iii); (c)-(iv); (d)-(i)
(a) AIDS, Malaria, filaria (d) (a)-(iii); (b)-(iv); (c)-(i); (d)-(ii)
(b) Cancer, AIDS, syphilis [NEET (2017)]
(c) Gonorrhoea, Syphilis, Genital Herpes 17. The function of copper ions in copper releasing IUDs is
(d) Gonorrhoea, tuberculosis and Genital herpes (a) They make the uterus unsuitable for implantation
[NEET (2020)] (b) They inhibit ovulation
10. In which of the following techniques, the embryos (c) They suppress sperm motility and fertilising
are transferred to assist those females who cannot capacity of sperms
conceive? (d) They inhibit gametogenesis
(a) ICSI and ZIFT (b) GIFT and ICSI [NEET (2017)]
(c) ZIFT and IUT (d) GIFT and ZIFT 18. Embryo with more than 16 blastomeres formed due to
[NEET (2020)] in vitro fertilization is transferred into
11. Which of the following contraceptive methods do (a) Fallopian tube (b) Fimbriae
involve a role of hormone? (c) Cervix (d) Uterus
(a) Barrier method, Lactational amenorrhea pills [NEET (2016-II)]
(b) CuT, Pills, Emergency contraceptives 19. Which of the following is INCORRECT regarding
(c) Pills, Emergency contraceptives, Barrier methods. vasectomy?
(d) Lactational amenorrhea, Pills, Emergency (a) No sperm occurs in epididymis
contraceptives (b) Vasa deferentia is cut and tied
[NEET (2019)] (c) Irreversible sterility
12. Select the hormone-releasing Intra-Uterine Devices. (d) No sperm occurs in seminal fluid
(a) Multiload 375, Progestasert [NEET (2016-II)]
(b) Progestasert, LNG-20 20. Which of the following is hormone releasing IUD?
(c) Lippes Loop, Multiload 375 (a) Multiload 375 (b) Lippes loop
(d) Vaults, LNG-20 (c) Cu7 (d) LNG-20
[NEET (2019)] [NEET (2016-II)]
13. Which of the following sexually transmitted diseases is 21. Which of the following approaches does not give the
not completely curable? defined action of contraceptive?
(a) Genital warts (b) Genital herpes (a) Barrier Methods - Prevent fertilization
(c) Chlamydiasis (d) Gonorrhoea (b) Intrauterine devices - Increase phagocytosis of
[NEET (2019)] sperms, suppress sperm motility and fertilizing
14. The contraceptive ‘SAHELI’ capacity of sperms
(a) Is an IUD (c) Hormonal contraceptives - Prevent/retard of
(b) Increases the concentration of estrogen and sperms, prevent ovulation and fertilization
prevents ovulation in females (d) Vasectomy – Prevents spermatogenesis
(c) Blocks estrogen receptors in the uterus. Preventing [NEET (2016-I)]
eggs from getting implanted 22. In the context of Amniocentesis, which of the following
(d) is a post-coital contraceptive statement is incorrect?
[NEET (2018)] (a) It is usually done when a woman is between 14 and
15. In case of a couple where the male is having a very low 16 weeks pregnant
sperm count, which technique will be suitable for (b) It is used for prenatal sex determination
fertilisation? (c) It can be used for detection of Down syndrome
(a) Intrauterine transfer (d) It can be used for detection of Cleft palate
(b) Gamete intracytoplasmic fallopian transfer [NEET (2016-I)]
(c) Artificial Insemination 23. A childless couple can be assisted to have a child
(d) Intracytoplasmic sperm injection through a technique called GIFT. The full form of this
[NEET (2017)] technique is
16. Match the following sexually transmitted diseases (a) Gamete Inseminated Fallopian Transfer
(Column -I) with their causative agent (Column -II) and (b) Gamete Intra Fallopian Transfer
select the correct option. (c) Gamete Internal Fertilization and Transfer
Column I Column II (d) Germ cell Internal Fallopian Transfer
(a) Gonorrhea (i) HIV [NEET (2015)]
(b) Syphilis (ii) Neisseria 24. Which of the following is a hormone releasing
intrauterine device (IUD)?
(c) Genital warts (iii) Treponema (a) LNG – 20 (b) Cervical cap
(d) AIDS (iv) Human Papillomavirus (c) Vault (d) Multiload 375
(a) (a)-(iv); (b)-(ii); (c)-(iii); (d)-(i) [NEET (2014)]
25. Tubectomy is a method of sterilisation in which 31. Medical Termination of Pregnancy (MTP) is considered
(a) Ovaries are removed surgically safe up to how many weeks of pregnancy ?
(b) Small part of vas deferens is removed or tied up (a) Six weeks (b) Eight weeks
(c) Uterus is removed surgically (c) Twelve weeks (d) Eighteen weeks
(d) Small part of the fallopian tube is removed or tied [NEET (2011)]
up 32. In vitro fertilization is a technique that involves transfer
[NEET (2014)] of which one of the following into the fallopian tube?
26. Assisted reproductive technology, IVF involves transfer (a) Embryo only, upto 8 cell stage
of (b) Either zygote or early embryo upto 8 cell stage
(a) Zygote into the fallopian tube (c) Embryo of 32 cell stage
(b) Zygote into the uterus (d) Zygote only
(c) Embryo with 16 blastomeres into the fallopian tube [NEET (2010)]
(d) Ovum into the fallopian tube 33. The permissible use of the technique aminocentesis is
[NEET (2014)] for –
27. Artificial insemination means (a) Detecting sex of the unborn foetus
(a) Transfer of sperms of a healthy donor to a test tube (b) Artificial insemination
containing ova (c) Transfer of embryo into the uterus of a surrogate
(b) Transfer of sperms of husband to a test tube mother
containing ova
(d) Detecting any genetic abnormality
(c) Artificial introduction of sperms of a healthy donor
into the vagina [NEET (2010)]
(d) Introduction of sperms of healthy donor directly 34. Cu ions released from copper-releasing Intra Uterine
into the ovary Devices (IUDs) –
[NEET (2013)] (a) Make uterus unsuitable for implantation
28. Which of the following cannot be detected in a (b) Increase phagocytosis of sperms
developing foetus by amniocentesis? (c) Suppress sperm motility
(a) Klinefelter syndrome (d) Prevent ovulation
(b) Sex of the foetus [NEET (2010)]
(c) Down syndrome 35. Given below are four methods (A-D) and their modes of
(d) Jaundice action (1-4) in achieving contraception. Select their
[NEET (2013)] correct matching from the four options that follow:
29. One of the legal methods of birth control is Method Mode of Action
(a) Abortion by taking an appropriate medicine (1) The pill (a) Prevents sperms
(b) By abstaining from coitus from by 10 to 17 of the reaching cervix
menstrual cycle (2) Condom (b) Prevents implantation
(c) By having coitus at the time of day break
(3) Vasectomy (c) Prevents ovaulation
(d) By a premature ejaculation during coitus
[NEET (2013)] (4) Copper-T (d) Semen contains no
30. Which one of the following is the most wide accepted sperms
method of contraception in India, as at present ? (a) 1 = (c), 2 = (d), 3 = (a), 4 = (b)
(a) IUDs' (Intra uterine devices) (b) 1 = (b), 2 = (c), 3 = (a), 4 = (d)
(b) Cervical caps (c) 1 = (c), 2 = (a), 3 = (d), 4 = (b)
(c) Tubectomy (d) 1 = (d), 2 = (a), 3 = (b), 4 = (c)
(d) Diaphragms [NEET (2008)]
[NEET (2011)]
PRINCIPLES OF INHERITANCE AND VARIATION 93
PRINCIPLES OF INHERITANCE AND VARIATION

1. Frequency of recombination between gene pairs on 6. Upon exposure to UV radiation, DNA stained with
same chromosome as a measure of the distance between ethidium bromide will show
genes to map their positions on chromosome was used (a) Bright blue colour
for the first time by (b) Bright yellow colour
(a) Sutton and Boveri (c) Bright orange colour
(b) Alfred Sturtevant (d) Bright red colour
(c) Henking
[NEET (2023)]
(d) Thomas Hunt Morgan 7. Match List I with List II.
[NEET (2023)]
2. The phenomenon of pleiotropism refers to List I List II
(a) Presence of two alleles, each of the two genes A. Logistic I. Unlimited resource
controlling a single trait growth availability condition
(b) A single gene affecting multiple phenotypic B. Exponential II. Limited resource
expression
growth availability condition
(c) More than two genes affecting a single character
C. Expanding III. The percent individuals of
(d) Presence of several alleles of a single gene
age pyramid pre-reproductive age are
controlling a single crossover
lar reproductive and post-
[NEET (2023)]
reproductive age groups
3. Which of the following statements are correct about
gest followed by
Klinefelter’s syndrome?
A. This disorder was first described by Langdon Down reproductive and post-
(1866). reproductive age groups
B. Such an individual has overall masculine D. Stable age IV. The percent individuals of
development. However, the feminine development is pyramid pre-reproductive and
also expressed. reproductive age group
C. The affected individual is short-statured. are same
D. Physical, psychomotor and mental development is
retarded.
E. Such individuals are sterile. (a) A–II, B–III, C–I, D–IV
Choose the correct answer from the options given (b) A–II, B–IV, C–I, D–III
below: (c) A–II, B–IV, C–III, D–I
(a) C and D only (d) A–II, B–I, C–III, D–IV
(b) B and E only [NEET (2023)]
(c) A and E only 8. Given below are two statements:
Statement I : Mendel studied seven pairs of contrasting
(d) A and B only traits in pea plants and proposed the Laws of Inheritance
[NEET (2023)] Statement II : Seven characters examined by Mendel in
4. Broad palm with single palm crease is visible in a person his experiment on pea plants were seed shape and
suffering from colour, flower colour, pod shape and colour, flower
(a) Turner’s syndrome position and stem height
(b) Klinefelter’s syndrome In the light of the above statements, choose the correct
(c) Thalassemia answer from the options given below:
(d) Down’s syndrome (a) Both Statement I and Statement II are correct
[NEET (2023)] (c) Statement I is correct but Statement II is incorrect
5. Among ‘The Evil Quartet’, which one is considered the (d) Statement I is incorrect but Statement II is correct
most important cause driving extinction of species? [NEET (2022)]
(a) Overexploitation for economic gain 9. XO type of sex determination can be found in
(b) Alien species invasions (a) Drosophila (b) Birds
(c) Co-extinctions (c) Grasshoppers (d) Monkeys
(d) Habitat loss and fragmentation [NEET (2022)]
[NEET (2023)]
10. Which of the following occurs due to the presence of an 17. Select the correct match
autosome linked dominant trait? (a) Sickle cell anaemia - Autosomal recessive trait,
(a) Sickle cell anaemia chromosome – 11
(b) Myotonic dystrophy (b) Thalassemia - X linked
(c) Haemophilia (c) Haemophilia - Y linked
(d) Thalassemia (d) Phenylketonuria - Autosomal dominant trait
[NEET (2022)] [NEET (2020)]
11. Given below are two statements : one is labelled as 18. Experimental verification of the Chromosomal theory of
Assertion (A) and the other is labelled as Reason (R). inheritance was done by:
Assertion (A): Mendel’s law of Independent assortment (a) Boveri (b) Morgan
does not hold goods for the genes that are located closely (c) Mendel (d) Sutton
on the same chromosome. [NEET (2020)]
Reason (R): Closely located genes assort independently. 19. Identify the wrong statement with reference to the gene
Answer from the options given below: ‘I’ that controls ABO blood groups.
(a) Both (A) and (R) are correct and (R) is the correct (a) When Ia and Ib are present together, they express the
explanation of (A) same type of sugar
(b) Both (A) and (R) are correct but (R) is not the (b) Allele ‘i’ does not produce any sugar
correct explanation of (A) (c) The gene (I) has three alleles
(c) (A) is correct but (R) is not correct (d) A person will have only two of the three alleles
(d) (A) is not correct but (R) is correct [NEET (2020)]
[NEET (2022)] 20. The first phase of translation is:
12. The recombination frequency between the genes a & c (a) Aminoacylation of tRNA
is 5%, b & c is 15%, b & d is 9%, a & b is 20%, c & d is (b) Recognition of an anti-codon
24% and a & d is 29%. What will be the sequence of (c) Binding of mRNA to ribosome
these genes on a linear chromosome? (d) Recognition of DNA molecule
(a) a , d, b, c [NEET (2020)]
(b) d, b, a, c 21. Select the incorrect statement
(c) a, b, c, d (a) In male grasshoppers, 50% of sperms have no sex-
(d) a, c, b, d chromosome
[NEET (2022)] (b) In domesticated fowls, sex of progeny depends on
13. If a colour blind female marries a man whose mother the type of sperm rather than egg
was also colour blind, what are the chances of her (c) Human males have one of their sex-chromosome
progeny having colour blindness ? much shorter than the other
(a) 25% (d) Male fruit fly is heterogametic
(b) 50% [NEET (2019)]
(c) 75% 22. Under which of the following conditions will there be
(d) 100% no change in the reading frame of following mRNA?
[NEET (2022)] 5’AACAGCGGUGCUAUU 3’
14. The production of gametes by the parents, formation of (a) Deletion of G from 5th position
zygotes, the F1 and F2 plants can be understood from a (b) Insertion of A and G at 4th and 5th positions
diagram called respectively
(a) Punnett square (c) Deletion of GGU from 7th , 8th and 9th position
(b) Net square (d) Insertion of G at 5th position
(c) Bullet square [NEET (2019)]
(d) Punch square 23. What map unit (Centimorgan) is adopted in the
[NEET (2021)] construction of genetic maps?
15. In a cross between a male and female, both heterozygous (a) A unit of distance between two expressed genes,
for sickle cell anaemia gene, what percentage of the representing 100% crossover.
progeny will be diseased? (b) A unit of distance between genes on chromosomes,
(a) 25% (b) 100% representing 1% crossover.
(c) 50% (d) 75% (c) A unit of distance between genes on chromosomes,
[NEET (2021)] representing 50% crossover.
16. How many true breeding pea plant varieties did mendel (d) A unit of distance between two expressed genes,
select as pairs, which were similar except in one representing 10% crossover.
character with contrasting traits? [NEET (2019)]
(a) 14 (b) 8 24. In Antirrhinum (Snapdragon), a red flower was crossed
(c) 4 (d) 2 with a white flower and in F1 generation, pink In
[NEET (2020)] Antirrhinum (Snapdragon), a red flower was crossed
with a white flower and in F1 generation, pink flowers. (d) G.Mendel - Transformation
Choose the incorrect statement from the following : [NEET (2018)]
(a) Pink colour in F1 is due to incomplete dominance 32. Which one from those given below is the period for
(b) Ratio of F2 is 1/4 (Red): 2/4 (Pink): ¼ (White) Mendel's hybridization experiments?
(c) Law of Segregation does not apply in this (a) 1857 - 1869 (b) 1870 - 1877
experiment. (c) 1856 -1863 (d) 1840 -1850
(d) This experiment does not follow the Principle of [NEET (2017)]
Dominance 33. Thalassemia and sickle cell anemia are caused due to a
[NEET (2019)] problem in globin molecule synthesis. Select the correct
25. What is the genetic disorder in which an individual has statement.
an overall masculine development, gynaecomastia and (a) Thalassemia is due to less synthesis of globin
is sterile? molecules
(a) Klinefelter’s syndrome (b) Sickle cell anemia is due to a quantitative problem
(b) Edward syndrome of globin molecules.
(c) Down’s syndrome (c) Both are due to a qualitative defect in globin chain
(d) Turner’s syndrome synthesis
[NEET (2019)] (d) Both are due to a quantitative defect in globin chain
26. The frequency of recombination between gene pairs on synthesis
the same chromosome as a measure of the distance [NEET (2017)]
between genes was explained by: 34. A disease caused by an autosomal-primary
(a) Gregor J Mendel nondisjunction is
(b) Alfred Sturtevant (a) Turner's Syndrome
(c) Sutton Boveri (b) Sickle Cell Anemia
(d) T. H. Morgan (c) Down's Syndrome
[NEET (2019)] (d) Klinefelter's Syndrome
27. Which of the following muscular disorders is inherited? [NEET (2017)]
(a) Muscular dystrophy 35. Among the following characters, which one was not
(b) Myasthenia gravis considered by Mendel in his experiments on pea?
(c) Botulism (a) Seed - Green or Yellow
(d) Tetany (b) Pod - Inflated or Constricted
[NEET (2019)] (c) Stem - Tall or Dwarf
28. Which of the following characteristics represent (d) Trichomes - Glandular or non-glandular
‘Inheritance of blood groups’ in humans? [NEET (2017)]
1. Dominance 36. The genotypes of a Husband and Wife are I AIB and IAi.
2. Codominance Among the blood types of their children, how many
3. Multiple allele different genotypes and phenotypes are possible?
4. Incomplete dominance (a) 4 genotypes; 3 phenotypes
5. Polygenic inheritance (b) 4 genotypes; 4 phenotypes
(a) 2, 4 and 5 (b) 1, 2 and 3 (c) 3 genotypes; 3 phenotypes
(c) 2, 3 and 5 (d) 1, 3 and 4 (d) 3 genotypes; 4phenotypes
[NEET (2018)] [NEET (2017)]
29. A woman has an X-linked condition on one of her X 37. If a colour-blind man marries a woman who is
chromosomes. This chromosome can be inherited by homozygous for normal colour vision, the probability of
(a) Only grandchildren their son being colourblind is
(b) Only sons (a) 0.5 (b) 0.75
(c) Only daughters (c) 1 (d) 0
(d) Both sons and daughters [NEET (2016-II)]
[NEET (2018)] 38. A true breeding plant is
30. Which of the following pairs is wrongly matched? (a) Produced due to cross-pollination among unrelated
(a) XO type sex determination : Grasshopper plants
(b) ABO blood grouping: Co-dominance (b) Near homozygous and produces offspring of its
(c) Starch synthesis in pea: Multiple alleles own kind
(d) T.H.Morgan: Linkage (c) Always homozygous recessive in its genetic
[NEET (2018)] constitution
31. Select the correct match: (d) One that is able to breed on its own
(a) T.H.Morgan - Transduction [NEET (2016-II)]
(b) F2 × Recessive parent - Dihybrid cross 39. The mechanism that causes a gene to move from one
(c) Ribozyme - Nucleic acid linkage group to another is called
(a) Duplication (b) Translocation (c) 3 : 1 : : Tall : Dwarf

(c) Crossing over (d) Inversion (d) 3 : 1 : : Dwarf : Tall
[NEET (2016-II)] [NEET (2016-I)]
40. In a testcross involving F1 dihybrid flies, more parental 44. Which of the following most appropriately describes
– type offspring were produced than the recombinant- haemophilia?
type offspring. This indicates: (a) Recessive gene disorder
(a) The two genes are located on two different (b) X-linked recessive gene disorder
chromosomes. (c) Chromosomal disorder
(b) Chromosomes failed to separate during meiosis. (d) Dominant gene disorder
(c) The two genes are linked and present on the same [NEET (2016-I)]
chromosome. 45. A pleiotropic gene
(d) Both of the characters are controlled by more than (a) Is expressed only in primitive plants
one gene. (b) Is a gene evolved during Pliocene
[NEET (2016-I)] (c) Controls a trait only in combination with another
41. Pick out the correct statements: gene
(A) Haemophilia is a sex-linked recessive disease (d) Controls multiple traits in an individual
(B) Down’s syndrome is due to aneuploidy [NEET (2015)]
(C) Phenylketonuria is an autosomal recessive gene 46. In his classic experiments on pea plants, Mendel did not
(D) Sickle cell anaemia is an X-linked recessive gene use
disorder (a) Seed colour
(a) (A) and (D) are correct (b) Pod length
(b) (B) and (D) are correct (c) Seed shape
(c) (A), (C) and (D) are correct (d) Flower position
(d) (A), (B) and (C) are correct [NEET (2015)]
[NEET (2016-I)] 47. A colour blind man marries a woman with normal sight
42. Match the terms in Column I with their description in who has no history of colour blindness in her family.
Column II and chose the correct option : What is the probability of their grandson being colour
blind?
Column-I Column-II (a) 0.5
(a) Dominance (i) Many genes govern a (b) 1
single character (c) Nil
(d) 0.25
(b) Codominance (ii) In a heterozygous [NEET (2015)]
organism only one 48. In the following human pedigree, the filled symbols
allele expresses itself represent the affected individuals. Identify the type of
(c) Pleiotropy (iii) In a heterozygous given pedigree.
organism both alleles
express themselves
fully
(d) Polygenic (iv) A single gene
inheritance influences many
characters
Code:
(a) (a) - (ii); (b) - (i); (c) - (iv); (d) - (iii) (a) Autosomal dominant
(b) (a) - (ii); (b) - (iii); (c) - (iv); (d) - (i) (b) X-linked recessive
(c) (a) - (iv); (b) - (i); (c) - (ii); (d) - (iii) (c) Autosomal recessive
(d) (a) - (iv); (b) - (iii); (c) - (i); (d) - (ii) (d) X-linked dominant
[NEET (2016-I)] [NEET (2015)]
43. A tall true breeding garden pea plant is crossed with a 49. The term "linkage" was coined by:
dwarf true breeding garden pea plant. When the F1 (a) T.H. Morgan (b) T. Boveri
plants were selfed, the resulting genotypes were in the (c) G. Mendel (d) W. Slitton
ratio of [NEET (2015)]
(a) 1 : 2 : 1 : : Tall homozygous : Tall heterozygous : 50. A gene showing codominance has
Dwarf (a) One allele dominant on the other
(b) 1 : 2 : 1 : : Tall heterozygous : Tall homozygous : (b) Alleles tightly linked on the same chromosome
Dwarf (c) Alleles that are recessive to each other
(d) Both alleles independently expressed in the (c) The genes show an independent assortment
heterozygote (d) If the genes are present on the same chromosome,
[NEET (2015)] they under meiosis go more than one crossovers in
51. A human female with Turner’s syndrome every meiosis
(a) Has one additional X Chromosome [NEET (2013)]
(b) Exhibits male characters 59. Read the following four statements (A-D):
(c) Is able to produce children with normal husband (A) In transcription, adenosine pairs with uracil
(d) Has 45 chromosomes with XO (B) Regulation of lac operon by repressor is referred to
[NEET (2014)] as positive regulation
52. A man whose father was colour blind marries a woman (C) The human genome has approximately 50,000 genes
who had a colour blind mother and a normal father. (D) Haemophilia is a sex-linked recessive disedase
What percentage of male children of this couple will be How many of the above statements are right?
colour blind? (a) Three (b) Four
(a) 0% (b) 50% (c) One (d) Two
(c) 75% (d) 25% [NEET (2012)]
[NEET (2014)]
60. A test cross is carried out to:
53. Fruit colour in squash is an example of
(a) Predict whether two traits are linked
(a) Dominant epistasis
(b) Assess the number of alleles of a gene
(b) Complementary genes
(c) Determine whether two species or varieties will
(c) Inhibitory genes
breed successfully
(d) Recessive epistasis
(d) Determine the genotype of a plant at F2
[NEET (2014)]
54. If both parents are carriers for thalassemia, which is an [NEET (2012)]
autosomal recessive disorder, what are the chances of 61. Represented below is the inheritance pattem of the
pregnancy resulting in an affected child? certain ty pe of traits in humans. Which one of the
(a) No chance (b) 50% following conditions could be an example of this pattem
(c) 25% (d) 100% ?
[NEET (2013)]
55. The incorrect statement with regard to Haemophilia is
(a) It is a sex-linked disease
(b) It is a recessive disease
(c) It is a dominant disease
(d) A single protein involved in the clotting of blood is
affected
[NEET (2013)]
56. Which Mendelian idea is depicted by a cross in which
the F1 generation resembles both the parents? (a) Sickel cell anaemia
(a) Incomplete dominance (b) Haemophilia
(b) Law of dominance (c) Thalassemia
(c) Inheritance of one gene (d) Phenylketonuria
(d) Codominance [NEET (2012)]
[NEET (2013)] 62. Which one of the following is a wrong statement
57. If two persons with ‘AB’ blood group marry and have regarding mutations?
sufficiently large number of children, these children (a) Cancer cells commonly show chromosomal
could be classified as ‘A’ blood group: ‘B’ blood group aberrations
in 1 : 2 : 1 ratio. Modern technique of protein (b) UV and Gamma rays are mutagens
electrophoresis reveals presence of both ‘A’ and ‘B’ (c) Change in a single base pair of DNA does not cause
type proteins in ‘AB’ blood group individuals. This is an mutation
example of (d) Deletion and insertion of base pairs cause frame-shift
(a) Codominance mutations
(b) Incomplete dominance [NEET (2012)]
(c) Partial dominance 63. Mutations can be induced with :
(d) Complete dominance (a) Gamma radiation
[NEET (2013)] (b) Infra Red radiations
58. Which of the following statements is not true of two (c) IAA
genes that show 50 recombination frequency? (d) Ethylene
(a) The genes may be on different chromosomes [NEET (2011)]
(b) The genes are tightly linked
64. Which one of the following conditions correctly (c) Genes loosely linked on the same chromosome
describes the manner of determining the sex in the given show similar recombinations as the tightly linked ones
examples ? (d) Tightly linked genes on the same chromosome
(a) Homozygous sex chromosomes (XX) produce male show very few recombination
in Drosophila [NEET (2010)]
(b) Homozygous sex chromosomes (ZZ) determine 71. Which one of the following symbols and its
female sex in Birds representation, used in human pedigree analysis is
(c) XO type of sex chromosomes determine male sex in correct –
grasshopper (a)
(d) XO condition in humans as found in Turner
Syndrome, determines female sex (b)
[NEET (2011)]
65. A person with unknown blood group under ABO (c)
system, has suffered much blood loss in an accident and
needs immediate blood transfusion. His one friend who (d)
has a valid certificate of his own blood type, offers for
blood donation without delay. What would have been
the type of blood group of the donor friend [NEET (2010)]
(a) Type A (b) Type B 72. Point mutation involves :
(c) Type AB (d) Type O (a) Deletion
[NEET (2011)] (b) Insertion
66. When two unrelated individuals or lines are crossed, the (c) Change in single base pair
per romance of F1 hybrid is often superior to both (d) Duplication
parents. This phenomenon is called : [NEET (2009)]
(a) Metamorphosis (b) Heterosis 73. Sickel cell anemia is :
(c) Transformation (d) Sphcing (a) Characterized by elongated sickle like RBCs with a
[NEET (2011)] nucleus
67. Which one of the following cannot be explained on the (b) An autosomal linked dominant trait
basis of Mendel's Law of Dominance? (c) Caused by substitute of valine by glutamic acid in
(a) The discrete unit controlling a particular character is the beta globin chain of haemoglobin
called a factor (d) Caused by a change in a single base pair of DNA
(b) Out of one pair of factors one is dominant, and the [NEET (2009)]
other recessive 74. Study the pedigree chart given below :
(c) Alleles do not show any blending and both the
characters recover as such in F2 generation
(d) Factors occur in pairs
[NEET (2010)]
68. The genotype of a plant showing the dominant
phenotype can be determined by –
(a) Test cross
What does it show ?
(b) Dihybrid cross
(a) Inheritance of a recessive sex-linked disease like
(c) Pedigree analysis
haemophilia
(d) Back cross
[NEET (2010)] (b) Inheritance of a sex-linked inborn error of
69. ABO blood groups in humans are controlled by the gene metabolism like phenylketonuria
I. It has three alleles – IA, IB and i. Since there are three (c) Inheritance of a condition like phenylketonuria as
an autosomal recessive trait
different alleles, six different genotypes are possible.
(d) The pedigree chart is wrong as this is not possible
How many phenotypes can occur –
[NEET (2009)]
(a) Three (b) One
(c) Four (d) Two 75. The most popularly known blood grouping is the ABO
[NEET (2010)] grouping. It is named ABO and not ABC, because "O"
70. Select the correct statement from the ones given below in it refers to having :
(a) No antigens A and B on RBCs
with respect to dihybrid cross –
(b) Other antigens besides A and B on RBCs
(a) Tightly linked genes on the same chromosome show
(c) Overdominance of this type on the genes for A and
higher recombinations
(b) Genes far apart on the same chromosome show B types
very few recombinations (d) One antibody only-either anti-A and anti-B on the
RBCs
[NEET (2009)]
76. Select the incorrect statement from the following : (a) AABB (b) AaBb
(a) Baldness is a sex limited trait (c) AaBB (d) AABb
(b) Linkage is an exception to the principle of [NEET (2007)]
independent assortment in heredity. 84. Phenotype of an organism is the result of-
(c) Galactosemia is an inborn error of metabolism (a) Mutations and linkages
(d) Small population size results in random genetic (b) Cytoplasmic effects and nutrition
drift in a population (c) Environmental changes and sexual dimorphism
[NEET (2009)] (d) Genotype and environment interactions
77. Unisexuality of flowers prevents: [NEET (2006)]
(a) Geitonogamy, but not xenogamy 85. In which mode of inheritance do you expect more
(b) Autogamy and geitonogamy maternal influence among the offspring ?
(c) Autogamy, but not geitonogamy (a) Autosomal
(d) Both geitonogamy and xenogamy (b) Cytoplasmic
[NEET (2008)] (c) Y-linked
78. Haploids are more suitable for mutation studies than the (d) X-linked
diploids. This is because: [NEET (2006)]
(a) Haploids are more abundant in nature than diploids 86. How many different kinds of gametes will be produced
(b) All mutations, whether dominant or recessive are by a plant having the genotype AABbCC ?
expressed in haploids (a) Three (b) Four
(c) Haploids are reproductively more stable than (c) Nine (d) Two
diploids [NEET (2006)]
(d) Mutagens penetrate in haploids more effectively 87. Which one of the following is an example of polygenic
than in diploids inheritance ?
[NEET (2008)] (a) Flower colour in Mirabilis jalapa
79. Inheritance of skin colour in humans is an example of:- (b) Production of male honey bee
(a) Codominance (c) Pod shape in garden pea
(b) Chromosomal aberration (d) Skin colour in humans
(c) Point mutation [NEET (2006)]
(d) Polygenic inheritance 88. In Mendel's experiments with garden pea, round seed
[NEET (2007)] shape (RR) was dominant over wrinkled seeds (rr),
80. A common test to find the genotype of a hybrid is by:- yellow cotyledon (YY) was dominant over green
(a) Crossing of one F1 progeny with male parent cotyledon (yy). What are the expected phenotypes in the
(b) Crossing of one F2 progeny with male parent F2 generation of the cross RRYY × rryy ?
(c) Crossing of one F2 progeny with female parent (a) Only round seeds with green cotyledons
(d) Studying the sexual behaviour of F1 (b) Only wrinkled seeds with yellow cotyledons
progenies (c) Only wrinkled seeds with green cotyledons
[NEET (2007)] (d) Round seeds with yellow cotyledons, and wrinkled
81. Two genes R and Y are located very close on the seeds with yellow cotyledons
chromosomal linkage map of maize plant. When RRYY [NEET (2006)]
and rryy genotypes are hybridized, the F2 segregation 89. Test cross involves-
will show:- (a) Crossing between two genotypes with recessive trait
(a) Higher number of the parental types (b) Crossing between two F1 hybrids
(b) Higher number of the recombinant types (c) Crossing the F1 hybrid with a double recessive
genotype
(c) Segregation in the expected 9 : 3 : 3 : 1 ratio (d) Crossing between two genotypes with dominant
(d) Segregation in 3 : 1 ratio trait
[NEET (2007)] [NEET (2006)]
82. In pea plants, yellow seeds are dominant to green. If a 90. If a colourblind woman marries a normal visioned man,
heterozygous yellow seeded plant is crossed with a their sons will be -
green seeded plant, what ratio of yellow and green (a) All normal visioned
seeded plants would you expect in F1 generation ? (b) One-half colourblind and one-half normal
(a) 3 : 1 (b) 50 : 50 (c) Three-fourths colourblind and one-fourth normal
(c) 9 : 1 (d) 1 : 3 (d) All colourblind
[NEET (2007)] [NEET (2006)]
83. A human male produces sperms with the genotypes AB, 91. Cri-du-chat syndrome in humans is caused by the-
Ab, AB, and ab pertaining to two diallelic characters in (a) Fertilization of an XX egg by a normal Y-bearing
equal proportions. What is the corresponding genotype sperm
of this person ? (b) Loss of half of the short arm of chromosome 5
(c) Loss of half of the long arm of chromosome 5 (d) A greater proportion of girls die in infancy
(d) Trisomy of 21st chromosome [NEET (2005)]
[NEET (2006)] 100. A women with 47 chromosomes due to three copies of
92. Sickle cell anemia has not been eliminated from the chromosome 21 is characterized by -
African population because- (a) Turner syndrome
(a) It is controlled by recessive genes (b) Down syndrome
(b) It is not a fatal disease (c) Superfemaleness
(c) It provides immunity against malaria (d) Triploidy
(d) It is controlled by dominant genes [NEET (2005)]
[NEET (2006)] 101. A man and a women, who do not show any apparent
93. Both sickle cell anemia and Huntington's chorea are- signs of a certain inherited disease, have seven children
(a) Bacteria-related diseases (2 daughter and 5 sons). Three of the sons suffer from
(b) Congenital disorders the given disease but none of the daughters are affected.
(c) Pollutant-induced disorders Which of the following mode of inheritance do you
(d) Virus-related diseases suggest for this disease
[NEET (2006)] (a) Sex-limited recessive
94. At a particular locus, frequency of 'A' allele is 0.6 and (b) Autosomal dominant
that of 'a' is 0.4. What would be the frequency of (c) Sex-linked recessive
heterozygotes in a random mating population at (d) Sex-linked dominant
equilibrium - [NEET (2005)]
(a) 0.24 (b) 0.16 102. A normal woman, whose father was colour-blind is
(c) 0.48 (d) 0.36 married to a normal man. The sons would be :-
[NEET (2005)] (a) 50% colour-blind
95. In order to find out the different types of gametes (b) All normal
produced by a pea plants having the genotype AaBb, it (c) All colour-blind
should be crossed to a plant with the genotype - (d) 75 % colour-blind
(a) AaBb (b) aabb [NEET (2004)]
(c) AABB (d) aaBB 103. The recessive genes located on X-chromosomes in
[NEET (2005)] humans are always-
96. Which of the following is not a hereditary disease - (a) Sub-lethal
(a) Haemophilia (b) Expressed in males
(b) Cretinism (c) Expressed in females
(c) Cystic fibrosis (d) Lethal
(d) Thalasasemia [NEET (2004)]
[NEET (2005)] 104. In a mutational event, when adenine is replaced by
97. A woman with normal vision, but whose father was guanine, it is a case of -
colour bind, marries a colour blind man. Suppose that (a) Transcription
the fourth child of this couple was a boy. This boy - (b) Transition
(a) Must have normal colour vision (c) Transversion
(b) May be colour blind or may be normal vision (d) Frameshift mutation
(c) Will be partially colour blind since he is [NEET (2004)]
heterozygous for the colour blind mutant allele. 105. A male human is heterozygous for autosomal genes A
and B and is also hemizygous for hemophilic gene h.
(d) Must be colour blind
What proportion of his sperms will be abh :-
[NEET (2005)] (a) 1/32 (b) 1/16
98. During transcription holoenzyme RNA polymerase (c) 1/4 (d) 1/8
binds to a DNA sequence and the DNA assumes a saddle [NEET (2004)]
like structure at the point. What is the sequence called - 106. A self-fertilizing trihybrid plant forms :-
(a) CAAT box (b) GGTT box (a) 4 different gametes and 16 different zygotes
(c) AAAT box (d) TATA box (b) 8 different gametes and 16 different zygotes
[NEET (2005)] (c) 8 different gametes and 32 different zygotes
99. Haemophilia is more commonly seen in human males (d) 8 different gametes and 64 different zygotes
than in human females because - [NEET (2004)]
(a) This disease is due to a Y-linked recessive mutation 107. Lack of independent assortment of two genes A and B
(b) This disease is due to an X-linked recessive in fruit fly Drosophila is due to :-
mutation (a) Recombination (b) Linkage
(c) This disease is due to an X-linked dominant (c) Crossing over (d) Repulsion
mutation [NEET (2004)]
108. In the ABO system of blood groups if both antigens are (c) RNA transcription pattern
present but no antibody, the blood group of the (d) Protein structure
individual would be :- [NEET (2004)]
(a) O (b) AB 111. One of the parents of a cross has a mutation in its
(c) A (d) B mitochondria. In that cross, that parent is taken as a
[NEET (2004)] male. During segregation of F2 progenies that mutation
109. In a plant red fruit (R) is dominant over yellow fruit (r) is found in -
and tallness (T) is dominant over shortness (t). If a plant (a) None of the progenies
with RRTt genotype is crossed with a plant that (b) All the progenies
is rrtt (c) 50% of the progenies
(a) 50% will be tall with red fruit (d) 1/3 of the progenies
(b) 75% will be tall with red fruit [NEET (2004)]
(c) All the offspring will be tall with red fruit 112. When a diploid female plant is crossed with a tetraploid
(d) 25% will be tall with red fruit male, the ploidy of endosperm cells in the resulting seed
[NEET (2004)] is :-
110. After a mutation at a genetic locus the character of an (a) Pentaploidy (b) Diploidy
organism changes due to the change in :- (c) Triploidy (d) Tetraploidy
(a) DNA replication [NEET (2004)]
(b) Protein synthesis pattern
MOLECULAR BASIS OF INHERITANCE 102
MOLECULAR BASIS OF INHERITANCE

1. Unequivocal proof that DNA is the genetic material was (a) Both Statement I and Statement II are false.
first proposed by (b) Statement I is correct, but Statement II is false.
(a) Alfred Hershey and Martha Chase (c) Statement I is incorrect, but Statement II is true.
(b) Avery, Macleoid and McCarthy (d) Both Statement I and Statement II are true.
(c) Wilkins and Franklin [NEET (2023)]
(d) Frederick Griffith 8. Given below are two statements:
Statement I: RNA mutates at a faster rate.
[NEET (2023)]
Statement II: Viruses having RNA genome and shorter
2. What is the role of RNA polymerase III in the process life span mutate and evolve faster.
of transcription in Eukaryotes? In the light of the above statements, choose the correct
(a) Transcription of tRNA, 5 srRNA and snRNA. answer from the options given below:
(b) Transcription of precursor of mRNA. (a) Both Statement I and Statement II are false.
(c) Transcription of only snRNAs. (b) Statement I is true, but Statement II is false.
(d) Transcription of rRNAs (28S, 18S and 5.8S) (c) Statement I is false, but Statement II is true.
[NEET (2023)] (d) Both Statement I and Statement II are true.
3. Expressed Sequence Tags (ESTs) refer to [NEET (2023)]
(a) All genes that are expressed as proteins. 9. Which one of the following is the sequence on
(b) All genes whether expressed or unexpressed. corresponding coding strand, if the sequence on mRNA
(c) Certain important expressed genes. formed is as follows:
5′ AUCGAUCGAUCGAUCGAUCG AUCG AUCG
(d) All genes that are expressed as RNA.
3′?
[NEET (2023)] (a) 3′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC
4. How many different proteins does the ribosome consist 5′
of? (b) 5′ ATCGATCGATCGATCGATCGATCGATCG
(a) 60 (b) 40 3′
(c) 20 (d) 80 (c) 3′ ATCGATCGATCGATCGATCGATCGATCG
[NEET (2023)] 5′
5. Which of the following is not a cloning vector? (d) 5′ UAGCUAGCUAGCUAGCUAGCUAGC
(a) YAC (b) pBR322 UAGC 3′ [NEET (2023)]
(c) Probe (d) BAC 10. The process of translation of mRNA to proteins begins
[NEET (2023)] as soon as:
6. Match List I with List II. (a) The small subunit of ribosome encounters mRNA
(b) The larger subunit of ribosome encounters mRNA
List I List II (c) Both the subunits join together to bind with mRNA
A. Gene ‘a’ I. β-galactosidase (d) The tRNA is activated and the larger subunit of
B. Gene ‘y’ II. Transacetylase ribosome encounters mRNA
[NEET (2022)]
C. Gene ‘I’ III. Permease
11. DNA polymorphism forms the basis of:
D. Gene ‘z’ IV. Repressor protein (a) Genetic mapping
Choose the correct answer from the options given (b) DNA fingerprinting
below: (c) Both genetic mapping and DNA fingerprinting
(a) A–II, B–III, C–IV, D–I (d) Translation
(b) A–III, B–IV, C–I, D–II [NEET (2022)]
(c) A–III, B–I, C–IV, D–II 12. Read the following statements and choose the set of
(d) A–II, B–I, C–IV, D–III correct statements:
[NEET (2023)] (a) Euchromatin is loosely packed chromatin
7. Given below are two statements: (b) Heterochromatin is transcriptionally active
Statement I: In prokaryotes, the positively charged DNA (c) Histone octamer is wrapped by negatively charged
is held with some negatively charged proteins in a region DNA in nucleosome
called nucleoid. Statement II: In eukaryotes, the (d) Histones are rich in lysine and arginine.
negatively charged DNA is wrapped around the (e) A typical nucleosome contains 400 bp of DNA helix
positively charged histone octamer to form nucleosome. Choose the correct answer from the options given
In the light of the above statements, choose the correct below:
answer from the options given below: (a) (b), (d), (e) Only
(b) (a), (c), (d) Only 19. DNA fingerprinting involves identifying differences in
(c) (b), (e) Only some specific regions in DNA sequence, called as:
(d) (a), (c), (e) Only (a) Single nucleotides
[NEET (2022)] (b) Polymorphic DNA
13. If a geneticist uses the blind approach for sequencing the (c) Satellite DNA
whole genome of an organism, followed by assignment (d) Repetitive DNA
of functions to different segment, the methodology [NEET (2021)]
adopted by him is called as: 20. What is the role of RNA polymerase III in the process
(a) Sequence annotation of transcription in eukaryotes?
(b) Gene mapping (a) Transcribes precursor of mRNA
(c) Expressed sequence tags (b) Transcribes only snRNAs
(d) Bioinformatics (c) Transcribes rRNAs (28S, 18S and 5.8S)
[NEET (2022)] (d) Transcribes tRNA, 5s rRNA and snRNA
14. In an E. coli strain the i gene gets mutated and its product [NEET (2021)]
can not bind the inducer molecule. If the growth medium 21. Which of the following RNAs is not required for the
is provided with lactose, what will be the outcome? synthesis of protein?
(a) Only z gene will get transcribed (a) rRNA (b) siRNA
(b) z, y, a genes will be transcribed (c) mRNA (d) tRNA
(c) z, y, a genes will not be translated [NEET (2021)]
(d) RNA polymerase will bind the promoter region 22. If Adenine makes 30% of the DNA molecule, what will
[NEET (2022)] be the percentage of Thymine, Guanine, and Cytosine in
15. If the length of a DNA molecule is 1.1 metres, what will it?
be the approximate number of base pairs? (a) T: 30; G: 20; C: 20
(a) 3.3 × 109 bp (b) T: 20; G: 25; C: 25
(b) 6.6 × 109 bp (c) T: 20; G: 30; C: 20
(c) 3.3 × 106 bp (d) T: 20; G: 20; C: 30
(d) 6.6 × 106 bp [NEET (2021)]
[NEET (2022)] 23. Which is the “Only enzyme” that has “Capability” to
16. Ten E. coli cells with 15N- dsDNA are incubated in a catalyse Initiation, Elongation and Termination in the
medium containing 14N nucleotides. After 60 minutes, process of transcription in prokaryotes?
how many E. coli cells will have DNA totally free from (a) DNA Ligase
15
N? (b) DNase
(a) 20 cells (c) DNA dependent DNA polymerase
(b) 40 cells (d) DNA dependent RNA polymerase
(c) 60 cells [NEET (2021)]
(d) 80 cells 24. Statement I: The codon ‘AUG’ codes for methionine
[NEET (2022)] and phenylalanine.
17. Complete the flowchart on central dogma. Statement II: ‘AAA’ and ‘AAG’ both codons code for
the amino acid lysine.
(a) Statement I is correct but statement II is false
(a) (a)-Replication; (b)-Transcription; (c)-Translation; (b) Statement I is incorrect but statement II is true
(d)-Protein (c) Both Statement I and Statement II are true
(b) (a)-Transduction; (b)-Translation; (c)-Replication; (d) Both Statement I and Statement II are false
(d)-Protein [NEET (2021)]
(c) (a)-Replication; (b)-Transcription; (c)- 25. Which one of the following statements about Histones
Transduction; (d)-Protein is wrong?
(d) (a)-Translation; (b)-Replication; (c)-Transcription; (a) Histones are rich in amino acids - Lysine and
(d)-Transduction Arginine
[NEET (2021)] (b) Histones carry positive charge in the side chain.
18. Identify the correct statement. (c) Histones are organized to form a unit of 8
(a) The coding strand in a transcription unit is copied to molecules.
an mRNA (d) The pH of histones is slightly acidic
(b) Split gene arrangement is characteristic of [NEET (2021)]
prokaryotes 26. Which of the following statements is correct?
(c) In capping, methyl guanosine triphosphate is added (a) Adenine pairs with thymine through three H-bonds.
to the 3’ end of hnRNA. (b) Adenine does not pair with thymine.
(d) RNA polymerase binds with Rho factor to (c) Adenine pairs with thymine through two H-bonds.
terminate the process of transcription in bacteria. (d) Adenine pairs with thymine through one H-bond.
[NEET (2021)]
[NEET (2020)] 34. AGGTATCGCAT is a sequence from the coding strand

27. If the distance between two consecutive base pairs is of a gene. What will be the corresponding sequence of
0.34 nm and the total number of base pairs of a DNA the transcribed mRNA?
double helix in a typical mammalian cell is 6.6 × 109 bp, (a) UGGTUTCGCAT
then the length of the DNA is approximately. (b) ACCUAUGCGAU
(a) 2.2 meters (b) 2.7 meters (c) AGGUAUCGCAU
(c) 2.0 meters (d) 2.5 meters (d) UCCAUAGCGUA
[NEET (2020)] [NEET (2018)]
28. Name the enzyme that facilitates opening of DNA helix 35. All of the following are part of an operon except
during transcription. (a) An enhancer
(a) DNA polymerase (b) Structural genes
(b) RNA polymerase (c) An operator
(c) DNA ligase (d) A promoter
(d) DNA helicase [NEET (2018)]
[NEET (2020)] 36. Select the correct match:
29. The first phase of translation is: (a) Matthew Meselson and F. Stahl- Pisum sativum
(a) Aminoacylation of tRNA (b) Alfred Hershey and Martha Chase- TMV
(b) Recognition of an anti-codon (c) Alec Jeffreys - Streptococcus pneumoniae
(c) Binding of mRNA to ribosome (d) Francois Jacob and Jacques Monod - Lac operon
(d) Recognition of DNA molecule [NEET (2018)]
[NEET (2020)] 37. The experimental proof for semiconservative replication
30. Expressed Sequence Tags (ESTs) refers to of DNA was first shown in a
(a) Polypeptide expression (a) Plant (b) Bacterium
(b) DNA polymorphism (c) Fungus (d) Virus
(c) Novel DNA sequences [NEET (2018)]
(d) Genes expressed as RNA 38. Select the correct statement:
[NEET (2019)] (a) Spliceosomes take part in translation
31. Match the following genes of the Lac operon with their (b) Punnett square was developed by a British scientist
respective products: (c) Franklin Stahl coined the term “linkage”
(d) Transduction was discovered by S. Altman
Column I Column II [NEET (2018)]
(A) i gene (i) β-galactosidase 39. DNA fragments are
(a) Neutral
(B) z gene (ii) Permease
(b) Either positively or negatively charged depending
(C) a gene (iii) Repressor on their size
(D) y gene (iv) Transacetylase (c) Positively charged
Select the correct option: (d) Negatively charged
(a) A – (iii), B – (i), C – (ii), D – (iv) [NEET (2017)]
(b) A – (iii), B – (i), C – (iv), D – (ii) 40. Spliceosomes are not found in cells of
(c) A – (iii), B – (iv), C – (i), D – (ii) (a) Animals (b) Bacteria
(d) A – (i), B – (iii), C – (ii), D – (iv) (c) Plants (d) Fungi
[NEET (2019)] [NEET (2017)]
32. Purines found both in DNA and RNA are 41. The association of histone H1 with a nucleosome
(a) Adenine and guanine indicates
(b) Guanine and cytosine (a) The DNA is condensed into a chromatin Fibre
(c) Cytosine and thymine (b) The DNA double helix is exposed
(d) Adenine and thymine (c) Transcription is occurring
[NEET (2019)] (d) DNA replication is occurring
33. Which of the following features of genetic code does [NEET (2017)]
allow bacteria to produce human insulin by recombinant 42. DNA replication in bacteria occurs
DNA technology? (a) Prior to fission
(a) Genetic code is redundant (b) Just before transcription
(b) Genetic code is nearly universal (c) During the S phase
(c) Genetic code is specific (d) Within nucleolus
(d) Genetic code is not ambiguous [NEET (2017)]
[NEET (2019)] 43. Which of the following RNAs should be most abundant
in animal cells?
(a) mRNA (b) mi-RNA
(c) rRNA (d) tRNA 53. Which of the following is not required for any of the
[NEET (2017)] techniques of DNA fingerprinting available at present?
44. If there are 999 bases in an RNA that codes for a protein (a) Polymerase chain reaction
with 333 amino acids and the base at position 901 is (b) Zinc finger analysis
deleted such that the length of the RNA becomes 998 (c) Restriction enzymes
bases how many codons will be altered? (d) DNA-DNA hybridization
(a) 33 (b) 333 [NEET (2016-I)]
(c) 1 (d) 11 54. Which of the following is required as inducer(s) for the
[NEET (2017)] expression of Lac operon?
45. During DNA replication, Okazaki fragments are used to (a) Glucose
elongate (b) Galactose
(a) The leading strand away from the replication fork. (c) Lactose
(b) The lagging strand away from the replication fork (d) Lactose and galactose
(c) The leading strand towards the replication fork [NEET (2016-I)]
(d) The lagging strand towards the replication fork 55. Satellite DNA is important because it:
[NEET (2017)] (a) Codes for proteins needed in cell cycle.
46. The final proof for DNA as the genetic material came (b) Shows a high degree of polymorphism in the
from the experiments of population and also the same degree of polymorphism
(a) Avery, Mcleod and McCarty in an individual, which is heritable from parents to
(b) Hargobind Khorana children.
(c) Griffith (c) Does not code for proteins and is the same in all
(d) Hershey and Chase members of the population.
[NEET (2017)] (d) Codes for enzymes needed for DNA replication.
47. Taylor conducted the experiments to prove [NEET (2015)]
semiconservative mode of chromosome replication on 56. The introduction of t-DNA into plates involves:
(a) Vicia faba (a) Infection of the plant by Agrobacterium tumefaciens
(b) Drosophila melanogaster (b) Altering the pH of the soil, then heat shocking the
(c) E. coli plants
(d) Vinca rosea (c) Exposing the plates to cold for a brief period
[NEET (2016-II)] (d) Allowing the plant roots to stand in water
48. DNA-dependent RNA polymerase catalyzes [NEET (2015)]
transcription on one strand of the DNA which is called 57. Balbiani rings are sites of:
the _____. (a) Lipid synthesis
(a) Coding strand (b) Alpha strand (b) Nucleotide synthesis
(c) Anti strand (d) Template strand (c) Polysaccharide synthesis
[NEET (2016-II)] (d) RNA and protein synthesis
49. A molecule that can act as a genetic material must fulfill [NEET (2015)]
the traits given below, except. 58. Identify the correct order of organisation of genetic
(a) It should be able to generate its replica. material from largest to smallest:
(b) It should be unstable structurally and chemically. (a) Chromosome, gene, genome, nucleotide
(c) It should provide the scope for slow changes that (b) Genome, chromosome, nucleotide, gene
are required for evolution. (c) Genome, chromosome, gene, nucleotide
(d) It should be able to express itself in the form of (d) Chromosome, genome, nucleotide, gene
‘Mendelian characters’. [NEET (2015)]
[NEET (2016-II)] 59. Which one of the following is not applicable to RNA?
50. Which of the following rRNAs acts as structural RNA (a) Complementary base pairing
as well as ribozyme in bacteria ? (b) 5′ phosphoryl and 3′ hydroxyl ends
(a) 18 S rRNA (b) 23 S rRNA (c) Heterocyclic nitrogenous bases
(c) 5.8 S rRNA (d) 5 S rRNA (d) Chargaff's rule
[NEET (2016-II)] [NEET (2015)]
51. The equivalent of a structural gene is 60. Transformation was discovered by:
(a) Cistron (b) Operon (a) Hershey and Chase
(c) Recon (d) Muton (b) Griffith
[NEET (2016-II)] (c) Watson and Crick
52. Which of the following is the starter codon? (d) Meselson and Stahl
(a) AUG (b) UGA [NEET (2014)]
(c) UAA (d) UAG 61. An analysis of chromosomal DNA using the southern
[NEET (2016-I)] hybridisation technique does not use:
(a) Blotting 67. Which one of the following represents a palindromic

(b) Autoradiography sequence in DNA?
(c) PCR (a) 5'-CCAATG-3'
(d) Electrophoresis 3'-GAATCC-5'
[NEET (2014)] (b) 5'-CATTAG-3'
62. Which one of the following is wrongly matched? 3'-GATAAC-5'
(a) Translation - Using information in m-RNA to make (c) 5'-GATACC-3'
protein 3'-CCTAAG-5'
(b) Repressor protein - Binds to operator to stop (d) 5'-GAATTC-3'
enzyme synthesis 3'-CTTAAG-5'
(c) Operon - Structural genes, operator and promoter
[NEET (2012)]
(d) Transcription - Writing information from DNA to t-
RNA 68. What is it that forms the basis of DNA Fingerprinting?
[NEET (2014)] (a) The relative difference in the DNA occurrence in
63. Commonly used vector for human genome sequencing blood, skin and saliva
are: (b) The relative amount of DNA in the ridges and
(a) BAC and YAC grooves of the fingerprints
(b) Expression vectors (c) Satellite DNA occurring as highly repeated short
(c) T/A cloning vectors DNA segments
(d) t-DNA (d) The relative proportions of prines and pyrimidines in
[NEET (2014)] DNA
64. Select the correct option. [NEET (2012)]
(a) Direction of RNA synthesis - 3′ – 5′, Direction of 69. Which one of the following also acts as a catalyst in a
reading the template DNA strand - 5′ – 3′ bacterial cell ?
(b) Direction of RNA synthesis - 5′ – 3′, Direction of (a) 23 s RNA (b) 5 s RNA
reading the template DNA strand - 5′ – 3′ (c) sn RNA (d) hn RNA
(c) Direction of RNA synthesis - 3′ – 5′, Direction of [NEET (2011)]
reading the template DNA strand - 3′ – 5′ 70. What are those structures that appear as 'beads- on-
(d) Direction of RNA synthesis - 5′ – 3′, Direction of string' in the chromosomes when viewed under electron
reading the template DNA strand - 3′ – 5′ microscope ?
[NEET (2014)] (a) Base pairs (b) Genes
65. Which enzyme/s will be produced in a cell in which (c) Nucleotides (d) Nucleosomes
there is a nonsense mutation in the lac Y gene? [NEET (2011)]
(a) β − galactosidase 71. Select the two correct statements out of the four (a-d)
(b) Lactose permease given below about lac operon.
(c) Transacetylase (a) Glucose or galactose may bind with the repressor and
(d) Lactose permease and transacetylase inactivate it
[NEET (2013)] (b) In the absence of lactose the repressor binds with the
66. Given below is a diagram representing the central operator region
dogma of molecular biology and some statements (c) The z-gene codes for permease
related to it: (d) This was elucidated by Francois Jacob and Jacque
Monod
The correct statements are :
(a) (b) and (c) (b) (a) and (c)
i. It was proposed by Francis Crick (c) (b) and (d) (d) (a) and (b)
ii. In some viruses the flow of genetic information [NEET (2010)]
occurs in the reverse direction 72. The one aspect which is not a salient feature of genetic
iii. The processes 'd' and 'e' both take place in the nucleus code, is its being –
iv. Uracil can be found in both 'a' and 'b' (a) Degenerate (b) Ambiguous
v. tRNA is involved only in 'e' (c) Universal (d) Specific
vi. After 'c' is formed, it moves out of the nucleus into [NEET (2010)]
the cytoplasm 73. Satellite DNA is useful tool in –
Which option represents all the correct statements? (a) Organ transplantation
(a) ii, iii, v, vi (b) ii, iv, v (b) Sex determination
(c) i, ii, v (d) i, ii, iii, vi (c) Forensic science
[NEET (2013)] (d) Genetic engineering
[NEET (2010)]
74. Which one of the following does not follow the central (b) UUA, UCA — Leucine
dogma of molecular biology ? (c) GUU, GCU — Alanine
(a) Pea (b) Mucor (d) UAG, UGA — Stop
(c) Chlamydomonas (d) HIV [NEET (2008)]
[NEET (2010)] 83. One gene-one enzyme relationship was established for
75. The segment of DNA which acts as the instrument the first time in:
manual for the synthesis of the protein is : (a) Diplococus pneumoniae
(a) Nucleoside (b) Nucleotide (b) Neurospora crassia
(c) Ribose (d) Gene (c) Salmonella typhimurium
[NEET (2009)] (d) Escherichia Coli
76. What is not true for genetic code? [NEET (2007)]
(a) It is unambiguous 84. A sequential expression of a set of human genes occurs
(b) A codon in mRNA is read in a non-contiguous when a steroid molecule binds to the:-
fashion (a) Ribosome (b) Transfer RNA
(c) It is nearly universal (c) Messenger RNA (d) DNA sequence
(d) It is degenerate [NEET (2007)]
[NEET (2009)] 85. The Okazaki fragments in DNA chain growth:-
77. Removal of introns and joining the exons in a defined (a) Polymerize in the 5'-to-3' direction and explain 3'- to
order in a transcription unit is called : 5' DNA replication
(a) Capping (b) Splicing (b) Result in transcription
(c) Tailing (d) Transformation (c) Polymerize in the 3'-to-5' direction and forms
[NEET (2009)] replication fork
78. Semiconservative replication of DNA was first (d) Prove semi-conservative nature of DNA replication
demonstrated in : [NEET (2007)]
(a) Salmonella typhimurium 86. Molecular basis of organ differentiation depends on the
(b) Drosophila melanogaster modulation in transcription by-
(c) Escherichia coli (a) Anticodon
(d) Streptococcus pneumoniae (b) RNA polymerase
[NEET (2009)] (c) Ribosome
79. Whose experiments cracked the DNA and discovered (d) Transcription factor
unequivocally that a genetic code is a "triplet" ? [NEET (2007)]
(a) Beadle and Tatum 87. Telomere repetitive DNA sequences control the
(b) Nirenberg and Mathaei function of eukaryote chromosomes because they:
(c) Hershey and Chase (a) Prevent chromosome loss
(d) Morgan and Sturtevant (b) Act as replicons
[NEET (2009)] (c) Are RNA transcription initiator
80. Which one of the following pairs of nitrogenous bases (d) Help chromosome pairing
of nucleic acids, is wrongly matched with the category [NEET (2007)]
mentioned against it? 88. During transcription, RNA polymerase holoenzyme
(a) Guanine, Adenine — Purines binds to a gene promoter and assumes a saddle-like
(b) Adenine, Thymine — Purines structure. What is it's DNA-binding sequence ?
(c) Thymine, Uracil — Pyrimidines (a) TATA (b) TTAA
(d) Uracil, Cytosine — Pyrimidines (c) AATT (d) CACC
[NEET (2008)] [NEET (2007)]
81. In the DNA molecule: 89. The length of DNA molecule greatly exceeds the
(a) The proportion of adenine in relation to thymine dimensions of the nucleus in eukaryotic cells. How is
varies with the organism this DNA accommodated ?
(b) there are two strands which run antiparallel one in (a) Through elimination of repetitive DNA
5'→ 3' direction and other in 3'→ 5' (b) Deletion of non-essential genes
(c) the total amount of purine nucleotides and (c) Super-coiling in nucleosomes
pyrimidine nucleotides is not always equal (d) DNase digestion
(d) there are two strands which run parallel in the 5'→ [NEET (2007)]
3' direction 90. The two polynucleotide chain in DNA are:-
[NEET (2008)] (a) Semiconservative (b) Parallel
82. Which one of the following pairs of codons is correctly (c) Discontinuous (d) Antiparallel
matched with their function or the signal for the [NEET (2007)]
particular amino acid? 91. Amino acid sequence, in protein synthesis is decided by
(a) AUG, ACG — Start/Methionine the sequence of-
(a) tRNA (b) mRNA 99. Telomerase is an enzyme which is a -

(c) cDNA (d) rRNA (a) RNA
[NEET (2006)] (b) Ribonucleoprotein
92. One gene-one enzyme hypothesis was postulated by- (c) Repetitive DNA
(a) R. Franklin (d) Simple protein
(b) Hershey and Chase [NEET (2005)]
(c) A.Garrod 100. DNA fingerprinting refers to :-
(d) Beadle and Tatum (a) Anlysis of DNA samples using imprinting devices
[NEET (2006)] (b) Techniques used for molecular analysis of different
93. One turn of the helix in a B-form DNA is specimens of DNA
approximately- (c) Techniques used for identification of fingerprints of
(a) 20 nm (b) 0.34 nm individuals
(c) 3.4 nm (d) 2 nm (d) Molecular analysis of profiles of DNA samples
[NEET (2006)] [NEET (2004)]
94. Antiparallel strands of a DNA molecule means that- 101. During transcription, if the nucleotide sequence of the
(a) One strand turns anti-clockwise DNA strand that is being coded is ATACG, then the
(b) The phosphate groups of two DNA stands, at their nucleotide sequence in the mRNA would be -
ends, share the same position (a) TCTGG (b) UAUGC
(c) The phosphate groups at the start of two DNA (c) UATGC (d) TATGC
strands are in opposite position (pole) [NEET (2004)]
(d) One strand turns clockwise 102. The following ratio is generally constant for a given
[NEET (2006)] species :-
95. E. coli cells with a mutated z gene of the lac operon (a) T + C / G + A (b) G + C / A+ T
cannot grow in medium containing only lactose as the (c) A + C / T + G (d) A + G / C +T
source of energy because - [NEET (2004)]
(a) They cannot synthesize functional beta galactosidase 103. During replication of a bacterial chromosomes DNA
(b) They cannot transport lactose from the medium into synthesis starts from a replication origin site and :-
the cell (a) Is facilitated by telomerase
(c) The lac operon is constitutively active in these cells (b) Moves in one direction of the size
(d) In the presence of glucose, E. coli cells do not (c) Moves in bi-directional way
utilize lactose (d) RNA primers are involved
[NEET (2005)] [NEET (2004)]
96. Which one of the following makes use of RNA as a 104. Which form of RNA has a structure resembling clover
template to synthesize DNA - leaf ?
(a) DNA dependant RNA polymerase (a) hn-RNA (b) m-RNA
(b) DNA polymerase (c) t-RNA (d) r-RNA
(c) Reverse transcriptase [NEET (2004)]
(d) RNA polymerase 105. A nutritionally wild type organism, which does not
[NEET (2005)] require any additional growth supplement is known as :-
97. Nucleotides are building blocks of nucleic acids. Each (a) Holotype (b) Auxotroph
nucleotide is a composite molecule formed by - (c) Prototroph (d) Phenotype
(a) Base-sugar-OH [NEET (2004)]
(b) Base-sugar-phosphate 106. The telomeres of eukaryotic chromosomes consist of
(c) Sugar-phosphate short sequences of -
(d) (Base-sugar-phosphate)n (a) Cytosine rich repeats
[NEET (2005)] (b) Adenine rich repeats
98. Which one of the following hydrolyses internal (c) Guanine rich repeats
phosphodiester bonds in a polynucleotide chain- (d) Thymine rich repeats
(a) Lipase (b) Protease [NEET (2004)]
(c) Exonuclease (d) Endonuclease
[NEET (2005)]
EVOLUTION 109
EVOLUTION
1. Select the correct group/set of Australian Marsupials (a) (a)- (ii); (b) - (i); (c) - (iv);(d) - (iii)
exhibiting adaptive radiation. (b) (a)- (i); (b) - (iv); (c) - (iii);(d) - (ii)
(a) Numbat, Spotted cuscus, Flying phalanger (c) (a)- (iv); (b) - (iii); (c) - (ii);(d) - (i)
(b) Mole, Flying squirrel, Tasmanian tiger cat (d) (a)- (iii); (b) - (ii); (c) - (i);(d) - (iv)
(c) Lemur, Anteater, Wolf [NEET (2021)]
(d) Tasmanian wolf, Bobcat, Marsupial mole 6. Match list I with list II.
[NEET (2023)]
List I List II
2. Natural selection where more individuals acquire a
specific character value other than the mean character (a) Allen’s Rule (i) Kangaroo rat
value, leads to:
(a) Stabilising change (b) Physiological (ii) Desert lizard
(b) Directional change
adaptation
(c) Disruptive change
(d) Random change (c) Behavioural (iii) Marine fish at
[NEET (2022)] adaptation depth
3. Which of the following statements is not true ?
(a) Analogous structures are a result of convergent (d) Biochemical (iv) Polar seal
evolution
adaptation
(b) Sweet potato and potato is an example of analogy
(c) Homology indicates common ancestry
(d) Flippers of penguins and dolphins are a pair of (a) (a)- (iv); (b) - (i); (c) - (ii); (d) - (iii)
homologous organs (b) (a)- (iv); (b) - (iii); (c) - (ii); (d) - (i)
[NEET (2022)] (c) (a)- (iv); (b) - (ii); (c) - (iii); (d) - (i)
4. The factor that leads to Founder effect in a population is (d) (a)- (iv); (b) - (i); (c) - (iii); (d) - (ii)
(a) Mutation [NEET (2021)]
(b) Genetic drift 7. Embryological support for evolution was disapproved
(c) Natural selection by:
(d) Genetic recombination (a) Charles Darwin
(b) Oparin
[NEET (2021)]
(c) Karl Ernst von Baer
(d) Alfred Wallace
[NEET (2020)]
List I List II 8. Which of the following refer to the correct example(s)
of organisms which have evolved due to changes of
(a) Adaptive (i) Selection of resistant environment brought about by anthropogenic action?
radiation varieties due to (i) Darwin’s Finches of Galapagos islands.
excessive use of (ii) Herbicide resistant weeds
herbicides and (iii) Drug resistant eukaryotes.
pesticides (iv) Man-created breeds of domesticated animals like
dogs.
(b) Convergent (ii) Bones of forelimbs (a) (ii), (iii) & (iv)
(b) only (iv)
evolution in Man and Whale
(c) only (i)
(d) (i) & (iii)
(c) Divergent (iii) Wings of butterfly
[NEET (2020)]
evolution and birds 9. Flippers of Penguins and Dolphins are examples of
(a) Industrial melanism
(d) Evolution by (iv) Darwin Finches (b) Natural selection
anthropogenic (c) Adaptive radiation
action (d) Convergent evolution
[NEET (2020)]
EVOLUTION 110
10. From his experiments, S.L. Miller produced amino acids 16. Among the following sets of examples for divergent
by mixing the following in a closed flask: evolution, select the incorrect option:
(a) CH4 , H2 , NH3 and water vapor at 600 ºC (a) Heart of bat, man and cheetah
(b) CH3 , H2 NH3 and water vapor at 600 ºC (b) Brain of bat, man and cheetah
(c) CH4 , H2 , NH3 and water vapor at 800 ºC (c) Forelimbs of man, bat and cheetah
(d) CH3 , H2 , NH4 and water vapor at 800 ºC (d) Eye of octopus, bat and man
[NEET (2020)] [NEET (2018)]
11. Variations caused by mutation, as proposed by Hugo de 17. According to Hugo de Vries, the mechanism of
Vries, are evolution is
(a) Random and directionless (a) Saltation
(b) Small and directional (b) Phenotypic variations
(c) Small and directionless (c) Multiple-step mutations
(d) Random and directional (d) Minor mutations
[NEET (2019)] [NEET (2018)]
12. Match the hominids with their correct brain size: 18. . Which of the following represents the order of 'Horse'
?
Column-I Column-II (a) Caballus
(b) Ferus
A Homo habilis (i) 900 cc (c) Equidae
(d) Perissodactyla
B Homo neanderthalensis (i) 1350 cc [NEET (2017)]
19. Artificial selection to obtain cows yielding higher milk
C Homo erectus (iii) 650-800cc output represents
(a) disruptive selection as it splits the population into
D Home sapiens (iv) 1400 cc two, one yielding higher output and the other lower
output
(b) stabilizing selection followed by disruptive as it
(a) A – (iii), B – (i), C – (iv), D – (ii) stabilizes the population to produce higher cows. -
(b) A – (iii), B – (ii), C – (i), D – (iv) yielding cows
(c) A – (iii), B – (iv), C – (i), D – (ii) (c) stabilizing selection as it stabilizes this character in
(d) A – (iv), B – (iii), C – (i), D – (ii) the population.
[NEET (2019)] (d) directional selection as it pushes the mean of the
13. In a species the weight of newborn ranges from 2 to 5 character in one direction.
kg. 97% of the newborn with an average weight between [NEET (2017)]
3 to 3.3 kg survive whereas 99% of the infants born with 20. Which of the following is the CORRECT sequence of
weights from 2 to 2.5 kg or 4.5 to 5 kg die. Which type events in the origin of life?
of selection process is taking place? I. Formation of protobionts
(a) Stabilizing selection II. Synthesis of organic monomers
(b) Disruptive Selection III. Synthesis of organic polymers
(c) Cyclical Selection IV. Formation of DNA-based genetic systems
(d) Directional Selection (a) I, III, II, IV
[NEET (2019)] (b) II, III, I, IV
14. A gene locus has two alleles A and a. If the frequency of (c) II, III, IV, I
dominant allele A is 0.4, then what will be the frequency (d) I, II, III, IV
of homozygous dominants, heterozygous and [NEET (2016-II)]
homozygous recessive individuals in the population? 21. The chronological order of human evolution from early
(a) 0.16 (AA); 0.24 (Aa); 0.36 (aa) to the recent is
(b) 0.16 (AA); 0.48 (Aa); 0.36 (aa) (a) Ramapithecus → Australopithecus → Homo habilis
(c) 0.16 (AA); 0.36 (Aa); 0.48 (aa) → Homo erectus
(d) 0.36 (AA); 0.48 (Aa); 0.16 (aa) (b) Ramapithecus → Homo habilis → Australopithecus
[NEET (2019)] → Homo erectus
15. The similarity of bone structure in the forelimbs of many (c) Australopithecus → Homo habilis → Ramapithecus
vertebrates is an example of → Homo erectus
(a) Convergent evolution (d) Australopithecus → Ramapithecus → Homo habilis
(b) Analogy → Homo erectus
(c) Homology [NEET (2016-II)]
(d) Adaptive radiation
[NEET (2018)]
EVOLUTION 111
22. In Hardy-Weinberg equation, the frequency of (a) 0.5 (b) 0.6

heterozygous individuals is represented by (c) 0.7 (d) 0.4
(a) 2pq (b) pq [NEET (2014)]
(c) q2 (d) p2 30. Which one of the following are analogous structures?
[NEET (2016-II)] (a) flippers of penguins and dolphins
23. Genetic drift operates in _____. (b) thorns of Bougainvillea and tendrils of Cucurbita
(a) Large isolated population (c) forelimbs of bats and human
(b) Non-reproductive population (d) all of these
(c) Slow reproductive population [NEET (2014)]
(d) Small isolated population 31. Forelimbs of cat and lizard used in walking and
[NEET (2016-II)] forelimbs of whale used in swimming and forelimbs of
24. Analogous structures are a result of bats used in flying are examples of:
(a) Divergent evolution (a) Adaptive radiation
(b) Convergent evolution (b) Homologous organs
(c) Shared ancestry (c) Convergent evolution
(d) Stabilizing selection (d) Analogous organs
[NEET (2016-I)] [NEET (2014)]
25. Following are the two statements regarding the origin of 32. The eye of octopus and eye of cat show different
life: patterns of structure, yet they perform similar function.
(a) The earliest organisms that appeared on the earth This is an example of
were non-green and presumably anaerobes. (a) Homologous organs that have evolved due to
(b) The first autotrophic organisms were the convergent evolution
chemoautotrophs that never released oxygen. Of the (b) Homologous organs that have evolved due to
above statements which one of the following options is divergent evolution
correct? (c) Analogous organs that have evolved due to
(a) (a) is correct but (b) is false convergent evolution
(b) (b) is correct but (a) is false (d) Analogous organs that have evolved due to
(c) Both (a) and (b) are correct divergent evolution
(d) Both (a) and (b) are false [NEET (2013)]
[NEET (2016-I)] 33. According to Darwinism, the organic evolution is due to
26. Which of the following structures is homologous to the (a) Intraspecific competition
wing of a bird? (b) Interspecific competition
(a) Dorsal fin of a Shark (c) Competition within closely related species
(b) Wing of a Moth (d) Reduced feeding efficiency in one species due to
(c) Hind limb of Rabbit the presence of interfering species.
(d) Flipper of Whale [NEET (2013)]
[NEET (2016-I)] 34. The tendency of the population to remain in genetic
27. Industrial melanism is an example of equilibrium may be disturbed by
(a) Neo-Darwinism (a) Random mating
(b) Natural selection (b) Lack of migration
(c) Mutation (c) Lack of mutations
(d) Neo-Lamarckism (d) Lack of random mating
[NEET (2015)] [NEET (2013)]
28. The wings of a bird and wings of an insect are 35. The process by which organism with different
(a) Homologous structures and represent divergent evolutionary history evolve similar phenotypic
evolution. adaptations in response to a common environmental
(b) Analogous structures and represent convergent challenge, is called
evolution. (a) Natural selection
(c) Phylogenetic structures and represent divergent (b) Convergent evolution
evolution. (c) Non-random evolution
(d) Homologous structures and represent convergent (d) Adaptive radiation
evolution. [NEET (2013)]
[NEET (2015)] 36. Variation in gene frequencies within populations can
29. In a population of 1000 individuals, 360 belong to occur by chance rather than by natural selection. This is
genotype AA, 480 to Aa and the remaining 160 to aa. referred to as
Based on this data, the frequency of allele A in the (a) Genetic flow (b) Genetic drift
population is (c) Random mating (d) Genetic load
[NEET (2013)]
EVOLUTION 112
37. The idea of mutations was brought forth by : 44. Which one of the following pairs of items correctly
(a) Gregor Mendol, who worked on Pisum sativum belongs to the category of organs mentioned against it?
(b) Hardy Weinberg, who worked on allele (a) Nephridia of earthworm and malpighian tubules of
frequencies in a population cockroach — Excretory organs
(c) Charles Darwin, ·who observed a wide variety of (b) Wings of honeybee and wings of crow —
organisms during sea voyage Homologous organs
(d) Hugo do Vries, who worked on evening primrose (c) Thorn of Bougainvillea and tendrils of Cucurbita —
Analogous organs
[NEET (2012)]
(d) Nictitating membrane and blind spot in human eye
38. What was the most significant trend in the evolution of — Vestigial organs
modern man (Homo sapiens) from his ancestors ? [NEET (2008)]
(a) Increasing brain capacity 45. Which one of the following in birds, indicates their
(b) Upright posture reptilian ancestry?
(c) Shortening of jaws (a) Two special chambers crop and gizzard in their
(d) Binocular vision digestive tract
[NEET (2011)] (b) Eggs with a calcareous shell
39. Darwin's finches are a good example of – (c) Scales on their hind limbs
(a) Industrial melanism (d) Four-chambered heart
(b) Connecting link [NEET (2008)]
(c) Adaptive radiation 46. Which one of the following scientist's name is correctly
matched with the theory put fourth by him?
(d) Convergent evolution (a) deVries — Natural selection
[NEET (2010)] (b) Mendel — Theory of pangenesis
40. In the case of peppered moth (Biston betularia) the (c) Weismann — Theory of continuity of germplasm
black-coloured from became dominant over the light- (d) Pasteur — Inheritance of acquired characters
coloured form in England during industrial revolution. [NEET (2008)]
This is an example of - 47. When two species of different genealogy come to
(a) Inheritance of darker colour character acquired due resemble each other as a result of adaptation, the
to the darker environment phenomenon is termed:-
(b) Natural selection whereby the darker forms were (a) Convergent evolution
selected. (b) Divergent evolution
(c) Appearance of the darker coloured individuals due (c) Microevolution
to very poor sunlight (d) Co-evolution
(d) Protective mimicry [NEET (2007)]
[NEET (2009)] 48. Adaptive radiation refers to:-
41. Thorn of Bougainvillea and tendril of Cucurbita are (a) Power of adaptation in an individual to a variety of
examples of: environments
(a) Vestigial organs (b) Adaptations due to Geographical isolation
(b) Retrogressive evolution (c) Evolution of different species from acommon
(c) Analogous organs ancestor
(d) Homologous organs (d) Migration of members of a species to different
[NEET (2008)] geographical areas
42. Darwin's Finches are an excellent examples of: [NEET (2007)]
(a) Brood parasitism 49. The finches of Galapogas islands provide an evidence in
(b) Connecting links favour of-
(c) Adaptive radiation (a) Biogeographical Evolution
(d) Seasonal migration (b) Special Creation
[NEET (2008)] (c) Evolution due to Mutation
43. Which one of the following is incorrect about the (d) Retrogressive Evolution
characteristics of protobionts (coacervates and [NEET (2007)]
microspheres) as envisaged in the abiogenic origin of 50. One of the important consequences of geographical
life? isolation is:-
(a) They were partially isolated from the surru-ounding (a) Random creation of new species
(b) They could maintain an internal environ-ment (b) No change in the isolated fauna
(c) They were able to reproduce (c) Preventing Speciation
(d) They could separate combinations of mole-cules (d) Speciation through reproductive isolation
from the surroundings [NEET (2007)]
[NEET (2008)]
EVOLUTION 113
51. Industrial melanism as observed in peppered moth 59. Evolutionary history of an organism is known as-
proves that:- (a) Phylogeny (b) Ancestry
(a) Melanism is a pollution-generated feature (c) Paleontology (d) Ontogeny
(b) The true black melanic forms arise by a recurring [NEET (2006)]
random mutation 60. Which one of the following experiments suggests that
(c) The melanic form of the moth has no selective simplest living organisms could not have originated
advantage over lighter form in industrial area spontaneously from non-living matter -
(d) The lighter-form the moth has no selective (a) Larva cound appear in decaying organic matter
advantage either in polluted industrial area or non- (b) Meat was not spoiled, when heated and kept sealed
polluted area in a vessel
[NEET (2007)] (c) Microbes did not appear in stored meat
52. The concept of chemical evolution is based on- (d) Microbes appeared form unsterilized organic matter
(a) Possible origin of life by combination of chemicals [NEET (2005)]
under suitable environmental conditions 61. Which one of the following phenomena supports
(b) Crystallization of chemicals Darwin's concept of natural selection in organic
(c) Interaction of water, air and clay under intense heat evolution -
(d) Effect of solar radiation on chemicals (a) Production of 'Dolly', the sheep by cloning
[NEET (2007)] (b) Development of organs from 'stem' cells for organ
53. Among the human ancestors the brain size was more transplantation
than 1000 CC in:- (c) Development of transgenic animals
(a) Homo habilis (d) Prevalence of pesticide resistant insects
(b) Homo neanderthalensis [NEET (2005)]
(c) Homo erectus 62. Which of the following is the relatively most accurate
(d) Ramapithecus method for dating of fossils -
[NEET (2007)] (a) Electron-spin resonance method
54. Select the correct statement from the following: (b) Uranium-lead method
(a) Mutations are random and directional (c) Potassium–argon method
(b) Darwinian variations are small and directionless (d) Radio-carbon method
(c) Fitness is the end result of the ability to adapt and [NEET (2005)]
gets selected by nature 63. There are two opposing views about origin of modern
(d) All mammals except whales and camels have seven man. According to one view Homo erectus in Asia were
cervical vertebrae the ancestors of modern man. A study of variation of
[NEET (2007)] DNA however suggested African origin of modern man.
55. Which one of the following amino-acids was not found What kind of observation of DNA variation could
to be synthesized in Miller's experiment ? suggest this -
(a) Glycine (b) Aspartic acid (a) Greater variation in Asia than in Africa
(c) Glutamic acid (d) Alanine (b) Similar variation in Africa and Asia
[NEET (2006)] (c) Variation only in Asia and no variation in Africa
56. An important evidence in favour of organic evolution is (d) Greater variation in Africa than in Asia
the occurrence of- [NEET (2005)]
(a) Homologous and vestigial organs 64. De Vries gave his mutation theory on organic evolution
(b) Analogous and vestigial organs while working on -
(c) Homologous organs only (a) Oenothera lamarckiana
(d) Homologous and analogous organs (b) Drosophila melanogaster
[NEET (2006)] (c) Pisum sativum
57. Which one of the following is not a living fossil- (d) Althea rosea
(a) King crab (b) Sphenodon [NEET (2005)]
(c) Archaeopteryx (d) Peripatus 65. Age of fossils in the past was generally determined by
[NEET (2006)] radio-carbon method and other methods involving
58. Jurassic period of the Mesozoic era characterized by- radioactive elements found in the rocks. More precise
(a) Gymnosperms are dominant plants and first birds methods, which were used recently and led to the
appear revision of th evolutionary periods for different groups
(b) Radiation of reptiles and origin of mammal like of organisms includes -
reptiles (a) Study of the conditions of fossilization
(c) Dinosaurs become extinct and angiosperms appear (b) Electron spin resonance (ESR) & fossil DNA
(d) Flowering plants and first dinosaurs appear (c) Study of carbohydrates/proteins in rocks
[NEET (2006)] (d) Study of carbohydrates/proteins in fossils
[NEET (2004)]
EVOLUTION 114
66. What kind of evidence suggested that man is more (a) Oxygen
closely related with chimpanzee than with other (b) Hydrogen
hominoid apes ? (c) Water vapour
(a) Comparison of chromosomes morphology only (d) Methane
(b) Evidence from fossil remains and the fossil [NEET (2004)]
mitochondrial DNA alone 68. Presence of gills in the tadpole of frog indicates that :-
(c) Evidence from DNA extracted from sex (a) Fishes evolved from frog like ancestors
chromosomes, autosomes & mitochondria (b) Frogs will have gills in future
(d) Evidence from DNA from sex chromosomes only (c) Frogs evolved from gilled ancestors
[NEET (2004)] (d) Fishes were amphibious in the past
67. According to oparin, which one of the following was not [NEET (2004)]
present in the primitive atmosphere of the earth :-
HUMAN HEALTH AND DISEASES 115
HUMAN HEALTH AND DISEASES

1. Match List I with List II. 5. Select the incorrect statement with respect to acquired
List I List II immunity:
A. Ringworm I. Haemophilus influenzae (a) Primary response is produced when our body
B. Filariasis II. Trichophyton encounters a pathogen for the first time.
(b) Anamnestic response is elicited on subsequent
C. Malaria III. Wuchereria bancrofti encounters with the same pathogen
D. Pneumonia IV. Plasmodium vivax (c) Anamnestic response is due to memory of first
Choose the correct answer from the options given encounter
below: (d) Acquired immunity is non-specific type of defense
(a) A–II, B–III, C–I, D–IV present at the time of birth
(b) A–III, B–II, C–I, D–IV [NEET (2022)]
(c) A–III, B–II, C–IV, D–I 6. Match list I with list II.
(d) A–II, B–III, C–IV, D–I
List I List II
[NEET (2023)]
2. Match List I with List II. (a) Filariasis (i) Haemophilus influenzae
List I List II
A. Heroin I. Effect on cardiovascular (b) Amoebiasis (ii) Trichophyton
system
B. Marijuana II. Slows down body (c) Pneumonia (iii) Wuchereria bancrofti
function
C. Cocaine III. Painkiller (d) Ringworm (iv) Entamoeba histolytica
D. Morphine IV. Interfere with transport of
dopamine (a) (a)- (i); (b) - (ii); (c) - (iv);(d) - (iii)
Choose the correct answer from the options given (b) (a)- (ii); (b) - (iii); (c) - (i);(d) - (iv)
below: (c) (a)- (iv); (b) - (i); (c) - (iii);(d) - (ii)
(a) A–I, B–II, C–III, D–IV (d) (a)- (iii); (b) - (iv); (c) - (i);(d) - (ii)
(b) A–IV, B–III, C–II, D–I [NEET (2021)]
(c) A–III, B–IV, C–I, D–II 7. The infectious stage of plasmodium that enters the
(d) A–II, B–I, C–IV, D–III human body is
[NEET (2023)] (a) Female gametocytes
3. In which blood corpuscles, HIV undergoes replication (b) Male gametocytes
and produces progeny viruses? (c) Trophozoites
(a) B-lymphocytes (d) Sporozoites
(b) Basophils [NEET (2020)]
(c) Eosinophils 8. Match the following diseases with the causative
organism and select the correct option.
(d) TH cells
[NEET (2023)] Column I Column II
4. Given below are two statements:
Statement I: Autoimmune disorder is a condition where (a) Typhoid (i) Wuchereria
the body defense mechanism recognizes its own cells as
foreign bodies. (b) Pneumonia (ii) Plasmodium
Statement II: Rheumatoid arthritis is a condition where
the body does not attack self cells. (c) Filariasis (iii) Salmonella
In the light of the above statements, choose the most
appropriate answer from the options given below: (d) Malaria (iv) Haemophilus
(a) Both Statement I and Statement II are correct
(c) Statement I is correct but Statement II is incorrect (a) a – ii; b – i; c – iii; d – iv
(d) Statement I is incorrect but Statement II is correct (b) a – iv; b – i; c – ii; d – iii
[NEET (2022)] (c) a – i; b – iii; c – ii; d – iv
(d) a – iii; b – iv; c – i; d – ii 16. In which disease does mosquito-transmitted pathogen

[NEET (2020)] cause chronic inflammation of lymphatic vessels?
9. Identify the wrong statement with reference to (a) Ascariasis
immunity. (b) Ringworm disease
(a) Active immunity is quick and gives full response. (c) Elephantiasis
(b) Foetus receives some antibodies from mother, it is (d) Amoebiasis
an example for passive immunity. [NEET (2018)]
(c) When exposed to antigen (living or dead) 17. Which part of the poppy plant is used to obtain the drug
antibodies are produced in the host’s body. It is called “Smack”?
“Active immunity”. (a) Roots (b) Latex
(d) When readymade antibodies are directly given, it is (c) Flowers (d) Leaves
called “Passive immunity”. [NEET (2018)]
[NEET (2020)] 18. Transplantation of tissues/organs fails often due to non-
10. Colostrum, the yellowish fluid, secreted by mother acceptance by the patient's body. Which type of
during the initial days of lactation is very essential to immune-response is responsible for such rejections?
impart immunity to the newborn infants because it (a) Hormonal immune response
contains: (b) Physiological immune response
(a) Monocytes (c) Autoimmune response
(b) Macrophages (d) Cell-mediated immune response
(c) Immunoglobulin A [NEET (2017)]
(d) Natural killer cells 19. MALT constitutes about………… percent of the
[NEET (2019)] lymphoid tissue in the human body.
11. Drug called ‘Heroin’ is synthesized by (a) 70% (b) 10%
(a) Acetylation of morphine (c) 50% (d) 20%
(b) Glycosylation of morphine [NEET (2017)]
(c) Nitration of morphine 20. Which of the following sets of diseases is caused by
(d) Methylation of morphine bacteria?
[NEET (2019)] (a) Typhoid and smallpox
12. Which of the following immune responses is (b) Tetanus and mumps
responsible for rejection of kidney graft? (c) Herpes and influenza
(a) Humoral immune response (d) Cholera and tetanus
(b) Inflammatory immune response [NEET (2016-II)]
(c) Cell-mediated immune response 21. Which of the following is CORRECT regarding AIDS
(d) Auto-immune response causative agent HIV?
[NEET (2019)] (a) HIV is enveloped virus that contains two identical
13. Due to increasing air-borne allergens and pollutants, molecules of single-stranded RNA and two molecules of
many people in urban areas are suffering from reverse transcriptase.
respiratory disorder causing wheezing due to (b) HIV is unenveloped retrovirus.
(a) Inflammation of bronchi and bronchioles (c) HIV does not escape but attacks the acquired
(b) Proliferation of fibrous tissues and damage of the immune response.
alveolar walls (d) HIV is enveloped virus containing one molecule of
(c) Reduction in the secretion of surfactants by single-stranded RNA and one molecule of reverse
pneumocytes transcriptase.
(d) Benign growth on mucous lining of nasal cavity [NEET (2016-II)]
[NEET (2019)] 22. Which of the following statements is NOT true for
14. Identify the correct pair representing the causative agent cancer cells in relation to mutations?
of typhoid fever and the confirmatory test for typhoid. (a) Mutations in proto-oncogenes accelerate the cell
(a) Streptococcus pneumoniae/ Widal test cycle
(b) Salmonella typhi/ Anthrone test (b) Mutations destroy telomerase inhibitor
(c) Salmonella typhi/Widal test (c) Mutations inactivate the cell control
(d) Plasmodium vivax/ UTI test (d) Mutations inhibit production of telomerase
[NEET (2019)] [NEET (2016-I)]
15. Which of the following is not an autoimmune disease? 23. Antivenom injection contains preformed antibodies
(a) Alzheimer’s disease while polio drops that are administered into the body
(b) Rheumatoid arthritis contain
(c) Psoriasis (a) Activated pathogens
(d) Vitiligo (b) Harvested antibodies
[NEET (2018)] (c) Gamma globulin
(d) Attenuated pathogens (a) Depressant (b) Stimulant

[NEET (2016-I)] (c) Pain-killer (d) Hallucinogen
24. In higher vertebrates, the immune system can [NEET (2014)]
distinguish self-cell and non-self. If this property is lost 31. The cell-mediated immunity inside the human body is
due to genetic abnormality and it attacks self-cells, then carried out by
it leads to (a) T–lymphocytes (b) B–lymphocytes
(a) Allergic response (c) Thrombocytes (d) Erythrocytes
(b) Graft rejection [NEET (2013)]
(c) Auto-immune disease 32. Infection of Ascaris usually occurs by
(d) Active immunity (a) Drinking water containing eggs of Ascaris
[NEET (2016-I)] (b) Eating imperfectly cooked pork
25. Which of the following diseases is caused by a (c) Tse-tse fly
protozoan? (d) Mosquito bite
(a) Syphilis (b) Influenza [NEET (2013)]
(c) Babesiosis (d) Blastomycosis 33. Identify the molecules (a) and (b) shown below and
[NEET (2015)] select the right option giving their source and use.
26. If you suspect major deficiency of antibodies in a
person, to which of the following would you look for
confirmatory evidence?
(a) Fibrinogen in plasma
(b) Serum albumins
(c) Haemocytes (a) Molecule-(b) Heroin; Source-Cannabis sativa; Use-
(d) Serum globulins Depressant and slows down body functions
[NEET (2015)] (b) Molecule-(b) Cannabinoid; Source-Atropa
27. Which of the following immunoglobulins does belladona; Use-Produces hallucinations
constitute the largest percentage in human milk? (c) Molecule-(a) Morphine; Source-Papaver
(a) lgD (b) lgM somniferum; Use-Sedative and pain killer
(c) lgA (d) lgG (d) Molecule-(a) Cocaine; Source-Erythroxylum coca;
[NEET (2015)] Use-Accelerates the transport of dopamin
28. Which one of the following fungi contains [NEET (2012)]
hallucinogens?
34. Which one of the following sets of items in the option 1
(a) Amanita muscaria
- 4 are correctly categorized with one exception in it ?
(b) Neurospora sp.
(a) Items-Kangaroo, Koala, wombat; Category-
(c) Ustilago sp.
Australian marsupials; Exception-Wombat
(d) Morchella esculenta
(b) Items-Plasmodium, Cuscuta, Trypanosoma;
[NEET (2014)]
Category-Protozoan parasites; Exception-Cuscuta
29. At which stage of HIV infection does one usually show
(c) Items-Typhoid, Pneumonia, Diphtheria; Category-
symptoms of AIDS?
Bacterial diseases; Exception-Diphtheria
(a) When the infected retrovirus enters the host cells
(b) When HIV damages large number of helper T – (d) Items-UAA, UAG, UGA; Category-Stop codons;
lymphocytes Exception-UAG
(c) When the viral DNA is produced by reverse [NEET (2012)]
transcriptase 35. Which one of the following organisms is scientifically
(d) Within 15 days of sexual contact with an infected correctly named, correctly printed according to the
person International Rules of Nomenclature and correctly
[NEET (2014)] described?
30. Which is the particular type of drug that is obtained from (a) Plasmodium falciparum-a protozoan pathogen
the plant whose one flowering branch is shown below? causing the most serious type of malaria
(b) Felis tigris-The Indian tiger, well protected in Gir
forests.
(c) E.Coli-Full name Entamoeba coli, a commonly
occurring bacterium in human intestine
(d) Musca domestica-The common house lizards, a
reptile
[NEET (2012)]
36. Which one of the following statements is correct ·with (a) The HIV can be transmitted through eating food
respect to immunity ? together with an infected person
(a) The antibodies against small pox pathogen are (b) Drug addicts are least susceptible to HIV infection
produced by T -lymphocytes (c) AIDS patients are being fully cured cent percent
(b) Antibodies are protein molecules each of which has with proper care and nutrition
four light chains (d) The causative HIV retrovirus enters helper T-
(c) Rejection of a kidney graft is the function of B- lymphocytes thus reducing their numbers
lymphocytes [NEET (2010)]
(d) Performed antibodiesneed to be injected to treat the 44. Consider the following four statements (a–d) regarding
bite by a viper snake kidney transplant and select the two correct ones out of
these –
[NEET (2012)]
(a) Even if a kidney transplant is proper the recipient
37. Which one of the following acts as a physiological
may need to take immunosuppresants for a long time
barrier to the entry of microorganisms in human body ?
(b) The cell-mediated immune response is responsible
(a) Skin
for the graft rejection
(b) Epithelium of Urogenital tract
(c) The B-lymphocytes are responsible for rejection of
(c) Tears
the graft
(d) Monocytes
(d) The acceptance or rejection of a kidney transplant
[NEET (2011)]
depends on specific interferons
38. Where will you look for the sporozoites of the malarial
The two correct statements are –
parasite ?
(a) (b) and (c) (b) (c) and (d)
(a) Salivary glands of freshly moulted female Anopheles
(c) (a) and (c) (d) (a) and (b)
mosquito
[NEET (2010)]
(b) Saliva of infected female Anopheles mosquito
45. Which one of the following statement is correct ?
(c) Red blood corpuscles of humans suffering from
(a) Malignant tumours may exhibit metastasis
malaria
(b) Patients who have undergone surgery are given
(d) Spleen of infected humans
cannabinoids to relieve pain.
[NEET (2011)]
(c) Benign tumours show the property of metastasis
39. At which stage of HIV infection does one usually shown
(d) Heroin accelerates body functions.
symptoms of AIDS ?
[NEET (2009)]
(a) Within 15 days of sexual contact with an infected
46. Which of following is a pair of viral diseases ?
person
(a) Typhoid, Tuberculosis
(b) When the infecting retrovirus enters host cells
(b) Ringworm, AIDS
(c) When viral DNA is produced by reverse
(c) Common Cold, AIDS
transcriptase
(d) Dysentery, Common Cold
(d) When HIV replicates rapidly in helper T-
[NEET (2009)]
lymphocytes damages larger number of these
47. A person likely to develop tetanus is immunized by
[NEET (2011)]
administering :
40. Select the correct statement from the ones given below :
(a) Weakned germs
(a) Barbiturates when given to criminals make them tell
(b) Dead germs
the truth
(c) Preformed antibodies
(b) Morphine is often given to persons who have
(d) Wide spectrum antibiotics
undergone surgery as a pain killer
[NEET (2009)]
(c) Chewing tobacco lowers blood pressure and heart
48. Consider the following four measures (1-4) that could
rate
be taken to successfully grow chickpea in an area where
(d) Cocaine is given to patients after surgery as it
bacterial blight disease is common:
stimulates recovery
(i) Spray with Bordeaux mixture
[NEET (2010)]
(ii) Control of the insect vector of the disease pathogen
41. Ringworm in humans is caused by :
(iii) Use of only disease-free seeds
(a) Bacteria (b) Fungi
(iv) Use of varieties resistant to the disease
(c) Nematodes (d) Viruses
Which two of the above measures can control the
[NEET (2010)]
disease?
42. Widal test is used for the diagnosis of –
(a) (iii) and (iv) (b) (i) and (iv)
(a) Malaria (b) Pneumonia
(c) (ii) and (iii) (d) (i) and (ii)
(c) Tuberculosis (d) Typhoid
[NEET (2008)]
[NEET (2010)]
49. Consider the statements given below regarding
43. Which one of the following statements is correct with
contraception and answer as directed thereafter:
respect to AIDS ?
(i) Medical Termination of Pregnancy (MTP) during (c) Mood disorders

first trimester is generally safe (d) Addictive disorders
(ii) Generally chances of conception are nil until mother [NEET (2006)]
breast-feeds the infant upto two years 56. Mast cells secrete-
(iii) Intrauterine devices like copper-T are effective (a) Hippurin (b) Myoglobin
contraceptives (c) Histamine (d) Heamoglobin
(iv) Contraception pills may be taken upto one week [NEET (2006)]
after coitus to prevent conception 57. Antibodies in our body are complex-
Which two of the above statement are correct? (a) Lipoproteins (b) Steroids
(a) (i), (iii) (b) (i), (ii) (c) Prostaglandins (d) Glycoproteins
(c) (ii), (iii) (d) (iii), (iv) [NEET (2006)]
[NEET (2008)] 58. The causative agent of mad-cow disease is a-
50. To which type of barriers under innate immunity, do the (a) Bacterium (b) Prion
saliva in the mouth and the tears from the eyes, belong? (c) Worm (d) Virus
(a) Physiological barriers [NEET (2006)]
(b) Physical barriers 59. HIV that causes AIDS, first starts destroying
(c) Cytokine barriers (a) B-lymphocytes
(d) Cellular barriers (b) Leucocytes
[NEET (2008)] (c) Thrombocytes
51. Which one of the following is the correct statement (d) Helper T-lymphocytes
regarding the particular psychotropic drug specified? [NEET (2006)]
(a) Morphine leads to delusions and disturbed emotions 60. Which one of the following depresses brain activity and
(b) Barbiturates cause relaxation and temporary produces feelings of calmness, relaxation and
euphoria drowsiness -
(c) Hashish causes after thought perceptions and (a) Morphine (b) Valium
hallucinations (c) Hashish (d) Amphetamines
(d) Opium stimulates nervous system and causes [NEET (2005)]
hallucinations 61. AIDS is caused by HIV that principally infects
[NEET (2008)] (a) Activator B cells
52. If you suspect deficiency of antibodies in a person, to (b) T4 lymphocytes
which of the following would you look for confirmatory (c) Cytotoxic T cells
evidence ? (d) All lymphocytes
(a) Haemocytes [NEET (2005)]
(b) Serum albumins 62. Which of the following statements is not true for
(c) Serum globulins retroviruses :-
(d) Fibrinogen in the plasma (a) Retroviruses carry gene for RNA-dependent DNA
[NEET (2007)] polymerase
53. Increased asthmatic attacks in certain seasons are related (b) The genetic material in mature retroviruses is RNA
to: (c) Retroviruses are causative agents for certain kinds
(a) Low temperature of cancer in man
(b) Hot and humid environment (d) DNA is not present at any stage in the life cycle of
(c) Eating fruits preserved in tin containers retroviruses.
(d) Inhalation of seasonal pollen [NEET (2005)]
[NEET (2007)] 63. Cancer cells are more easily damaged by radiation than
54. The bacterium (Clostridium botulinum) that causes normal cells because they are -
botulism is- (a) Undergoing rapid division
(a) A facultative anaerobe (b) Different in structure
(b) An obligate anaerobe (c) Non-dividing
(c) A facultative aerobe (d) Starved of mutation
(d) An obligate aerobe [NEET (2004)]
[NEET (2006)] 64. Which one of the following is not correctly matched
55. A person showing unpredictable moods, outbursts of (a) Culex pipiens – Filariasis
emotion, quarrelsome behaviour and conflicts with (b) Aedes aegypti – Yellow fever
others is suffering from- (c) Anopheles culifaciens – Leishmaniasis
(a) Schizophrenia (d) Glossina palpalis – Sleeping sickness
(b) Borderline Personality Disorder (BPD) [NEET (2004)]
MICROBES IN HUMAN WELFARE 120
MICROBES IN HUMAN WELFARE

1. Identify the microorganism which is responsible for the 4. Which of the following is put into anaerobic sludge
production of an immunosuppressive molecule digester for further sewage treatment?
cyclosporin A: (a) Effluents of primary treatment
(a) Trichoderma polysporum (b) Activated sludge
(b) Clostridium butylicum (c) Primary sludge
(c) Aspergillus niger (d) Floating debris
(d) Streptococcus cerevisiae [NEET (2020)]
[NEET (2022)] 5. Match the following organisms with the products they
2. Match list I with list II. produce.
Column I Column II
List I List II
(A) Lactobacillus (i) Cheese
(a) Aspergillus niger (i) Acetic Acid
(B) Saccharomyces cerevisiae (ii) Curd
(b) Acetobacter aceti (ii) Lactic Acid
(C) Aspergillus niger (iii) Citric Acid
(c) Clostridium butylicum (iii) Citric Acid
(D) Acetobacter aceti (iv) Bread
(d) Lactobacillus (iv) Butyric Acid
(v) Acetic Acid
(a) (a)- (ii); (b) - (iii); (c) - (i);(d) - (iv) (a) A – (ii), B – (iv), C – (iii), D – (v)
(b) (a)- (iv); (b) - (ii); (c) - (i);(d) - (iii) (b) A – (iii), B – (iv), C – (v), D – (i)
(c) (a)- (iii); (b) - (i); (c) - (iv);(d) - (ii) (c) A – (ii), B – (i), C – (iii), D – (v)
(d) A – (ii), B – (iv), C – (v), D – (iii)
(d) (a)- (i); (b) - (ii); (c) - (iii);(d) - (iv)
[NEET (2019)]
[NEET (2021)] 6. Select the correct group of biocontrol agents.
3. Match the following columns and select the correct (a) Trichoderma, Baculovirus, Bacillus thuringiensis
option. (b) Oscillataria, Rhizobium, Trichoderma
(c) Nostoc, Azospirillum, Nucleopolyhedrovirus
Column I Column II (d) Bacillus thuringiensis, Tobacco mosaic virus,
Aphids
(a) Clostridium (i) Cyclosporin-A [NEET (2019)]
butylicum 7. Which of the following is a commercial blood
cholesterol lowering agent?
(b) Trichoderma (ii) Butyric Acid (a) Statin (b) Streptokinase
polysporum (c) Lipases (d) Cyclosporin A
[NEET (2019)]
(c) Monascus (iii) Citric Acid 8. Which of the following can be used as a biocontrol agent
purpureus in the treatment of plant disease?
(a) Chlorella (b) Anabaena
(c) Lactobacillus (d) Trichoderma
(d) Aspergillus niger (iv) Blood cholesterol
[NEET (2019)]
lowering agent 9. Conversion of milk to curd improves its nutritional
value by increasing the amount of
(a) Vitamin B12 (b) Vitamin A
(a) a – i; b – ii; c – iv; d – iii (c) Vitamin D (d) Vitamin E
(b) a – iv; b – iii; c – ii; d – i [NEET (2018)]
(c) a – iii; b – iv; c – ii; d – i 10. Which of the following in sewage treatment removes
(d) a – ii; b – i; c – iv; d – iii suspended solids?
[NEET (2020)] (a) Primary treatment
(b) Sludge treatment
(c) Tertiary treatment
(d) Secondary treatment (a) (a)-(iii); (b)-(iv); (c)-(i); (d)-(ii)

[NEET (2017)] (b) (a)-(iv); (b)-(iii); (c)-(ii); (d)-(i)
11. Which of the following is correctly matched for the (c) (a)-(iv); (b)-(ii); (c)-(i); (d)-(iii)
product produced by them? (d) (a)-(iii); (b)-(i); (c)-(iv); (d)-(ii)
(a) Penicillium notatum: Acetic acid [NEET (2015)]
(b) Saccharomyces cerevisiae: Ethanol 16. What gases are produced in anaerobic sludge
(c) Acetobacter aceti: Antibiotics digesters?
(d) Methanobacterium: Lactic acid (a) Methane, hydrogen sulphide and CO2
[NEET (2017)] (b) Methane, hydrogen sulphide and O2
12. Match Column-I with Column-II and select the (c) Hydrogen sulphide and CO2
CORRECT option using the codes given below. (d) Methane and CO2 only
Column-I Column-II [NEET (2014)]
a) Citric acid i) Trichoderma 17. During sewage treatment, biogases are produced which
b) Cyclosporin A ii) Clostridium include
(a) Methane, hydrogen sulphide, carbon dioxide
c) Statins iii) Aspergillus (b) Methane, oxygen, hydrogen sulphide
d) Butyric acid iv) Monascus (c) Hydrogen sulphide, methane, sulphur dioxide
(a) a) - iii), b) - i), c) - iv), d) - ii) (d) Hydrogen sulphide, nitrogen, methane
(b) a) - i), b) - iv), c) - ii), d) - iii) [NEET (2013)]
(c) a) - iii), b) - iv), c) - i), d) - ii) 18. A good producer of citric acid is
(d) a) - iii), b) - i), c) - ii), d) - iv) (a) Aspergillus
[NEET (2016-II)] (b) Pseudomonas
13. The primitive prokaryotes responsible for the (c) Clostridium
production of biogas from the dung of ruminant animals, (d) Saccharomyces
include the: [NEET (2013)]
(a) Halophiles 19. In gobar gas, the maximum amount is that of:
(b) Thermoacidophiles (a) Methane (b) Propane
(c) Methanogens (c) Carbon dioxide (d) Butane
(d) Eubacteria [NEET (2012)]
[NEET (2016-I)]
20. The domestic sewage in large cities:
14. Which of the following is wrongly matched in the given
(a) Is processed by aerobic and then anaerobic bacteria
table?
in the secondary treatment in Se\-vage Treatment Plant
(a) Microbe- Trichoderma polysporum; Product-
(STPs)
Cyclosporin A; Application- Immunosuppressive drug
(b) When treated in STPs does not really require the
(b) Microbe- Monascus purpureus; Product- Statins;
aeration step as the sewage contains adequate oxygen
Application- Lowering of blood cholesterol
(c) Has very high amounts of suspended solids and
(c) Microbe- Streptococcus; Product- Streptokinase;
dissolved salts
Application- Removal of clot from blood vessel
(d) Microbe- Clostridium butylicum; Product- Lipase; (d) Has a high BOD as it contains both aerobic and
Application- Removal of oil stains anaerobic bacteria.
[NEET (2016-I)] [NEET (2012)]
15. Match the following list of microbes and their 21. Organisms called Methanogens are most abundant
importance. in a :
(a) Hot spring
(a) Saccharomyces (i) Production of (b) Sulphur rock
cerevisiae immunosuppressiv (c) Cattle yard
e agents (d) Polluted stream
[NEET (2011)]
(b) Monascus (ii) Ripening of Swiss
22. Ethanol is commercially produced through a particular
purpureus cheese special of :
(c) Trichoderma (iii) Commercial (a) Aspergillus
polysporum production of (b) Sanccharomyces
ethanol (c) Clostridium
(d) Propionibacteri (iv) Production of (d) Trichoderma
[NEET (2011)]
um sharmanii blood cholesterol-
23. Secondary sewage treatment is mainly a :
lowering agents (a) Biological process
(b) Physical process
(c) Mechanical process (c) Has no relationship with concentration of oxygen in

(d) Chemical process the water
[NEET (2011)] (d) Gives a measure of Salmonella in the water
24. Which one of the following is not a biofertilizer ? [NEET (2009)]
(a) Mycorrhiza 33. Which of the following is not used as a biopesticide ?
(b) Agrobacterium (a) Xanthomonas Campestris
(c) Rhizobium (b) Bacillus thringiensis
(d) Nostoc (c) Trichoderma harzianum
[NEET (2011)] (d) Nuclear Polyhedral Virus (NPV)
25. Which of the following is mainly produced by the [NEET (2009)]
activity of anaerobic bacteria on sewage ? 34. Which one of the following proved effective for
(a) Marsh gas (b) Laughing gas biological control of nematodal disese in plants?
(c) Propane (d) Mustard gas (a) Gliocladium virens
[NEET (2011)] (b) Paecilomyces lilacinus
26. Continuous addition of sugars in 'fed batch' fermentation (c) Pisolithus tinctorius
is done to : (d) Pseudomonas cepacia
(a) Degrade sewage [NEET (2008)]
(b) Produce methane 35. Trichoderma harzianum has proved a useful
(c) Obtain antibiotics microorganism for:
(d) Purify enzymes (a) Gene transfer in higher plants
[NEET (2011)] (b) Biological control of soil-borne plant pathogens
27. An organism used as a Biofertilizer for raising soyabean (c) Bioremediation of contaminated soils
crop is : (d) Reclamation of wastelands
(a) Nostoc (b) Azotobacter [NEET (2008)]
(c) Azospirillum (d) Rhizobium 36. In which one of the following the BOD (Biochemical
[NEET (2011)] Oxygen Demand) of sewage (S), distillery effluent
28. Select the correct statement from the following: (DE), paper mill effluent (PE) and sugar mill effluent
(a) Biogas is produced by the activity of aerobic bacteria (SE) have been arranged in ascending order ?
on animal waste (a) S < DE < PE < SE
(b) Methanobacterium is an aerobic bacterium found in (b) SE < S < PE < DE
rumen of cattle (c) SE < PE < S < DE
(c) Biogas, commonly called gobar gas, is pure (d) PE < S < SE < DE
methane [NEET (2007)]
(d) Activated sludge-sediment in settlement tanks of 37. Which one of the following statements is correct ?
sewage treatment plant is a rich source of aerobic (a) At present it is not possible to grow maize without
bacteria chemical fertilizers
[NEET (2010)] (b) Extensive use of chemical fertilizers may lead to
29. A common biocontrol agent for the control of plant eutrophication of nearby water bodies
diseases is – (c) Both Azotobacter and Rhizobium fix atmospheric
(a) Baculovirus nitrogen in root nodules of plants
(b) Bacillus thuringiensis (d) Cyanobacteria such as Anabaena and nostoc are
(c) Glomus important mobilizers of phosphates and potassium for
(d) Trichoderma plant nutrition in soil
[NEET (2010)] [NEET (2007)]
30. Which one of the following not used in organic farming? 38. Probiotics are-
(a) Glomus (b) Earthworm (a) Live microbial food supplement
(c) Oscillatoria (d) Snail (b) Safe antibiotics
[NEET (2010)] (c) Cancer inducting microbes
31. Stirred-tank bioreactors have been designed for – (d) New kind of food allergens
(a) Addition of preservatives to the product [NEET (2007)]
(b) Purification of the product 39. Which one of the following pairs is wrongly matched ?
(c) Ensuring anaerobic conditions in the culture vessel (a) Coliforms – Vinegar
(d) Availability of oxygen throughout the process (b) Methanogens – Gobar gas
[NEET (2010)] (c) Yeast – Ethanol
32. Biochemical Oxygen Demand (BOD) in a river water : (d) Streptomycetes – Antibiotic
(a) Increases when sewage gets mixed with river water [NEET (2007)]
(b) Remains unchanged when algal bloom occurs
40. Limit of BOD prescribed by Central Pollution Control 42. For retting of Jute the fermenting microbe used is -
Board for the discharge of industrial and municipal (a) Methophilic bacteria
waste waters into natural surface waters, is - (b) Helicobactor pylori
(a) < 3.0 ppm (b) <10 ppm (c) Butyric acid bacteria
(c) < 100 ppm (d) < 30 ppm (d) Streptococcus lactin
[NEET (2006)] [NEET (2005)]
41. Which of the following is not used for disinfection of 43. Dough kept overnight in warm weather becomes soft
drinking water - and spongy becauses of :-
(a) Chlorine (a) Fermentation
(b) Phenyl (b) Cohesion
(c) Chloramine (c) Osmosis
(d) Ozone (d) Absorption of carbon dioxide from atmosphere
[NEET (2005)] [NEET (2005)]
BIOTECHNOLOGY PRINCIPLES AND PROCESSES 124
BIOTECHNOLOGY PRINCIPLES AND PROCESSES

1. During the purification process for recombinant DNA 6. In the following palindromic base sequence of DNA,
technology, addition of chilled ethanol precipitates out which one can be cut easily by a particular restriction
(a) DNA (b) Histones enzyme?
(c) Polysaccharides (d) RNA (a) 5’ GATACT 3’ ; 3’ CTATGA 5’
[NEET (2023)] (b) 5’ GAATTC 3’ ; 3’ CTTAAG 5’
2. In gene gun method, used to introduce alien DNA into (c) 5’ CTCAGT 3’ ; 3’ GAGTCA 5’
host cells, microparticles of _______ metal are used. (d) 5’ GTATTC 3’ ; 3’ CATAAG 5’
(a) Zinc [NEET (2022)]
(b) Tungsten or gold 7. Given below are two statements:
(c) Silver Statement I: Restriction endonucleases recognise
(d) Copper specific sequences to cut DNA known as palindromic
nucleotide sequences.
[NEET (2023)]
Statement II: Restriction endonucleases cut the DNA
3. Main steps in the formation of recombinant DNA are strand a little away from the centre of the palindromic
given below. Arrange these steps in a correct sequence. site.
A. Insertion of recombinant DNA into the host cell. In the light of the above statements, choose the most
B. Cutting of DNA at specific location by restriction appropriate answer from the options given below:
enzyme. (a) Both Statement I and Statement II are correct
C. Isolation of desired DNA fragment. (b) Both Statement I and Statement II are incorrect
D. Amplification of gene of interest using PCR. (c) Statement I is correct but Statement II is incorrect
Choose the correct answer from the options given (d) Statement I is incorrect but Statement II is
below: correct
(a) C, A, B, D [NEET (2022)]
(b) C, B, D, A 8. Which of the following is not a desirable feature of a
(c) B, D, A, C cloning vector ?
(d) B, C, D, A (a) Presence of origin of replication
[NEET (2023)] (b) Presence of a marker gene
4. Given below are two statements: one is labelled as (c) Presence of single restriction enzyme site
Assertion (A) and the other is labelled as Reason (R). (d) Presence of two or more recognition sites
Assertion (A): Polymerase chain reaction is used in [NEET (2022)]
DNA amplification. 9. During the purification process for recombinant DNA
Reason (R): The ampicillin resistant gene is used as a technology, the addition of chilled ethanol precipitates
selectable marker to check transformation. out:
In the light of the above statements, choose the correct (a) Histones
answer from the options given below: (b) Polysaccharides
(a) Both (A) and (R) are correct and (R) is the correct (c) RNA
explanation of (A) (d) DNA
(b) Both (A) and (R) are correct but (R) is not the [NEET (2021)]
correct explanation of (A) 10. Which of the following is a correct sequence of steps in
(c) (A) is correct but (R) is not correct a PCR (Polymerase Chain Reaction)?
(d) (A) is not correct but (R) is correct (a) Extension, Denaturation, Annealing
[NEET (2022)] (b) Annealing, Denaturation, Extension
5. Which one of the following statements is not true (c) Denaturation, Annealing, Extension
regarding gel electrophoresis technique? (d) Denaturation, Extension, Annealing
(a) The process of extraction of separated DNA strands [NEET (2021)]
from gel is called elution 11. DNA strands on a gel stained with ethidium bromide
(b) The separated DNA fragments are stained by using when viewed under UV radiation, appear as
ethidium bromide (a) Dark red bands
(c) The presence of chromogenic substrate gives blue (b) Bright blue bands
coloured DNA bands on the gel (c) Yellow bands
(d) Bright orange coloured bands of DNA can be (d) Bright orange bands
observed in the gel when exposed to UV light [NEET (2021)]
[NEET (2022)]
12. Plasmid pBR322 has a PstI restriction enzyme site (b) a – iii; b – iv; c – i; d – ii
within gene ampR that confers ampicillin resistance. If (c) a – ii; b – iv; c – iii; d – i
this enzyme is used for inserting a gene for β-galactoside (d) a – iv; b – iii; c – i; d – ii
production and the recombinant plasmid is inserted in an [NEET (2020)]
E.coli strain 18. Identify the wrong statement with regard to restriction
(a) It will lead to lysis of the host cell enzymes.
(b) It will be able to produce a novel protein with dual (a) They are useful in genetic engineering
ability (b) Sticky ends can be joined by using endonucleases
(c) It will not be able to confer ampicillin resistance to (c) Each restriction enzyme functions by inspecting the
the host cell length of a DNA sequence
(d) The transformed cells will have the ability to resist (d) They cut the strand of DNA at palindromic sites
ampicillin as well as produce β-galactoside [NEET (2020)]
[NEET (2021)] 19. The sequence that controls the copy number of the
13. A specific recognition sequence identified by linked DNA in the vector, is termed
endonucleases to make cuts at specific positions within (a) Palindromic sequence
the DNA is: (b) Recognition site
(a) Palindromic Nucleotide sequences (c) Selectable marker
(b) Poly(A) tail sequences (d) Ori site
(c) Degenerate primer sequence [NEET (2020)]
(d) Okazaki sequences 20. Following statements describe the characteristics of the
[NEET (2021)] enzyme Restriction Endonuclease. Identify the incorrect
14. In gel electrophoresis, separated DNA fragments can be statement.
visualized with the help of: (a) The enzyme binds DNA at specific sites and cuts
(a) Acetocarmine in UV radiation only one of the two strands
(b) Ethidium bromide in infrared radiation (b) The enzyme cuts the sugar-phosphate backbone at
(c) Acetocarmine in bright blue light specific sites on each strand
(d) Ethidium bromide in UV radiation (c) The enzyme recognizes a specific palindromic
[NEET (2020)] nucleotide sequence in the DNA
15. The specific palindromic sequence which is recognized (d) The enzyme cuts DNA molecule at identified
by EcoRI is positions within the DNA
(a) 5’- CTTAAG – 3’, 3’ GAATTC – 5’ [NEET (2019)]
(b) 5’- GGATCC - 3’, 3’- CCTAGG - 5’ 21. DNA precipitation out of a mixture of biomolecules can
(c) 5’- GAATTC - 3’, 3’ -CTTAAG - 5’ be achieved by treatment with:
(d) 5’- GGAACC - 3’, 3’ - CCTTGG - 5’ (a) Chilled ethanol
[NEET (2020)] (b) Methanol at room temperature
16. Choose the correct pair from the following. (c) Chilled chloroform
(a) Nucleases - Separate the two strands of DNA (d) Isopropanol
(b) Exonucleases - Make cuts at specific positions [NEET (2019)]
within DNA 22. Which one of the following equipment is essentially
(c) Ligases - Join the two DNA molecules required for growing microbes on a large scale, for
(d) Polymerases - Break the DNA into fragments industrial production of enzymes?
[NEET (2020)] (a) Sludge digester
17. Match the organism with its use in biotechnology. (b) Industrial oven
(c) Bioreactor
Column I Column II (d) BOD incubator
(a) Bacillus (i) Cloning vector [NEET (2019)]
Thuringiensis 23. The correct order of steps in Polymerase Chain Reaction
(PCR) is
(b) Thermus aquaticus (ii) Construction of first (a) Denaturation, Extension, Annealing
rDNA Molecule (b) Annealing, Extension, Denaturation
(c) Agrobacterium (iii) DNA polymerase (c) Extension, Denaturation, Annealing
tumefaciens (d) Denaturation, Annealing, Extension
(d) Salmonella (iv) Cry proteins [NEET (2018)]
typhimurium 24. The DNA fragments separated on an agarose gel can be
visualised after staining with
(a) Aniline blue
Select the correct option from the following (b) Ethidium bromide
(a) a – iii; b – ii; c – iv; d – i
(c) Bromophenol blue 34. Which of the following is not a feature of the plasmids?
(d) Acetocarmine (a) Independent replication
[NEET (2017)] (b) Circular structure
25. A gene whose expression helps to identify transformed (c) Transferable
cell is known as (d) Single stranded
(a) Plasmid (b) Structural gene [NEET (2016-I)]
(c) Selectable marker (d) Vector 35. The DNA molecule to which the gene of interest is
[NEET (2017)] integrated for cloning is called
26. The process of separation and purification of expressed (a) Transformer (b) Vector
protein before marketing is called (c) Template (d) Carrier
(a) Bioprocessing [NEET (2015)]
(b) Postproduction processing 36. The cutting of DNA at specific locations became
(c) Upstream Processing possible with the discovery of
(d) Downstream processing (a) Restriction enzymes
[NEET (2017)] (b) Probes
27. What is the criterion for DNA fragments movement on (c) Selectable markers
agarose gel during gel electrophoresis? (d) Ligases
(a) Positively charged fragments move to the farther end [NEET (2015)]
(b) Negatively charged fragments do not move 37. Which vector can clone only a small fragment of DNA?
(c) The larger the fragment size, the farther it moves (a) Yeast artificial chromosome
(d) The smaller the fragment size, the farther it moves (b) Plasmid
[NEET (2017)] (c) Cosmid
28. Which of the following restriction enzymes produces (d) Bacterial artificial chromosome
blunt ends? [NEET (2014)]
(a) Eco RV (b) Xho I 38. In-vitro clonal propagation in plants is characterised by
(c) Hind III (d) Sal I (a) Northern blotting
[NEET (2016-II)] (b) Electrophoresis and HPLC
29. Which of the following is NOT a component of (c) Microscopy
downstream processing? (d) PCR and RAPD
(a) Purification (b) Preservation [NEET (2014)]
(c) Expression (d) Separation 39. The colonies of recombinant bacteria appear white in
[NEET (2016-II)] contrast to blue colonies of non-recombinant bacteria
30. A foreign DNA and plasmid cut by the same restriction because of
endonuclease can be joined to form a recombinant (a) Non-recombinant bacteria containing beta-
plasmid using galactosidase
(a) Taq polymerase (b) Insertional inactivation of apha-galactosidase in
(b) Polymerase III non-recombinant bacteria
(c) Ligase (c) Insertional inactivation of alpha-galactosidase in
(d) EcoRI recombinant bacteria
[NEET (2016-II)] (d) Inactivation of glycosidase enzyme in recombinant
31. Stirred-tank bioreactors have been designed for ____. bacteria
(a) Addition of preservatives to the product [NEET (2013)]
(b) Availability of oxygen throughout the process 40. Which of the following is not correctly matched for the
(c) Ensuring anaerobic conditions in the culture vessel organism and its cell wall degrading enzyme?
(d) Purification of product (a) Bacteria - Lysozyme
[NEET (2016-II)] (b) Plant cell - Cellulase
32. Which of the following is a restriction endonuclease? (c) Algae - Methylase
(a) Hind II (b) Protease (d) Fungi - Chitinase
(c) DNase I (d) R Nase [NEET (2013)]
[NEET (2016-I)] 41. DNA fragments generated by the restriction
33. The thermostable DNA polymerase enzyme is obtained endonucleases in a chemical reaction can be separated
from by
(a) Thermus aquaticus (a) Centrifugation
(b) Thiobacillus ferrooxidans (b) Polymerase chain reaction
(c) Bacillus subtilis (c) Electrophoresis
(d) Pseudomonas putida (d) Restriction mapping
[NEET (2016-I)] [NEET (2013)]
42. In genetic engineering, the antibiotics are used : 48. Which one of the following is used as vector for cloning
(a) To select healthy vectors genes into higher organisms?
(b) As sequences from where replication starts (a) Baculovirus
(c) To keep the cultures free of infection (b) Salmonella typhimurium
(d) As selectable markers (c) Rhizopus nigricans
(d) Retrovirus
[NEET (2012)]
[NEET (2010)]
43. The figure below shows three steps (A, B, C) of 49. Which one of the following palindromic base sequences
Polymerase Chain Reaction (PCR). Select the option in DNA can be easily cut at about the middle by some
giving correct identification together with that it particular restriction enzyme?
represents? (a) 5' _____ CG TTCG ______ 3'
3' ______ATGGTA ______5'
(b) 5'______GATATG ______3'
3'______CTACTA ______5'
(c) 5'______GAATTC ______3'
3'______CTTAAG______5'
(d) 5'______CACGTA______3'
3'______CTCAGT______5'
[NEET (2010)]
50. DNA or RNA segment tagged with a radioactive
moleculer is called –
(a) Vector
(a) A-Denaturation at a temperature of about 500C (b) Probe
(b) C-Extension I the presence of heat stable DNA (c) Clone
polymerase (d) Plasmid
(c) A-Annealing with two sets of primers [NEET (2010)]
(d) B-Denaturation at a temperature of about 98 0C 51. Restriction endonucleases are enzymes which –
separating the two DNA strands (a) Make cuts at specific positions within the DNA
molecule
[NEET (2012)] (b) Recognize a specific nucleotide sequence for
44. Biolistics (gene-gun) is suitable for- binding of DNA ligase
(a) Transformation of plant cells (c) Restrict the action of the enzyme DNA polymerase
(b) Constructing recombinant DNA by joining with (d) Remove nucleotides from the ends of the DNA
vectors molecule
(c) DNA finger printing [NEET (2010)]
(d) Disarming pathogen vectors 52. The linking of antibiotic resistance gene with the
[NEET (2012)] plasmid vector became possible with:
45. Agarose extracted from sea weeds finds use in : (a) DNA polymerase
(a) Gel electrophoresis (b) Exonucleases
(b) Spectrophotometry (c) DNA ligase
(c) Tissue Culture (d) Endonucleases
[NEET (2008)]
(d) PCR
53. Gel electrophoresis is used for:
[NEET (2011)] (a) Construction of recombinant DNA by joining with
46. Given below is a sample of a portion of DNA strand cloning vectors
giving the base sequence on the opposite strands. What (b) Isolation of DNA molecule
is so special shown in it ? (c) Cutting of DNA into fragments
5' .............. GAATTC ................ 3' (d) Separation of DNA fragments according to their
3' .............. CTTAAG ................. 5' size
(a) Palindromic sequence of base pairs [NEET (2008)]
(b) Replication completed 54. Two microbes found to be very useful in genetic
(c) Deletion mutation engineering are-
(d) Start codon at the 5' end (a) Escherichia coli and Agrobacterium tumefaciens
[NEET (2011)] (b) Vibrio cholerae and a tailed bacteriophage
47. There is a restriction endonuclease called EcoRl. What (c) Diplococcus sp.and Pseudomonas sp.
does "co" part in it stand for ? (d) Crown gall bacterium and Caenorhabditis elegans
(a) Coli (b) Colon [NEET (2006)]
(c) Coelom (d) Coenzyme
[NEET (2011)]
55. Restriction endonuclease - 57. Restriction endonucleases :-

(a) Cuts the DNA molecule randomly (a) Are used in genetic engineering for ligating two
(b) Cuts the DNA molecule at specific sites DNA molecules
(c) Restricts the synthesis of DNA inside the nucleus (b) Are used for in vitro DNA synthesis
(d) Synthesizes DNA (c) Are synthesized by bacteria as part of their defense
[NEET (2006)] mechanism
56. In transgenics expression of transgene in target tissue is (d) Are present in mammalian cells for degradation of
determined by :- DNA when the cell dies
(a) Transgene (b) Promoter [NEET (2004)]
(c) Reporter (d) Enhancer
[NEET (2004)]
BIOTECHNOLOGY AND ITS APPLICATION 129
BIOTECHNOLOGY AND ITS APPLICATION

1. Which one of the following techniques does not serve (b) Detection of gene mutation
the purpose of early diagnosis of a disease for its early (c) Molecular diagnosis
treatment? (d) Gene amplification
(a) Serum and urine analysis [NEET (2021)]
(b) Polymerase Chain Reaction (PCR) technique 6. When gene targeting involving gene amplification is
(c) Enzyme Linked Immunosorbent Assay (ELISA) attempted in an individual's tissue to treat disease, it is
technique known as
(d) Recombinant DNA Technology (a) Molecular diagnosis
(b) Safety testing
[NEET (2023)]
(c) Biopiracy
2. Transposons can be used during which one of the (d) Gene therapy
following? [NEET (2021)]
(a) Polymerase chain reaction 7. Nowadays it is possible to detect the mutated gene
(b) Gene silencing causing cancer by allowing radioactive probe to
(c) Autoradiography hybridize its complementary DNA in a clone of cells,
(d) Gene sequencing followed by its detection using autoradiography
[NEET (2022)] because:
3. In gene therapy of Adenosine Deaminase (ADA) (a) Mutated gene does not appear on a Photographic film
deficiency, the patient requires periodic infusion of as the probe has no complementarity with it
genetically engineered lymphocytes because: (b) Mutated gene does not appear on Photographic film
(a) Retroviral vector is introduced into these as the probe has complementarity with it
lymphocytes (c) Mutated gene partially appears on a photographic
(b) Gene isolated from marrow cells producing ADA is film
introduced into cells at embryonic stages (d) Mutated gene completely and clearly appears on a
(c) Lymphocytes from patient’s blood are grown in photographic film
culture, outside the body [NEET (2021)]
8. With regard to insulin choose correct options.
(d) Genetically engineered lymphocytes are not
(a) C-peptide is not present in mature insulin.
immortal cells. (b) The insulin produced by rDNA technology has C-
[NEET (2022)] peptide.
4. Statements related to human insulin are given below: (c) The pro-insulin has C-peptide.
Which statement(s) is/are correct about genetically (d) A-peptide and B-peptide of insulin are
engineered Insulin? interconnected by disulphide bridges
(a) Pro-hormone insulin contain extra stretch of C- Choose the correct answer from the options given
peptide below.
(b) A peptide and B-peptide chains of insulin were (a) (a), (c) and (d) only (b) (a) and (d) only
produced separately in E. coli, extracted and combined (c) (b) and (d) only (d) (b) and (c) only
by creating a disulphide bond between them. [NEET (2021)]
(c) Insulin used for treating Diabetes was extracted from 9. For effective treatment of the disease, early diagnosis
Cattles and Pigs. and understanding its pathophysiology is very
(d) Pro-hormone insulin needs to be processed for important. Which of the following molecular diagnostic
converting into a mature and functional hormone. techniques is very useful for early detection?
(e) Some patients develop allergic reactions to the (a) ELISA Technique
foreign insulin. (b) Hybridization Technique
Choose the most appropriate answer from the options (c) Western Blotting Technique
given below: (d) Southern Blotting Technique
(a) (a), (b) and (d) only [NEET (2021)]
(b) (b) only 10. The Adenosine deaminase deficiency results into
(c) (c) and (d) only (a) Digestive disorder
(d) (c), (d) and (e) only (b) Addison’s disease
[NEET (2022)] (c) Dysfunction of Immune system
5. Which of the following is not an application of PCR (d) Parkinson’s disease
(Polymerase Chain Reaction)? [NEET (2021)]
(a) Purification of isolated protein
11. Bt cotton variety that was developed by the introduction (a) Research Committee on Genetic Manipulation
of toxin gene of Bacillus thuringiensis (Bt) is resistant (RCGM)
to (b) Council for Scientific and Industrial Research
(a) Plant nematodes (b) Insect predators (CSIR)
(c) Insect pests (d) Fungal diseases (c) Indian Council of Medical Research (ICMR)
[NEET (2020)] (d) Genetic Engineering Appraisal Committee (GEAC)
12. Which of the following statements is not correct? [NEET (2018)]
(a) The functional insulin has A and B chains linked 18. Use of bioresources by multinational companies and
together by hydrogen bonds organisations without authorisation from the concerned
(b) Genetically engineered insulin is produced in E. country and its people is called
coli (a) Biodegradation
(c) In man insulin is synthesised as a proinsulin (b) Biopiracy
(d) The proinsulin has an extra peptide called C- (c) Bio-infringement
peptide (d) Bioexploitation
[NEET (2020)] [NEET (2018)]
13. Match the following columns and select the correct 19. Which of the following is commonly used as a vector
option. for introducing a DNA fragment in human
lymphocytes?
Column I Column II (a) λ phage (b) Ti plasmid
(a) Bt cotton (i) Gene therapy (c) Retrovirus (d) pBR 322
(b) Adenosine deaminase (ii) Cellular defence [NEET (2018)]
20. Which kind of therapy was given in 1990 to a four-year-
deficiency old girl with adenosine deaminase (ADA) deficiency?
(c) RNAi (iii) Detection of HIV (a) Chemotherapy
infection (b) Immunotherapy
(d) PCR (iv) Bacillus (c) Radiation therapy
thuringiensis (d) Gene therapy
[NEET (2016-II)]
21. Which part of the tobacco plant is infected by
(a) a – ii; b - iii; c – iv; d - i
Meloidogyne incognitia?
(b) a – i; b – ii; c – iii; d – iv
(a) Flower (b) Leaf
(c) a – iv; b – i; c – ii; d - iii
(c) Stem (d) Root
(d) a – iii; b – ii; c – i; d - iv
[NEET (2016-I)]
[NEET (2020)]
22. The two polypeptides of human insulin are linked
14. What triggers activation of protoxin to active Bt toxin of
together by
Bacillus thuringiensis in bollworm?
(a) Hydrogen bonds
(a) Moist surface of midgut
(b) Phosphodiester bond
(b) Alkaline pH of gut
(c) Covalent bond
(c) Acidic pH of stomach
(d) Disulphide bridges
(d) Body temperature
[NEET (2016-I)]
[NEET (2019)]
23. Golden rice is a genetically modified crop plant where
15. Which of the following is true for Golden rice?
the incorporated gene is meant for biosynthesis of
(a) It is pest resistant, with a gene from Bacillus
(a) Vitamin B (b) Vitamin C
thuringiensis
(c) Omega (d) Omega A
(b) It is drought tolerant developed using
[NEET (2015)]
Agrobacterium vector
24. The first human hormone produced by recombinant
(c) It has yellow grains because of a gene introduced
DNA technology is
from a primitive variety of rice
(a) Estrogen (b) Thyroxine
(d) It is Vitamin A enriched with a gene from daffodil
(c) Progesterone (d) Insulin
[NEET (2019)]
[NEET (2014)]
16. A ‘new’ variety of rice was patented by a foreign
25. Which of the following Bt crops is being grown in India
company, though such varieties have been present in
by the farmers?
India for a long time. This is related to
(a) Maize (b) Cotton
(a) Lerma Rojo (b) Sharbati Sonora
(c) Brinjal (d) Soybean
(c) Co-667 (d) Basmati
[NEET (2013)]
[NEET (2018)]
26. Tobacco plants resistant to a nematode have been
17. In India, the organisation responsible for assessing the
developed by the introduction of DNA that produced (in
safety of introducing genetically modified organisms for
the host cells):
public use is
(a) A particular hormone (b) Transgenic models for studying new treatments for
(b) An antifeedant certain cardiac disease
(c) A toxic protein (c) Transgenic Cow-Rosie which produces high fat
(d) Both sense and anti-sense RNA milk for making ghee
(d) Animals like bulls for farm work as they have super
[NEET (2012)]
power
27. Read the following four statements (A-D): [NEET (2010)]
(A) Colostrum is recommended for the new born 35. Some of the characteristics of Bt cotton are –
because it is rich in antigen (a) Long fibre and resistance to aphids
(B) Chikengunya is caused by a Gram negative (b) Medium yield, long fibre and resistance to beetle
bacterium pests
(C) Tissue culture has proved useful in obtaining virus- (c) High yield and production of toxic protein crystals
free plants which kill dipteran pests
(D) Beer is manufactured by distillation of fermented (d) High yield and resistance to bollworms
grape juice [NEET (2010)]
How many of the above statements are wrong? 36. An improved variety of transgenic basmati rice
(a) Three (b) Four (a) Does not require chemical fertilizers and growth
(c) One (d) Two hormones
[NEET (2012)] (b) Gives high yield and is rich in vitamin A
28. The first clinical gene therapy was given for treating - (c) Is completely resistant to all insect pests and disease
(a) Chicken pox of paddy
(b) Rheumatoid arthritis (d) Gives high yield but has no characteristic atoms
(c) Adenosine deaminase deficiency [NEET (2010)]
(d) Diabetes mellitus 37. What is true about Bt toxin ?
[NEET (2012)] (a) The concerned Bacillus has antitoxins
29. Maximum number of existing transgenic animals is of : (b) The inactive protoxin gets converted into active
(a) Pig (b) Fish form in the insect gut
(c) Mice (d) Cow (c) Bt protein exists as active toxin in the Bacillus
[NEET (2011)] (d) The activated toxin enters the ovaries of the pest to
30. The process of RNA interference has been used in the sterillise it and thus prevent its multiplication.
development of plants resistant to : [NEET (2009)]
(a) Insects (b) Nematodes 38. The genetic defect-adenosine deaminase (ADA)
(c) Fungi (d) Viruses deficiency may be cured permanently by
[NEET (2011)] (a) Enzyme replacement therapy
31. A certain patient is suspected to be suffering from (b) Periodic infusion of genetically engineered
Acquired Immuno Deficiency Syndrome. Which lymphocytes having functional ADA cDNA
diagnostic technique will you recommend for its (c) Administering adenosine deaminase activators
detection ? (d) Introducing bone marrow cells producing ADA into
(a) WIDAL (b) ELISA cells at early embryonic stages
(c) MRI (d) Ultra Sound [NEET (2009)]
[NEET (2011)] 39. Human insulin is being commercially produced from a
32. The most common substrate used in distilleries for the transgenic species of:
production of ethanol is : (a) Rhizobium (b) Saccharomyces
(a) Molasses (b) Corn meal (c) Escherichia (d) Mycobacterium
(c) Soyabean (d) Ground gram [NEET (2008)]
[NEET (2011)] 40. What is antisense technology?
33. The genetically-modified (GM) brinjal in India has been (a) When a piece of RNA that is complementary in
developed for: sequence is used to stop expression of a specific gene
(a) Insect-resistance (b) RNA polymerase producing DNA
(b) Enhancing shelf life (c) A cell displaying a foreign antigen used for
(c) Enhancing mineral content synthesis of antigens
(d) Drought-resistance (d) Production of somaclonal variants in tissue cultures
[NEET (2010)] [NEET (2008)]
34. Genetic engineering has been successfully used for 41. Cry1 endotoxins obtained from Bacillus thuringiensis
producing – are effective against:
(a) Transgenic mice for testing safety of polio vaccine (a) Nematodes (b) Boll worms
before use in humans (c) Mosquitoes (d) Flies
[NEET (2008)]
42. A transgenic food crop which may help in solving the (a) Bioinsecticidal plants
problem of night-blindness in developing countries is: (b) Bio-mineralization processes
(a) Bt. Soybean (c) Biofertilizers
(b) Golden rice (d) Bio-metallurgical techniques
(c) Flaver Saver tomatoes [NEET (2005)]
(d) Starlink maize 48. Production of a human protein in bacteria by genetic
[NEET (2008)] engineering is possible because
43. Main objective of production/use of herbicide resistant (a) Bacterial cell can carry out the RNA splicing
GM crops is to: reactions
(a) Encourage eco-friendly herbicides (b) The mechanism of gene regulation is identical in
(b) Reduce herbicide accumulation in food articles for humans and bacteria
health safety (c) The human chromosome can replicate in bacterial
(c) Eliminate weeds from the field without the use of cell
manual labour (d) The genetic code is universal
(d) Eliminate weeds from the field without the use of [NEET (2005)]
herbicides 49. The most thoroughly studied of the known bacteria-
[NEET (2008)] plant interactions is the :-
44. Consider the following statements about biomedical (a) Gall formation on certain angiosperms by
technologies, Agrobacterium
(i) During open heart surgery blood is circulated in the (b) Nodulation of Sesbania stems by nitrogen fixing
heart-lung machine bacteria
(ii) Blockage in coronary arteries is removed by (c) Plant growth stimulation by phosphate– solubilising
angiography bacteria
(iii) Computerised Axial Tomography (CAT) shows (d) Cyanobacterial symbiosis with some aquatic ferns
detailed internal structure as seen in a section of body. [NEET (2004)]
(iv) X-ray provides clear and detailed images of organs 50. The most likely reason for the development of resistance
like prostate glands and lungs against pesticides in insects damaging a crop is :-
Which two of the above statements are correct? (a) Genetic recombination
(a) (i) and (iii) (b) (i) and (ii) (b) Directed mutations
(c) (ii) and (iv) (d) (iii) and (iv) (c) Acquired heritable changes
[NEET (2008)] (d) Random mutations
45. Golden rice is a promising transgenic crop. When [NEET (2004)]
released for cultivation, it will help in 51. ELISA is used to detect viruses, where :-
(a) Alleviation of vitamin A deficiency (a) Southern blotting is done
(b) Pest resistance (b) Alkaline phosphatase is the key reagent
(c) Herbicide tolerance (c) Catalase is the key reagent
(d) Producing a petrol-like fuel from rice (d) DNA-probes are required
[NEET (2006)] [NEET (2004)]
46. Golden rice is a transgenic crop of the future with the 52. The Ti plasmid is often used for making transgenic
following improved trait - plants. This plasmid is found in
(a) High protein content (a) Rhizobium of the roots of leguminous plants
(b) High vitamin – A content (b) Agrobacterium
(c) High lysine (essential amino acid) content (c) Yeast as a 2 μm plasmid
(d) Insect resistance (d) Azotobacter
[NEET (2005)] [NEET (2004)]
47. Bacillus thuringiensis (Bt) strains have been used for
designing novel -
ORGANISMS AND POPULATION 133
ORGANISMS AND POPULATION

1. Match List I with List II: (c) 1.0 (d) Zero
[NEET (2022)]
List I List II(Species A and 6. Amensalism can be represented as
(Interaction) B) (a) Species A ( - ) ; Species B ( - )
A. Mutualism I. +(A), O(B) (b) Species A ( +) ; Species B (0)
(c) Species A ( - ) ; Species B (0)
B. Commensalism II. –(A), O(B) (d) Species A ( + );Species B ( + )
C. Amensalism III. +(A), –(B) [NEET (2021)]
D. Parasitism IV. +(A), +(B) 7. Inspite of interspecific competition in nature, which
Choose the correct answer from the options given mechanism the competing species might have evolved
below: for their survival?
(a) A–IV, B–I, C–II, D–III (a) Mutualism
(b) A–IV, B–III, C–I, D–II (b) Predation
(c) A–III, B–I, C–IV, D–II (c) Resource partitioning
(d) A–IV, B–II, C–I, D–III (d) Competitive release
[NEET (2021)]
[NEET (2023)] 8. In the exponential growth equation Nt = N0ert , e
2. Given below are two statements: represents
Statement I: Gause’s ‘Competitive Exclusion Principle’ (a) The base of natural logarithms
states that two closely related species competing for the (b) The base of geometric logarithms
same resources cannot co-exist indefinitely, and the (c) The base of number logarithms
competitively inferior one will be eliminated eventually. (d) The base of exponential logarithms
Statement II: In general, carnivores are more adversely [NEET (2021)]
affected by competition than herbivores. 9. Assertion (A): A person goes to high altitude and
In the light of the above statements, choose the correct experiences 'altitude sickness' with symptoms like
answer from the options given below: breathing difficulty and heart palpitations.
(a) Both Statement I and Statement II are false. Reason (R): Due to low atmospheric pressure at high
(b) Statement I is correct, but Statement II is false. altitudes, the body does not get sufficient oxygen. In the
(c) Statement I is incorrect, but Statement II is true. light of the above statements, choose the correct answer
(d) Both Statement I and Statement II are true. from the options given below
[NEET (2023)] (a) (A) is true but (R) is false
(b) (A) is false but (R) is true
3. Which one of the following statements cannot be
(c) Both (A) and (R) are true and (R) is the correct
connected to Predation?
explanation of (A)
(a) It helps in maintaining species diversity in a
(d) Both (A) and (R) are true but (R) is not the correct
community
explanation of (A)
(b) It might lead to extinction of a species
[NEET (2021)]
(c) Both the interacting species are negatively impacted
10. Which of the following is not an attribute of a
(d) It is necessitated by nature to maintain the ecological population?
balance (a) Mortality (b) Species interaction
[NEET (2022)] (c) Sex ratio (d) Natality
4. While explaining interspecific interaction of population, [NEET (2020)]
(+) sign is assigned for beneficial interaction, (-) sign is 11. Match Column – I with Column – II.
assigned for detrimental interaction and (0) for neutral Column - I Column - II
interaction. Which of the following interactions can be (A) (i) Symbiotic association of fungi
assigned (+) for one species and (-) for another species Saprophyte with plant roots
involved in the interaction?
(a) Predation (b) Amensalism (B) Parasite (ii) Decomposition of dead organic
(c) Commensalism (d) Competition materials
[NEET (2022)] (C) Lichens (iii) Living on living plants or
5. If ‘8’ Drosophila in a laboratory population of ‘80’ died animals
during a week, the death rate in the population is__ (D) (iv) Symbiotic association of algae
individuals per Drosophila per week. Mycorrhiza and fungi
(a) 0.1 (b) 10
Choose the correct answer from the options given 19. Presence of plants arranged into well-defined vertical
below: layers depending on their height can be seen best in
(a) A – (iii), B – (ii), C – (i), D – (iv) (a) Grassland
(b) A – (ii), B – (i), C – (iii), D – (iv) (b) Temperate Forest
(c) A – (ii), B – (iii), C – (iv), D – (i) (c) Tropical Savannah
(d) A – (i), B – (ii), C – (iii), D – (iv) (d) Tropical Rainforest
[NEET (2019)] [NEET (2017)]
12. Pinus seed cannot germinate and establish without 20. The principle of competitive exclusion was stated by
fungal association. This is because _____.
(a) It has obligate association with mycorrhizae (a) G.F. Gause
(b) It have very hard seed coat (b) MacArthur
(c) Its seeds contain inhibitors that prevent germination (c) Verhulst and Pearl
(d) Its embryo is immature (d) C. Darwin
[NEET (2019)] [NEET (2016-II)]
13. In a growing population of a country 21. If ‘+’ sign is assigned to beneficial interaction, ‘-’ sign
(a) Reproductive and pre-reproductive individuals are to detrimental and ‘0’ sign to neutral interaction, then
equal in number the population interaction represented by ‘+’ ‘-’ refers to
(b) Reproductive individuals are less than the post- (a) Amensalism (b) Commensalism
reproductive individuals (c) Parasitism (d) Mutualism
(c) Pre-reproductive individuals are more than the [NEET (2016-II)]
reproductive individuals 22. Which of the following is CORRECT for r-selected
(d) Pre-reproductive individuals are less than the species?
reproductive individuals (a) Large number of progeny with large size
[NEET (2018)] (b) Small number of progeny with small size
14. Which one of the following population interactions is (c) Small number of progeny with large size
widely used in medical science for the production of (d) Large number of progeny with small size
antibiotics? [NEET (2016-II)]
(a) Parasitism (b) Mutualism 23. It is much easier for a small animal to run uphill than for
(c) Commensalism (d) Amensalism a large animal because:
[NEET (2018)] (a) It is easier to carry a small body weight
15. Niche is (b) Smaller animals have a higher metabolic rate
(a) The range of temperature that the organism needs to (c) Small animals have a lower O2 requirement
live (d) The efficiency of muscles in large animals is less
(b) The physical space where an organism lives than in the small animals
(c) All the biological factors in the organism’s [NEET (2016-I)]
environment 24. When does the growth rate of a population following the
(d) The functional role played by the organism where it logistic model equal zero? The logistic model is given
lives as DN/dt = rN(1 – N/K)
[NEET (2018)] (a) When N/K is exactly one
16. Natality refers to (b) When N nears the carrying capacity of the habitat
(a) Number of individuals leaving the habitat (c) When N/K equals zero
(b) Birth rate (d) When death rate is greater than birth rate
(c) Death rate [NEET (2016-I)]
(d) Number of individuals entering a habitat 25. Gause’s principle of competitive exclusion states that
[NEET (2018)] (a) More abundant species will exclude the less
17. Which one of the following plants shows a very close abundant species through competition
relationship with a species of moth, where none of the (b) Competition for the same resources excludes
two can complete its life cycle without the other? species having different food preferences
(a) Banana (b) Yucca (c) No two species can occupy the same niche
(c) Hydrilla (d) Viola indefinitely for the same limiting resources
[NEET (2018)] (d) Larger organisms exclude smaller ones through
18. Asymptote is a logistic growth curve is obtained when competition
(a) K>N [NEET (2016-I)]
(b) K 26. In which of the following interactions both partners are
(c) The value of 'r' approaches zero adversely affected?
(d) K = N (a) Competition (b) Predation
[NEET (2017)] (c) Parasitism (d) Mutualism
[NEET (2015)]
27. During ecological succession: (b) losing heat rapidly from the body during high
(a) The gradual and predictable change in species temperature
composition occurs in a given area. (c) bask in sun when temperature is low
(b) The establishment of a new biotic community is (d) insulating body due to thick fatty dermis
very fast in its primary phase. (a) (a), (b) (b) (c), (d)
(c) The number and types of animals remain constant. (c) (a), (c) (d) (b), (d)
(d) The changes lead to a community that is in near [NEET (2011)]
equilibrium with the environment and is called pioneer 35. Which one of the following is categorised as a parasite
community. in true sense ?
[NEET (2015)] (a) The cuckoo (koel) lays its eggs in crow's nest
28. An association of individuals of different species living (b) The female anopheles bites and sucks blood from
in the same habitat and having functional interaction is: humans
(a) Ecological niche (c) Human foetus developing inside the uterus draws
(b) Biotic community nourishment from the mother
(c) Ecosystem (d) Head louse living on the human scalp as well as
(d) Population laying eggs on human hair
[NEET (2015)] [NEET (2011)]
29. Just as a person moving from Delhi to Shimla to escape 36. The figure given below is a diagrammatic representation
the heat for the duration of hot summer, thousands of of response of organisms to abiotic factors. What do a,
migratory birds from Siberia and other extremely cold b and c represent respectively –
northern regions move to:
(a) Meghalaya
(b) Corbett National Park
(c) Keoladeo National Park
(d) Western Ghat
[NEET (2014)]
30. Match the following and select the correct option:
Column I Column II
A Earthworm (i) Pioneer species (a) (a)- conformer; (b)- regulator; (c)- partial regulator
(b) (a)- regulator; (b)- partial regulator; (c)- conformer
B Succession (ii) Detritivore (c) (a)- partial regulator; (b)- regulator; (c)- conformer
C Ecosystem service (iii) Natality
(d) (a)- regulator; (b)- conformer; (c)- partial regulator
D Population growth (iv) Pollination
[NEET (2010)]
(a) A – (i), B – (ii), C – (iii), D – (iv) 37. A country with a high rate of population growth took
(b) A – (iv), B – (i), C – (iii), D – (ii) measures to reduce it. The figure below shows age-sex
(c) A – (iii), B – (ii), C – (iv), D – (i) pyramids of populations A and B twenty years apart.
(d) A – (ii), B – (i), C – (iv), D – (iii) Select the correct interpretation about them : –
[NEET (2014)]
31. A sedentary sea anemone gets attached to the shell lining
of hermit crab. The association is
(a) Ectoparasitism (b) Symbiosis
(c) Commensalism (d) Amensalism
[NEET (2013)]
32. A biologist studied the population of rats in a barn. He
found that the average natality was 250, average
mortality 240, immigration 20 and emigration 30. The
net increase in population is
(a) 10 (b) 15
(c) 05 (d) Zero
[NEET (2013)]
33. Cuscuta is an example of:
(a) Brood parasitism (b) Predation
(c) Endoparasitism (d) Ectoparasitism
[NEET (2012)]
34. Consider the following four conditions (a – d) and select (a) "A" is the earlier pyramid and no change has
the correct pair of them as adaptation to environment in occurred in the growth rate
desert lizards. The conditions : (b) "A" is more recent shows slight reduction in the
(a) burrowing in soil to escape high temperature growth rate
(c) "B" is earlier pyramid and shows stabilized growth (c) Population
rate (d) Landscape
(d) "B" is more recent showing that population is very [NEET (2007)]
young 42. The population of an insect species shows an explosive
increase in numbers during rainy season followed by its
[NEET (2009)]
disappearance at the end of the season. What does this
38. Consider the following four statements (1-4) about
show ?
certain desert animals such as kangaroo-rat.
(a) The population of its predators increases enormously
(i) They have dark colour and high rate of reproduction
(b) S-shaped or sigmoid growth of this insect
and excrete solid urine
(c) The food plants mature and die at the end of the
(ii) They do not drink water, breathe at a slow rate to
rainy season
conserve water and have their body covered with thick
(d) Its population growth curve is of J-type
hairs
[NEET (2007)]
(iii) They feed on dry seeds and do not required drinking
43. The formula for exponential population growth is-
water
(a) dt/dN = rN (b) dN/rN = dt
(iv) They excrete very concentrated urine and do not use
(c) rN/dN = dt (d) dN/dt = rN
water to regulate body temperature
[NEET (2006)]
Out of these four, which two are correct-
44. Niche overlap indicates-
(a) (iii) and (i)
(a) Active cooperation between two species
(b) (i) and (ii)
(b) Two different parasites on the same host
(c) (iii) and (iv)
(c) Sharing of one or more resources between the two
(d) (ii) and (iii)
species
[NEET (2008)]
(d) Mutualism between two species
39. If the mean and the median pertaining to a certain
[NEET (2006)]
character of a population are of the same value, the
45. Animals have the innate ability to escape from
following is most likely to occur:-
predation. Examples for the same are given below.
(a) A skewed curve
Select the incorrect example
(b) A normal distribution
(a) Colour change in chameleon
(c) A bi-modal distribution
(b) Poison fangs in snakes
(d) A T-shaped curve (c) Melanism in moths
[NEET (2007)] (d) Enlargement of body size by swallowing air in
40. A high density of elephant population in an area can puffer fish
result in :- [NEET (2005)]
(a) Predation on one another 46. The maximum growth rate occurs in :-
(b) Mutualism (a) Senescent phase
(c) Intra specific competition (b) Lag phase
(d) Inter specific competition (c) Exponential phase
[NEET (2007)] (d) Stationary phase
41. Geometric representation of age structure is a [NEET (2004)]
characteristic of :-
(a) Ecosystem
(b) Biotic community
ECOSYSTEM 137
ECOSYSTEM
1. In the equation: (c) Pyramid of biomass in the sea is generally inverted.
GPP – R = NPP (d) Pyramid of biomass in the sea is generally upright
GPP is gross primary productivity, NPP is net primary [NEET (2021)]
productivity, R here is ______. 7. In the equation GPP - R = NPP, R represents
(a) Respiratory quotient (a) Environment factor
(b) Respiratory loss (b) Respiration losses
(c) Reproductive allocation (c) Radiant energy
(d) Photosynthetically active radiation (d) Retardation factor
[NEET (2021)]
[NEET (2023)]
8. The amount of nutrients such as carbon, nitrogen,
2. Identify the correct statements:
phosphorus, and calcium present in the soil at any given
A. Detrivores perform fragmentation.
time is referred to as
B. The humus is further degraded by some microbes
(a) Standing state
during mineralization.
(b) Standing crop
C. Water-soluble inorganic nutrients go down into the
(c) Climax
soil and get precipitated by a process called leaching.
(d) Climax community
D. The detritus food chain begins with living organisms.
[NEET (2021)]
E. Earthworms break down detritus into smaller
9. Match the trophic levels with their correct species
particles by a process called catabolism.
examples in grassland ecosystem.
Choose the correct answer from the option given below:
Column I Column II
(a) B, C, D only (b) C, D, E only
(c) D, E, A only (d) A, B, C only (a) Fourth trophic level (i) Crow
[NEET (2023)] (b) Second trophic level (ii) Vulture
3. Given below are two statements: (c) First trophic level (iii) Rabbit
Statement I : Decomposition is a process in which the (d) Third trophic level (iv) Grass
detritus is degraded into simpler substances by (a) a – iv; b – iii; c – ii; d – i
microbes. (b) a – i; b – ii; c – iii; d – iv
Statement II: In a particular climatic condition, (c) a – ii; b – iii; c – iv; d – i
decomposition is faster if the detritus is rich in lignin and (d) a – iii; b – ii; c – i; d – iv
chitin. [NEET (2020)]
In the light of the above statements, choose the correct 10. In relation to Gross primary productivity and Net
answer from the options given below primary productivity of an ecosystem. Which one of the
(a) Both Statement I and Statement II are correct following statements is correct?
(b) Both Statement I and Statement II are incorrect (a) Gross primary productivity and Net primary
(c) Statement I is correct but Statement II is incorrect productivity are one and same
(d) Statement I is incorrect but Statement II is correct (b) There is no relationship between Gross primary
productivity and Net primary productivity
[NEET (2022)]
(c) Gross primary productivity is always less than Net
4. Which one of the following will accelerate phosphorus
primary productivity
cycle?
(d) Gross primary productivity is always more than Net
(a) Burning of fossil fuels
primary productivity
(b) Volcanic activity
[NEET (2020)]
(c) Weathering of rocks
11. Which of the following ecological pyramids is generally
(d) Rainfall and storms inverted?
[NEET (2022)] (a) Pyramid of energy
5. Detritivores breakdown detritus into smaller particles. (b) Pyramid of biomass in a forest
This process is called: (c) Pyramid of biomass in a sea
(a) Catabolism (b) Fragmentation (d) Pyramid of numbers in grassland
(c) Humification (d) Decomposition [NEET (2019)]
[NEET (2022)] 12. What type of ecological pyramid would be obtained
6. Which of the following statements is not correct? with the following data?
(a) Pyramid of energy is always upright Secondary consumer: 120 g
(b) Pyramid of numbers in a grassland ecosystem is Primary consumer: 60 g
upright Primary producer: 10 g
ECOSYSTEM 138
(a) Upright pyramid of numbers (c) Gaseous nutrient cycle, Sedimentary nutrient cycle
(b) Pyramid of energy - Nitrogen and sulphur, Carbon and phosphorus.
(c) Inverted Pyramid of biomass (d) Gaseous nutrient cycle, Sedimentary nutrient cycle
(d) Upright pyramid of biomass - Sulphur and phosphorus, Carbon and nitrogen.
[NEET (2018)] [NEET (2015)]
13. Which ecosystem has the maximum biomass? 22. An association of individuals of different species living
(a) Pond ecosystem in the same habitat and having functional interaction is:
(b) Lake ecosystem (a) Ecological niche
(c) Forest ecosystem (b) Biotic community
(d) Grassland ecosystem (c) Ecosystem
[NEET (2017)] (d) Population
14. The primary producers of the deep-sea hydrothermal [NEET (2015)]
vent ecosystem are 23. Given below is a simplified model of phosphorus
(a) Chemosynthetic bacteria cycling in a terrestrial ecosystem with four blanks (A-
(b) Blue-green algae D). Identify the blanks.
(c) Coral reefs
(d) Green algae
[NEET (2016-II)]
15. Which of the following would appear as the pioneer
organisms on bare rocks?
(a) Lichens (b) Liverworts
(c) Mosses (d) Green algae
[NEET (2016-I)] (a) A - Litter fall, B – Producers, C - Rock minerals, D -
16. The term ecosystem was coined by Detritus
(a) E.P. Odum (b) A.G. Tansley (b) A - Detritus, B - Rock minerals, C - Producers, D -
(c) E. Haeckel (d) E. Warming Litter fall
[NEET (2016-I)] (c) A - Producers, B - Litter fall, C - Rock minerals, D
17. Which one of the following is a characteristic feature of - Detritus
the cropland ecosystem? (d) A – Producers, B - Detritus, C - Litter fall, D -
(a) Absence of soil organisms Producers
(b) Least genetic diversity [NEET (2014)]
(c) Absence of weeds 24. If 20 J of energy is trapped at producer level, then how
(d) Ecological succession much energy will be available to peacock as food in the
[NEET (2016-I)] following chain?
18. Increase in concentration of the toxicant at successive Plant → mice → snake → peacock
trophic levels is known as: (a) 0.002 J (b) 0.2 J
(a) Biomagnification (c) 0.0002 J (d) 0.02 J
(b) Biodeterioration [NEET (2014)]
(c) Biotransformation 25. Which one of the following processes during
(d) Biogeochemical cycling decomposition is correctly described?
[NEET (2015)] (a) Fragmentation – Carried out by organism such as
19. Most animals that live in deep oceanic waters are earthworm
(a) Primary consumers (b) Humification – Leads to the accumulation of a dark
(b) Secondary consumers coloured substance humus which under microbial
(c) Tertiary consumers action at a very fast rate goes microbial action at a very
(d) Detritivores fast rate
[NEET (2015)] (c) Catabolism – Last step in the decomposition under
20. The UN conference of Parties on climate change in the fully anaerobic condition
year 2012 was held at (d) Leaching – Water soluble inorganic nutrients rise to
(a) Durban (b) Doha the top layers of soil
(c) Lima (d) Warsaw [NEET (2013)]
[NEET (2015)] 26. Natural reservoir of phosphorus is
21. In which of the following, both pairs have the correct (a) Seawater (b) Animal bones
combination? (c) Rock (d) fossils
(a) Gaseous nutrient cycle, Sedimentary nutrient cycle - [NEET (2013)]
Carbon and nitrogen, Sulphur and phosphorus. 27. How many organisms in the list given below are
(b) Gaseous nutrient cycle, Sedimentary nutrient cycle autotrophs ?
- Carbon and sulphur, Nitrogen and phosphorus.
ECOSYSTEM 139
Lactobacillus, Nostoc, Chara, Nitrosomonas,

Nitrobacter, Streptomyces, Sacharomyces,
Jiypanosoma, Porphyra, Woljia
(a) Five (b) Six
(c) Three (d) Four
[NEET (2012)]
28. The rate of formation of new organic matter by rabbit in (a) Expanding population
a grassland, is called: (b) Vanishing population
(a) Secondary producteivity (c) Stable population
(b) Net primary productivity (d) Declining population
(c) Gross primary productivity [NEET (2011)]
(d) Net productivity 35. Which one of the following statements for pyramid of
[NEET (2012)] energy is incorrect, whereas the remaining three are
29. Identify the likely organisms (a), (b), (c) and (d) in the correct ?
food web shown below: (a) It is upright in shape
(b) Its base is broad
(c) It shows energy content of different trophic level
organisms
(d) It is inverted in shape
[NEET (2011)]
36. Study the four statements (a–d) given below and select
the two correct ones out of them –
(a) A lion eating a deer and a sparrow feeding on grain
are ecologically similar in being consumers
(a) (a)- dog; (b)- squirrel; (c)- bat; (d)- deer (b) Predator star fish Pisaster helps in maintaining
(b) (a)-rat; (b)- dog; (c)-tortoise; (d)-crow species diversity of some invertebrates
(c) (a)- squirrel; (b)-cat; (c)-rat; (d)-pigeon (c) Predators ultimately lead to the extinction of prey
(d) (a)- deer; (b)-rabbit; (c)-frog; (d)-rat species
(d) Production of chemicals such as nicotine, strychnine
[NEET (2012)]
by the plants are metaboilic disorders
30. The second stage of hydro sere is occupied by plants like
The two correct stament are-
(a) Typha (b) Salix
(a) a and d (b) a and b
(c) Vallisneria (d) Azolla
(c) b and c (d) c and d
[NEET (2012)]
[NEET (2010)]
31. Of the total incident solar radiation the proportion of
37. The biomass available for consumption by the
PAR is
herbivores and the decomposers is called –
(a) More than 80% (b) About 70%
(a) Net primary productivity
(c) About 60% (d) Less than 50%
(b) Secondary productivity
[NEET (2011)]
(c) Standing crop
32. Mass of living matter at a trophic level in an area at any
(d) Gross primary productivity
time is called :
[NEET (2010)]
(a) Standing state (b) Standing crop
38. Which one of the following is one of the characteristics
(c) Detritus (d) Humus
of a biological community?
[NEET (2011)]
(a) Stratification (b) Natality
33. Which one of the following statements is correct for
(c) Mortality (d) Sex-ratio
secondary succession?
[NEET (2010)]
(a) It is similar to primary succession except that it has
39. Which of the following is a symbiotic nitrogen fixer ?
a relatively fast pace.
(a) Azolla (b) Glomus
(b) It begins on a bare rock.
(c) Azotobacter (d) Frankia
(c) It occurs on deforested site
[NEET (2009)]
(d) It follows primary succession
40. Which one of the following types organisms occupy
[NEET (2011)]
more than one trophic level in a pond ecosystem ?
34. What type of human population is represented by the
(a) Frog (b) Phytoplankton
following age pyramid ?
(c) Fish (d) Zooplankton
[NEET (2009)]
ECOSYSTEM 140
41. The correct sequence of plants in hydrosere is : 45. Which one of the following is not used for construction
(a) Oak → Lantana → Volvox → Hydrilla →Pistia → of ecological pyramids ?
Scirpus (a) Dry weight
(b) Oak → Lantana → Scirpus → Pistia →Hydrilla → (b) Number of individuals
Volvox (c) Rate of energy flow
(c) Volvox → Hydrilla → Pistia → Scirpus →Lantana (d) Fresh weight
→ Oak [NEET (2006)]
(d) Pistia → Volvox → Scirpus → Hydrilla →Oak → 46. What is a keystone species ?
Lantana (a) A common species that has plenty of biomass, yet
[NEET (2009)] has a fairly low impact on the community's organization
42. Consider the following statements concerning food (b) A rare species that has minimal impact on the
chains: biomass and on other species in the community
(i) Removal of 80% tigers from an area resulted in (c) A dominant species that constitutes a large
greatly increased growth of vegetation proportion of the biomass and which affects many
(ii) Removal of most of the carnivores resulted in an other species
increased population of deers (d) A species which makes up only a small proportion
(iii) The length of food chains is generally limited to 3- of the total biomass of a community, yet has a huge
4 trophic levels due to energy loss impact on the community's organization and survival
(iv) The length of food chains may vary from 2 to 8 [NEET (2004)]
trophic levels 47. Which of the following is expected to have the highest
(a) (i), (iv) (b) (i), (ii) value (gm/m2/yr) in a grassland ecosystem : -
(c) (ii), (iii) (d) (iii), (iv) (a) Tertiary production
[NEET (2008)] (b) Gross production (GP)
43. The slow rate of decomposition of fallen logs in nature (c) Net production (NP)
is due to their: (d) Secondary production
(a) Anaerobic environment around them [NEET (2004)]
(b) Low cellulose content 48. An ecosystem which can be easily damaged but can
(c) Low moisture content recover after some time if damaging effect stops will be
(d) Poor nitrogen content having -
[NEET (2008)] (a) High stability and low resilience
44. Which one of the following ecosystem types has the (b) Low stability and low resilience
highest annual net primary productivity ? (c) High stability and high resilience
(a) Temperate deciduous forest (d) Low stability and high resilience
(b) Tropical rain forest [NEET (2004)]
(c) Tropical deciduous forest
(d) Temperate evergreen forest
[NEET (2007)]
BIODIVERSITY AND CONSERVATION 141
BIODIVERSITY AND CONSERVATION

1. Given below are two statements: (b) To assess threats posed to native species by
Statement I: Endarch and exarch are the terms often used invasive weed species
for describing the position of secondary xylem in the (c) For immediate steps to discontinue use of CFCs that
plant body. were damaging the ozone layer
Statement II: Exarch condition is the most common (d) To reduce CO2 emissions and global warming
feature of the root system. [NEET (2019)]
In the light of the above statements, choose the correct 9. Which of the following is the most important cause for
answer from the options given below: animals and plants being driven to extinction?
(a) Both Statement I and Statement II are false. (a) Drought and floods
(b) Statement I is correct, but Statement II is false. (b) Economic exploitation
(c) Statement I is incorrect, but Statement II is true. (c) Alien species invasion
(d) Both Statement I and Statement II are true. (d) Habitat loss and fragmentation
[NEET (2019)]
[NEET (2023)]
10. All of the following are included in ‘Ex-situ
2. Which of the following is not a method of ex situ conservation’ except
conservation? (a) Botanical gardens (b) Sacred groves
(a) In vitro fertilization (b) National Parks (c) Wildlife safari parks (d) Seed Banks
(c) Micropropagation (d) Cryopreservation [NEET (2018)]
[NEET (2022)] 11. Alexander Von Humbolt described for the first time
3. Habitat loss and fragmentation, over exploitation, alien (a) Species area relationships
species invasion and co-extinction are causes for: (b) Population Growth equation
(a) Population explosion (b) Competition (c) Ecological Biodiversity
(c) Biodiversity loss (d) Natality (d) Laws of limiting factor
[NEET (2022)] [NEET (2017)]
4. In situ conservation refers to: 12. The region of Biosphere Reserve which is legally
(a) Protect and conserve the whole ecosystem protected and where no human activity is allowed is
(b) Conserve only high risk species known as
(c) Conserve only endangered species (a) Transition zone
(d) Conserve only extinct species (b) Restoration zone
[NEET (2022)] (c) Core zone
5. Which of the following regions of the globe exhibits (d) Buffer zone
highest species diversity? [NEET (2017)]
(a) Himalayas 13. Which one of the following is related to Ex-situ
(b) Amazon forests conservation of threatened animals and plants?
(c) Western Ghats of India (a) Amazon rainforest
(d) Madagascar (b) Himalayan region
[NEET (2020)] (c) Wildlife Safari parks
6. According to Robert May, the global species diversity is (d) Biodiversity hotspots
about [NEET (2017)]
(a) 50 million (b) 7 million 14. Which of the following National Parks is home to the
(c) 1.5 million (d) 20 million famous musk deer or hangul?
[NEET (2020)] (a) Bandhavgarh National Park, Madhya Pradesh
7. Which one of the following is not a method of in situ (b) Eaglenest Wildlife Sanctuary, Arunachal Pradesh
conservation of biodiversity? (c) Dachigam National Park, Jammu and Kashmir
(a) Wildlife Sanctuary (d) Keibul Lamjao National Park, Manipur
(b) Botanical Garden [NEET (2016-II)]
(c) Sacred Grove 15. Red List contains data or information on
(d) Biosphere Reserve (a) Plants whose products are in international trade
[NEET (2019)] (b) Threatened species
8. The Earth Summit held in Rio de Janeiro in 1992 was (c) Marine vertebrates only
called (d) All economically important plants
(a) For conservation of biodiversity and sustainable [NEET (2016-II)]
utilization of its benefits 16. Which of the following is CORRECTLY matched?
(a) Age pyramid- Biome
(b) Parthenium hysterophorus- Threat to biodiversity (a) Endemic

(c) Stratification- Population (b) Critically endangered
(d) Aerenchyma- Opuntia (c) Extinct
[NEET (2016-II)] (d) Vulnerable
17. How many hotspots of biodiversity in the world have [NEET (2014)]
been identified till date by Norman Myers? 25. Which of the following represents the maximum
(a) 25 (b) 34 number of species among global biodiversity?
(c) 43 (d) 17 (a) Algae
[NEET (2016-II)] (b) Lichens
18. Which of the following is the most important cause of (c) Fungi
animals and plants being driven to extinction? (d) Mosses and Ferns
(a) Over-exploitation [NEET (2013)]
(b) Alien species invasion 26. Which one of the following is not used in ex situ plant
(c) Habitat loss and fragmentation conservation?
(d) Co-extinctions (a) Field gene banks
[NEET (2016-I)] (b) Seed banks
19. Which is the National Aquatic Animal of India? (c) Shifting cultivation
(a) Gangetic shark (b) River dolphin (d) Botanical Gardens
(c) Blue whale (d) Sea-horse [NEET (2013)]
[NEET (2016-I)] 27. Select the correct statement about biodiversity :
20. The species confined to a particular region and not found (a) Large scale planting of Bt cotton has no adverse
elsewhere is termed as effect on biodiversity
(a) Keystone (b) Alien (b) Westem Ghats have a very high degree of species
(c) Endemic (d) Rare richness and endemism
[NEET (2015)] (c) Conservation of biodiversity is just a fad pursued by
21. Given below is the representation of the extent of global the developed countries
diversity of invertebrates. What groups do the four (d) The desert areas of Rajasthan and Gujarat have a very
portions (A-D) represent respectively? high level of desert animal species as well as numerous
rare animals
[NEET (2012)]
28. Sacred groves are specially useful in -
(a) Preventing soil erosion
(b) Year-round flow of water in rivers
(c) Conserving rare and threatened species
(d) Generating environmental awareness
(a) A – Crustaceans, B – Insects, C – Molluscs, D - Other [NEET (2012)]
animal group 29. Which one of the following have the highest number of
(b) A - Molluscs, B - Other animal group, C - species in nature ?
Crustaceans, D - Insects (a) Angiosperms (b) Fungi
(c) A - Insects, B - Molluscs, C - Crustaceans, D - (c) Insects (d) Birds
Other animal group [NEET (2011)]
(d) A – Insects, B - Crustaceans, C - Other animal 30. Large Woody Vines are more commonly found in :
group, D - Molluscs (a) Alpine forests
[NEET (2014)] (b) Temperate forests
22. The organisation which publishes the Red List of (c) Mangroves
species is (d) Tropical rainforests
(a) IUCN (b) UNEP [NEET (2011)]
(c) WWF (d) ICFRE 31. Which one of the following expanded forms of the
[NEET (2014)]
following acronyms is correct ?
23. An example of ex situ conservation is: (a) IUCN = International Union for Conservation of
(a) Seed bank Nature and Natural Resources
(b) Wildlife Sanctuary (b) IPCC = International Panel for Climate Change
(c) Sacred grove (c) UNEP = United Nations Environmental policy
(d) National park (d) EPA = Environmental Pollution Agency
[NEET (2014)]
[NEET (2011)]
24. A species facing extremely high risk of extinction in the
immediate future is called
32. Which one of the following shows maximum genetic (a) Nile perch, Ficus religiosa
diversity in India ? (b) Ficus religiosa, Lantana camara
(a) Mango (b) Groundnut (c) Lantana camara, Water hyacinth
(c) Rice (d) Maize (d) Water hyacinth, Prosopis cinereria
[NEET (2011)] [NEET (2007)]
33. Which one of the following is an example of ex-situ 39. One of endangered species of Indian medicinal plants is
conservation ? that of:-
(a) Wild life sanctuary (b) Seed bank (a) Nepenthes (b) Podophyllum
(c) Sacred groves (d) National park (c) Ocimum (d) Garlic
[NEET (2010)] [NEET (2007)]
34. Which one of the following has maximum genetic 40. Which one of the following is not included under in-situ
diversity in India ? conservation ?
(a) Tea (b) Teak (a) Sanctuary (b) Botanical garden
(c) Mango (d) Wheat (c) Biosphere reserve (d) National park
[NEET (2009)] [NEET (2006)]
35. Tiger is not a resident in which one of the following 41. Which of the following is considered a hot-spot of
National Park ? biodiversity in India ?
(a) Jim Corbett (b) Ranthambhor (a) Western Ghats (b) Indo-Gangetic Plain
(c) Sunderbans (d) Gir (c) Eastern Ghats (d) Aravalli Hills
[NEET (2009)] [NEET (2006)]
36. Which one of the following is not observed in 42. Biodiversity Act of India was passed by the Parliament
biodiversity hotspots ? in the year
(a) Lesser inter-specific competition (a) 2002 (b) 1992
(b) Species richness (c) 1996 (d) 2000
(c) Endenism [NEET (2005)]
(d) Accelerated species loss 43. At which latitude, heat gain through insolation
[NEET (2008)] approximately equals heat loss through terrestrial
37. The table below gives the populations (in thousands) of radiation -
ten species (A-J) in four areas (a-d) consisting of the (a) 42½o North and South
number of habitats given within brackets against each. (b) 22½o North and South
Study the table and answer the question which follows: (c) 400 North and South
(d) 660 North and South
[NEET (2005)]
44. In your opinion, which is the most effective way to
conserve the plant diversity of an area :-
(a) By creating biosphere reserve
(b) By creating botanical garden
Which area out of a to d shows maximum species (c) By developing seed bank
diversity? (d) By tissue culture method
(a) d (b) a
(c) b (d) c [NEET (2004)]
[NEET (2008)]
38. Which one of the following pairs of organisms are exotic
species introduced in India ?
ANSWER KEY 144
ANSWER KEY
ANSWER KEY 145
THE LIVING WORLD:

1. (a) 2. (b) 3. (a) 4. (d) 5. (c) 6. (a) 7. (c) 8. (b) 9. (b) 10. (c) 11. (c) 12. (a)
BIOLOGICAL CLASSIFICATION:
1. (c) 2. (a) 3. (d) 4. (d) 5. (b) 6. (c) 7. (b) 8. (d) 9. (b) 10. (c) 11. (c) 12. (b)
13. (b) 14. (d) 15. (a) 16. (a) 17. (a) 18. (b) 19. (c) 20. (a) 21. (d) 22. (d) 23. (a) 24. (b)
25. (c) 26. (c) 27. (a) 28. (a) 29. (a) 30. (a) 31. (d) 32. (d) 33. (a) 34. (c) 35. (d) 36. (a)
37. (d) 38. (b) 39. (d) 40. (a) 41. (a) 42. (a) 43. (b) 44. (b) 45. (b) 46. (c) 47. (d) 48. (d)
49. (c) 50. (d) 51. (b) 52. (a) 53. (b) 54. (a) 55. (a) 56. (b) 57. (b) 58. (c) 59. (b) 60. (b)
61. (c) 62. (d)
PLANT KINGDOM:
1. (a) 2. (b) 3. (d) 4. (b) 5. (c) 6. (b) 7. (a) 8. (b) 9. (b) 10. (c) 11. (d) 12. (b)
13. (b) 14. (b) 15. (c) 16. (c) 17. (b) 18. (c) 19. (c) 20. (d) 21. (a) 22. (b) 23. (d) 24. (c)
25. (c) 26. (b) 27. (c) 28. (c) 29. (b) 30. (a) 31. (d) 32. (c) 33. (c) 34. (a) 35. (b) 36. (a)
37. (a) 38. (d) 39. (a) 40. (d) 41. (d) 42. (b) 43. (b) 44. (d) 45. (b) 46. (a) 47. (b) 48. (b)
49. (d) 50. (a) 51. (a) 52. (d) 53. (d) 54. (d) 55. (d) 56. (b)
ANIMAL KINGDOM:
1. (a) 2. (a) 3. (a) 4. (c) 5. (d) 6. (a) 7. (b) 8. (a) 9. (c) 10. (a) 11. (d) 12. (b)
13. (d) 14. (c) 15. (a) 16. (d) 17. (c) 18. (b) 19. (a) 20. (c) 21. (a) 22. (a) 23. (a) 24. (d)
25. (c) 26. (a) 27. (b) 28. (c) 29. (b) 30. (c) 31. (b) 32. (c) 33. (d) 34. (a) 35. (c) 36. (b)
37. (c) 38. (c) 39. (a) 40. (a) 41. (c) 42. (c) 43. (d) 44. (a) 45. (d) 46. (c) 47. (a) 48. (a)
49. (c) 50. (d) 51. (d) 52. (a) 53. (b) 54. (a) 55. (d) 56. (d) 57. (b) 58. (c) 59. (b) 60. (c)
61. (c) 62. (c) 63. (b) 64. (b) 65. (d) 66. (b) 67. (a) 68. (b) 69. (c) 70. (c) 71. (d) 72. (a)
73. (a)
MORPHOLOGY OF FLOWERING PLANTS:

1. (d) 2. (d) 3. (c) 4. (b) 5. (b) 6. (b) 7. (c) 8. (b) 9. (c) 10. (b) 11. (b) 12. (c)
13. (c) 14. (b) 15. (b) 16. (c) 17. (a) 18. (c) 19. (a) 20. (d) 21. (c) 22. (d) 23. (d) 24. (a)
25. (a) 26. (c) 27. (b) 28. (c) 29. (d) 30. (a) 31. (a) 32. (c) 33. (b) 34. (b) 35. (c) 36. (c)
37. (b) 38. (a) 39. (a) 40. (b) 41. (c) 42. (b) 43. (a) 44. (c) 45. (b) 46. (b) 47. (d) 48. (b)
49. (a) 50. (a) 51. (c) 52. (b) 53. (c) 54. (b) 55. (d) 56. (d) 57. (b) 58. (a) 59. (a) 60. (c)
61. (b) 62. (a) 63. (d) 64. (a) 65. (d) 66. (c) 67. (a) 68. (d) 69. (b) 70. (c) 71. (d) 72. (c)
73. (b) 74. (d) 75. (d) 76. (c) 77. (b) 78. (c) 79. (c) 80. (d)
ANATOMY OF FLOWERING PLANTS:

1. (d) 2. (a) 3. (e) 4. (b) 5. (c) 6. (d) 7. (a) 8. (c) 9. (a) 10. (c) 11. (c) 12. (a)
13. (c) 14. (d) 15. (b) 16. (c) 17. (a) 18. (a) 19. (a) 20. (b) 21. (d) 22. (c) 23. (a) 24. (b)
25. (c) 26. (a) 27. (a) 28. (c) 29. (a) 30. (d) 31. (d) 32. (c) 33. (a) 34. (c) 35. (b) 36. (a)
37. (a) 38. (d) 39. (c) 40. (d) 41. (c) 42. (d)
ANSWER KEY 146
STRUCTURAL ORGANISATION IN ANIMALS:

1. (a) 2. (b) 3. (b) 4. (a) 5. (b) 6. (d) 7. (a) 8. (a) 9. (c) 10. (d) 11. (c) 12. (a)
13. (d) 14. (a) 15. (c) 16. (d) 17. (b) 18. (b) 19. (d) 20. (a) 21. (b) 22. (b) 23. (c) 24. (c)
25. (d) 26. (d) 27. (c) 28. (a) 29. (c) 30. (d) 31. (c) 32. (d) 33. (a) 34. (d) 35. (b) 36. (c)
37. (b) 38. (d) 39. (b) 40. (d) 41. (b) 42. (d) 43. (a)
CELL: THE UNIT OF LIFE:

1. (a) 2. (b) 3. (a) 4. (c) 5. (c) 6. (c) 7. (a) 8. (d) 9. (d) 10. (a) 11. (d) 12. (a)
13. (c) 14. (b) 15. (c) 16. (d) 17. (d) 18. (d) 19. (b) 20. (b) 21. (a) 22. (d) 23. (a) 24. (d)
25. (c) 26. (a) 27. (b) 28. (c) 29. (a) 30. (d) 31. (d) 32. (b) 33. (b) 34. (b) 35. (a) 36. (d)
37. (a) 38. (a) 39. (d) 40. (d) 41. (b) 42. (d) 43. (d) 44. (c) 45. (a) 46. (b) 47. (c) 48. (a)
49. (b) 50. (a) 51. (c) 52. (b) 53. (a) 54. (b) 55. (d) 56. (a) 57. (d) 58. (c) 59. (d) 60. (c)
61. (d) 62. (b) 63. (d) 64. (c) 65. (b) 66. (c) 67. (b) 68. (a) 69. (a) 70. (a) 71. (a) 72. (a)
73. (a) 74. (a) 75. (b) 76. (d) 77. (b)
BIOMOLECULES:
1. (b) 2. (d) 3. (d) 4. (c) 5. (c) 6. (c) 7. (d) 8. (d) 9. (c) 10. (b) 11. (a) 12. (a)
13. (d) 14. (b) 15. (c) 16. (a) 17. (b) 18. (b) 19. (d) 20. (b) 21. (b) 22. (a) 23. (c) 24. (a)
25. (b) 26. (d) 27. (d) 28. (a) 29. (a) 30. (d) 31. (a) 32. (c) 33. (c) 34. (d) 35. (d) 36. (c)
37. (a) 38. (c) 39. (d) 40. (a) 41. (c) 42. (c) 43. (d) 44. (a) 45. (a)
CELL CYCLE AND CELL DIVISION:

1. (b) 2. (a) 3. (a) 4. (b) 5. (c) 6. (a) 7. (c) 8. (c) 9. (b) 10. (b) 11. (a) 12. (a)
13. (c) 14. (c) 15. (a) 16. (d) 17. (a) 18. (a) 19. (c) 20. (d) 21. (b) 22. (a) 23. (d) 24. (d)
25. (d) 26. (d) 27. (b) 28. (d) 29. (a) 30. (b) 31. (b) 32. (b) 33. (d) 34. (d) 35. (a) 36 (c)
37. (b) 38. (a) 39. (a) 40. (c) 41. (a) 42. (d) 43. (d) 44. (b) 45. (b) 46. (a) 47. (a) 48. (d)
PHOTOSYNTHESIS IN HIGHER PLANTS:

1. (a) 2. (d) 3. (d) 4. (a) 5. (b) 6. (a) 7. (b) 8. (d) 9. (b) 10. (c) 11. (d) 12. (b)
13. (c) 14. (d) 15. (a) 16. (c) 17. (b) 18. (b) 19. (b) 20. (b) 21. (b) 22. (d) 23. (a) 24. (d)
25. (b) 26. (d) 27. (d) 28. (c) 29. (a) 30. (d) 31. (a) 32. (b) 33. (a) 34. (a) 35. (a) 36. (b)
37. (b) 38. (d) 39. (b) 40. (d) 41. (b) 42. (d) 43. (b) 44. (c)
RESPIRATION IN PLANTS:
1. (d) 2. (d) 3. (c) 4. (d) 5. (d) 6. (a) 7. (a) 8. (a) 9. (d) 10. (b) 11. (b) 12. (c)
13. (c) 14. (c) 15. (c) 16. (c) 17. (d) 18. (b) 19. (b) 20. (d) 21. (c) 22. (b) 23. (c) 24. (c)
25. (d) 26. (b)
ANSWER KEY 147
PLANT GROWTH AND DEVELOPMENT:

1. (a) 2. (b) 3. (b) 4. (d) 5. (c) 6. (a) 7. (a) 8. (b) 9. (c) 10. (c) 11. (d) 12. (d)
13. (c) 14. (a) 15. (a) 16. (c) 17. (a) 18. (a) 19. (d) 20. (b) 21. (d) 22. (a) 23. (b) 24. (b)
25. (d) 26. (a) 27. (b) 28. (a) 29. (d) 30. (d) 31. (b) 32. (a) 33. (c) 34. (c) 35. (b) 36. (d)
37. (d) 38. (a) 39. (c) 40. (c) 41. (b) 42. (d)
BREATHING AND EXCHANGE OF GASES:

1. (c) 2. (d) 3. (b) 4. (c) 5. (c) 6. (a) 7. (c) 8. (d) 9. (a) 10. (a) 11. (c) 12. (c)
13. (a) 14. (a) 15. (b) 16. (a) 17. (b) 18. (d) 19. (c) 20. (c) 21. (c) 22. (b) 23. (b) 24. (b)
25. (b) 26. (b) 27. (c) 28. (c)
BODY FLUIDS AND CIRCULATION:

1. (d) 2. (b) 3. (d) 4. (c) 5. (c) 6. (b) 7. (c) 8. (a) 9. (b) 10. (d) 11. (d) 12. (c)
13. (c) 14. (b) 15. (b) 16. (c) 17. (c) 18. (c) 19. (c) 20. (d) 21. (a) 22. (c) 23. (b) 24. (b)
25. (c) 26. (c) 27. (a) 28. (a) 29. (d) 30. (a) 31. (a) 32. (a) 33. (d) 34. (b) 35. (b) 36. (c)
37. (a) 38. (d) 39. (b) 40. (b) 41. (a) 42. (c) 43. (b) 44. (a) 45. (d) 46. (b)
EXCRETORY PRODUCTS AND THEIR ELIMINATION:

1. (b) 2. (b) 3. (a) 4. (d) 5. (d) 6. (a) 7. (b) 8. (a) 9. (d) 10. (d) 11. (c) 12. (a)
13. (c) 14. (b) 15. (d) 16. (c) 17. (d) 18. (a) 19. (d) 20. (b) 21. (c) 22. (c) 23. (b) 24. (b)
25. (b) 26. (c) 27. (d) 28. (d) 29. (a) 30. (a) 31. (c) 32. (a) 33. (a) 34. (b)
LOCOMOTION AND MOVEMENT:

1. (a) 2. (a) 3. (a) 4. (c) 5. (b) 6. (a) 7. (b) 8. (c) 9. (b) 10. (c) 11. (c) 12. (a)
13. (c) 14. (d) 15. (d) 16. (c) 17. (c) 18. (a) 19. (c) 20. (c) 21. (b) 22. (c) 23. (a) 24. (a)
25. (c) 26. (c) 27. (b) 28. (b) 29. (d) 30. (c) 31. (b)
NEURAL CONTROL AND COORDINATION:

1. (d) 2. (d) 3. (d) 4. (a) 5. (c) 6. (a) 7. (d) 8. (b) 9. (c) 10. (c) 11. (b) 12. (d)
13. (b) 14. (b) 15. (a) 16. (b) 17. (d) 18. (d) 19. (b) 20. (a) 21. (a) 22. (a) 23. (a) 24. (a)
25. (a) 26. (d) 27. (c) 28. (b) 29. (a) 30. (b) 31. (d) 32. (b) 33. (b) 34. (c) 35. (c) 36. (c)
37. (d) 38. (d) 39. (b) 40. (b) 41. (d)
CHEMICAL COORDINATION AND INTEGRATION:

1. (d) 2. (b) 3. (b) 4. (b) 5. (c) 6. (a) 7. (a) 8. (c) 9. (b) 10. (a) 11. (b) 12. (c)
13. (d) 14. (d) 15. (a) 16. (a) 17. (b) 18. (d) 19. (a) 20. (a) 21. (b) 22. (a) 23. (c) 24. (d)
25. (a) 26. (b) 27. (c) 28. (b) 29. (a) 30. (c) 31. (c) 32. (a) 33. (c) 34. (b) 35. (c) 36. (a)
37. (c) 38. (a) 39. (d) 40. (c) 41. (c) 42. (d) 43. (c) 44. (a) 45. (b) 46. (a) 47. (a) 48. (c)
49. (a) 50. (c) 51. (d) 52. (d) 53. (a)
ANSWER KEY 148
SEXUAL REPRODUCTION IN FLOWERING PLANTS:

1. (d) 2. (a) 3. (d) 4. (a) 5. (c) 6. (c) 7. (c) 8. (c) 9. (c) 10. (b) 11. (c) 12. (a)
13. (c) 14. (c) 15. (d) 16. (d) 17. (a) 18. (d) 19. (d) 20. (d) 21. (a) 22. (a) 23. (b) 24. (d)
25. (d) 26. (b) 27. (a) 28. (d) 29. (a) 30. (d) 31. (d) 32. (a) 33. (d) 34. (b) 35. (c) 36. (b)
37. (d) 38. (b) 39. (d) 40. (b) 41. (c) 42. (c) 43. (c) 44. (d) 45. (d) 46. (c) 47. (b) 48. (d)
49. (b) 50. (d) 51. (c) 52. (d) 53. (a) 54. (b) 55. (b) 56. (b) 57. (c) 58. (c) 59. (a) 60. (c)
61. (d) 62. (a) 63. (c) 64. (c) 65. (b) 66. (b) 67. (b) 68. (d) 69. (b) 70. (a) 71. (d)
HUMAN REPRODUCTION:
1. (d) 2. (a) 3. (b) 4. (a) 5. (b) 6. (b) 7. (d) 8. (b) 9. (c) 10. (b) 11. (b) 12. (a)
13. (d) 14. (a) 15. (b) 16. (d) 17. (c) 18. (b) 19. (a) 20. (d) 21. (b) 22. (b) 23. (d) 24. (a)
25. (b) 26. (d) 27. (a) 28. (d) 29. (a) 30. (d) 31. (b) 32. (b) 33. (c) 34. (b) 35. (c) 36. (b)
37. (a) 38. (b) 39. (b) 40. (b) 41. (b) 42. (a) 43. (b) 44. (c) 45. (c) 46. (c) 47. (d) 48. (d)
49. (b) 50. (c) 51. (c) 52. (b) 53. (d) 54. (b) 55. (b) 56. (b) 57. (d) 58. (b) 59. (d) 60. (d)
61. (c) 62. (a)
REPRODUCTIVE HEALTH:
1. (c) 2. (a) 3. (a) 4. (c) 5. (b) 6. (d) 7. (d) 8. (a) 9. (c) 10. (c) 11. (d) 12. (b)
13. (b) 14. (c) 15. (c) 16. (c) 17. (c) 18. (d) 19. (a) 20. (d) 21. (d) 22. (d) 23. (b) 24. (a)
25. (d) 26. (a) 27. (c) 28. (d) 29. (a) 30. (a) 31. (c) 32. (b) 33. (d) 34. (c) 35. (c)
PRINCIPLES OF INHERITANCE AND VARIATION:

1. (b) 2. (b) 3. (b) 4. (d) 5. (d) 6. (c) 7. (d) 8. (a) 9. (c) 10. (b) 11. (c) 12. (d)
13. (d) 14. (a) 15. (a) 16. (a) 17. (a) 18. (b) 19. (a) 20. (a) 21. (b) 22. (c) 23. (b) 24. (c)
25. (a) 26. (b) 27. (a) 28. (b) 29. (d) 30. (c) 31. (c) 32. (c) 33. (a) 34. (c) 35. (d) 36. (a)
37. (d) 38. (b) 39. (b) 40. (c) 41. (d) 42. (b) 43. (a) 44. (b) 45. (d) 46. (b) 47. (c) 48. (c)
49. (a) 50. (d) 51. (d) 52. (b) 53. (a) 54. (c) 55. (c) 56. (d) 57. (a) 58. (b) 59. (d) 60. (d)
61. (b) 62. (c) 63. (a) 64. (c) 65. (d) 66. (b) 67. (c) 68. (a) 69. (c) 70. (d) 71. (a) 72. (c)
73. (d) 74. (c) 75. (a) 76. (a) 77. (c) 78. (b) 79. (d) 80. (a) 81. (a) 82. (b) 83. (b) 84. (d)
85. (b) 86. (d) 87. (d) 88. (d) 89. (c) 90. (d) 91. (b) 92. (c) 93. (b) 94. (c) 95. (b) 96. (b)
97. (b) 98. (d) 99. (b) 100. (b) 101. (c) 102. (a) 103. (b) 104. (b) 105. (d) 106. (d) 107. (b) 108. (b)
109. (a) 110. (d) 111. (a) 112. (d)
MOLECULAR BASIS OF INHERITANCE:

1. (a) 2. (a) 3. (d) 4. (d) 5. (c) 6. (a) 7. (c) 8. (d) 9. (b) 10. (a) 11. (c) 12. (b)
13. (a) 14. (c) 15. (a) 16. (c) 17. (a) 18. (d) 19. (d) 20. (d) 21. (b) 22. (a) 23. (d) 24. (b)
25. (d) 26. (c) 27. (a) 28. (b) 29. (a) 30. (d) 31. (b) 32. (a) 33. (b) 34. (c) 35. (a) 36. (d)
37. (b) 38. (b) 39. (d) 40. (b) 41. (a) 42. (a) 43. (c) 44. (a) 45. (b) 46. (d) 47. (a) 48. (d)
49. (b) 50. (b) 51. (a) 52. (a) 53. (b) 54. (c) 55. (b) 56. (a) 57. (d) 58. (c) 59. (d) 60. (b)
61. (c) 62. (d) 63. (a) 64. (d) 65. (a) 66. (c) 67. (d) 68. (c) 69. (a) 70. (d) 71. (c) 72. (b)
73. (c) 74. (d) 75. (d) 76. (b) 77. (b) 78. (c) 79. (b) 80. (b) 81. (b) 82. (d) 83. (b) 84. (d)
85. (a) 86. (d) 87. (a) 88. (a) 89. (c) 90. (d) 91. (b) 92. (d) 93. (c) 94. (c) 95. (a) 96. (c)
97. (b) 98. (d) 99. (b) 100. (d) 101. (b) 102. (b) 103. (c) 104. (c) 105. (c) 106. (c)
ANSWER KEY 149
EVOLUTION:
1. (a) 2. (b) 3. (d) 4. (b) 5. (c) 6. (a) 7. (c) 8. (a) 9. (d) 10. (c) 11. (a) 12. (c)
13. (a) 14. (b) 15. (c) 16. (d) 17. (a) 18. (d) 19. (d) 20. (b) 21. (a) 22. (a) 23. (d) 24. (b)
25. (c) 26. (d) 27. (b) 28. (b) 29. (b) 30. (a) 31. (b) 32. (c) 33. (b) 34. (d) 35. (b) 36. (b)
37. (d) 38. (a) 39. (c) 40. (b) 41. (d) 42. (c) 43. (c) 44. (a) 45. (c) 46. (c) 47. (a) 48. (c)
49. (a) 50. (d) 51. (a) 52. (a) 53. (b) 54. (c) 55. (c) 56. (a) 57. (c) 58. (a) 59. (a) 60. (b)
61. (d) 62. (a) 63. (a) 64. (a) 65. (b) 66. (c) 67. (a) 68. (c)
HUMAN HEALTH AND DISEASES:

1. (d) 2. (d) 3. (d) 4. (c) 5. (d) 6. (d) 7. (d) 8. (d) 9. (a) 10. (c) 11. (a) 12. (c)
13. (a) 14. (c) 15. (a) 16. (c) 17. (b) 18. (d) 19. (c) 20. (d) 21. (a) 22. (d) 23. (d) 24. (c)
25. (c) 26. (d) 27. (c) 28. (a) 29. (b) 30. (d) 31. (a) 32. (a) 33. (c) 34. (b) 35. (a) 36. (d)
37. (c) 38. (b) 39. (d) 40. (b) 41. (b) 42. (d) 43. (d) 44. (d) 45. (a) 46. (c) 47. (c) 48. (a)
49. (a) 50. (a) 51. (b) 52. (c) 53. (d) 54. (b) 55. (b) 56. (c) 57. (d) 58. (b) 59. (d) 60. (b)
61. (b) 62. (d) 63. (a) 64. (c)
MICROBES IN HUMAN WELFARE:

1. (a) 2. (c) 3. (d) 4. (b) 5. (a) 6. (a) 7. (a) 8. (d) 9. (a) 10. (a) 11. (b) 12. (a)
13. (c) 14. (d) 15. (a) 16. (a) 17. (a) 18. (a) 19. (a) 20. (a) 21. (c) 22. (b) 23. (a) 24. (b)
25. (a) 26. (c) 27. (d) 28. (d) 29. (d) 30. (d) 31. (d) 32. (a) 33. (a) 34. (b) 35. (b) 36. (b)
37. (b) 38. (a) 39. (a) 40. (d) 41. (b) 42. (c) 43. (a)
BIOTECHNOLOGY PRINCIPLES AND PROCESSES:

1. (a) 2. (b) 3. (d) 4. (b) 5. (c) 6. (b) 7. (a) 8. (d) 9. (d) 10. (c) 11. (d) 12. (c)
13. (a) 14. (d) 15. (c) 16. (c) 17. (d) 18. (b) 19. (d) 20. (a) 21. (a) 22. (c) 23. (d) 24. (b)
25. (c) 26. (d) 27. (d) 28. (a) 29. (c) 30. (c) 31. (b) 32. (a) 33. (a) 34. (d) 35. (b) 36. (a)
37. (b) 38. (d) 39. (c) 40. (c) 41. (c) 42. (d) 43. (b) 44. (a) 45. (a) 46. (a) 47. (a) 48. (d)
49. (c) 50. (b) 51. (a) 52. (c) 53. (d) 54. (a) 55. (b) 56. (b) 57. (c)
BIOTECHNOLOGY: AND ITS APPLICATION:

1. (a) 2. (d) 3. (d) 4. (b) 5. (a) 6. (d) 7. (a) 8. (a) 9. (a) 10. (c) 11. (c) 12. (a)
13. (c) 14. (b) 15. (d) 16. (d) 17. (d) 18. (b) 19. (c) 20. (d) 21. (d) 22. (d) 23. (d) 24. (d)
25. (b) 26. (d) 27. (a) 28. (c) 29. (c) 30. (b) 31. (b) 32. (a) 33. (a) 34. (a) 35. (d) 36. (b)
37. (b) 38. (d) 39. (c) 40. (a) 41. (b) 42. (b) 43. (c) 44. (a) 45. (a) 46. (b) 47. (a) 48. (d)
49. (a) 50. (d) 51. (b) 52. (b)
ORGANISMS AND POPULATIONS:

1. (a) 2. (b) 3. (c) 4. (a) 5. (a) 6. (c) 7. (c) 8. (a) 9. (c) 10. (b) 11. (c) 12. (a)
13. (c) 14. (d) 15. (d) 16. (b) 17. (b) 18. (d) 19. (d) 20. (a) 21. (c) 22. (d) 23. (b) 24. (a)
25. (c) 26. (a) 27. (a) 28. (b) 29. (c) 30. (d) 31. (c) 32. (d) 33. (d) 34. (c) 35. (d) 36. (d)
37. (b) 38. (d) 39. (b) 40. (c) 41. (c) 42. (d) 43. (d) 44. (c) 45. (d) 46. (c)
ANSWER KEY 150
ECOSYSTEM:
1. (b) 2. (d) 3. (c) 4. (c) 5. (b) 6. (d) 7. (b) 8. (a) 9. (c) 10. (d) 11. (c) 12. (c)
13. (c) 14. (a) 15. (a) 16. (b) 17. (b) 18. (a) 19. (d) 20. (b) 21. (a) 22. (b) 23. (b) 24. (d)
25. (a) 26. (c) 27. (b) 28. (a) 29. (d) 30. (c) 31. (d) 32. (b) 33. (a) 34. (d) 35. (d) 36. (d)
37. (a) 38. (a) 39. (d) 40. (c) 41. (c) 42. (c) 43. (c) 44. (b) 45. (d) 46. (d) 47. (b) 48. (d)
BIODIVERSITY AND CONSERVATION:

1. (c) 2. (b) 3. (c) 4. (a) 5. (b) 6. (b) 7. (b) 8. (a) 9. (d) 10. (b) 11. (a) 12. (c)
13. (c) 14. (c) 15. (b) 16. (b) 17. (b) 18. (c) 19. (b) 20. (c) 21. (c) 22. (a) 23. (a) 24. (b)
25. (c) 26. (c) 27. (b) 28. (c) 29. (c) 30. (d) 31. (a) 32. (c) 33. (b) 34. (c) 35. (d) 36. (a)
37. (a) 38. (c) 39. (b) 40. (b) 41. (a) 42. (a) 43. (d) 44. (a)
THE LIVING WORLD 151
THE LIVING WORLD (SOLUTIONS)

1. In the animal kingdom, there are seven main represents a species new to science. Thus, helping in
taxonomic ranks: kingdom, phylum or division, class, the understanding of plant diversity, conservation, and
order, family, genus, species. sustainable use. It does not carry information on plant
2. Housefly belongs to the family Muscidae. Fireflies are height. So, the correct answer is ‘Height of the plant’.
placed in the family Lampyridae of class Insecta. The 6. Binomial nomenclature means naming an organism
grasshopper is also an insect placed in the family with two words. The first word represents the genus
Acrididae. A cockroach is also an insect placed in the and the second word represents species. The first letter
family Blattidae. of the genus is always written in the capital letter and
3. According to rules of binomial nomenclature, the the first letter of species in small letters. The names are
correctly written scientific name of mango generally written in the Latin language as they are
is Mangifera indica Linn. Scientific names are always mostly derived from Latin and Greek. These are
written in italics and their discoverer name is written at italicized in the font. If written with the hand, they are
the end in short form. Discoverer name is not written underlined. These can't be written in any other
in italics. languages as these are rules followed worldwide in
4. Herbarium is taxonomic aid, which is the collection of nomenclature.
dried and pressed plant specimens. 7. A museum has a collection of plant and animal
The Key is taxonomic aid, which helps in the specimens. They may be preserved as dry specimens.
identification of various taxa. They may be stuffed and preserved. Insects are kept in
The museum is also taxonomic aid where plant and insect boxes. Museums often have skeletons of animals
animal specimens are preserved. too.
Catalogue is also taxonomic aid, which is a list that 8. Tiger –tigris, the species
enumerates methodically all the species found in an 9. Can reproduce freely with each other and form seeds
area with brief description aiding identification.
5. The Herbarium is a collection of preserved plants that 10. International code of Botanical Nomenclature
are stored, cataloged, and arranged systematically for 11. Interaction with the environment and progressive
study. When specimens are collected in the field, the evolution
herbarium and associated information in the library are 12. They allow ex-situ conservation of germ
used to identify these specimens, to determine how one
species differs from another, or whether a specimen
BIOLOGICAL CLASSIFICATION (SOLUTIONS)

1. Mycoplasmas are the smallest cells which are only 0.3 11. Archaebacteria are able to survive in harsh conditions
µm in length hence they can pass through less than 1 because of the branched lipid chain in the cell
micron filter. All prokaryotes have a cell wall membrane which reduces fluidity of the cell
surrounding the cell membrane except in mycoplasma. membrane.
So, statement I is correct and statement II is incorrect. Halophiles are exclusively found in saline habitats.
2. The nutrition in bacteria is mainly autotrophic and 12. Viroids are sub-viral agents as infectious RNA
heterotrophic. Phototrophic bacteria contain various particles, without a protein coat. The virus is made up
pigments to synthesise their own food, while of protein and has a protein coat as an outer covering.
heterotrophic bacteria are dependent on other Viroid is the smallest particle that contains RNA as a
organisms for food. Parasitic bacteria fulfil their genetic material but does not contain protein as an
nutrition needs or requirements from the host cell. outer covering.
Slime moulds are saprophytes belonging to Kingdom 13. Photoperiod affects the reproduction in plants by
Protista. Mycoplasma are prokaryotic organisms which regulating the flowering timing of the plants. The
do not possess a cell wall. binomial system of nomenclature was given by
3. Saprophytes are plants and animals which live on dead Carolus Linnaeus. R. H. Whittaker proposed 5
material and obtain all their nutrients. Some of these kingdom classification of living organisms.
organisms can fix atmospheric nitrogen in specialized So, the correct option is 'a and d'.
cells called heterocysts, e.g., Nostoc and Anabaena. 14. Diatoms are unicellular eukaryotes placed under the
The fusion of two nuclei is called karyogamy. kingdom Protista and serve as main producers in
Hence, the (d) option is correct as fusion of oceans. The cell of diatoms is surrounded by the cell
protoplasms between two motile or non-motile wall, deposited with silica, called as frustules which
gametes is called plasmogamy. are composed of two overlapping halves (the epitheca
4. Viroids have free RNA without a protein coat. Potato and the hypotheca). Shells of diatoms are highly
spindle tuber disease is a disease caused by viroids. resistant to decomposition due to the presence of silica
5. Infective constituent in viruses is either DNA or RNA, and are deposited in ocean beds leading to the
not protein. formation of the diatomaceous earth. The gliding
6. Yeast is a unicellular sac fungus. It lacks a filamentous movement of floating diatoms is a passive process,
structure or hyphae. It comes under the group. facilitated by secretion of slimy material. Therefore,
7. Phytoplankton is the producer in the ocean. Diatoms the correct answer is option d.
belong to the class of phytoplankton which are known 15. Carl Woese proposed the classification of the
as chief producers in the ocean. organisms in three kingdoms, Archaebacteria,
8. Ciliates differ from other protozoans in having two Eubacteria and Eukarya, which were later called the
types of nuclei. domains. The archaebacteria are the group which
eg. Paramoecium has two types of nuclei i.e. comprises the primitive prokaryotic organisms like
macronucleus and micronucleus. methanogens. These are unicellular, anaerobic and
9. Pseudopodia are the finger-like projections and are the autotrophic prokaryotes. The cell wall lacks
locomotory organs of the protozoan protists. For peptidoglycan and can convert carbon dioxide and
example, Amoeba. hydrogen into methane gas. The hydrogen serves as an
The cell wall is present in the members of both the electron donor for the reduction of carbon dioxide.
kingdom Fungi and Plantae. Fungi have a cell wall Therefore, the correct answer is option a.
made up of chitin and polysaccharides while plants' 16. The fungal cell wall is mainly composed of chitin, not
cell wall is made up of cellulose and hemicellulose. cellulose. All the fungi are eukaryotic, heterotrophic
Mitochondria are called the powerhouse of the cell (saprophytic) and may be unicellular or multicellular.
because these are associated with cellular respiration. 17. Fimbriae and pili are hair-like appendages present on
Mitochondria is present only in eukaryotes and absent the bacterial cell wall similar to flagella. They are
in prokaryotes i.e. in members of kingdom Monera. shorter than flagella and more in number. They are
Mushrooms belong to the class Basidiomycetes of involved in the bacterial conjugation, attachment to the
kingdom Fungi. For example, Agaricus. surface and motility. They are present in both Gram-
10. Saccharomyces i.e. yeast is a eukaryote (unicellular positive and Gram-negative bacteria but more
fungi). prevalent in Gramnegative bacteria.
Mycobacterium is a bacteria i.e. prokaryote. Fimbriae and pili are extensions of the cytoplasmic
Anabaena and Nostoc are cyanobacteria; they are also membrane and are made up of an oligomeric protein
prokaryotes. known as pilin.
18. R.H. Whittaker proposed a five kingdom classification 32. Viruses are the acellular, small infectious agents that
in which Protista is a kingdom that comprises replicate only inside the living cells of organisms. The
organisms which are unicellular but eukaryotic genetic material is made from either DNA or RNA
organisms. Its members may be autotrophic or enclosed by the protein coat.
heterotrophic. Primarily these are aquatic. The Protista 33. Sea-fan (Gorgonia) belongs to kingdom Animalia and
kingdom has been divided into chrysophytes, phylum Cnidaria, which completely lacks a cell wall.
euglenoids, dinoflagellates, protozoans, and slime Saccharomyces is a fungus which has a cell wall
moulds. majorly composed of chitin. Blue-green algae or
19. Phycomycetes are also called algal fungi. They have cyanobacteria are the eubacteria which are covered by
characteristic aseptate coenocytic hyphae. cell wall.
Cyanobacteria are also called blue-green algae. They 34. Mesosomes are the infolding of the bacterial cell
are photosynthetic bacteria. Golden algae are also membrane.These structures are thought to be
called desmids. It is referred to as a single species, analogous to the eukaryotic mitochondria. As
Prymnesium parvum. It is found in freshwater. mitochondria are the site of respiration, these
Bacteria has two domains, namely eubacteria and mesosomes carry out respiration in the bacteria
archaea. Eubacteria are also called true bacteria. They 35. Five kingdom system of classification suggested by
have rigid cell walls and flagella R.H. Whittaker is based on cell structure, thallus
20. The fungal cell wall is predominantly composed of organisation, mode of nutrition, reproduction and
carbohydrate polymers called chitin. Chitin is thought phylogenetic relationships. It is not based on the
to mostly add structural strength to the cell wall. habitat of the organisms because a single organism can
21. Viroids are infectious, non protein‐coding, highly inhabit one or more habitat.
structured small circular low-molecular-weight 36. Archaebacteria flourish in deep-sea hydrothermal vents
ribonucleic acids (RNAs) able to replicate and hot springs where sunlight is scarce. They obtain
autonomously and induce diseases in higher plants. nutrition through chemosynthesis.
Viroids are single-stranded covalently closed circular 37. In cyanobacteria, chromatophores are the
RNA molecules existing as highly base-paired rod-like photosynthetic pigments containing membranous
structures. extensions. These pigments are mainly chlorophylls
22. Kingdom Monera includes prokaryotes in which and impart their peculiar bluish green colour.
nuclear membrane is absent. Hence, the (d) statement 38. Cyanobacteria are found in the coralloid root of the
is wrong. Cycas plant.
23. In diatoms (Chrysophytes), the cell walls form two thin 39. According to 5 kingdom classification
overlapping shells, which fit together as in a soap box. Chlamydomonas and Chlorella are the members of
Hence, the (a) option is correct. Protists. (NCERT-XI pg. 18)
24. Fimbriae are small bristle-like fibres found in bacteria 40. Protista
that help them to attach to the rock or host tissues. 41. Capsid
25. Morels and truffles are edible mushrooms. They are 42. Eubacteria and archea
not poisonous. 43. Prions
26. Mycoplasmas are organisms that completely lack a cell 44. Prions
wall. 45. Late blight of potato : Alternaria solani
27. In 1971 T.O. Diener discovered viroids. 46. Free infectious RNA
28. Deuteromycetes are commonly known as imperfect 47. Archaea have some novel features that are absent in
fungi because only the asexual or vegetative phases of other prokaryotes and eukaryotes
these fungi are known. They are decomposers of litter 48. Downy mildew of grapes
and help in mineral cycling. 49. Physarum
29. Tobacco mosaic virus shows coiled RNA strand and a 50. Mycoplasma is a single-celled, prokaryotic organism.
protein coat called capsid made of small subunits or The organism lacks the cell wall. The antibiotic
capsomeres.The coat protein self-assembles into the penicillin interferes with the process of cell wall
rod-like helical structure around the RNA which forms synthesis in which the N-acetyl muramic acid, N-acetyl
a hairpin loop structure. Inside the core helix, a coiled glucosamine and amino acids in peptidoglycan are
RNA molecule is present. Coiled RNA is absent in linked. The antibiotic interferes with the process of
measles, retrovirus and poliovirus. linking of these molecules in the cell wall. Since there
30. Flagella is a whip-like appendage present on the is no cell wall in the Mycoplasma, there is no effect of
surface of the bacteria. It is helically shaped and penicillin.
contains the protein flagellin. Its main function is the 51. Birds' nest fungi and Pufballs
locomotion. It helps motile bacteria to move. 52. Claviceps
31. Archaebacteria differ from other bacteria in having a 53. Plasmodium
different cell wall structure and this feature is 54. Bentinckia nicobarica and Red Panda
responsible for their survival in extreme conditions. 55. These are all unicellular protists
56. A, D and E only 59. Grow and multiply in very deep marine sediments
57. Several diatoms and a few cyanobacteria 60. Lytic
58. Gene flow does not occur between the populations of a 61. A symbiotic relationship with the alga
species 62. Observable characteristics of existing organisms
PLANT KINGDOM 155
PLANT KINGDOM (SOLUTIONS)
1. Genera like Selaginella and Salvinia produce two seed habit and it is considered an important step in
kinds of spores, macro (large) and micro (small) evolution.
spores, are known as heterosporous. 10. Ectocarpus is a member of Phaeophyceae or brown
2. Reason (R): Air currents carry the pollen grains to the algae that are found primarily in marine habitats. They
mouth of the archegonia where the male gametes are possess chlorophyll a, c, carotenoids, and xanthophylls.
discharged, and pollen tube is formed. They vary in colour from olive green to various shades
3. Both A and R are correct, and R is the correct of brown depending upon the amount of the
explanation of A. xanthophyll pigment, fucoxanthin present in them.
4. Brown algae or Phaeophyceae contain mannitol as Food is stored as complex carbohydrates, which may
stored food material. Ulothrix belongs to be in the form of laminarin or mannitol.
Chlorophyceae (green algae) and they contain starch as 11. Floridean starch is the storage substance found in red
the reserve food material. algae (Rhodophyta). The structure of this compound is
5. Red algae and brown algae can be employed to similar to amylopectin and glycogen.
produce hydrocolloids as thickening and gelling 12. Strobilus is a structure present on many land plant
agents. Carrageen is one such hydrocolloid which is species such as gymnosperms, club moss, horsetail,
produced by red algae (Rhodophyceae). etc. It consists of sporangia bearing structure densely
6. Spirogyra: Sporophytic generation is represented only aggregated along a stem. Equisetum produces strobili.
by the one-celled zygote. There are no free-living 13. Chlorella and Spirulina are unicellular algae. Chlorella
sporophytes. The dominant, photosynthetic phase in comes under chlorophyceae and Spirulina comes under
such plants is the free-living gametophyte. Fern: The cyanobacteria. They are rich in proteins and are used as
diploid sporophyte is represented by a dominant, food supplements even by space travellers. These algae
independent, photosynthetic, vascular plant body. It also produce a nutritional biomass that astronauts can
alternates with multicellular, saprophytic/autotrophic, eat.
independent but short-lived haploid gametophyte. 14. In pteridophytes, megaspore is retained for some time
Funaria: Dominant haploid leafy gametophyte in female gametophyte, however, permanent retention
alternating with partially dependent multicellular is required for seed formation, such as in gymnosperms
sporophyte. and angiosperm. That's why pteridophytes are the first
Cycas: Dominant diploid sporophyte vascular plant, plant that retains female gametophyte on the parent
with highly reduced male or female gametophyte. This sporophyte for some time.
is found in all gymnosperms (Cycas) and angiosperms. 15. Polysiphonia is a genus of red algae, where asexual
7. Red algae produce carrageen. Carrageen is a common spores and gametes are non-motile or non-flagellated.
name given to polysaccharides extracted from certain 16. Gymnosperms have a naked ovule hence ovule is not
seaweeds like red edible seaweeds. It is used as a enclosed by the ovary wall.
gelling, thickening, and stabilizing agent. The cell wall Selaginella and Salvinia both are heterosporous.
of red algae is composed of agar, carrageen, and funori Sequoia is a gymnosperm
along with cellulose. In brown algae, the cell wall Stems are usually unbranched in Cycas and branched
contains algin while in green algae it is composed of in Cedrus.
cellulose and pectin. In blue-green algae, the cell wall 17. Zygotic meiosis is defined as a meiotic division that
is composed of mucopeptides. results in the formation of haploid individuals. It
8. Gemmae are green, multicellular asexual buds that are occurs in the zygote. It is to be noted that thallophytes
produced by some liverworts like Marchantia. Mosses have dominant gametophytic generation, i.e., the
reproduce vegetatively by fragmentation and budding presence of haploid individuals. Chlamydomonas has a
of protonema. Pteridophytes and gymnosperms haplontic life cycle as they belong to the kingdom
normally do not reproduce asexually. Plantae and division thallophyta, hence show zygotic
9. Genera like Selaginella and Salvinia which produce meiosis.
two kinds of spores, macro (large) and micro (small) 18. Haplodiplontic cycle is the life cycle which is
spores, are known as heterosporous. The megaspores intermediate between haplontic and diplontic. In this
and microspores germinate and give rise to female and both the haplontic and diplontic are free living and
male gametophytes, respectively. The female multicellular. In the diplontic life cycle the diploid
gametophytes in these plants are retained on the parent sporophyte is dominant. Ectocarpus and Fucus are
sporophytes for variable periods. The development of algae which have both haplodiplontic and diplontic life
the zygotes into young embryos takes place within the cycles.
female gametophytes. This event is a precursor to the
PLANT KINGDOM 156
19. Pinus is a monoecious plant having both male and nodes with globule present below the nucule i.e.
female cones on the same plant. oogonium are present at upper portion and antheridium
Cycas possess either male or female reproductive parts, is present at a lower portion.
Equisetum produces the same type of spore 30. Chlorella is a genus of single-cell green algae
(homosporous) and Salvinia produces different types belonging to the phylum Chlorophyta. It is a potential
of spores (heterosporous). food source because it is high in protein and other
20. Volvox is a motile colonial freshwater alga with a essential nutrients; when dried, it is about 45% protein,
definite number of vegetative cells. It is a unicellular 20% fat, 20% carbohydrate, 5% fibre, and 10%
green alga found in freshwater bodies. It is minerals and vitamins. It is also abundant in calories
photosynthetic in nature. and vitamins.
21. Algin is obtained from brown algae and carrageenan 31. Chara is a monoecious green alga that shows the
from red algae. presence of an upper oogonium and lower antheridium
22. Conifers are gymnosperms and lack vessels. Needle- on the same plant.
shaped leaves of gymnosperms are adapted not to 32. (a) In liverworts, mosses, and ferns gametophytes are
accumulate much snow, the presence of thick waxy free-living.
cuticle and sclerenchyma protect the underlying (b) Gymnosperms and some ferns produce two kinds
mesophyll cells, tightly packed tissues protect the of spores, macro (large) and micro (small) spores,and
central vein containing vascular tissues. Thus, these are known as heterosporous.
leaves are well adapted to withstand the harsh and cold (c) Sexual reproduction in Fucus, Volvox and Albugo
climate. They have sunken stomata to preserve water Is oogamous which refers to the fusion between one
loss during physiological drought conditions. So, the large, non-motile (static) female gamete and a smaller,
correct answer is 'Thick cuticle' motile male gamete.
23. In bryophytes and pteridophytes, transport of male (d) The sporophyte in mosses is more elaborate than
gametes requires water. The male gametes, produced that in liverworts.
by reproductive structures called antheridia, are free- (e) Pinus is monoecious, having the male and female
swimming sperm cells that need water to transport cones on the same tree whereas Marchantia is a
them to the female gametes, which are enclosed within dioecious species having male and female organs on
structures called archegonia. Because of the need for different thalli.Hence, statements a, b and c are correct
water, bryophytes are especially common in wet whereas statements d and e are not correct.
habitats such as bogs, streambanks, and in moist 33. Ginkgo male gamete is motile free swimming but male
forests. gametophyte is not independent and not of free
24. Sequoia is one of the tallest trees. It is also known as existence.
the redwood tree. Leaves of gymnosperms are well 34. In Salvinia, both male and female gametophytes are
adapted to the extreme of climate. Gymnosperms are found in massulaes not in prothallus.
heterosporous. Salvinia is a pteridophyte whereas 35. Marchantia
Ginkgo and Pinus are gymnosperms. 36. Smaller and to have smaller sex organs
25. During microsporogenesis and megasporogenesis, each 37. Gametophyte is dependent on the sporophyte in
microspore mother cell and diploid megaspore mother gymnosperms. e.g., Pinus. Gymnosperms are vascular
cell undergo meiosis to form a tetrad of haploid plants that produce seeds in cones. Examples include
microspores and megaspores respectively. conifers such as pine and spruce trees. The
26. Mucor has non-motile and non-flagellated gametes. It gymnosperm life cycle has a dominant sporophyte
belongs to the kingdom Fungi. generation. Both gametophytes and the next
27. In Spirogyra, sexual reproduction takes place through generation’s new sporophytes develop on the
non-flagellated and similar sized gametes, and hence sporophyte parent plant. Marchantia and Polytrichum
called isogamous. Isogamy involves the fusion of are bryophytes and Adiantum is a fern.
gametes that are morphologically and physiologically 38. In Sphagnum, male and female gametophytes are
similar. independent and free of living. Sphagnum comes under
28. Species of Sphagnum, a moss, provide peat that has the class of bryophytes; the most important phase in
been used as fuel and packaging material because of its the life cycle is the gametophyte. Gametophytes are the
water holding capacity. cells that undergo division to produce spores and new
29. Chara is a multicellular green alga. Sexual plants.
reproduction in Chara is oogamous. The male sex 39. Cellulose, galactans and mannans
organ is a spherical structure which is yellow in color 40. Ustilago
and is called antheridium or globule. The female sex 41. Fucus
organ is oval shaped green colored structure and is 42. Equisetum
called oogonium or nucule. Most species of Chara are 43. In gymnosperm like Cedrus, the male and the female
monoecious i.e. globule and nucule are present on the gametophyte do not have an independent free-living
same plant. Globule and nucule are present at the existence. They remain inside the sporangia on the
PLANT KINGDOM 157
sporophytes which means that the female gametophyte fertilisation as a result of triple fusion or double
within megasporangium and male gametophyte within fertilisation, thus, it is a tripod tissue. In both conifers
microsporangium. and grasses, seeds are from ovules. Xylem tracheids
44. Salvinia are present grasses. Pollen tubes are also formed
45. Types of pigments present in the cell grasses. in both conifers and in both conifers and
46. Riccia, Dryopteris and Cycas grasses.
47. Elaters 50. Is partially parasitic on the gametophyte
48. It is hygroscopic 51. A –L ; B –J; C –M ; D – N ; E – K
49. The conifers (gymnosperms) differ from the grasses 52. Cycads
(angiosperm) in the formation of endosperm before 53. Prairie - epiphytes
fertilisation. Infact, in gymnosperms, the endosperm is 54. Power of adaptability in diverse habitat
a haploid tissue as it formed before fertilisation, while 55. Due to long periods of evolutionary changes
in angiosperms, the endosperm is formed after 56. Desert
ANIMAL KINGDOM 158
ANIMAL KINGDOM (SOLUTIONS)

1. Adults of phylum Hemichordata exhibit Bilateral Ornithorhynchus is the scientific name of Platypus.
symmetry. They both belong to class Mammalia. Hemidactylus is
2. Hairs, pinna and mammary glands the scientific name of a Wall lizard that belongs to
3. A. Presence of dorsal, hollow nerve cord. class reptilia.
D. Presence of ventral heart 10. Physalia is commonly known as the Portuguese man of
E. Triploblastic coelomate animals war. Limulus is considered a living fossil and is
4. All arthropods have a hard exoskeleton made of chitin, commonly known as king crab. Ancylostoma is a
a type of protein. This shell provides protection for the roundworm and is commonly known as hookworm.
animals, and gives support for the attachment of the Pinctada is commonly known as pearl oyster, included
arthropod's muscles. Although arthropods grow, their in the phylum Mollusca.
exoskeletons do not grow with them. 11. Flatworms are bilaterally symmetrical, triploblastic and
5. Crop and gizzard are part of the digestive tract of birds acoelomate animals with organ level of organisation.
(class Aves) and insects (phylum Arthropoda). Pavo, Aschelminthes are triploblastic, bilaterally symmetrical
Psittacula, Corvus are birds hence all three have crops and pseudocoelomate. Annelida are triploblastic,
and gizzard. Chameleon, Bangarus and Crocodilus are bilaterally symmetrical and coelomate. Ctenophora is
reptiles and reptiles do not have crop and gizzard in radially symmetrical, diploblastic.
their digestive system. Bufo belongs to class Amphibia 12. (1) In Urochordata, notochord is present only in larval
and Balaenoptera is a mammal. tail, while in Cephalochordata, it extends from head to
6. All vertebrates are chordates but all chordates are not tail region and is persistent throughout their life.
vertebrates. This statement is true because all the (2) Vertebrates possess notochord during the
features of chordates are present in all the vertebrates embryonic period. The notochord is replaced by a
in some stage of life. In adult vertebrates, the cartilaginous or bony vertebral column in the adult.
notochord is replaced by the vertebral column and this (3) Central nervous system is dorsal and hollow.
is not the case for all chordates, hence the assertion is (4) Chordata is divided into 3 subphyla: Urochordata,
correct and reason is the correct explanation of Cephalochordata and Vertebrata.
assertion.
7. Metagenesis is the characteristic of cnidarians. Those S.No Chordates Non-Chordates
cnidarians which exist in both forms exhibit alternation 1. Notochord present Notochord absent.
of generation (Metagenesis), i.e., polyps produce 2. Central nervous The central nervous
medusae asexually and medusae form the polyps system is dorsal, system is ventral, solid
sexually (e.g., Obelia). Ctenophores, commonly known hollow and single. and double
as sea walnuts or comb jellies are exclusively marine, 3. Pharynx perforated Gill slits are absent.
radially symmetrical, diploblastic organisms with by gill slits.
tissue level of organization. The body bears eight 4. Heart is ventral. Heart is dorsal (if
external rows of ciliated comb plates, which help in present)
locomotion. 5. A post-anal part (tail) Post-anal tail is
8. In earthworm, the body shows this pattern called is present. absent.
metameric segmentation, and the phenomenon is
known as metamerism. Sponges have a water transport 13. (a) Locusta is a gregarious pest.
or canal system. Water enters through minute pores (b) In Echinodermata, adults are radially symmetrical
(ostia) in the body wall into a central cavity, and larva are bilaterally symmetrical. For example:
spongocoel, from where it goes out through the Asterias.
osculum. Ctenophores bear eight external rows of (c) In Arthropoda, scorpion respires through book
ciliated comb plates, which help in locomotion. lungs.
Coelenterata possesses cnidoblasts or cnidocytes (d) Bioluminescence (the property of a living organism
(which contain the stinging capsules or nematocysts) to emit light) is well marked in ctenophores. For
present on the tentacles and the body. Cnidoblasts are example: Ctenoplana.
used for anchorage, defense, and for the capture of 14. (a) Cyclostomata that belongs to agnatha which
prey. comprises the living jawless vertebrates.
9. The scientific name of Vulture is Neophron. Vultures (b) Chondrichthyes consists of the cartilaginous fishes
belong to the class Aves. Aves possess an (eg. shark), a typical member of which has heterocercal
endoskeleton that is fully ossified (bony) and the long (two unequal lobes) caudal fins.
bones are hollow with air cavities (pneumatic).
Macropus is the scientific name of kangaroo.
ANIMAL KINGDOM 159
(c) Osteichthyes consists of the bony fishes in which hexapod and has the head, thorax, and abdomen as
air bladder is present which regulates buoyancy. body segments. It belongs to class Insecta and order
(d) Chondrichthyes poison sting (e.g., Trygon, whose Diptera as functional forewings for flying, small
common name is sting ray). hindwings and mouth adapted for sucking. It belongs
15. (a) Pila is a Mollusc. The mouth contains a file- like a to the family Muscidae due to the presence of sucking
rasping organ for feeding called radula. mouth appendages. Hence correct matching is:
(b) Bombyx is an Arthropod. In Bombyx excretion (a)-(iii), (b)-(i), (c)-(iv), (d)-(ii)
takes place through malpighian tubules. 25. Both mammals and birds can regulate body
(c) Pleurobrachia is Ctenophore. The body bears eight temperature and have warm-blooded nature. They have
external rows of ciliated comb plates, which help in lungs and hence use them for breathing. Both the
locomotion. groups have ossified endoskeletons (formation of
(d) Taenia is a platyhelminth. Specialised cells called bones by adding osteoblasts - osteogenesis, results in
flame cells help in osmoregulation and excretion in it. an ossified endoskeleton.) But birds lay eggs and show
16. True segmentation is present in Annelida, Arthropoda oviparity whereas mammals give birth to live young
and Chordata. They also have organ system level of and show Vivipary (except Monotremes or egg-laying
organisation, bilateral symmetry and are true mammals).
coelomates. 26, Chondrichthyes is a class that contains the
17. Metamorphosis refers to the transformation of a larva cartilaginous fishes: they are jawed vertebrates with
into an adult. paired fins, paired nares, scales, a heart with its
Animals that perform metamorphosis are said to have chambers in series, and skeletons made of cartilage
indirect development. rather than bone. Viviparous - Giving birth to living
In earthworm, development is direct which means no young that develop within the mother's body rather
larval stage and hence no metamorphosis is present. than hatching from eggs. Not all mammals are
18. Homeotherm is animals that maintain constant body viviparous like platypus. All chordates do not possess a
temperature, irrespective of surrounding temperature. mouth with an upper and lower jaw. All reptiles have
Birds and mammals are homeotherms. Camelus and three-chambered hearts, except crocodiles, which have
Macropus are mammals whereas Psittacula is a bird. four-chambered hearts (2 atria, 2 ventricles), like
Chelone (Turtle) belongs to class reptilia which are mammals and birds.
Poikilotherm or cold blood. 27. Indeterminate and radial cleavage is a feature of
19. The digestive tract of Aves has additional chambers in deuterostomes while cockroach is an example of
their digestive system as crop and Gizzard. protostomes. Protostomes develop the mouth before
The crop is concerned with the storage of food grains. the anus, they also have spiral and determinate
The gizzard is a masticatory organ in birds used to cleavage. Spiral cleavage refers to the rotational
crush food again. pattern of the dividing cells, and determinate means
20. Spongocoel is a large central cavity in the sponges. that each cell has a certain fate – they cannot become
Water enters through the numerous ostium in the whole organisms if isolated from other cells.
cavity and exits through a central pore known as an 28. Arthropods have a rigid chitinous exoskeleton that
osculum. Choanocytes are the flagellated cells which covers their complete body. They are characterized by
line the spongocoel. It helps to set up water current and a segmented body with repetitions of organs and
helps in intake of food. tissues at intervals i.e. metameric segmentation and
21. Sharks and Trygon (stingray) are the members of have paired, jointed appendages to perform different
Chondrichthyes (cartilaginous fish) while whales, functions. Parapodia are lateral appendages of annelids
dolphins, and seals are aquatic mammals that belong to and are characteristic features of Nereis (Phylum
class Mammalia. Annelida), not Arthropoda.
22. Pharyngeal gill slits are present in hemichordates as 29. In Porifera, water enters through minute pores (ostia)
well as in chordates. The notochord is present in in the body wall into a central cavity, spongocoel, from
chordates only. The ventral tubular nerve cord is a where it goes out through the osculum. This pathway
characteristic feature of non-chordates. of water transport is helpful in food gathering,
23. Cyclostomata is the historical class of jawless fishes respiratory exchange and removal of waste.
that lack paired fins without any exception. All reptiles Fertilisation is internal and development is indirect,
have three-chambered hearts but the exception is having a larval stage which is morphologically distinct
Crocodiles have four-chambered heart. Class from the adult.
Chondrichthyes are cartilaginous fishes that lack 30. Double circulatory system is a characteristic feature of
operculum. Monotremes are the egg laying mammals. mammals. Whale is a mammal hence, it has two
Therefore, the correct answer is option A. separate circulatory pathways for blood flow.
24. Housefly belongs to phylum Arthropoda characterised 31. Metagenesis refers to alternation of generation between
by the segmented body, jointed appendages and a asexual and sexual phases of an organism within the
chitinous exoskeleton. It has an articulated, tracheated same species.
ANIMAL KINGDOM 160
32. The chitinous exoskeleton of arthropods is formed by 41. (NCERT-XIth, Page No. 57) (Chapter-Animal
the polymerisation of N-acetyl glucosamine, which is a kingdom, Class-Osteichthyes)
derivative of glucose. 42. Genus name- Salamandra; Two characters-(a) A
33. Petromyzon is marine but migrates for spawning to tympanum represents ear, (b) Fertilization is external;
fresh water. After spawning, within a few days, the fish Class /Phylum-Amphibia
die. Their larvae, after metamorphosis, return to the 43. Chondrichthyes : possess cartilaginous endoskeleton
ocean. 44. Male shark – Claspers borne on pelvic fins
34. Torpedo also called electric ray can produce electric 45. Fasciola
current. They possess a pair of electric organs, 46. Spongilla has special collared cells called choanocytes,
modified muscle tissues. They produce electric not found in the remaining three
discharge for communication, defense and navigation. 47. Flat worms
35. Phylum Cnidaria includes both marine and freshwater 48. Round worms (Aschelminthes) are pseudocoelomates
species. However, most of them are marine, only a few 49. Aschelminthes (round worms)
are freshwater species. Ctenophora, Cephalochordata, 50. Annelida and Arthropoda
Echinoderms are found exclusively in the marine 51. Lampreys and hag fishes
environment. 52. Pseudocoelom
36. Cuttlefish belongs to Phylum Mollusca. Silverfish 53. Mollusca — Normally oviparous and development
belongs to Phylum Arthropoda. It is a small, primitive, through a trochophore or veliger larva
wingless insect, not a fish. Pufferfish and flying fish 54. Animals- Scorpion, Spider, Cockroach;
belong to Phylum Chordata. Morphological feature- Ventral solid central nervous
37. Prawns, scorpions and locusts belong to the phylum system
Arthropoda. Hence, the (c) option is correct. Whereas 55. Presence of neither true coelom nor metamerism
malarial parasite is a sporozoan, Amoeba is an 56. Convergent evolution
amoeboid protozoan and mosquito belongs to 57. A, C and D
Arthropoda. Hence, the (a) option is wrong. 58. Ventral central nervous system – Leech
Earthworm belongs to Annelida, Pinworm belongs to 59. Homoiothermy
Ascheminthes, Tapeworm belongs to Platyhelminthes. 60. They all possess dorsal heart
Hence, the (b) option is incorrect. Sponge belongs to 61. Mollusca-Loligo, Teredo, Octopus
Porifera, Sea anemone belongs to Cnidaria, Starfish 62. Annelida and Arthropoda
belongs to Echinodermata. Hence, the (d) option is also 63. Periplaneta
incorrect. 64. Ctenoplana and Beroe
38. Housefly, butterfly, tsetse fly and silverfish are 65. Kangaroo, Hedgehog, Dolphin, Loris
members of Class Insecta belonging to the phylum 66. Jointed legs and chitinous exoskeleton
Arthropoda. 67. Absence of body cavity
39. Petromyzon is a vertebrate belonging to Cyclostomata 68. Ten pairs of cranial nerves
which is an ectoparasite on marine fish and turtles. 69. Animals belonging to Phylum porifera are exclusively
Ichthyophis is a limbless amphibian. Limulus (king marine
crab) is a living fossil, which belongs to the phylum 70. Echinodermata
Arthropoda. Admasia having polyp body form is a 71. Insecta
Coelenterata. 72. Conserve water
40. (NCERT-XIth, Page No. 57) (Chapter-Animal 73. Presence of diaphragm
Kingdom, Class-Osteichthyes)
MORPHOLOGY OF FLOWERING PLANTS (SOLUTIONS)

1. Fabaceae - Androecium: ten, diadelphous, anther such as rice and wheat, pollen grains lose viability
dithecous within 30 minutes of their release, and in some
2. Both A and R are true, and R is the correct explanation members of Rosaceae, Leguminosae, and Solanaceae,
of A. they maintain viability for months.
3. China rose, tomato, Petunia and lemon – Axile 11. Plum/peach belongs to the family Rosaceae and it
placentation shows half-inferior ovary. So the flowers are
Beans, pea and lupin – Marginal placentation perigynous. Sunflowers have inferior ovary. Brinjal
Mustard, cucumber – Parietal placentation (Solanaceae) has a superior ovary. Mustards have
Dianthus and primrose – Free central placentation superior ovaries.
4. Antipodals, synergids, Polar nuclei – Haploid 12. Roots that originate from the base of stem constitute
Primary endosperm nucleus – Triploid the fibrous root system as seen in the monocots
Zygote – Diploid example is wheat plant.
5. Pisum, commonly known as a pea, shows vexillary 13. Flower of compositae family contains two types of
aestivation and diadelphous stamens. Colchicum flower i.e., ray florets (located at peripheral) and disc
autumnale, Solanum nigrum and Allium cepa show florets (located at centre). Ray florets have inferior
valvate aestivation. ovary and the reason is that the other parts of the
6. Zygomorphic flowers are those which are only divided flower are attached above the level of ovary. Example
into two halves from one plane (bilaterally of such an ovary is ray florets of Sunflowers.
symmetrical). It includes pea, Gulmohar, Cassia, and 14. In parietal placentation, the ovules develop on the
beans. inner wall of the ovary or in the peripheral part. e.g
Mustard, datura, and chilli are actinomorphic flowers Mustard, Argemone etc. Parietal placentation appears
as they can be divided into two halves from any plane as follows:
(radially symmetrical) .
7. • Axillary buds of stems may also get modified into
woody, straight and pointed thorns. Thorns are found
in many plants such as Citrus and Bougainvillea.
• Stem tendrils which develop from axillary buds, are
slender and spirally coiled and help plants to climb
such as in cucumber, pumpkins and watermelon etc.
• Some plants of arid regions modify their stems into 15. Sweet potatoes (Ipomoea batatas) are modified
flattened structures such as Opuntia. They contain adventitious roots. They are swollen and contain high
chlorophyll and carry out functions such as amounts of starch. Other examples of modified
photosynthesis. adventitious roots include cassava, dahlia. Thus, the
• Rhizophora grows in swampy areas and many of their correct answer is option b.
roots come out of the ground and grow vertically A rhizome is a food storing underground modified
upwards. Such roots, also known as pneumatophores, stems.
help to get oxygen for respiration. 16. Halophytes like mangroves contain pneumatophores or
• Underground stems of grass and strawberry, etc., respiratory roots. It is a modified tap root that emerges
spread to new niches and when older parts die new from the soil and absorbs oxygen from the air due to
plants are formed (vegetative propagation). the unavailability of oxygen in the soil. It is an
8. The stamens may be united into one bunch or one apogeotropic (-vely geotropic) root having lenticels
bundle (monoadelphous) as in china rose, or two called pneumathodes to uptake O2 .
bundles (diadelphous) as in pea, or into more than two
bundles (polyadelphous) as in citrus.
9. The floral formula of
Solanaceae family
Fabaceae family
Liliaceae family
10. The period for which pollen grains remain viable is 17. Stems sometimes get modified to perform some
highly variable and to some extent depends on the specialised functions. Thorns are hard, pointed straight
prevailing temperature and humidity. In some cereals structures for protection. The axillary bud of the stem
is modified into thorns in Bougainvillea to protect 25. If filaments of androecium are joined together to form
them from their enemies. more than two groups but their anthers are separated, it
18. Root has three prominent regions, i.e., a zone of cell is called polyadelphous condition. E.g. Citrus
division, a zone of elongation, and a zone of Therefore, the correct answer is option A.
maturation and differentiation. In roots, the root hairs 26. The condition of fused pistil is known as syncarpous.
arise from the zone of maturation. This zone is a Process of gamete formation is known as
differentiated zone thus bearing root hairs. gametogenesis. The calyx may be gamosepalous
19. The edible part of the coconut is the endosperm. The (sepals united) or polysepalous (sepals free). Unisexual
endosperm is the nutritive tissue that helps in the female flower contain only female reproductive organ
development of the embryo in angiosperms. Coconut and is known as pistillate flower. Hence correct
has double endosperm with liquid nuclear endosperm matching is: a) - iii), b) - i), c) - iv), d) - ii)
and cellular endosperm. In mature coconut, the liquid 27. In potato, banana, and ginger, the plantlets arise from
endosperm becomes milky and is enclosed by the nodes present in the modified stem. Tubers of potato
kernel. are the underground modification of stem which stores
20. Halophytes grow in saline soils as they are starch. It has buds or eyes on the nodes which helps in
physiologically adapted to withstand high salinity. the growth of new plants as these buds are
They show vivipary which is in-situ seed germination, meristematic in nature. Ginger is propagated by the
i.e., condition of the seed germination while still rhizome. It is an underground stem modification. The
attached to the parent plant. They also possess plantlets arise from nodes present in the modified stem.
modified roots called pneumatophores for gaseous Banana has a reduced underground stem, called the
exchange. rhizome, which bears several buds. Each of these buds
21. Coconut fruit is a drupe. Drupe fruit can be defined as sprouts and forms its own pseudostem and a new
indehiscent fruit in which an outer fleshy part bulbous rhizome. So, the statement b is false.
surrounds a single shell of hard endocarp with a seed 28. Phylloclades is a flattened, photosynthetic branch or
inside. A drupe develops from a monocarpellary stem that resembles or performs the function of a leaf.
superior ovary and is one-seeded. 29. The embryo in maize grain consists of a single
22. In free-central placentation, the pistil is polycarpellary cotyledon called scutellum, a radicle and a plumule.
and syncarpous but the ovary is unilocular. The ovules The radicle lies towards the pointed side of the
are borne around a central column which is connected embryonic region of the seed. IT is covered by a
with the ovary wall by any septum. Free-central protective sheath called coleorhiza. The plumule is
placentation is found in Dianthus. Argemone, brassica located towards the upper side of the embryonic region
have parietal placentation, citrus has axile placentation. opposite to radicle. It is also enclosed in a protective
23. A flower which can be divided into two equal vertical sheath known as coleoptile.
halves by any vertical plane is said to be 30. The pitcher of Nepenthes is the modification of leaf
actinomorphic, e.g.: Datura, chilli, mustard. The lamina which takes the form of pitcher to trap insects.
bilaterally symmetrical flowers which are symmetrical Thorns of citrus are modified stems which performs
in only one plane and can be cut into two equal halves the function of climbing or defense. Thorns are present
through a single vertical plane only are said to be in the axil of leaves or apex of the stem. A tendril of
zygomorphic, e.g. Gulmohur and Cassia. Canna has cucumber is a modified stem which is formed by the
asymmetric flowers. modification of terminal bud into tendril because the
24. Families of the given plants : stem is often weak in such plants. Flattened structure
Indigofera: Fabaceae of Opuntia is also a stem modification.
Sesbania: Fabaceae 31. According to number of carpels, gynoecium is
Salvia: Lamiaceae monocarpellary, bicarpellary, tricarpellary and
Allium: Liliaceae multicarpellary. Ovary with united carpels is called a
Aloe: Liliaceae syncarpous ovary while that with distinct carpels is an
Mustard: Brassicaceae apocarpous ovary. Solanaceae have bicarpellary,
Groundnut: Fabaceae syncarpous, bilocular or tetralocular gynoecium with
Radish: Brassicaceae superior and obliquely placed ovary. Liliaceae have
Gram: Fabaceae tricarpellary, syncarpous, trilocular gynoecium.
Turnip: Brassicaceae Fabaceae has monocarpellary gynoecium.
The family having different length stamens in their 32. Papilionaceous flowers are flowers with the
flower is Brassicaceae and Lamiaceae. We are characteristic irregular and butterfly-like corolla. The
provided with four plants belonging to the above two flowers have a bilateral symmetry with the corolla
mentioned families. So, Salvia (didynamous), mustard, consisting of five petals. The largest known as
radish and turnip (tetradynamous) will have an unequal vaxillum overlaps the two lateral petals (wings) which
length of stamens. in turn overlap the two smallest anterior petals (keel);
So, the correct answer is 'Four'.
this type of aestivation is known as vexillary or showing radial symmetry, hypogynous ovary and with
papilionaceous. twisted aestivation of petals.
33. A superior ovary is an ovary attached to the receptacle 44. Mustard, brinjal, china rose, lupin, chilli, Petunia,
above the attachment of other floral parts. Among tomato, Withania, potato, onion, aloe, tulip, sunn
china rose, mustard, brinjal, potato, guava, cucumber, hemp, gram and bean have hypogynous flowers. Plum
petunia, and tulip have superior ovaries. Only guava and rose have perigynous flowers, while pumpkin,
and cucumber have inferior ovaries. bitter gourd, cucumber and guava have epigynous
34. In axile placentation, the ovules are arranged axially flowers .
inside the ovary. It occurs in lemon. Dianthus have 45. Marginal placentation is present in Fabaceae family.
free central placentation. Peas have marginal (NCERT -XI pg.79)
placentation. Argemone have parietal central. 46. NCERT-XI pg.81
35. The wheat grain has a small embryo with one large, 47. Stamens in gloriasa (Liliaceae) and petunia
shield-shaped cotyledon known as scutellum. (Solanceae) are free and does not show cohesion.
36. Non-albuminous seeds are seeds which have no Symbiotic N2 fixer occur in soil, in free living state
residual endosperm as it is completely consumed also.
during embryo development. Non-albuminous seed is 48. Peach
produced in pea. 49. Axillary buds
37. The edible parts of tomato are the placenta and 50. Flower of tulip is a modified shoot
pericarp. Placenta is the connecting tissue which 51.
supplies nutrition to the embryo and pericarp is the
remains of the ovular wall.
38. When more than one carpel is present, they may be 52. Mango
free and are called apocarpous. An aggregate fruit 53. Gulmohur
develops from multicarpellary apocarpous gynoecium 54. Basal
and each ripened is called fruitlet or etaerio. The 55. Tracheids
example is raspberry. 56. Bean
39. Aestivation refers to the arrangement of the petals or 57. Plum
sepals in a flower. When the margins of the sepals or 58. Monoadelphous
petals overlap one another without any particular 59. Cotyledon
direction, it is called imbricate. Example Cassia. When 60. Thigmotropism
the margins of the sepals or petals overlap one another 61. Groundnut and pomegranate
regularly in a particular direction, it is called twisted, 62. Castor
for example, China rose. When the margins of the 63. Syconus
sepals or petals do not overlap one another, it is called 64. Tobacco
valvate, for example, Calotropis. When the petals are 65. Lemon
of different sizes and show a descending imbricate 66. Heterospory
pattern, it is called vexillary, for example, pea. 67. Pea
40. Mango is a seeded fruit. A sterile stamen is called a 68. Mustard
staminode. The seed in grasses is endospermic. 69. Intercalary meristem
However, in maize grain, the endosperm is surrounded 70. Pomegranate
by a proteinaceous aleurone layer. 71. Cypsela
41. Potato is an edible underground stem which stores 72. A cluster of compactly borne flowers on a common
food. Modified stems located below ground are bulbs axis
(which are actually primarily the enlarged base of the 73. Treating the plants with low concentrations of
plant's leaves), corms, rhizomes, and tubers. Potato is gibberellic acid and auxins
the edible portion is an underground stem that is a 74. Litchi
tuber. The eyes of the potato are lateral buds. 75. Marginal
42. Seed coat of coconut is thick. Coconut is a drupe fruit. 76. Solanaceae
It has an indehiscent, hard, lignified seed coat. The 77. Scutellum
seed coat is thin and membranous in groundnut, gram 78. Juicy aril
and maize seeds. 79. Mesocarp
43. China rose belongs to Family Malvaceae; flowers of 80. Root cap, cell division, cell enlargement, cell
plants belonging to this family are actinomorphic maturation
ANATOMY OF FLOWERING PLANTS (SOLUTIONS)

1. Both A and R are true, and R is the correct explanation 6. Lenticels permit the exchange of gases between the
of A outer atmosphere and the internal tissue of the stem.
2. In old trees, the greater part of the secondary xylem is With the continuous increase in girth due to the
dark brown due to deposition of organic compounds activity of vascular cambium, the outer cortical and
like tannins, resins, oils, gums, aromatic substances epidermis layers get broken and need to be replaced to
and essential oils in the central or innermost layers of provide new protective cell layers. Hence, sooner or
the stem. These substances make it hard, durable and later, another meristematic tissue called cork cambium
resistant to the attacks of microorganisms and insects. or phellogen develops, usually in the cortex region.
3. All the given statements are correct: Phellogen is a couple of layers thick. It is made of
• When xylem and phloem within a vascular bundle are narrow, thin-walled, and nearly rectangular cells.
arranged in an alternate manner along the different Phellogen cuts off cells on both sides. The outer cells
radii, the arrangement is called radial such as in roots. differentiate into cork or phellem while the inner cells
• Conjoint, closed vascular bundles enclose both xylem differentiate into secondary cortex or phelloderm. The
and phloem. Xylem is found towards the inner surface cork is impervious to water due to suberin deposition
and phloem towards the outer surface. Cambium is in the cell wall.
absent. 7. When the cells of medullary rays are differentiated,
• Open vascular bundles are vascular bundles in which they give rise to the new cambium called
secondary growth is possible. This type of vascular interfascicular cambium. Loose parenchyma cells
bundle has cambium present in between the xylem and rupturing the epidermis and forming a lens-shaped
phloem. opening in the bark are called complementary cells.
• Vascular bundles of dicot stem are eight in number, Large colourless empty cells in the epidermis of grass
arranged in the form of a broken ring. The vascular leaves are called bulliform cells. In the dicot leaf,
bundles are conjoint, collateral and open. Xylem is on vascular bundles are surrounded by large thick-walled
the inner surface and phloem on the outer surface. cells called bundle sheath cells.
Xylem is described as endarch. 8. All anatomical features mentioned is shown by
• Vascular bundles in monocot roots are radial, monocotyledonous stem so option (c) is correct. In
polyarch and exarch. Large number (more than 6) of monocots vascular bundles are scattered between
xylem and phloem groups alternate with each other. parenchymatous ground tissue. There is no pith region
4. In the spring season, cambium is very active. The in monocots. The vascular bundles are closed as they
wood formed during this season is called spring wood do not have cambium in it.
or early wood. 9. In a large tree, only the outer secondary xylem
- In spring season, cambium produces a large number (sapwood) serves in water conduction, while the inner
of xylary elements having vessels with wider cavities part (heartwood) is composed of dead but structurally
and not narrow cavities. strong secondary xylem and is darker in colour due to
-The spring wood is lighter in colour. deposition of tannins, resins and oils.
-The two kinds of woods (spring and autumnwood) 10. Growth rings are formed by the differential activity of
appear as alternate concentric rings that constitute an cambium in different seasons. In plants of temperate
annual ring. Annual rings seen in a cut stem give an regions, cambium is more active during spring and less
estimate of the age of the tree. active in autumn seasons. In temperate regions,
-Springwood has a lower density. climatic conditions are not uniform throughout the
5. Growth in plants is largely restricted to specialized year. However, in tropics, climatic conditions are
regions of active cell division called meristems. uniform throughout the year.
Meristematic tissues are those tissues that have cells 11. Phloem in gymnosperms lacks both sieve tube and
with active cell division capacity. Permanent tissues companion cells, whereas they contain albuminous
having all cells similar in structure and function are cells and sieve cells.
called simple tissues. Vascular tissue is a complex 12. Bulliform cells are the modified epidermal cell present
conducting tissue, formed of more than one cell type, in the leaves of grasses. Bulliform cells become flaccid
found in vascular plants. The sclereids are spherical, due to water loss. This makes the leaves curl inward to
oval, or cylindrical, highly thickened dead cells with minimise water loss.
very narrow cavities (lumen). These are commonly 13. Secondary growth occurs in dicot and gymnosperms.
found in the fruit walls of nuts; pulp of fruits like Grasses are monocots hence they do not perform
guava, pear, and sapota; seed coats of legumes and secondary growth.
leaves of tea. Palm like monocots shows anomalous secondary
growth.
14. Endodermis of the root contains a Casparian strip on Therefore, the correct answer is option d.
the radial and inner tangential wall. It is formed by the 22. The correct order of the components with reference to
deposition of suberin. Casparian strips are their arrangement from outer side to inner side in a
impermeable for water and it is a characteristic feature woody dicot stem is phellem – secondary cortex –
of roots. secondary phloem – wood.
15. Vascular cambium is partially primary and partially 23. Tracheids and vessels together are called tracheary
secondary meristem. elements as both take part in transport of sap.
It forms the secondary xylem towards the inside and Tracheids differ from other tracheary elements in being
the secondary phloem towards the outsides. 4-10 times imperforate and their wall is more thickened. The wall
more secondary xylem is produced than secondary of vessels is perforated.
phloem due to differential activity of cambium. 24. In stems, the protoxylem lies towards the centre (pith)
16. Monocots contain dumb-bell shaped stomata. Grass and the metaxylem lies towards the periphery of the
being a monocot, has dumb-bell shaped stomata in its organ. This type of primary xylem is called endarch. In
leaves. Kidney shaped stomata are present in dicot roots, the protoxylem lies towards the periphery and
leaves. the metaxylem lies towards the centre. Such
17. Heartwood is physiologically inactive due to the arrangement of primary xylem is called exarch.
deposition of organic compounds and tyloses 25. The number of annual rings tells the age of the tree.
formation, so this will not conduct water and minerals. The number of annual rings suggests the number of
18. Cork cambium undergoes periclinal division and cuts years. The annual rings of a tree are made each year
off thick-walled suberized dead cells toward outside when a new layer of wood is added to the trunk and
i.e., phellem (cork) and it cuts off thin-walled living branches of the tree. The study of the rings of trees is
cells i.e., phelloderm on the inner side. Parenchyma is called dendrochronology.
living tissue and helps in support and storing food. 26. Interfascicular cambium develops from the cells of the
Collenchyma is also living tissue that provides tensile medullary rays. The interfascicular cambium is formed
strength to plants. from the cells of the medullary rays adjoining the
19. During secondary growth, vascular cambium gives rise interfascicular cambium.
to secondary xylem and secondary phloem. Phelloderm 27. Dicot root is diarch to hexarch while in monocot
is formed by cork cambium. The periderm is derived polyarchy condition is present (NCERT-XI pg. 91)
from the phellogen, a meristematic region that arises 28. All tissues except epidermis and vascular bundles
via the dedifferentiation of parenchyma cells in the 29. Chloroplasts
epidermis, cortex, phloem, or pericycle. 30. Periderm
20. The balloon shaped structures, formed in the vessels 31. Intercalary meristem
of heart wood, due to the extension of parenchyma are 32. Having dead and non-conducting elements
called tyloses. They block the vessels. They contain the 33. Differentiating
depositions of bio-chemicals like tannins, resins, gums, 34. Closed and scattered
etc. Due to the presence of tyloses, heart wood cannot 35. Sorghum (family - Poaceae) is a monocot plant. The
conduct water and heart wood shows resistance to leaves of monocot do not contain palisade parenchyma,
pathogens to insects. So it is highly durable. So, the because the mesophyll of monocot leaf is not
correct option is ‘are extensions of xylem parenchyma differentiated into palisade and spongy parenchyma, all
cells into vessels’. being thin walled, chlorophyllous and irregularly
21. Cortex is the ground tissue present below the compactly arranged with fewer inter cellular spaces.
epidermis. It surrounds the central cylinder and 36. Hydrophytes
endodermis lines the outermost layer of the cylinder. 37. Position of protoxylem
So, the region between epidermis and stele is cortex. 38. Plerome
Pericycle is present between the endodermis and 39. Teak and pine
vascular bundle. The whole ground tissue system 40. Enucleate condition
(cortex, endodermis and pericycle) is present between 41. Mass flow involving a carrier and ATP
epidermis and stele. 42. Flowers, fruit and leaves
STRUCTURAL ORGANISATION IN ANIMALS

(SOLUTIONS)
1. Statement I: Ligaments are dense regular tissue. at some fusion points allow the cells to contract as a
Statement II: Cartilage is specialised connective unit, i.e., when one cell receives a signal to contract, its
tissue. neighbors are also stimulated to contract.
2. Excretion is performed by Malpighian tubules in 9. A ring of gastric caeca is present at the junction of the
cockroach. In addition, the fat body, nephrocytes and foregut and midgut. At the junction of the midgut and
urecose glands also help in excretion. hindgut, malpighian tubules are present. The
3. hypopharynx lies within the cavity enclosed by
mouthparts. In female cockroaches, the 7 th sternum is
List I List II boat-shaped and together with the 8th and 9th sterna
A. Mast cells II. Areolar connective form a genital pouch. The 10th abdominal segment in
tissue both sexes bears a pair of anal cerci.
B. Inner surface of I. Ciliated epithelium 10. Three types of junctions are found in tissues. Tight
bronchiole junctions stop leakage of substances from leaking
C. Blood IV. Specialised across a tissue. Adhering junctions cement and keep
connective tissue neighboring cells together. Gap junctions or
D. Tubular parts of III. Cuboidal epithelium communication junctions facilitate communication
nephron between cells by connecting the cytoplasm of
adjoining cells.
4. Presence of anal styles – seen only in males. 11. The anterior end of the earthworm has a mouth that has
5. In cockroaches, the first pair of wings or the forewings a covering called prostomium. Prostomium acts as a
are also called tegmina. They arise from the wedge to force open cracks in the soil. Prostomium has
mesothorax. receptors, so it is sensory in function. The first body
6. Neuroglia, also called glia or glial cells, are non- segment of earthworms is the peristomium.
neuronal cells of the nervous system. Hence they are a 12. The cuboidal epithelium is composed of a single layer
component of the neural tissues and not connective of cube-like cells. This is commonly found in ducts of
tissues. glands and tubular parts of nephrons in kidneys and its
7. Bronchioles-If the columnar or cuboidal cells bear cilia main functions are secretion and absorption. The
on their free surface they are called ciliated epithelium. epithelium of proximal convoluted tubule (PCT) of
They are mainly present in the inner surface of hollow nephron has microvilli. Hence, the (a) option is correct.
organs like bronchioles and fallopian tubes. 13. Goblet cells are modified columnar epithelial cells. It
Goblet cell-Columnar or cuboidal cells get specialised is found in the lining of organs like the respiratory tract
for secretion and are called glandular epithelium. and intestine. It secrete mucus which creates a
Goblet cells of the alimentary canal is an example of protective layer.
glandular tissue. 14. The nervous system of cockroach is spread throughout
Adipose tissue-Adipose tissue is a type of loose the body and consists of a series of fused, segmentally
connective tissue located mainly beneath the skin. The arranged ganglia which are joined by paired
cells of this tissue are specialised to store fats. longitudinal connective tissue on the ventral side. In
Tendons-Tendons are examples of dense regular the thorax region, three ganglia are present and six
connective tissues. They attach skeletal muscles to ganglia are present in the abdomen. The head of
bones and ligaments which attach one bone to another cockroach contains a bit of nervous system while the
are examples of this tissue majority of nervous system is present along the ventral
8. The smooth muscle fibres taper at both ends (fusiform) part of the body. This is the reason why cockroaches
and do not show striations. Cell junctions hold them may live for a few days if their head is removed.
together and they are bundled together in a connective 15. Bronchioles and fallopian tubes are lined with ciliated
tissue sheath. The wall of internal organs such as the epithelium to move mucus and ovum respectively in a
blood vessels, stomach and intestine contains this type specific direction.
of muscle tissue. Smooth muscles are ‘involuntary’ as 16. The correct sequence of organs in the alimentary canal
their functioning cannot be directly controlled. of cockroach starting from mouth is: Pharynx →
Intercalated discs are the characteristics of cardiac Oesophagus → Crop → Gizzard → Ileum → Colon →
muscle. Communication junctions (intercalated discs) Rectum as shown in the given diagram.
as blood vessels, the gastrointestinal tract, the bladder,

or the uterus. Areolar tissue is located in the skin;
binds the outer layers of the skin to the muscles
beneath. Transitional epithelium occurs in the mucosal
lining of ureters, a portion of the urethra, and urinary
bladder. Cuboidal epithelium mainly occurs in kidney
tubules.
21. Loose connective tissues include areolar tissue,
reticular tissue, and adipose tissue. A tendon is a type
of fibrous connective tissue, and it attaches muscle to
the bone. Cartilage (specialized connective tissue) is
the flexible connective tissue found in animals. It also
includes the joints between bones, the rib cage, the ear,
the nose, the bronchial tubes. Thus, areolar tissue is a
17. Males bear a pair of short, thread-like anal styles which loose connective tissue in which the cells and fibers are
are absent in females. loosely arranged in a semi-fluid ground substance.
Anal/caudal styles arise from the 9th abdominal 22. The cuboidal epithelium is composed of a single layer
segment in the male cockroaches. of cube-like cells. It is found in tubular parts of
nephrons in kidneys and its main functions are
secretion and absorption. The inner lining of salivary
ducts has stratified columnar epithelia. A stratified
squamous non-keratinized epithelium lines the oral
cavity. Bronchioles are lined by ciliated cuboidal
epithelium.
23. Cockroach develops from the nymph to the adult form
through the process of moulting. The next to last
nymphal stage in cockroach shows the presence of
wing pads, but only adult cockroaches have wings.
24. Ear pinna and tip nose are example of yellow elastin
cartilage.
(NCERT-XIth, Page No 104) (Chapter-Structural
organization I Animals)
25. NCERT XI Fig. 7.4(a) Page no. 103 (Connective
tissue)
26. NCERT XI fig.7.2(a) Page 102 (Glandular Epithilium)
27. Bronchioles and Fallopian tubes
28. The food is ground by mandibles and gizzard
29. The typhlosole greatly increases the effective
18. Frog or the vertebrates have myogenic heart, i.e., they absorption area of the digested food in the intestine
are self contractile or are autoexcitable. They do not 30. Squamous epithelium
require external stimuli. When a frog’s heart is taken 31. Coelomic fluid
out of the body, it continues to beat for some time 32. Epithelial tissue
because till then ATP is available. It is not dependent 33. Tip of the nose
on the nervous system and does not require external 34. Ciliated
stimuli as the SA node can generate action potential on 35. Two pairs of testes in 10th and 11th segments.
its own. 36. Coelomic fluid
19. In male cockroaches, sperms are produced from the 37. Cockroach — 10 pairs of spiracles (2 pairs on thorax
testes and while the cockroach is still young, they are and 8 pairs on abdomen)
brought by the vasa deferentia into the seminal vesicles 38. Camouflage
for storage. The sperms in the seminal vesicles are 39. Integument with muscles
glued together in the form of bundles called 40. Ammonotelic when plenty of water is available.
spermatophores. 41. Just opposite to the site of entry of sperm into ovum
20. Smooth muscle is a non-striated muscle which is 42. Microvilli
mainly involved in involuntary actions. It is 43. Heparin and histamine
responsible for the contractility of hollow organs, such
CELL: THE UNIT OF LIFE (SOLUTIONS)

1. The endomembrane system include endoplasmic the thylakoids are present in the stroma. Thylakoids are
reticulum (ER), golgi complex, lysosomes and arranged in stacks like the piles of coins called grana
vacuoles. Since the functions of the mitochondria, (singular: granum) or the intergranal thylakoids. Every
chloroplast and peroxisomes are not coordinated with chromosome essentially has a primary constriction or
the above components, these are not considered as part the centromere on the sides of which disc-shaped
of the endomembrane system. structures called kinetochores are present. The golgi
2. The cytoskeleton in a cell are involved in many complex consists of many flat, disc-shaped sacs or
functions such as mechanical support, motility, cisternae of 0.5µm to 1.0µm diameter. These are
maintenance of the shape of the cell. stacked parallel to each other. A varied number of
3. The metacentric chromosome has a middle centromere cisternae are present in a golgi complex.
forming two equal arms of the chromosome. 8. The endomembrane system consists of the
- In the case of an acrocentric chromosome the endoplasmic reticulum, Golgi complex, vacuoles, and
centromere is situated close to its end forming one lysosomes. Mitochondria is a semi-autonomous cell
extremely short and one very long arm. organelle. The ribosome is a non-membranous cell
-The sub-metacentric chromosome has centromere organelle.
slightly away from the middle of the chromosome 9. Inclusions bodies are distinct granules that may occupy
resulting in one shorter arm and one longer arm. a substantial part of the cytoplasm. Inclusion, granules
-Telocentric chromosomes have a terminal centromere. are usually reserved food material and not bound by
4. Endoplasmic reticulum is not found in prokaryotes. any membrane. They are not involved in ingestion of
Therefore, both RER and SER are absent in food particles. So option (d) is incorrect.
prokaryotic cells. 10. Proteins and lipids are formed in the endoplasmic
5. The nuclear envelope consists of two lipid bilayer reticulum and some of them are modified to form
membranes: an inner nuclear membrane and an outer glycoproteins and glycolipids in the Golgi apparatus.
nuclear membrane. The space between the membranes 11. Concept of "Omnis cellula-e cellula" regarding cell
is called the perinuclear space, which forms a barrier division was proposed by Rudolf Virchow. It means
between the materials present inside the nucleus and new cells arise from pre-existing cells.
that of the cytoplasm. 12. • Sub metacentric chromosome is Heterobrachial.
At a number of places the nuclear envelope is • Short arm designated as 'p' arm
interrupted by minute pores, which are formed by the (p = petite i.e. short)
fusion of its two membranes. These nuclear pores are • Long arm designated as 'q' arm
the passages through which movement of RNA and 13. Lysosomes bud off from trans face of Golgi bodies.
protein molecules takes place in both directions Precursors of lysosomal enzymes are synthesised by
between the nucleus and the cytoplasm. RER and then sent to Golgi bodies for further
Mature sieve tube elements are deep , tubular and do processing.
not contain nucleus in the cells with no secondary wall 14. Lysosomes and vacuoles do not have DNA. Inside the
and terminal sieve plate. They lack nucleus at the cell three organelles contain DNA i.e., mitochondria,
maturity so that they are associated with companion chloroplast and nucleus.
cells for support. 15. The phenomenon of association of many ribosomes
Many membrane bound minute vesicles called with single m-RNA leads to the formation of
microbodies that contain various enzymes, are present polyribosomes or polysomes or ergasomes. They are
in both plant and animal cells. involved in the formation of multiple copies of a
6. Based on the position of the centromere, chromosomes polypeptide simultaneously.
are categorized as metacentric, submetacentric, 16. Phospholipid synthesis does not take place in RER.
acrocentric, and telocentric. The metacentric has a The smooth endoplasmic reticulum is involved in lipid
centromere in the middle of the chromosome with two synthesis.
equal arms of the chromosomes. Sub-metacentric has a 17. Polytene chromosomes are found in salivary glands of
sub-terminal centromere with one shorter arm and one insects of order Diptera whereas oocytes of amphibians
longer arm. Acrocentric have centromere close to its contain lampbrush chromosomes which are diplotene
end forming one extremely short and one very long bivalent chromosomes.
arm. Telocentric have terminal centromere. 18. Nucleolus is a non-membranous structure and is a site
7. The inner membrane of mitochondria forms a number of rRNA synthesis. Centromere takes part in spindle
of infoldings called the cristae (sing.: crista) towards formation.
the matrix. The cristae increase the surface area. A
number of organized flattened membranous sacs called
19. Golgi complex, after modification of proteins, packs it of amino acids bonded together by peptide linkage.
and releases it in the form of secretory vesicles from Okazaki fragments are small nucleic acid fragments
their trans-face. formed by discontinuous replication of lagging strand
Mesosomes take part in the respiration of bacteria. during DNA replication and are later joined together
Fatty acid breakdown takes place in the cytoplasm. by DNA ligase enzyme.
20. Mitochondria are the site of aerobic oxidation of 27. The microtubules are found in the cytoplasmic matrix
carbohydrates to generate ATP. It oxidizes the pyruvic of all eukaryotic cells. They also occur in cilia,
acid and produces energy in the form of ATP. It also flagella, centrioles, basal bodies, and mitotic apparatus.
stores the energy for future use. Spindle fibers form the protein structure which helps in
21. Mycoplasmas are the smallest, wall-less prokaryotes, mitosis and meiosis. Centrioles are the two cylindrical
pleomorphic in nature. It does not possess a cell wall structures of a cell organelle called centrosome. Cilia
but has a cell membrane as an outer covering. These and flagella are fine hair-like outgrowths of the
are pathogenic to both plants and animals as they do membrane while peroxisomes are the microbodies.
not have a cell wall and hence do not get affected by 28. Mitochondria are considered as semi-autonomous cell
the antibiotics. organelle because they have their own DNA which can
22. Lysosomes are membranous organelles whose specific replicate independently. The mitochondrial DNA
function is to breakdown cellular wastes and debris by produces its own mRNA, tRNA and rRNA which acts
engulfing it with hydrolytic enzymes. Due to their as a protein synthesizing machinery. The organelles
peculiar function, they are also known as the “suicide possess their own ribosomes, called mito ribosomes.
bags” of the cell. The same applies to chloroplast as well.
23. Plant cells have large central vacuoles while animal 29. Chromatophores are pigments that take part in
cells contain many small vacuoles. Protists are photosynthesis. Hence, (a) option is correct.
eukaryotic cells which have well defined nucleus and 30. Besides the nucleus, the eukaryotic cells have other
other cell organelles. Methanogens are prokaryotes membrane-bound cell organelles like lysosomes, Golgi
which do not have well defined nuclei. Gas vacuoles apparatus, and mitochondria. Ribosomes are non-
are aggregates of hollow cylindrical structures called membrane bound organelles present in all cells.
gas vesicles. They are the form of stored food materials 31. A protoplast is a cell whose cell wall is removed by
in the cytoplasm of Blue-green algae, Purple digestion with enzymes.
photosynthetic bacteria, and Green photosynthetic 32. Ribosomes are non-membrane bound organelles found
bacteria. in all cells.
24. Anthocyanins are water soluble pigments. These are 33. The gap junction facilitates communication between
present in the vacuoles. These appear in different adjoining cells by connecting the cytoplasm for rapid
colors like red, blue or purple depending on the pH. transfer of ions, small molecules and some large
Xanthophylls are the typical yellow pigments of molecules.
leaves. Chlorophyll is a term used for several closely 34. 1. Thylakoids are flat membranous sacs in stroma of
related green pigments found in cyanobacteria and the chloroplasts.
chloroplasts of algae and plants. Carotenoids are plant 2. Cristae are folds in the inner membrane of
pigments responsible for bright red, yellow and orange mitochondria.
hues in many fruits and vegetables. These pigments 3. Cisternae are disc-shaped sacs in Golgi apparatus.
play an important role in plant's health. 4. Chromatin is a condensed structure of DNA.
25. Nucleus is the double membrane bound organelle of 35. Nuclear envelope is a double layered membrane
eukaryotic cells that serve to house genetic material. surrounding the nucleus in eukaryotes. However, it is
The two membranes together make the nuclear not found in a prokaryotic cell.
envelope. Mitochondrion is double membrane bound 36. Basal bodies are modified centrioles that give rise to
organelle, wherein the inner membrane is present as cilia and flagella. In the cell, apex is the basal body
infolding and forms cristae. Cristae have respiratory that is the anchoring site for a flagellum. Chlorophyll is
enzymes and serve as a site for cellular respiration. found in high concentrations in chloroplasts of plant
Chloroplast is double membrane bound organelle in cells. Chlorophyll is vital for photosynthesis, which
which the inner membrane surrounds the alkaline allows plants to absorb energy from light. Chlorophyll
stroma and thylakoid system. Lysosomes are bound by molecules are specifically arranged in and around
a single layer of typical phospholipids. photosystems that are embedded in the thylakoid
26. Large clusters of 10 to 100 ribosomes, actively membranes of chloroplasts. The inner membrane of the
translating protein synthesis are called polysomes. The mitochondria folds inwards, forming the cristae. These
ribosomes in a polysome are connected by a single folds allow a much greater amount of electron
molecule of mRNA that is being translated transport chain enzymes and ATP synthase to be
simultaneously by many closely spaced ribosomes. packed into the mitochondrion. Ribozymes
Polymers are large molecules composed of many (ribonucleic acid enzymes), also termed RNA
monomer units. Polypeptide is a large linear polymer molecules are capable of catalyzing specific
biochemical reactions, similar to the action of protein 50. Mitochondria

enzymes. RNA can be both genetic material (like 51. Cytoplasm
DNA) and a biological catalyst like protein enzymes. 52. Proteins embedded in a phospholipid bilayer
37. Vacuoles are the organelles that store all the extra 53. Connection between adjacent cells
water and salts that are the basis of creating osmotic 54. Light-independent reaction enzymes
pressure in the cell. The vacuole takes up a huge 55. Calcium pectate
central place in the cell. The solution outside the cell is 56. Cellulose microfibrils
hypertonic, hypotonic, or isotonic with respect to the 57. Glyoxysomes
contents inside the vacuole. Plastids are the centers for 58. Several ribosomes attached to a single mRNA
photosynthesis. Ribosomes are small granule-like 59. Is membrane-bound and contains water and excretory
structures that help in protein synthesis whereas substances
mitochondria generate energy for the cell by utilizing 60. Pseudomonas and Xanthomonas are bacteria. Bacterial
sugars. cell walls are made of peptidoglycan. Saccharomyces
38. The primary types of fibers comprising the cerevisiae is a fungus Fungal cell walls are mainly
cytoskeleton are microfilaments, microtubules, and made of chitin. Based on elimination, and since it is
intermediate filaments. Microfilaments are fine, unlikely to know what kind of organism Pythium is,
thread-like protein fibers, 3-6 nm in diameter. They are you can conclude that Pythium is the right answer. In
composed predominantly of a contractile protein called reality, Pythium is a kind of fungus that does not have
actin. Microtubules are cylindrical tubes, 20-25 nm in Chitin, but cellulose as a major cell wall component.
diameter. They are composed of subunits of the protein 61. While lipids can rarely flip-flop proteins cannot
tubulin. Intermediate filaments are about 10 nm 62. Submicroscopic molecular level
diameter and provide tensile strength for the cell. 63. Proline
Lamin is the protein present in intermediate filaments. 64. Both chloroplasts and mitochondria have an internal
39. The rough endoplasmic reticulum is found around the compartment, the thylakoid space bounded by the
Golgi apparatus and is involved in protein synthesis. thylakoid membrane
40. The Golgi complex is involved in post-translational 65. Ciliated epithelium
modification of proteins and glycosidation of lipid and 66. Certain types of bacteria
protein for the formation of glycolipid and 67. The enzymes of the electron transfer chain are
glycoprotein, respectively. embedded in the outer membrane
41. SER is the major site for lipid synthesis. Smooth 68. The resolution power of the electron microscope is
endoplasmic reticulum (SER) lacks ribosomes and much higher than that of the light microscope
functions in lipid metabolism and biosynthesis, 69. The organized beating of cilia is controlled by fluxes
carbohydrate metabolism, etc., and is especially of Ca2+ across the membrane
abundant in mammalian liver and gonad cells. 70. On ribosomes presents in cytoplasm as well as in
42. Thylakoids from granum in chloroplast. (NCERT-XI mitochondria
pg.136) 71. Movement of chromosomes towards poles
43. Ribosome is known as organelle within organelle 72. Proteins can also undergo flip-flop movements in the
because it is present in mitochondria & chloroplast also lipid bilayer
44. Golgi apparatus 73. Endoplasmic Reticulum
45. Ribosomes 74. Grana
46. Plasma membrane 75. Microtubular organization and type of movement
47. Escheria coli 76. Mitochondria and chloroplasts
48. Plasmodesmata 77. Thylakoids
49. Streptococcus
BIOMOLECULES 171
BIOMOLECULES (SOLUTIONS)
1. Starch forms helical secondary structures, thus, it can functions in host organisms are not known yet.
hold I2 molecules in the helical portion. The starch-I2 is However, many of them are useful to human welfare.
blue in colour. Cellulose on the other hand, does not 9. Proteins are polypeptides. They are linear chains of
contain complex helices and hence cannot hold I2 . amino acids linked by peptide bonds. Fatty acids could
2. Succinic dehydrogenase be saturated (without double bonds) or unsaturated
3. Both Statement I and Statement II are true. (with one or more C=C double bonds). In a
4. Statement I: A protein is imagined as a line, the left polysaccharide, the individual monosaccharides are
end represented by first amino acid (N-terminal) and linked by a glycosidic bond. In a nucleic acid, a
the right end represented by last amino acid (C- phosphate moiety links the 3’- carbon of one sugar of
terminal). one nucleotide to the 5’-carbon of the sugar of the
5. Some lipids have phosphorus and a phosphorylated succeeding nucleotide. The bond between the
organic compound in them. These are phospholipids. phosphate and hydroxyl group of sugar is an ester
Example - Lecithin found in cell membranes is bond. As there is one such ester bond on either side, it
phospholipid and not glycolipid. is called the phosphodiester bond. This bond is also
-Fatty acids could be saturated (without double bond) formed by dehydration. This bond is formed between
or unsaturated (with one or more C=C double bonds). two carbon atoms of two adjacent monosaccharides.
-Oils have a lower melting point (e.g., gingelly oil) and 10. Ricin is a secondary metabolite that is a toxin obtained
hence remain as oil in winters. So, this statement is from the Ricinus plant. Vinblastin and curcumin are
correct. drugs. Morphine and codeine are alkaloids. Abrin is
-Lipids are all insoluble in polar solvents like water but also a toxin obtained by the plant Abrus. Concanavalin
highly soluble in the non-polar or weakly polar organic A is a lectin.
solvents, including ether, chloroform, benzene, and 11. The correct option is (a) because lipids having only
acetone. This is the correct statement. single bonds are called saturated fatty acids and lipids
-Many lipids have both glycerol and fatty acids. Here having one or more C = C double bonds are called
the fatty acids are found esterified with glycerol. They unsaturated fatty acids. Palmitic acid has 16 carbon
can then be monoglycerides, diglycerides and atoms including carboxyl carbon. Arachidonic acid has
triglycerides. This statement is also correct. 20 carbon atoms including carboxyl carbon. Lecithin is
6. In a dehydration reaction, two molecules of the sugar a phospholipid found in the cell membrane. Glycerol
glucose (monomers) combine to form a single has 3 carbons, each bearing a hydroxyl (–OH) group.
molecule of the sugar maltose. Two glucose molecules 12. Secondary plant metabolites are several chemical
should combine to form a disaccharide C12H24O12 . compounds produced by the plant cell through
However, due to dehydration, one H2O molecule is metabolic pathways obtained from the primary
eliminated and the final product is C12H22O11 . metabolic pathways. Primary metabolites include small
molecules such as sugars, amino acids, tricarboxylic
acids, or Krebs cycle intermediates, proteins, nucleic
acids and polysaccharides. Many secondary
metabolites are toxic or repellant to herbivores and
microbes and help to defend plants producing them.
7. Glycogen is the storage carbohydrate of animals. Secondary metabolism includes a large number of
Globulins are involved in defense mechanisms of the specialized compounds that do not aid in the growth
body. An antibody, also known as an immunoglobulin. and development of plants but are required for the
Steroids are lipids as they are hydrophobic and plant to survive in its environment.
insoluble in water. Many hormones in the human body 13. Collagen is the most abundant protein in the animal
are steroids. For example: Progesterone, Testosterone world and Ribulose bisphosphate Carboxylase-
stc. Thrombin is an enzyme in coagulation cascade, Oxygenase (RUBisCO) is the most abundant protein in
which converts inactive fibrinogens of the plasma into the whole of the biosphere. Lectins are carbohydrate-
fibrins. binding proteins. Insulin is the hormone that helps in
8. Amino acids and glucose are included under the controlling the level of sugar(glucose) in the blood.
category of primary metabolites as they have Haemoglobin is the iron bound protein molecule
identifiable functions and play known roles in normal (pigment) in the blood that helps to transport oxygen.
physiological processes. Rubber, gums, morphine, 14. Inulin is a polysaccharide containing glycosidic bonds,
codeine, vinblastin, and curcumin are included under insulin is a protein which is composed of two peptide
the category of secondary metabolites as their role or chains and contains peptide bonds.
BIOMOLECULES 172
15. Malonate resembles succinate in structure. Succinate is while a fatty acid consists of a long hydrocarbon chain
the substrate of the enzyme succinate dehydrogenase. attached to a carboxyl group.
Hence malonate acts as a competitive inhibitor of this 26. Glycine is an amino acid with the chemical formula of
enzyme. Collagen is a protein, and hence contains NH2‐CH2‐COOH. It is not a sulfur-containing amino
peptide bonds. Cell wall of fungi is made of chitin. acid. Sucrose is a disaccharide formed by the
Ricin, a toxin, is a secondary metabolite. glycosidic linkage between glucose and fructose.
16. Lysine is the basic amino acid. Valine is neutral amino Cellulose is a polysaccharide. It is formed by the
acid. Tyrosine is an aromatic amino acid. Glutamic linkage of beta 1,4 linkage of the glucose unit. It is an
acid is acidic amino acid. important component of the cell wall of the plant. The
17. Concanavalin A is a secondary metabolite, a type of nitrogenous bases are purines and pyrimidines. The
lectin. It has the property to agglutinate RBCs. purines are adenine and guanine. The pyrimidines are
18. "Coenzymes, metal ions and prosthetic groups that are thymine and cytosine. In RNA, the thymine is replaced
bound to enzyme protein are called cofactor. by uracil.
Prosthetic groups are tightly bound to enzymes 27. In nucleic acids, the phosphate group at the 5′ position
whereas metal ions and coenzymes are not tightly of the sugar molecule is joined to the sugar molecule of
bound to enzymes." Active catalytic enzyme with its the next nucleotide at 3′ position by a phosphodiester
bound prosthetic group is called holoenzyme. bond.
19. Sugar is a common term used to denote carbohydrates. 28. Non-reducing sugars do not have an OH group
Carbohydrates are polyhydroxy aldehydes/ketones or attached to the anomeric carbon, so they cannot reduce
their derivatives, which means they have carbonyl and other compounds. Sucrose is a non-reducing
hydroxyl groups. carbohydrate whereas lactose, ribose-5-phosphate and
20. Holoenzyme is the active form of the enzyme. It is maltose are reducing carbohydrates. Sucrose does not
made of 2 components called the apoenzyme and contain a hemiacetal group or a hemiketal group and,
coenzyme. A cofactor can also be called as a coenzyme therefore, is stable in water.
if it is an organic molecule. The apoprotein itself is 29. Substrate binds with enzyme at its active site. A non
inactive. On binding with the cofactor, it gets activated competitive inhibitor binds the enzyme at a site distinct
resulting in the formation of a holoenzyme that is from the active site, the site which binds the substrate.
functional. Hence, it does not have any effect on the substrate
21. Nucleic acids are polymers of nucleotides. Proteins are concentration. This type of inhibition cannot be
polymers of amino acids. Polysaccharides are reversed by addition of more substrate. A competitive
polymers of monosaccharides and lipids are the esters inhibitor binds to the enzyme at the active site, the site
of fatty acids and alcohol. These are not polymeric. which binds the substrate. This type of inhibition can
22. Any chemical reaction includes formation of a be reversed by addition of more substrate. For
transition state between the reactant and product. example, malonate is a competitive inhibitor of
Formation of the transition state requires high energy succinic dehydrogenase. Succinate and malonate both
content of reactant molecules, formation of transient bind to the same active site of the enzyme succinic
unstable charges, rearrangements of chemical bonds dehydrogenase. Addition of a lot of succinate reverses
etc. The energy required for formation of transition inhibition of succinic dehydrogenase by malonate.
state is termed as activation energy. Enzymes enhance 30. Coenzymes are enzymes loosely attached to an organic
the rate of reaction by lowering the activation energy molecule. These organic molecules are generally
of the transition state. In a given graph, the energy of derivatives of vitamins.
substrate is higher than that of a product reflecting the 31. Chitin is a polymer of N-acetyl galactosamine and
exothermic nature of reaction. And B is the activation hence is a nitrogen-containing polysaccharide.
energy in absence of enzyme which is lowered down to 32. A phosphoglyceride molecule consists of a saturated or
A in presence of enzyme. unsaturated fatty acid esterified to a glycerol molecule
23. Hydrophobic interactions, H bonds, and electrostatic to which a phosphate group is also attached.
interactions are the weak ones and stabilize the tertiary
structure of proteins while ester bonds are covalent
bonds and are least likely to be involved in stabilizing
the three dimensional folding of most proteins.
24. Ribozymes are RNA molecules that have the ability to
catalyze specific biochemical reactions, including
RNA splicing in gene expression, similar to the action
of protein enzymes. Hence, a ribozyme is a non-
proteinaceous enzyme.
25. A fat molecule consists of two parts: one glycerol
backbone and three fatty acid tails. Glycerol is a small 33. The transition state structure of the substrate formed
organic molecule with three hydroxyl (OH) groups, during an enzymatic reaction is transient and unstable.
BIOMOLECULES 173
Transition state is the state of an activated complex 39. (2) and (4)
which is highly unstable and readily changes into the 40. Coenzyme
product. 41. Glycine
34. Lecithin is phosphoglycerid present in plasma 42. Competitive inhibition is seen when the substrate and
membrane. (NCERT-XI pg 144) the inhibitor compete for the active site on the enzyme
35. Zinc is cofactor required for activity of enzyme 43. Help in regulating metabolism
carboxypeptidase. 44. The Km value
36. x-axis- temperature; y-axis- enzyme activity 45. Some bacteria, algae and green plant cells
37. A : Lecithin-a component of cell membrane
38. Malonate
CELL CYCLE AND CELL DIVISION (SOLUTIONS)

1. Anaphase II begins with the simultaneous splitting of separate, and the two chromatids of each chromosome
the centromere of each chromosome (which was move to opposite poles on the spindle. The separated
holding the sister chromatids together), allowing them chromatids are now called chromosomes in their own
to move toward opposite poles of the cell by right.
shortening of microtubules attached to kinetochores. 12. S or synthesis phase marks the period during which
2. During pachytene, the four chromatids of each bivalent DNA synthesis or replication takes place. During this
chromosomes becomes distinct and clearly appears as time the amount of DNA per cell doubles. During the
tetrads. This stage is characterised by the appearance G2 phase, proteins are synthesized in preparation for
of recombination nodules, the sites at which crossing mitosis while cell growth continues. These cells that do
over occurs between non-sister chromatids of the not divide further exit the G1 phase to enter an inactive
homologous chromosomes. stage called the quiescent stage (G0 ) of the cell cycle.
3. G1 phase G1 phase corresponds to the interval between mitosis
4. and initiation of DNA replication. During the G1 phase,
List I List Ii the cell is metabolically active and continuously grows
A. M Phase IV. Equational division but does not replicate its DNA.
B. G2 Phase I. Proteins are synthesized 13. In animal cells, during the S phase, DNA replication
C. Quiescent II. Inactive phase begins in the nucleus, and the centriole duplicates in
stage the cytoplasm. In the G2 phase there is duplication of
D. G1 Phase III. Interval between mitosis mitochondria, chloroplast, and Golgi bodies. Tubulin
and initiation of DNA protein is also synthesized during this phase. During
replication prophase, condensation of chromatin starts. During
metaphase, chromosomes get aligned at the equator to
5. Statement I: During G0 phase of cell cycle, the cell form a metaphasic plate.
remain metabolically active but no longer proliferate 14. S or synthesis phase marks the period during which
unless called on to do so depending on the requirement DNA synthesis or replication takes place. During this
of the organism. time the amount of DNA per cell doubles. If the initial
6. A. Tetrad formation is seen during Zygotene. amount of DNA is denoted as 2C then it increases to
C. Crossing over takes place during Pachytene. 4C. However, there is no increase in the chromosome
E. Crossing over takes place between non - sister number; if the cell had diploid or 2n number of
chromatids of homologous chromosome. chromosomes at G1 , even after the S phase the number
7. In mitosis, homologous chromosomes do not pair of chromosomes remains the same, i.e., 2n. Therefore,
together. They line up end-to-end so that when they the correct option is c.
divide, each daughter cell receives a sister chromatid 15. In meiosis, I, chiasmata (X-shaped structure) is formed
from both members of the homologous pair. in the diplotene stage while it terminalizes in the
8. In the pachytene stage of prophase I, the non-sister diakinesis stage. Bivalents are formed in the zygotene
chromatids of the homologous chromosomes cross- stage and crossing over takes place in the pachytene
over and exchange of genetic material takes place. stage. Compaction of chromosomal material occurs in
Recombination nodules are the sites at which the non- the leptotene stage.
sister chromatids cross-over. 16. Some cells in the adult animals do not appear to exhibit
9. In mitosis, the metaphase is characterised by all the division (e.g., heart cells) and many other cells divide
chromosomes coming to lie at the equator with one only occasionally, as needed to replace cells that have
chromatid of each chromosome connected by its been lost because of injury or cell death. These cells
kinetochore to spindle fibres from one pole and its that do not divide further exit G1 phase to enter an
sister chromatid connected by its kinetochore to inactive stage called quiescent stage (G0 ) of the cell
spindle fibres from the opposite pole. cycle. Cells in this stage remain metabolically active
10. In meiosis, a cell undergoes two divisions, i.e. meiosis but no longer proliferate unless called on to do so
I and II. Meiosis I is reduction division and meiosis II depending on the requirement of the organism.
is equational division (similar to mitosis). However, 17. Dissolution of the synaptonemal complex occurs at the
DNA replicates only once during meiosis, i.e. before diplotene phase of prophase I in meiosis. It occurs after
meiosis I in S phase. the completion of crossing over which takes place in
11. In anaphase II, the centromeres separate, and the sister the pachytene stage.
chromatids—now individual chromosomes—move 18. G1 phase is a metabolically active stage of the cell
toward the opposite poles of the cell. The centromeres cycle. Different types of amino acid, RNA and protein
synthesis take place in the G1 phase but DNA opposite poles of the spindle attach to the pair of
replication does not take place. homologous chromosomes.
(Note:- DNA replication occur in S phase). Diakinesis -Final stage of prophase -I marked by
19. The correct sequence of phases of cell cycle is terminalisation of chiasmata. Chromosomes are fully
G1 → S → G2 → M condensed and the -meiotic spindle is assembled to
prepare the homologous chromosome for seperation.
Anaphase I- The homologous chromosomes separate,
while sister chromatids remain associated at their
centromeres.
a) - iii) , b) - iv), c) - ii), d) - i)
26. The cell cycle is a four-stage process in which the cell
increases in size (gap 1 stage or G1 phase), copies its
DNA (synthesis or S phase), prepares to divide (gap 2
stage or G2 phase), and divides (mitosis or M phase).
The stages G1 , S, and G2 make up interphase, which
accounts for the span between cell divisions.
20. Cells in G0 phase are said to exit cell cycle. These are
at the quiescent stage where they are metabolically
active but do not proliferate unless called upon to do
so. Some cells in animals do not show cell division
(e.g. nerve cells), and some cells divide occasionally to
replace the damaged/injured cells. These cells do not
divide further and exit the G1 phase of cell cycle and
enter into an inactive stage called G0 phase.
21. Synaptonemal complex disintegrates and
terminalisation begins during the diplotene stage, i.e. 27. After the division of the nucleus, the division of
chiasmata start to shift towards the end. cytoplasm takes place which is known as cytokinesis.
22. Anaphase Promoting Complex (APC) is a protein This involves the formation of a cell plate to divide
necessary for the separation of daughter chromosomes two daughter nuclei. If the cytoplasmic division is not
during anaphase. If APC is defective then the proper and there is no formation of a cell wall then two
chromosomes will fail to segregate during anaphase. daughter nuclei cannot be separated and it will result in
23. The correct sequence of events during mitosis would the formation of a single cell with double genetic
be as follows: material. This condition is known as polyploidy.
(i) Condensation of DNA so that chromosomes 28. Synapsis, as it's a pairing of the homologous
become visible occurs during early to mid-prophase. chromosomes. It occurs during the zygotene stage of
(ii) Nuclear membrane disassembly begins at late the meiosis. The homologous chromosomes come
prophase or transition to metaphase. closer leading to cross-over in the stage called
(iii) Arrangement of chromosomes at the equator pachytene. These features are hereby not observed
occurs during metaphase, called congression. during mitosis.
(iv) Centromere division or splitting occurs during 29. The pachytene stage is characterized by the formation
anaphase forming daughter chromosomes. of recombination nodules which allows the exchange
(v) Segregation also occurs during anaphase as of genetic material between non-sister chromatids of
daughter chromosomes separate and move to opposite homologous chromosomes by a process known as
poles. crossing over. This also helps in the generation of
(vi) Telophase leads to the formation of two daughter recombinants.
nuclei. 30. In prophase of mitosis, specialized regions on
24. Stalled forks activate checkpoint signaling and pause centromeres called kinetochores attach chromosomes
replication. Since, G1/S checkpoint checks DNA to spindle fibers. The centromere is the part of a
damage, cells size prior to S-phase (i.e. DNA chromosome that links sister chromatids. During
replication phase). This checkpoint would be activated mitosis, spindle fibers attach to the chromosomes via
by a stalled DNA replication fork. the kinetochore. Kinetochores generate kinetochore
25. Pachytene -The third stage of prophase I, bivalent fibers, which attach sister chromatids to spindle fibers.
chromosomes clearly appears as tetrads, crossing over Kinetochore fibers and spindle polar fibers work
between homologous chromosomes occur. together to manipulate and separate chromosomes
Metaphase I -The bivalent chromosomes align on the during mitosis and meiosis.
equatorial plate of spindle. The microtubes from the 31. During zygotene stage of meiosis, chromosomes start
pairing together and this process of association is
called synapsis. Crossing over occurs at pachytene 35. The given figure is an illustration of the telophase
stage. Diakinesis is marked by terminalisation of stage, wherein the nuclear envelope and Golgi complex
chiasmata. By the end of diakinesis, the nucleolus reformation is taking place.
disappears and the nuclear envelope also breaks down. 36. The complex formed by a pair of synapsed
32. In the G1 phase, the initial amount of DNA was 2C. In homologous chromosomes is known as a bivalent. The
the S phase, DNA replicates and the amount of DNA homologous chromosomes start pairing in the zygotene
doubles. So the amount of DNA becomes 4C. In the G 2 subphase of prophase I (meiosis I), and this process of
phase, there will be no change in the amount of DNA, association is called synapsis. Complex formed by a
so it remains 4C. In M phase, cell division occurs. pair of synapsed homologous chromosomes is called
Before dividing into two daughter cells, the amount of bivalent or tetrad.
DNA was 4C. After cytokinesis, each daughter cell 37. Separation of homologous chromosome occur in
will have 2C amount of DNA. Thus, in the S phase, 2C anaphase I of meiosis I. (NCERT-XI pg. 169)
becomes 4C and at the end of the M phase, 4C 38. Chromosomes move to the spindle equator and get
becomes 2C. Hence, the amount of DNA remains at aligned along equatorial plate in metaphase
4C during G2 . 39. Late prophase
33. During pachytene, crossing over occurs which is an 40. Late Anaphase - Prophase
enzyme-mediated process that requires the enzyme 41. Two homolog chromosomes
recombinase. Recombination nodules are formed 42. D-Synthetic phase
during the pachytene stage of meiosis which helps to 43. Secondary spermatocytes
exchange the genetic segments between two non-sister 44. During S-phase
chromatids. Recombinase enzymes play a prominent 45. Formation of the contractile ring and formation of the
role in the formation of recombination nodules. phragmoplast
34. Interphase of the cell cycle involves G1 , S and G2 46. Non-sister chromatids of a bivalent
phases. S or synthesis phase marks the period during 47. DNA replication takes place in S-phase
which DNA synthesis or replication takes place. 48. Metaphase
Hence, the amount of DNA doubles in each cell during
the S phase of the cell cycle.
PHOTOSYNTHESIS IN HIGHER PLANTS (SOLUTIONS)

1. For every CO2 molecule entering the Calvin cycle, 3 10. In non-cyclic photophosphorylation, plastoquinone
molecules of ATP and 2 of NADPH are required. To obtains electrons from PS-II and transfers them to cyt
make one molecule of glucose 6 turns of the cycle are b6 -f complex.
required. Thus, 18 ATP and 12 NADPH2 are required 11. Photorespiration is the light-dependent process in
for the synthesis of one molecule of glucose during which RuBisCO enzymes perform oxygenation instead
Calvin cycle. of fixing carbon dioxide (C3 cycle) and oxidizes
2. 680 nm ribulose 1, 5-bisphosphate to produce a 3-carbon
3. Manganese phosphoglyceric acid and a 2-carbon
4. A and D only phosphoglycolate. Hence, the (d) option is correct.
5. Chemiosmotic hypothesis explains the mechanism of 12. ATP, NADPH, and oxygen are products of light
ATP synthesis in the thylakoids of chloroplast. In reaction, while NADH is a product of the respiration
photosynthesis, the synthesis of ATP is linked to the process. NADPH is produced at PS-I, ATP is formed
development of a proton gradient across the cell by ATPase, and oxygen is released at PS-II.
membrane. No electron gradient is formed during 13. Green sulphur bacteria do not use H2O as the source of
generation of ATP electrons - they use H2 , H2S, and S instead. Therefore,
6. PEP is the 3C compound and acts as the primary CO2 they do not evolve O2 . This type of photosynthesis is
acceptor in the mesophyll cells of C4 plants, leading to known as anoxygenic photosynthesis.
the formation of OAA, a C4 acid. 14. PEP (Phosphoenolpyruvate) is a 3C compound that
Ribulose-1,5-bisphosphate carboxylase (RUBISCO) is serves as the primary CO2 acceptor in the mesophyll
an enzyme found in the mesophyll cells present within cell of C4 plants like maize, sugarcane, sorghum, etc.
the C3 plants. In C4 plants, this enzyme is found in the In C3 plants ribulose biphosphate acts as a primary
bundle sheath cells. acceptor and gets converted into phosphoglycerate
7. The particularly large cells around the vascular bundles (PGA).
of the C4 plants are called bundle sheath cells, and the 15. In C3 plants, photosynthesis is decreased at higher
leaves which have such anatomy are said to have temperatures due to increased photorespiration. As a
‘Kranz’ anatomy. In C4 plants the bundle sheath cells result, RuBisCO binds to oxygen instead of carbon
may form several layers around the vascular bundles; dioxide. That's why C3 plants have a much lower
they are characterised by having a large number of temperature optimum as compared to C4 plants.
chloroplasts, thick walls impervious to gaseous C4 plants have a higher temperature optimum because
exchange and no intercellular spaces. So, bundle of the presence of pyruvate phosphate dikinase
sheath cells found around the vascular bundles of C4 enzyme, which is sensitive to lower temperatures.
plants increase the number of chloroplasts for the Hence, it shows a higher rate of photosynthesis at
operation of the Calvin cycle. higher temperatures.
8. Most of the plants that are adapted to dry tropical 16. Phytochromes are light-sensitive chromoproteins (a
regions have the C4 pathway. These plants are called type of photoreceptor) in plants, bacteria, and fungi
C4 plants. Sugarcane, maize, sorghum, etc. are which are used to detect light. They are sensitive to
examples of these plants. In C4 pathway, the primary light in the red and far-red region of the visible
CO2 acceptor is 3 carbon compound, phosphoenol spectrum and can be classified as either Type I, which
pyruvate (PEP) which is present in mesophyll cells. is activated by far-red light, or Type II which is
PEP combines with CO2 to form 4 carbon compounds activated by red light. They are responsible for
i.e., oxaloacetic acid (OAA) in the presence of enzyme photoperiodism in plants.
PEP carboxylase. Hence, the first stable product of 17. Photorespiration is a respiratory process in many
CO2 fixation in sorghum is oxaloacetic acid. higher plants by which they take up oxygen in the light
9. When the two photosystems work in a series, first PS and give out some carbon dioxide, contrary to the
II and then PS I, a process called non-cyclic general pattern of photosynthesis. In this process,
photophosphorylation occurs. The two photosystems RuBisCO binds to oxygen, and RuBP is converted to
are connected through an electron transport chain, as produce one molecule of phosphoglycerate and one
seen earlier – in the Z scheme. Both ATP and molecule of phosphoglycolate. Neither sugar nor ATP
NADPH+ and H+ are synthesized by this kind of is synthesized in this pathway. It rather utilizes one
electron flow. When only PS I is functional, the ATP for the removal of carbon dioxide. Therefore, it is
electron is circulated within the photosystem and the a wasteful process.
phosphorylation occurs due to the cyclic flow of Photorespiration is present in C3 but absent in C4
electrons is called cyclic photophosphorylation. plants.
C4 plants have a mechanism to increase the decrease in quantum yield at wavelengths greater than
intracellular concentration of carbon dioxide at the 680nm. This decrease in quantum yield takes place in
enzyme site. Hence, this ensures more carbon fixation the red part of the spectrum. The number of oxygen
and minimizes the oxygenase activity. molecules released per light quanta absorbed is called
18. When a plant is transpiring, its stomata are open, the quantum yield of photosynthesis. This effect was
allowing gas exchange between the atmosphere and the first of all noticed by Robert Emerson.
leaf. Open stomata allow water vapor to leave the leaf 22. The inside of the thylakoid membrane is called the
but also allow carbon dioxide (CO2 ) to enter. Carbon lumen. The light-independent reactions take place
dioxide needed for photosynthesis to operate. Much outside the thylakoid membrane called the stroma. The
more water leaves the leaf than CO2 enters for three light-independent reactions are also known as dark
reasons: is reactions in which carbon dioxide is utilized for the
1. H2O molecules are smaller than CO2 molecules and synthesis of sugar. These reactions are not light-driven
so they move to their destination faster. but dependent upon products of the light reactions
2. CO2 is only about 0.036% of the atmosphere so the (ATP and NADPH).
gradient for its entry into the plant is much smaller 23. Photolysis of water takes place in the presence of
than the gradient for H2O moving from a hydrated leaf manganese, calcium and chlorine ions.
into a dry atmosphere. 24. Anoxygenic photosynthesis is the phototrophic
3. CO2 has a much longer distance to travel to reach its process, where cellular energy i.e., ATP is produced
destination in the chloroplast from the atmosphere without producing oxygen. Water is therefore not used
compared to H2O which only has to move from the leaf as an electron donor. There are several groups of
cell surface to the atmosphere. bacteria, that undergo anoxygenic photosynthesis such
19. This plant is a C4 plant. C4 plants are special as they as green sulfur bacteria, green and red filamentous
have a special type of leaf anatomy called Kranz anoxygenic phototrophs (FAPs), phototrophic purple
anatomy. They can tolerate higher temperatures, they bacteria, Rhodospirillum because they do not produce
show a response to high intensities of light, they lack a oxygen as a by- product of photosynthesis. This
wasteful process called photorespiration and they have bacterium is used in nitrogen fixation.
improved efficiency of nitrogen utilization. Most of the 25. Conserving water
plants that are adapted to dry tropical regions have the 26. Algae
C4 pathway and are known as C4 plants. In these 27. Lower rate of photorespiration
plants, double fixation of carbon dioxide occurs. 28. Oscillatoria
20. The thylakoid lumen is a continuous aqueous phase, 29. ATP
enclosed by the thylakoid membrane. It plays an 30. Mesophyll cells
important role for photophosphorylation during 31. A proton gradient forms across the inner membrane
photosynthesis. During the light-dependent reaction, 32. They have more chloroplasts
protons are pumped across the thylakoid membrane 33. Quinone
into the lumen making it acidic down to pH 4. The 34. Quinone
ATP synthase complex transports protons across the 35. Succinate dehydrogenase
thylakoid from lumen to stroma. These protons flow 36. 640 nm
down an electrochemical gradient and the energy 37. Mesophyll
released by that flow is trapped on the stroma side of 38. An iron sulphur protein
the thylakoid membrane by ATP synthesis. 39. Stroma of chloroplasts and peroxisomes
21. The Emerson effect is the increase in the rate of 40. In C4 plants, fixation of one carbon dioxide requires 5
photosynthesis after chloroplasts are exposed to light ATP and 3 NADPH when compared to 3 ATP and 2
of wavelength 670 nm (red light) and 700 nm (far red NADPH in C3 plants.In both plants, Calvin cycle needs
light). When simultaneously exposed to light of both to make a total of 6 turns to produce a glucose
wavelengths, the rate of photosynthesis is far higher molecule. Hence, C4 plants need 12 ATP's more than
than the sum of the red light and far red light C3 plants to synthesize an hexose molecule.
photosynthesis rates. Wavelengths beyond 700nm are 41. Effective pumping of CO2 into bundle sheath cells
apparently of insufficient energy to drive any part of 42. 400-700 nm
photosynthesis. So a rates. Wavelengths beyond 43. 3-phosphoglyceric acid
700nm are apparently of insufficient energy to drive 44. 400-700 nm
any part of photosynthesis. So a words there is a sharp
RESPIRATION IN PLANTS (SOLUTIONS)

1. Both A and R are true, and R is the correct explanation
of A.
2. Less than seven percent of the energy in glucose is
released in fermentation and moreover not all of it is
stored as ATP.
3. Each glucose molecule generates two molecules of
pyruvate. When a glucose molecule is partially
oxidised to form two molecules of pyruvate, 4
molecules of ATP are produced. Out of this, two ATPs
are utilised in the preparatory phase of glycolysis
therefore there is a net gain of two ATP molecules.
4. In ETC, oxidation of one molecule of NADH gives rise
to 3 molecules of ATP, while that of one molecule of
FADH2 produces 2 molecules of ATP. Carbohydrates, fats and proteins, all get converted to
5. During Krebs' or citric acid cycle, succinyl-CoA is acetyl Co-A to enter into Krebs cycle of aerobic
acted upon by enzyme succinyl-CoA synthetase to cellular respiration. Thus, it is the common factor of
form succinate (a 4C compound). The reaction releases respiration entering Krebs cycle after breakdown of
sufficient energy to form ATP (in plants) or GTP (in carbohydrates, fats and proteins.
animals) by substrate-level phosphorylation. GTP can 13. Oxidative phosphorylation refers to the synthesis of
then be used to form ATP ATP by ADP and Pi . This reaction is driven by the
6. Hexokinase catalyzes the conversion of glucose to energy released from the oxidation of reducing factors
glucose-6 phosphate. It is the first step of the activation like NADH and FADH2 by transfer of their electrons
phase of glycolysis. In this step, phosphate group is through the electron transport chain to oxygen.
added to the glucose which is provided by ATP. Electron transport chain is present in the inner
7. In mitochondria, enzymes for electron transport are mitochondrial membrane and passes the electrons
present in the inner membrane. down a series of carriers and pumps protons into the
8. intermembrane space. Oxygen serves as the final
electron acceptor. The resulting proton gradient serves
as an energy source for the enzyme ATP synthase to
synthesize ATP.
14.
9. All the required enzyme for oxidative phosphorylation

is present on inner mitochondrial membrane hence it
takes place in the inner mitochondrial membrane.
10. In cellular respiration, NAD+ acts as an electron
carrier. NAD+ has two functions- co-enzymes and an
electron carrier, which acts as an electron acceptor in
the process of glycolysis and Krebs’ cycle and
provides this electron in ETC (Electron transport
chain) for the production of ATP's.
11. Krebs’ cycle also known as the citric acid cycle is the
main source of energy for cells. It is also an important
part of aerobic respiration. It takes place in the matrix Carbohydrates, fats and proteins, all get converted to
of the mitochondria. Krebs’ cycle starts with the acetyl Co-A to enter into Krebs cycle of aerobic
condensation of acetyl CoA (2C) with oxaloacetic acid cellular respiration. Thus, it is the common factor of
(4C) to form citric acid (6C). respiration entering Krebs cycle after breakdown of
12. carbohydrates, fats and proteins.
15. Nearly 20-25 percent of CO2 is transported by RBCs
whereas 70 percent of it is carried as bicarbonate to the
lungs. About 7 percent of CO2 is carried in a dissolved
state through plasma.
16. End products of aerobic respiration in animals, level, pathway B is the Krebs cycle wherein ATP is
alcoholic fermentation and aerobic respiration in plants generated at the substrate level and ATP is generated
release CO2 . However, lactate fermentation does not through oxidative phosphorylation in ETS which is
release CO2 . Lactate fermentation is a type of pathway C.
anaerobic respiration in which the respiratory substrate 19. Fermentation
is converted into lactate along with the production of 20. Amphibolic
ATP. It takes place in muscles during strenuous 21. Fermentation
physical work. 22. ATP in small stepwise units
17. Acetyl CoA is the common metabolite to respiration- 23. Fifty-seven
mediated breakdown of fats, carbohydrates and 24. Electron transport chain
proteins. 25. RBCs
18. Arrows 4, 8 and 12 indicate ATP. Pathway A is 26. NAD+
glycolysis, where ATP is generated at the substrate
PLANT GROWTH AND DEVELOPMENT (SOLUTIONS)

1. Gibberellic acid 9. Gibberellins are involved in the natural process of
2. Ethylene breaking dormancy and other aspects of germination.
3. Ethylene is a gaseous phytohormone that regulates Gibberellic acid, one of the gibberellins, stimulates the
both growth, and senescence. cells of germinating seeds to produce mRNA
• It is produced in large amounts by tissues undergoing molecules that code for hydrolytic enzymes.
senescence and ripening fruits. 10. Growth curve consists of three phases i.e. lag phase
• It promotes or inhibits growth and senescence (slow growth), log phase (fast growth) and steady state
processes in the plants. (no growth).
• Ethylene inhibits lateral buds and causes apical 11. Gibberellin hormone causes the plant growth in length
dominance. and elongation of stem. It is able to promote the
• Ethylene promotes femaleness in Pineapple and internode elongation because of which the size of
Cucumber. sugarcane plant increases.
• It increases the number of female flowers in 12. Plant hormone auxin induces flowering in pineapple.
cucumber plants, thereby increasing the final yield. Ethylene also helps in synchronization of flowering
• The hormone also increases the absorption surface and fruit set up in pineapple.
area of the root as it promotes root growth and root 13. Photoperiodism is the phenomenon in which formation
hair formation. of flowers in plants depends on the relative length of
4. Plasticity is the ability of the plant to adjust to a dark or light periods. Photoperiodic stimulus is
particular environment by altering the rate of growth, perceived by the leaf. Flowering plants use
development, and metabolism. For example, phytochrome as a photoreceptor.
heterophylly in cotton, coriander, larkspur and 14. Auxins prevent premature leaf and fruit fall. It
buttercup. Maize does not show plasticity. promotes the abscission of older mature leaves and
5. Ethylene is a simple gaseous plant growth regulator fruits. Hence, the (a) option is correct.
(PGR). It promotes Femaleness (feminising effect) in Whereas cytokinin helps in the delay of leaf
Pineapple (Bromeliaceae) and Cucumber. Application senescence, overcome apical dominance, etc.
of Ethylene increases the number of female flowers in Gibberellin help in seed germination.
cucumber plants, thereby increasing the final yield. Ethylene help in fruit ripening, triple response etc.
Hence, Ethylene can be applied by the farmer to 15. Auxins help to initiate rooting in stem cuttings and
increase the number of female flowers in the cucumber thus promote the growth of stems and roots.
plants. Cytokinins are synthesised in regions where rapid cell
6. 2, 4-D (2, 4-Dichlorophenoxyacetic) is synthetic auxin. division occurs, for example, root apices and
They are widely used to kill dicotyledonous weeds and developing shoot buds. Higher auxin and cytokinin
do not affect mature monocotyledonous plants. It is ratio induces root formation whereas lower ratio
used to prepare weed-free lawns by gardeners. Auxin induces formation of shoots.
also controls xylem differentiation and helps in cell 16. The Avena geo-curvature test is a bioassay for auxin-
division. IAA and IBA are natural auxins. NAA is a type growth regulators. Etiolated oat coleoptiles are
synthetic auxin. used and the test is conducted in special perspex trays
7. Plants follow different pathways in response to the under diffuse daylight. The lowest IAA concentration
environment or phases of life to form different kinds of which can be determined is around 30 to 60 μg/l IAA.
structures. This ability is called plasticity, e.g., The concentration response curves follow a
heterophylly in cotton, coriander, and larkspur. In such logarithmic course up to 1,000 μg/l.
plants, the leaves of the juvenile plant are different in 17. Avena coleoptile curvature is an auxin bioassay
shape from those in mature plants. On the other hand, quantitative test that measures the concentration of
differences in the shapes of leaves produced in air and auxin to produce the effect and its amount.
those produced in water in buttercup also represent the 18. It is the basis for quantitative determination of small
heterophyllous development due to the environment. amounts of growth promoting substances. The Avena
This phenomenon of heterophylly is an example of coleoptile test is a bioassay firstly done by F. W. Went.
plasticity. It is for IAA (indole-3-acetic acid). It measures the
8. The site of perception of light in plants during angle of the curvature of a decapitated coleoptile after
photoperiodism is the leaf. The site of perception of placing an agar block containing auxin on one side. It
low-temperature stimulus during vernalization is shoot is seen that when coleoptile tips are placed on agar,
apex and embryo. Axillary buds are not sites of agar produced bending when placed on one side of
perception of photoperiod. freshly cut coleoptile stumps.
19. Abscisic acid stimulates the closure of stomata in the 25. Auxin
epidermis during water stress conditions and increases 26. Tobacco
the tolerance of plants to various kinds of stresses. 27. NAA
Therefore, it is also called the stress hormone. 28. Abscisic acid
20. The process in which flowering plants are grown in 29. Leaf abscission
partial or complete absence of light characterised by 30. Tobacco
long and weak stems and smaller, sparse pale yellow 31. GA
colour of leaves is called etiolation. Hence, the white 32. Autonomic movement of growth
coloured tomato seedlings are etiolated. 33. Gibberellic acid – Leaf fall
21. Gibberellin functions in breaking seed dormancy by 34. Differential expression of genes
inducing the aleurone cells to secrete enzymes which 35. It frees axillary buds from apical dominance
break stored food in the seed. 36. Application of iron and magnesium to promote
22. Effect of temperature (low temperature) on flowering synthesis of chlorophyll
is vernalization and also relative length of day and 37. Stratification
night affects flowering called as photoperiodism. Both 38. α- amylase
these involves hormone vernalin and florigen. 39. Opening of flower bud
23. Carrot is a biennial plant requires stimuli of low 40. Short day
temperature i.e., vermalization for flowering. 41. Gibberellins
24. ABA is generally antagonistic to Gibberellin 42. Larger photosynthetic unit size than the sun plants
specifically in maintaining seed dormancy while
Gibberellin breaks seed dormancy.
BREATHING AND EXCHANGE OF GASES (SOLUTIONS)

1. Vital Capacity (VC) refers to the maximum volume of
air a person can breathe in after a forced expiration.
This includes ERV, TV and IRV or the maximum
volume of air a person can breathe out after a forced
inspiration.
2. The part starting with the external nostrils up to the
terminal bronchioles constitute the conducting part
whereas the alveoli and their ducts form the respiratory
or exchange part of the respiratory system. The
conducting part transports the atmospheric air to the
alveoli, clears it from foreign particles, humidifies and
also brings the air to body temperature. Exchange part
is the site of actual diffusion of O2 and CO2 between 8. Tidal Volume = 500 ml
blood and atmospheric air. Expiratory Reserve Volume = 1000 ml
3. Every 100 ml of oxygenated blood can deliver around Expiratory Capacity = TV + ERV
5 ml of O2 to the tissues under normal physiological = 500 + 1000
conditions. = 1500 ml
4. Pressure contributed by an individual gas in a mixture 9. Silicosis is due to excess inhalation of silica dust in the
of gases is called partial pressure and is represented as workers involved in grinding or stone breaking
pO2 for oxygen and pCO2 for carbon dioxide. The industries. A long exposure gives rise to inflammation
partial pressures (in mmHg) of oxygen (O2) and carbon leading to fibrosis and thus causing serious lung
dioxide (CO2) at alveoli (the site of diffusion) are 104 damage. Anthrax is a serious infectious disease caused
and 40 respectively. In the atmosphere, pO2 is 159 mm by Bacillus anthracis. It commonly affects domestic
Hg and pCO2 is 0.3 mm Hg. In deoxygenated blood, and wild animals.
pO2 is 40 mmHg and pCO2 is 45 mmHg. In Emphysema is a chronic disorder in which alveolar
oxygenated blood, pO2 is 95 mmHg and pCO2 is 40 walls are damaged due to which respiratory surface is
mmHg. decreased.
5. In the alveoli, where there is high pO2 , low pCO2 , Botulism is a form of food poisoning caused by
lesser H+ concentration, and lower temperature, the Clostridium botulinum.
factors are all favourable for the formation of 10. Tidal volume is the volume of air inspired or expired
oxyhaemoglobin, whereas, in the tissues, where low during normal respiration. It is approximately 500 mL.
pO2 , high pCO2 , high H+ concentration, and higher Inspiratory reserve volume is an additional volume of
temperature exist, the conditions are favourable for air a person can inspire by a forceful inspiration. It is
dissociation of oxygen from the oxyhaemoglobin. around 2500-3000 mL. Expiratory reserve volume is
6. The Oxygen dissociation curve is highly useful in the additional volume of air a person can be exhaled by
studying the effect of factors like pCO2 , H+ a forceful expiration. Its value is 1000 – 1100 mL.
concentration, etc., on binding of O2 with Residual volume is a volume of air remaining in the
haemoglobin. In the alveoli, where there is high pO 2 , lungs even after forceful expiration. Its value is 1100 –
low pCO2 , lesser H+ concentration and lower 1200 mL.
temperature, favour the formation of oxyhaemoglobin. 11. Asthma is an allergy in which difficulty in breathing
In the tissues, where low pO2 , high pCO2 , high H+ causes wheezing due to inflammation of bronchi and
concentration and higher temperature exist, are bronchioles. Emphysema is a chronic disorder in which
favourable conditions for dissociation of oxygen from alveolar walls are damaged due to which respiratory
the oxyhaemoglobin. surface is decreased.
7. Inspiration is initiated by the contraction of diaphragm 12. The volume of air present in the lungs after forceful
which increases the volume of thoracic chamber in expiration is called the residual volume which prevents
antero-posterior axis and contraction of external inter- the collapsing of alveoli even after forceful expiration.
costal muscles which lifts up the ribs and sternum This averages around 1100 mL to 1200 mL.
causing increases in the volume of thoracic chamber in Inspiratory Reserve Volume (IRV) is the extra volume
dorsoventral axis. This increase in thoracic volume of air inspired by a forcible inspiration. Expiratory
causes an increase in pulmonary volume. It decreases Reserve Volume is the additional volume of air, a
the intra-pulmonary pressure to less than atmospheric person can expire by a forcible expiration. The volume
pressure which allows the entry of air from outside to of air inspired or expired during normal respiration is
the lungs i.e., inspiration. called tidal volume.
13. Lungs do not collapse between breaths as some air reduced due to damage in the alveolar walls. It is often
always remains in the lung which can never be caused due to cigarette smoking.
expelled because the negative intrapleural pressure is While asthma is a respiratory disorder in which there is
created by two opposing elastic forces pulling in the difficulty in breathing due to inflammation of the
intrapleural space. The elastic lungs tend to collapse bronchi and bronchioles.
while the elastic chest wall tends to thrust outward. Pleurisy- Inflammation of pleura that lines the lungs
These two opposite forces create a negative and chest cavity.
intrapleural pressure which in turn opposes the natural Pneumonia- Inflammation of one or both lungs due to
tendency of lungs to collapse. infection.
14. Alveoli are the site of gaseous exchange and have the 18. End products of aerobic respiration in animals,
higher partial pressure of oxygen than that of blood. alcoholic fermentation and aerobic respiration in plants
Blood is rich in carbon dioxide at cell and tissue level release CO2 . However, lactate fermentation does not
due to cellular respiration. The higher partial pressure release CO2 . Lactate fermentation is a type of
of oxygen in alveoli allows diffusion of oxygen from anaerobic respiration in which the respiratory substrate
alveoli into the blood. Therefore, the correct answer is is converted into lactate along with the production of
option a. ATP. It takes place in muscles during strenuous
15. Bronchial asthma is due to allergic reactions (release of physical work.
histamine from mast cells) to foreign substances that 19. A – trachea is supported by incomplete cartilaginous
affect respiratory tract. Excess amount of mucus is rings.
secreted on the wall of respiratory tract which may B – pleural membrane, prevents separation of the two
clog bronchi and bronchioles. pleural layers and lubricates the surface, so the lungs
16. Emphysema is a destructive disease of the lung in can move easily within the thoracic cavity.
which the alveoli (small sacs) that promote oxygen D – represents the diaphragm.
exchange between the air and the bloodstream are 20. A : alveolar cavity – main site of exchange of
destroyed. Smoking is the primary cause of respiratory gases
emphysema, which makes it a preventable illness. 21. (d) 3500 mL, (a) 1200 mL
While asthma is a respiratory disorder in which there is 22. Total lung capacity minus residual volume
difficulty in breathing due to inflammation of the 23. Has a higher affinity for oxygen than that of an adult
bronchi and bronchioles. 24. Atmospheric O2 level is less and hence more RBCs are
Respiratory alkalosis- It is characterized by a low level needed to absorb the required amount of O2 to survive
of carbon dioxide in the blood due to breathing 25. The presence of non-respiratory air sacs, increases the
excessively. efficiency of respiration in birds
Respiratory acidosis- It occurs when the body cannot 26. As bicarbonates
remove enough carbon dioxide that the body produces 27. Faster and deeper
and hence, making the body fluid and blood acidic. 28. Carbon monoxide
17. Emphysema is a pulmonary disease in which alveolar
surface area involved in gas exchange is drastically
BODY FLUIDS AND CIRCULATION (SOLUTIONS)

1. So, persons with the 'AB' blood group can accept blood
List I List Ii from persons with AB as well as the other groups of
A. P-wave III. Depolarisation of complex blood due to the lack of antibodies in their blood.
atria Therefore, such persons are called "Universal
B. Q- I. Beginning of systole recipients".
wave 7. Eosinophils release mediators like histaminases during
C. QRS IV. Depolarisation of ventricles type I hypersensitivity or allergic reaction.
D. T-wave II. Repolarisation of ventricles Basophils are granulocytes i.e. they contain large
cytoplasmic granules and store histamine, a vasodilator
2. A. Neutrophils are the most abundant cells (60-65 per and anticoagulant heparin.
cent) of the total WBCs. Neutrophils are phagocytic in nature and are able to
D. Monocytes have kidney-shaped nucleus. engulf foreign substances (like bacteria) Lymphocytes
E. Basophils are granulocytes. have receptors on their surface and they produce
3. Blood clot or coagulum is formed mainly of a network antibodies so responsible for immune response.
of threads called fibrins in which dead and damaged 8. The QRS complex represents the depolarisation of the
formed elements of blood are trapped, so the statement, ventricles, which initiates the ventricular contraction.
coagulum is formed of a network of threads called The contraction starts shortly after Q and marks the
thrombins is incorrect. RBCs have an average life span beginning of ventricular systole.
of 120 days after which they are destroyed in the 9. Cardiac output = stroke volume x Heart rate
spleen, hence the spleen is called the graveyard of ⇒ Cardiac output = 5L or 5000 ml
RBCs. ⇒ Blood volume in ventricles at the end of diastole =
4. The Sino-atrial node generates new action potential. 100 ml
With the decline of ventricular pressure, the tricuspid ⇒ Blood volume in ventricles at the end of systole =
and bicuspid valves are pushed open by the pressure in 50 ml
the atria exerted by the blood which was being emptied Stroke volume = 100 - 50= 50 ml.
into them by the veins. Joint diastole refers to the So,
phase in the cardiac cycle of the heart when both atria 5000 ml = 50 ml x Heart rate
and ventricles are relaxed. During joint diastole, blood So, Heart rate = 100 beats per minute.
is poured into the left and right atria. Due to this filling 10. In ECG P-wave represents repolarization of atria. QRS
of blood, atrioventricular valves (Bicuspid and complex represents repolarization of ventricles. T-
Tricuspid valves) open and allow blood to flow from wave represents repolarization of the ventricle i.e.
atria to ventricles. During ventricular diastole, the return from excited to a normal state. Reduction in the
ventricular pressure falls causing the closure of size of T-wave is due to the reduced blood flow in the
semilunar valves and this prevents the backflow of coronary circulation through the coronary arteries and
blood into the ventricles. causes coronary ischemia.
5. Fibrins are formed by the conversion of inactive 11. Fibrinogen forms fibrin strands during coagulation.
fibrinogens in the plasma by the enzyme thrombin. These strands form a network and the meshes inside
Thrombins, in turn, are formed from another inactive which blood cells are trapped, this structure finally
substance present in the plasma called prothrombin. An forms a clot.
enzyme complex, thrombokinase, is required for the Globulins are globular proteins. Some globulins are
above reaction. This complex is formed by a series of produced in the liver, while others are made by the
linked enzymatic reactions (cascade process) involving immune system. Antibodies are derived from the
a number of factors present in the plasma in an inactive Globulin fraction of plasma proteins which means
state. Epinephrine also known as adrenaline is rapidly globulins are involved in defense mechanisms.
secreted in response to stress of any kind and during Albumin is another plasma protein mainly responsible
emergency situations and is called emergency for maintaining osmotic balance.
hormones or hormones of Fight or Flight. Renin 12. Tricuspid valves are present between the right atrium
enzyme secreted by the kidney (and also, possibly, by and right ventricle. Bicuspid valves are present
the placenta) that is part of a physiological system that between the left atrium and left ventricle. Semilunar
regulates blood pressure. In the blood, renin acts on a valves are present at the openings of the aortic and
protein known as angiotensinogen, resulting in the pulmonary aorta.
release of angiotensin I.
6. Persons with the 'AB' blood group contain antigens 'A'
and 'B' but lack antibodies anti-A and anti-B in plasma.
in oxygen transport and yields enhanced unloading of

oxygen by hemoglobin.
19. During each cardiac cycle, two prominent sounds are
produced which can be easily heard through a
stethoscope. The first heart sound (lub) is associated
with the closure of the tricuspid and bicuspid valves
whereas the second heart sound (dub) is associated
with the closure of the semilunar valves.
20. Person with blood group AB is considered a universal
recipient as he has both A and B antigens on the RBC
13. In human RBCs, the nucleus degenerates during but does not have antibodies against A and B antigen
maturation which provides more space for oxygen- cells.
carrying pigment (Haemoglobin). It lacks most of the 21. In an ECG, the P wave represents the depolarization of
cell organelles including mitochondria so respires both atria which leads to their contraction (atrial
anaerobically and does not show any metabolic activity systole).
and multiplication. Whereas QRS wave represents depolarization of
14. In the hepatic portal system, the hepatic portal vein ventricles which initiates ventricular contraction.
carries the maximum amount of nutrients from the T wave represents repolarisation of ventricles.
intestine to the liver. The hepatic portal vein carries the 22. A – Pulmonary vein takes pure blood from the lungs to
deoxygenated blood from the gastrointestinal tract, the left atria.
gallbladder, pancreas, and spleen to the liver. B – Dorsal aorta takes blood from the heart to parts of
15. Blood is composed of a clear, straw-colored, watery the body.
fluid called plasma in which different types of blood D – Pulmonary artery takes impure blood from the
cells are suspended. The serum is that part of blood heart to the lungs.
that is similar in composition with plasma but does not 23. (NCERT-XIth, Page NO. 279) (Chapter-Body fluids
contain clotting factors of blood. It includes all and circulation formed elements (Erythrocytes)
proteins (except protein involved in blood clotting) and 24. Acts as a reserve during muscular exercise
all the electrolytes, antibodies, antigens, hormones, etc. 25. Carry blood away from the heart to different organs
So, the correct option is b. 26. Heart
16. Thrombocytes are also called platelets. They are the 27. Fibrinogen
vital component of blood. It's basic function is to stop 28. 190/110 mm Hg may harm vital organs like brain and
bleeding from injured blood vessels by clumping and kidney
clotting blood vessels. Reduction in the number of 29. The flow of blood into the pulmonary artery will be
platelets causes clotting disorder and thus loss of blood reduced
from the body. 30. They carry about 20-25 per cent of CO2
Hence, the correct option is c. 31. (b) and (c)
17. The blood pressure in the arteries is greater than that in 32. P-depolarisation of the atria
the veins. Artery > Arteriole > Capillary > Venule > 33. More WBCs and no RBCs
Vein (Vena Cava). The pulmonary artery is a short and 34. Defence mechanisms of body
stout (wide) structure which branches into two parts. 35. Allergy
On the other hand the pulmonary veins are large blood 36. Mature RBCs
vessels. Hence, the pressure of blood is greater in the 37. Thymus
pulmonary artery as compared to that in the pulmonary 38. Basophils
vein. 39. Neutrophils and monocytes
18. A lower pH in the blood increases carbon dioxide 40. Pressure difference between the post caval and atrium
concentration which in turn, is suggestive of a more 41. Red blood cells
active tissue that requires more oxygen. According to 42. Blood serum
Bohr, the lower pH will cause hemoglobin to deliver 43. Folic acid and cobalamine
more oxygen. This manifests as a right-ward shift in 44. Thromboplastin
the Oxygen-Hemoglobin Dissociation Curve described 45. Test tube containing calcium bicarbonate
46. Sinuatrial node
EXCRETORY PRODUCTS AND THEIR ELIMINATION

(SOLUTIONS)
1. The concentration of urine refers to water absorption
List I List II from glomerular filtrate in Henle’s loop by counter-
A. Taenia III. Flame cells current mechanism.
B. Paramoecium II. Contractile vacuole Urine is carried from kidney to bladder through the
C. Periplaneta IV. Uricose gland ureter.
D. Pheretima I. Nephridia The urinary bladder is concerned with the storage of
2. A is true, but R is false. urine.
3. A. An excessive loss of body fluid from the body 9. Glycosuria denotes the presence of glucose in the
switches on the osmoreceptors. urine. This is observed when blood glucose level rises
E. ADH is responsible for an increase in GFR. above 180 mg/dl of blood, which is a threshold value
4. Reptiles, birds, land snails and insects excrete for blood glucose. Gout is caused due to deposition of
nitrogenous wastes as uric acid in the form of pellet or uric acid crystals in the joint.
paste with a minimum loss of water and are called Renal calculi are precipitates of calcium phosphate
uricotelic animals. Pavo (Peacock) belongs to class produced in the pelvis of the kidney.
aves (birds). Hence, it excretes nitrogenous wastes in Glomerulonephritis is the inflammatory condition of
the form of pellets or paste. Ornithorhynchus the glomerulus.
(Platypus) is a mammal and is ureotelic (excretes 10. A decrease in blood pressure/volume stimulates the
urea). Salamandra (Salamander) is an amphibian and release of renin, aldosterone, and ADH while the
is ammonotelic (excretes ammonia). Hippocampus is a increase in blood pressure/volume stimulates the
bony fish and is ammonotelic. release of Atrial Natriuretic Factor (ANF) which
5. • ANF causes vasodilation (dilation of blood vessels) causes vasodilation and also inhibits RAAS (Renin
and thereby decrease blood pressure. Angiotensin Aldosterone System) mechanism.
• Due to a decrease in the secretion of renin, it reduces 11. The Henle’s loop helps in maintaining the
the concentration of angiotensin I & II. concentration of urine. Descending limb of the loop of
• Angiotensin II, being a powerful vasoconstrictor, Henle is permeable to water but impermeable to
increases the glomerular blood pressure and thereby electrolytes while the ascending limb is impermeable
GFR. to water but permeable to electrolytes.
Angiotensin II also activates the adrenal cortex to 12. Sodium reabsorption occurs through tubular
release Aldosterone. reabsorption in proximal and distal convoluted tubules
• Reabsorption of Na+ and water from renal tubules only. The proximal convoluted tubule is involved in
due to aldosterone help in prevention of diuresis. active reabsorption of sodium into the peritubular
Hence, the (d) statement is correct. capillary network and passive flow of water. It
6. The proximity between the loop of Henle and vasa accounts for 67% of sodium reabsorption. DCT
recta as well as countercurrent in them help in reabsorption of sodium is also an active process but is
maintaining and increasing osmolarity towards the under hormonal regulation i.e., conditional response.
inner medullary interstitium. This mechanism helps to 13. The hepatic portal vein leads from the small intestine
maintain a concentration gradient in medullary to the liver. The hepatic vein carries blood away from
interstitium so human urine is nearly four times the liver to the vena cava which transports it back to
concentrated than initial filtrate formed. the heart. The hepatic vein has the highest
7. (a) and (b) statements are incorrect because dialysis concentration of urea. This is because urea is a by-
eliminates urea and potassium from the body whereas, product of amino acid catabolism, that occurs in the
c and d are correct. As phosphate ions are eliminated liver. Hence liver is the primary site for urea
during dialysis, along with that calcium ions are also production.
eliminated. So, there will be reduced absorption of 14. Grafted kidney may be rejected in a patient due to cell-
calcium ions from the gastrointestinal tract. RBC mediated immune response mediated by T-
production will be reduced, due to reduced lymphocytes in which the body is able to differentiate
erythropoietin hormone. 'self' and 'non-self'.
8. Ultrafiltration refers to filtration of very fine particles 15. Human urine is usually acidic because hydrogen ions,
having molecular weight less than 68,000 daltons potassium ions and ammonia are actively secreted into
through the Malpighian corpuscle. the filtrate which helps in the maintenance of ionic and
acid base balance of body fluids.
16. Cockroaches absorb nitrogenous waste products and Refer CP sheet excretory system Topic mode of
convert them into uric acid which is excreted out elimination of nitrogenous waste.
through the hindgut and hence, they are called 21. In frogs & humans NH3 is convered into urea in liver
uricotelic. for excretion Refer CP Sheet Excretory system,
17. Aldosterone causes reabsorption of Na+ and water from elimination of nitrogenous waste
the distal convoluted tubule which also leads to an 22. Convoluted tubules
increase in blood pressure and glomerular filtration 23. Podocytes : Create minute spaces (slit pores) for the
rate (GFR). Antidiuretic hormone (ADH) is secreted filtration of blood into the Bowman's capsul
by the posterior pituitary gland and targets nephrons to 24. Reptiles and Birds
increase water reabsorption and thereby decreasing 25. When someone drinks lot of water, ADH release is
water content in urine. suppressed
18. The adrenal gland is correctly labelled and is 26. Nearly 99 percent of the glomerular filtrate is
concerned with the release of the hormones adrenaline reabsorbed by the renal tube
and noradrenaline, collectively known as 27. In the liver, but eliminated mostly through kidneys
catecholamine, which stimulate glycogen breakdown 28. Cockroach
during emergency situations. 29. There will be no micturition
19. Fall in BP leading to fall in GFR causes activation of 30. Less urea in his urine
Renin - Angiotensin Aldosterone system RAAS due to 31. Liver cells
which JG apparatus releases Renin. 32. CO2 and ammonia
20. In case of toxicity and solubility 33. 20 mm Hg
Ammonia > urea>uric acid 34. Birds, reptiles and insects
More toxic substance will require more amount of
water for elimination
LOCOMOTION AND MOVEMENT (SOLUTIONS)

1. 8. The correct option is (c) because the length of the A-
band is retained. During muscle contraction, the
List I (Type of List II (Found between) following events occur: (1) The globular head of
Joint) myosin acts as ATPase and hydrolyses ATP molecule
A. Cartilaginous II. Between adjacent and eventually leads to the formation of cross-bridge.
Joint vertebrae in vertebral (2) This pulls the actin filament towards the center of
column the 'A-band'. (3) The Z-line attached to these actins are
B. Ball and Socket IV. Between humerus and also pulled inwards thereby causing a shortening of the
Joint pectoral girdle sarcomere. (4) The thin myofilaments move past the
C. Fibrous Joint I. Between flat skull bones thick myofilaments due to which the H-zone narrows.
D. Saddle Joint III. Between carpal and This reduces the length of the I-band but retains the
metacarpal of thumb length of the A-band. (5) The myosin then releases
ADP+Pi and goes back to its relaxed state.
2. A. Muscle bundles are held together by collagenous 9. (a) There are 12 pairs of ribs. Each rib is a thin flat
connective tissue layer called facia. bone connected dorsally to the vertebral column and
D. Z line is considered as functional unit of contraction ventrally to the sternum. Last 2 pairs (11th and 12th) of
called sarcomere. ribs are not connected ventrally and are therefore
3. Tetany - Tetany is a symptom characterized by the called floating ribs.
involuntary contraction of muscles that usually results (b) & (c) Scapula is a large triangular flat bone situated
from low calcium levels in the blood (i.e., in the dorsal part of the thorax between the second and
hypocalcemia). the seventh ribs. The dorsal, flat, triangular body of the
Myasthenia gravis - An autoimmune disorder in which scapula has a slightly elevated ridge called the spine
antibodies destroy the communication between nerves which projects as a flat, expanded process called the
and muscle, resulting in weakness of the skeletal acromion. The clavicle (collar bone) articulates with
muscles. this.
Muscular dystrophy - Genetic disorder that causes (d) Below the acromion is a depression called the
progressive weakness and loss of muscle mass. glenoid cavity which articulates with the head of the
4. Estrogen helps keep the bones healthful and strong. As humerus to form the shoulder joint.
estrogen levels decrease, bone loss may occur. For 10. * Vertebrosternal ribs are true ribs, dorsally they are
example, women who are post-menopausal are at an attached to the thoracic vertebrae and ventrally
increased risk of developing osteoporosis and bone connected to the sternum with the help of hyaline
fractures. cartilage. First seven pairs of ribs are called true ribs.
5. White fibrous cartilage is present between vertebrae to * 8th , 9th and 10th pairs of ribs do not articulate
allow limited movement. This ensures proper structural directly with the sternum but join the seventh ribs with
rigidity and body balance and yet, allows for limited the help of hyaline cartilage. These are
movement required. vertebrochondral or false ribs.
6. Myasthenia gravis is an autoimmune disorder affecting * Last 2 pairs (11 & 12) of ribs are not connected
the neuromuscular junction leading to fatigue, ventrally and are therefore called floating ribs.
weakening, and paralysis of skeletal muscle. Gout is * Only the first seven pairs of ribs are ventrally
inflammation of joints due to the accumulation of uric connected to the sternum.
acid crystals. Arthritis is inflammation of joints. 11. During muscular contraction, the level of calcium ions
Muscular dystrophy is the progressive degeneration of gets increased in the sarcoplasm. Increased level of
skeletal muscle mostly due to a genetic disorder. Ca++ now binds with a subunit of troponin (troponin
7. The scapula is a large triangular flat bone situated in “C”) which is masking the active site on actin filament
the dorsal part of the thorax between the second and and displaces the subunit of troponin. Once the active
the seventh ribs. The fibrous joint is shown by the flat site is exposed, the head of the myosin attaches and
skull bones which fuse end-to-end with the help of initiates contraction by sliding the actin over the
dense fibrous connective tissues in the form of sutures, myosin.
to form the cranium. Sternum is a flat bone on the 12. Synovial joints are freely movable joints that allow
ventral midline of thorax. Cartilaginous joints between considerable movements. The pivot joint is a type of
the adjacent vertebrae in the vertebral column permit synovial joint that provides rotational movement in
limited movements. between the atlas and axis vertebrae of the vertebral
column.
13. In humans, 12 pairs of ribs are present in which the locomotion. However, production of body heat is not
first 7 pairs of ribs (1st to 7th pairs) are attached the function of the skeletal system.
dorsally to the vertebral column and ventrally to the 18. Fibrous joints do not allow any movement. These are
sternum. found in flat skull bones which fuse end-to-end with
the help of dense fibrous connective tissue in the form
of sutures, to form the cranium.
While cartilaginous joint permits limited movement.
Synovial joints allows considerable movement.
Example- Ball and socket joint.
19. Cartilaginous joints are slightly movable joints. For
example, joints between pubic bones of pelvic girdles
and the joints between the vertebrae. Pivot joint is a
rotatory joint. Here, one bone is fixed and bears a peg-
like projection of pivot. The other bone fits over the
pivot by a concavity and freely rotates around. For
example, a joint between the atlas and axis of
mammals. Hinge joints, a protuberance known as
condyle at the end of one bone fits into the
14. Smooth muscles are involuntary muscles that are corresponding depression of the other. For example,
associated with slow and regular contraction and joints of ankle, knee, elbows etc.In gliding joints, the
relaxation patterns of movement. Fusiform muscles are articulating bones can slide upon one another. For
spindle-shaped muscles where muscle fibers are example, the joint between carpals.
arranged parallelly. Smooth muscle cells are fusiform. 20. The joint between the atlas and the axis is a pivot joint
This increases the degree of contraction of the muscle. which is an example of a synovial joint. These joints
Smooth muscles are non-striated. are characterized by the presence of a fluid-filled
15. Calcium is the ion released into the sarcoplasm from synovial cavity between the articulating surface of the
sarcoplasmic reticulum during polarisation. Ca ion two bones.
attaches to the Troponin-C. This brings a 21. Gout is caused by the excessive formation of uric acid,
conformational change in the tropomyosin. As a result and its subsequent deposition in the joints as
unmasking of active sites on actin for myosin takes monosodium salts.
place. Cross bridges are formed between actin and While the vertebral column has 12 thoracic vertebrae.
myosin. This results in muscle contraction. -The joint between adjacent vertebrae is a cartilaginous
Magnesium is used in phosphorylation reactions joint.
involving ATP -Progesterone hormone is produced from the corpus
Sodium and potassium help in maintaining the luteum that supports pregnancy.
membrane potential. 22. In the skeletal muscle, the central gap between acting
So the correct option is d. filaments extending through myosin filaments in the A
16. Lack of relaxation between successive stimuli in band is called the H-zone.
sustained muscle contraction is known as tetanus. 23. Tetany
Tetanus is an acute, often-fatal disease of the nervous 24. Iris – Involuntary smooth muscle
system that is caused by nerve toxins produced by the 25. Items- ilium, ischium pubis; Groups- Coxal bones of
bacterium Clostridium tetani. The tetanus toxin pelvic girdle
amplifies the chemical signal from the nerve to the 26. Hinge joint
muscle, which causes the muscles to tighten up in a 27. Floating ribs – 2 pairs
continuous ("tetanic" or "tonic") contraction or spasm. 28. Myosin
Tetanus often begins with mild spasms in the jaw 29. Pectoral girdle of mammals
muscles (lockjaw). 30. Gliding joint – between zygapophyses of the
17. The skeletal system helps in the formation of blood, successive vertebrae
storage of minerals like calcium and phosphorus and 31. Myosin
NEURAL CONTROL AND COORDINATION (SOLUTIONS)

1. amygdala, parahippocampal gyrus, and parts of the
thalamus. It deals with emotions and memory. It
List I List II regulates autonomic or endocrine function in response
A. Fovea III. Point of greatest visual acuity or to emotional stimuli and is also involved in reinforcing
resolution. behaviour.
B. Iris I. Visible coloured portion of eye 9. Lens in the human eye is held in its place by
that regulates diameter of pupil. suspensory ligaments attached to the ciliary body.
C. Blind IV. Point where optic nerve leaves
spot the eyeball and photoreceptor
cells are absent.
D. Sclera IV. External layer of eye formed of
dense connective tissue.
2. The inner parts of cerebral hemispheres and a group of

associated deep structures like amygdala,
hippocampus, etc., form a complex structure called the
limbic lobe or limbic system. Along with the
hypothalamus, it is involved in the regulation of sexual 10. Oligodendrocytes are neuroglial cells that produce
behaviour, expression of emotional reactions (e.g., myelin sheath in the central nervous system while
excitement, pleasure, rage and fear), and motivation. Schwann cell produces myelin sheath in the peripheral
3. A nerve impulse is transmitted from one neuron to nervous system.
another through junctions called synapses. There are 11. Neurotransmitters are the chemicals that help to
two types of synapses, namely, electrical synapses and transfer the nerve signal from one neuron to the other
chemical synapses. Transmission of an impulse across during chemical synapse. The receptor sites for
electrical synapses is very similar to impulse neurotransmitters are present on the post-synaptic
conduction along a single axon. Impulse transmission membrane. The pre-synaptic membrane is involved in
across an electrical synapse is always faster than that the release of neurotransmitters in the chemical
across a chemical synapse. synapse.
4. (a) Organ of corti is a structure located on the basilar 12. Carotene is the source of retinal which is involved in
membrane which contains hair cells that act as auditory the formation of rhodopsin of rod cells. Retinal, a
receptors. derivative of vitamin A, is the light-absorbing part of
(b) Cochlea is the coiled portion of the labyrinth (fluid all visual photopigments. It is necessary for the
production of retinal, a component of rhodopsin.
filled inner ear).
Vitamin A is necessary for the production of retinal, a
(c) Eustachian tube connects the middle ear cavity component of rhodopsin. Rhodopsin is required for
with the pharynx and helps in equalizing pressure of sensing dim light.
ear drums. 13. Photoreceptors in the human eye are depolarized
(d) Stapes is one of the ossicles of the middle ear and is during darkness and become hyperpolarized in
attached to the oval window of cochlea. response to the light stimulus. Meissner’s corpuscles
5. Cornea consists of a dense matrix of collagen and are mechanoreceptors for touch sensitivity in skin.
corneal epithelium. It is the most sensitive part of the Taste cells and photoreceptors can produce graded
eye. The cornea's main function is to refract, or bend, potential. Nociceptors are pain receptors which
light, so the light can meet and form an image of the produce threat response to stimuli like heat or
object on the retina. chemicals.
6. Hypothalamus contain the thermoregulatory centre of 14. The photosensitive compound present in vision is
our brain. It is responsible for maintaining constant called rhodopsin, also known as visual purple which
body temperature. consists of a large protein called opsin and retinal.
7. Nissl granules are present in the cyton and even extend Opsins are a group of light-sensitive proteins found in
into the dendrite but absent in the axon and rest part of photoreceptor cells of the retina. Five classical groups
the neuron. Nissl granules are in fact composed of free of opsins are involved in vision, mediating the
ribosomes and RER. They are responsible for protein conversion of a photon of light into an electrochemical
synthesis. signal, the first step in the visual transduction cascade.
8. The limbic system consists of a number of structures, Retinal allows certain microorganisms to convert light
including the fornix, hippocampus, cingulate gyrus, into metabolic energy.
15. In the mammalian eye, the fovea is a thinned-out impulse to the occipital lobe of the brain for
portion of the retina where only the cones are densely interpretation.
packed and the visual acuity (resolution) is the C - Aqueous chamber, filled with transparent fluid
greatest. It does not have rods. known as aqueous humor. It maintains the intraocular
16. Destruction of the anterior horn cells of the spinal cord pressure and refractive index of the eye.
would result in loss of voluntary motor impulses D - Sclera, protective layer of the eye.
because the anterior horn cells contain motor neurons 21. A – Receptor
that affect the axial muscles. B - Synaptic cleft
17. Post-ganglionic fibers of parasympathetic nervous C - Synaptic vesicles
system secrete acetylcholine which decrease heart rate D - Ca2+
and cardiac output. 22. Vitamin A
18. Muscle contraction is initiated by a signal sent by the 23. Comparatively more permeable of K+ Ions and nearly
central nervous system (CNS) via a motor neuron. A impermeable to Na+ ions
motor neuron along with the muscle fibres connected 24. Hypothalamus
to it constitute a motor unit. The junction betwee n a 25. Hypothalamus
motor neuron and the sarcolemma of the muscle fibre 26. Acetylcholine
is called the neuromuscular junction or motor-end 27. Floating ribs in humans — 4
plate. 28. A: Perilymph, B: Tectorial membrane, C: Endolymph
19. Rods have rhodopsin pigment while cones have three 29. Overall function- Rod cells-Vision in poor light; Cone
photopigments, iodopsin, porpyrosin and cyanopsin. cells-Colour vision and detailed vision in bright light
Retinal is a derivative of vitamin A. Rhodopsin is a 30. Na+ ions from extracelluar fluid to intracellular fluid
purplish red protein, also known as visual purple and is 31. It has no blood supply
associated with vision under low light. Retinal is 32. Perikaryon and dendrites
derivative of vitamin A and bound to light sensitive 33. First negative, then positive and again back to negative
proteins called opsins. It absorbs light and sends 34. The phosphate groups at the start of two DNA strands
signals to the brain. are in opposite position (pole)
20. A - Retina is the sensory layer of the eye and consists 35. Neurons
of rod and cone cells. Rod cells help with the vision in 36. Peristalsis of the intestines
dim light while the cone cells help with the vision in 37. Loss of cell mediated immunity
strong light. 38. Dopamine
B - Blindspot, devoid of rod and cone cells. The optic 39. Movement of the eye ball
nerve emerges from this point which carries the optic 40. Na+ into the cell
41. Tongue movements
CHEMICAL COORDINATION AND INTEGRATION

(SOLUTIONS)
1. disorder called diabetes mellitus which is associated
with loss of glucose through urine and formation of
List I List I harmful compounds known as ketone bodies.
(A) CCK (IV) Pancreas 7. Diabetes mellitus leads to a complex disorder called
(B) GIP (III) Gastric gland prolonged hyperglycemia, which is associated with
(C) ANF (II) Heart loss of glucose through urine known as glycosuria and
(D) ADH (I) Kidney when the cells are unable to utilize carbohydrates for
energy instead they use fats & proteins, and
2. • Melatonin plays a very important role in the degradation of these fats produces ketone bodies. The
regulation of a 24-hour (diurnal) rhythm of our body. presence of these ketone bodies in urine is known as
For example, it helps in maintaining the normal ketonuria.
rhythms of sleep-wake cycle. 8. GLUT-IV is an insulin dependent transporter and is
• The thymus plays a major role in the development of responsible for the majority of glucose transport into
the immune system. muscle and adipose cells in anabolic conditions.
3. Parathyroid hormone increases the Ca2+ levels in the Whereas GLUT-I is insulin independent and is widely
blood. PTH acts on bones and stimulates the process of distributed in different tissues.
bone resorption (dissolution/ demineralisation). PTH 9. • Insulin deficiency leads to diabetes mellitus.
also stimulates reabsorption of Ca2+ by the renal • Hyposecretion of thyroxine due to unavailability of
tubules and increases Ca2+ absorption from the iodine can cause enlargement of thyroid gland called
digested food. PTH is a hypercalcemic hormone and goitre.
along with TCT (thyrocalcitonin), it plays a significant • Deficiency of corticoids (Glucocorticoid +
role in calcium balance in the body. mineralocorticoid) leads to Addison's disease.
4. Juxtaglomerular cells of the kidney secrete • Growth hormone hypersecretion in adults leads to
erythropoietin hormone which stimulates RBC Acromegaly.
formation. Alpha cells of the pancreas produce the 10. Steroid hormones directly enter into the cell and bind
hormone glucagon. The cells of rostral with intracellular receptors either present in cytoplasm
adenohypophysis synthesize hormones of the anterior or nucleus and form hormone-receptor complex. This
lobe of the pituitary. The cells of bone marrow are hormone-receptor complex interacts with the genome.
responsible for the formation of formed elements. 11. Estrogen promotes the activity of osteoblast and
5. (a) Insulin acts mainly on hepatocytes and adipocytes inhibits osteoclast. In aging female osteoporosis occurs
(cells of adipose tissue), and enhances cellular glucose due to deficiency of estrogen. Parathormone promotes
uptake and utilization. the mobilisation of calcium from bone into the blood.
(b) Glucagon acts mainly on the liver cells Excessive activity of parathormone causes
(hepatocytes) and stimulates glycogenolysis resulting demineralisation leading to osteoporosis.
in increased blood sugar (hyperglycemia). 12. Epinephrine is derived from tyrosine amino acid by the
(c) Glucocorticoids stimulate gluconeogenesis, removal of a carboxyl group. It is a catecholamine.
lipolysis and proteolysis; and inhibit cellular uptake Ecdysone, Estradiol, and Estriol are steroid hormones.
and utilization of amino acids. 13. Epiphyseal plate is responsible for the growth of bone
(d) Insulin is associated with hypoglycemia. which closes after adolescence, therefore
6. Antidiuretic hormone released by the pituitary gland hypersecretion of growth hormone in adults does not
stimulates reabsorption of water by the kidneys. The cause a further increase in height.
deficiency of this hormone causes increased urine 14. Hypothalamus secretes GnRH which stimulates the
production, a condition called diabetes insipidus. anterior pituitary gland for the secretion of
Graves disease is an immune system disorder that gonadotropins (FSH and LH). GnRH is a
results in the overproduction of thyroid hormones. gonadotrophin hormone that is released by the
Addison's disease is caused by a deficiency of the hypothalamus. It acts on the anterior pituitary and
hormones secreted by the adrenal cortex. Pancreas is a stimulates the secretion of the LH and FSH which
composite gland which functions as both an exocrine further helps in the development of gonads.
and endocrine gland. The deficiency of insulin, a 15. The corpus luteum is the temporary endocrine structure
hormone secreted by the pancreas, causes a complex formed in the ovary after ovulation. It is responsible
for the release of the hormones like progesterone.
16. Oxytocin and vasopressin hormones are produced by 22. Gonadotropin-releasing hormone (GnRH) is produced
hypothalamus but stored and are released into the by the hypothalamus. It stimulates the pituitary gland
bloodstream via posterior pituitary. Posterior pituitary to produce luteinizing hormone (LH) and, to a lesser
do not synthesize any hormone that's why it is not a extent, follicle-stimulating hormone (FSH). However,
true endocrine gland. Endocrine glands are the ductless with depletion of follicular number, estrogen levels
glands that synthesize and secrete hormones in blood decrease with subsequent loss of negative feedback
directly. and resultant increases in GnRH secretion.
17. Osteoporosis is an age related disorder of the skeletal Progesterone also decreases GnRH secretion at the
system caused due to weakening of bones by decreased level of the hypothalamus.
Ca2+ ion and oestrogen levels. Oestrogen helps in 23. LH is a Luteinizing hormone produced by the
decreasing the resorption of bone by decreasing gonadotropic cells in the anterior pituitary gland. It
osteoclastic activity. As the oestrogen levels decrease plays an important role in puberty, menstruation, and
the osteoclastic activity increases and more Ca2+ ion is fertility. It triggers ovulation and development of the
withdrawn into blood from bone resulting in corpus luteum. In male, LH triggers the secretion of
osteoporosis. So the correct option is b. androgen called as testosterone from the Leydig cells.
18. Glucagon hormone from pancreas stimulates the liver FSH is follicle stimulating hormone produced by
to break down glycogen into glucose and breakdown of gonadotropic cells in the anterior pituitary gland. It
fat into glycerol and fatty acids in adipose tissues to helps in regulation of development, growth, pubertal
serve as a substrate for glucose formation in liver cells. maturation and reproductive processes of the body. It
Secretin is secreted by endocrine cells of the duodenal stimulates the Sertoli cells of the testicles and helps in
wall in response to the presence of hydrochloric acid in spermatogenesis, production of sperm. During the
chyme and induces the release of pancreatic juice from follicular phase, the LH and FSH increase gradually.
the pancreas. They stimulate follicular development and estrogen
Insulin serves to lower the blood glucose level by secretion by follicular cells.
stimulating the uptake of glucose by cells, specifically 24. Relaxin is a protein hormone secreted by placenta. It
muscle cells, liver cells and adipose tissues cells. Liver dilates the cervix and aids in childbirth. Inhibin is
and muscle cells store glucose as glycogen. Glucose secreted from ovaries and inhibits the release of FSH
serves as an energy source for muscle contraction and (Follicle stimulating hormone). Parathormone
in adipose tissues, it supplies glycerol for the formation increases blood calcium level by increasing the
of fat. reabsorption of calcium from the bones. Calcitonin acts
The enteroendocrine cells secrete gastrin which in turn on bone and kidneys to reduce blood calcium level.
promotes stomach churning and induces more release Insulin acts on hepatocytes and adipocytes and
of gastric juices. increases the uptake of cellular glucose and its
Therefore, the correct answer is option d. utilisation. Thus, it decreases blood glucose level.
19. Oversecretion of thyroid hormones (hyperthyroidism) Glucagon increases blood sugar level by stimulating
causes Graves’s disease which is characterized by the glycogenolysis (i.e. breakdown of glucose) and
formation of the exophthalmic goiter. gluconeogenesis (synthesis of glucose). Aldosterone
Addison’s disease is caused by the presence of maintains the electrolyte balance in the body by
ineffective ACTH which in turn leads to the deficiency reducing the loss of sodium through urine and sweat.
of aldosterone and cortisol hormones of the adrenal Atrial natriuretic factor stimulates excretion of sodium
cortex. Excessive ACTH secretion by anterior pituitary in kidneys.
results in hyperproduction of cortisol causing 25. Antidiuretic Hormone (ADH) is a peptide hormone
Cushing’s disease. Myxedema is caused by synthesised in the hypothalamus, but stored and
hypothyroidism in adults and is characterized by released from the posterior pituitary lobe or master
lethargy, hair loss, weight gain, puffed skin, lowered gland.
body temperature and slowed pulse rate. Therefore, the 26. Aldosterone is secreted by the cortex region of adrenal
correct answer is option a. glands and helps to regulate the balance of water and
20. Tryptophan serves as precursor for the synthesis of the electrolytes in our body. It is not involved in sugar
neurotransmitters serotonin and tryptamine as well as, metabolism. The remaining hormones are involved in
for the synthesis of the anti pellagra vitamin nicotinic sugar metabolism.
acid and the epiphyseal hormone melatonin. 27. Hypothalamus regulates the body temperature, so
21. FSH and LH act on specific membrane receptors in injury localised to the hypothalamus would most likely
granulosa cells and theca cells of the ovary, stimulating disrupt regulation of body temperature.
follicular growth and hormone synthesis. The peptide 28. Epinephrine (adrenaline) and nor-epinephrine (nor-
hormone inhibin is synthesized and secreted by adrenaline) are rapidly secreted by the adrenal medulla
granulosa cells and specifically inhibits FSH synthesis in response to stress of any kind and during emergency
and secretion by the pituitary. situations and are called emergency hormones or
hormones of fight or flight.
29. Oxytocin, produced by posterior pituitary gland 33. Source gland- Posterior pituitary; Hormone-
functions in parturition. Vasopressin; Function- Stimulates resorption of water
Melatonin is a hormone from the pineal gland that in the distal tubules in the nephron
helps regulate biological rhythms such as sleep and 34. A- Ovary; B- Glucagon; C- Growth
wake cycles. It directs the internal clock - the one that 35. Adrenaline
allows us to wake up about the same time every 36. Glucagon – Beta cells (source)
morning without an alarm clock. Progesterone secreted 37. Simple goitre
by the corpus luteum is a steroid hormone involved in 38. Thyroxine
the menstrual cycle, pregnancy and embryogenesis. 39. Myxoedema
Atrial natriuretic factor is a powerful vasodilator and a 40. Parathyroid and adrenal
protein hormone, secreted by heart muscle cells. 41. Parathormone
30. The thyroid gland synthesizes the hormone thyroxine 42. Lower levels of blood testosterone
with the help of iodine. Lack of iodine in the diet 43. Adrenaline
results in goiter. 44. Olfactory epithelium of our nose
31. Endocrine systems have non-nutrient intercellular 45. Endocrine glands regulate neural activity, and nervous
messengers called hormones. Adenohypophysis is system regulates endocrine glands
under the control of hormonal secretions of the 46. FSH
hypothalamus. The organs in the body like GI tract, 47. Cortisol
kidney, etc. do produce hormones, e.g., gastrin by the 48. Sodium
gastrointestinal tract. Releasing and inhibitory 49. Posterior pituitary lobe
hormones are produced by the hypothalamus. 50. Adrenalin
32. Hypothyroidism in the mother during pregnancy 51. Epinephrine
results in defective development and maturation of the 52. Luteinizing hormone – Failure of ovulation
growing foetus leading to stunted growth, mental 53. Proteins, steroids & biogenic amines
retardation, low IQ and abnormal skin.
SEXUAL REPRODUCTION IN FLOWERING PLANTS

(SOLUTIONS)
1. Majority of insect-pollinated flowers are large, nuclei, only three differentiate into two synergids and
colourful, fragrant and rich in nectar. Animals are one egg cell. Together they are known as the egg
attracted to flowers by colour and/or fragrance. apparatus. Similarly, at the chalazal end, three out of
2. Wind pollinated flowers often possess well-exposed four nuclei differentiate as antipodal cells. Th
stamens (so that the pollens are easily dispersed into remaining two nuclei (of the micropylar and the
wind currents) and large often-feathery stigma to easily chalazal end) move towards the center and are known
trap air-borne pollen grains. as the polar nuclei, which are situated in a large central
3. Among the animals, insects particularly bees are the cell. Hence, at maturity, the female gametophyte
dominant pollinating agents. appears as a 7- celled structure, though it has 8
Pollination carried out through water is called nucleate.
hydrophily. Pollination by water is quite rare in 7. Xenogamy refers to the transfer to pollen grains from
flowering plants (only 2%). anthers of one plant to stigma of a different plant
Pollination by wind is more common amongst abiotic which during pollination, brings genetically different
pollination. Wind pollination requires the light and types of pollen grains to stigma. Cleistogamy is a
non- sticky pollen grains so that they can be condition in which the flower does not open.
transported in wind currents. Geitonogamy refers to the transfer of pollen grain from
Some plants whose flowers are pollinated by flies and anther to the stigma of another flower of the same
beetles smell this way(foul odour), mainly to attract plant. Chasmogamy is a condition in which flowers
flies and beetles, which normally lay their eggs in remain open.
faeces and rotting materials. 8. In a majority of aquatic plants such as water hyacinth
4. Cleistogamous flowers are the ones that do not open and water lily, the flowers emerge above the level of
and show self-pollination. Hence, there is no cross water and are pollinated by insects or wind as in most
pollination occurring at all in these plants, there is little of the land plants. The pollen grains are in the upper
to no variation, which is disadvantageous for the part of thalamus and above the water level, so
plants. pollination can’t be done by water. That's why it is
5. Fruits are formed from the ovary of a flower after done by insects and wind.
fertilisation. Such fruits are called true fruits. However, 9. The body of the ovule fuses with the funicle in the
in a few species such as apple, strawberry, cashew, region called the hilum. The funicle is a stalk through
etc., some other parts of the flower, such as the which the ovule is attached to the placenta.
thalamus also contribute to fruit formation. Such fruits 10. (a) Pollen grain (n) located inside the anther (2n)
are called false fruits. The diagram shown here is of an which develops into male gametophyte. (b) Embryo
apple. The parts labeled as A is mesocarp, B is Sac (n) is a female gametophyte located inside ovule
endocarp, C is thalamus, and D is seed. (2n).
11. The phenomenon in which the female gamete develops
into an embryo without getting fused with male gamete
(fertilisation) is called parthenogenesis.
parthenocarpy is the natural or artificially induced
production of fruit without fertilisation of ovules,
which makes the fruit seedless.
Fertilization is also known as syngamy.
Autogamy, or self-fertilization, refers to the fusion of
two gametes that come from one individual.
6. Angiospermic female gametophyte is an eight-celled
12. Generally during the development of fruit and seed the
embryo sac. The diploid cell of the embryo sac forms
nucellus completely disappears but in few cases it
the mother cell and undergoes meiosis to form four
persists around the seed is called Perisperm.
haploid cells. Out of four, three degenerate and one
e.g: Black pepper, Beet
forms the female megaspore. The megaspore
13. Following are the post-fertilisation changes.
undergoes three successive mitotic divisions which
• Ovule develop into seed
lead to the formation of four nuclei each at both the
• Ovary develop into fruit
ends i.e., at the micropylar and the chalazal end in the
• Zygote develop into embryo
embryo sac. At the micropylar end, out of the four
• Central cell give rise to endosperm
14. In flowering plants, out of the two male gametes mother cells (2n). The diploid megaspore mother cells
discharged in synergids, one fuses with the egg and then undergo meiosis to form a linear tetrad of
other fuses with the secondary or definitive nucleus megaspores. Megaspore is the first cell of the female
present in the central cell. gametophyte. Out of four, one functional megaspore
undergoes megagametogenesis to form 8-nucleate and
7-celled embryo sac. Ovule serves as megasporangium
wherein megaspores production occurs. Therefore, the
correct answer is option d.
15. In pinus, winged pollen grains are present. It is 25. In water hyacinth and water lily, the flowers emerge
extended outer exine on two lateral sides to form the above the level of water and are pollinated by insects
wings of pollen. It is the characteristic feature of Pinus. or wind.
The wings of the pollen rise upwards and float in the 26. Megaspore mother cell of megasporangium undergoes
air during pollination. meiosis and forms megaspore tetrad, out of which, one
16. Sporopollenin is the hardest material on earth. It is megaspore is functional. Central cell of the embryo sac
neither degraded by enzymes nor by strong acids and is the large cell consisting of two polar nuclei.
alkali therefore it is helpful in preserving pollen as a Synergids, the flanking cells of the egg cell, have
fossil. finger-like projections of the wall in their cytoplasm,
Pollenkitt helps in pollination by insects. the filiform apparatus. An embryo sac has three
Cellulosic intine is the inner layer of pollen grain antipodal cells which provide nutrition to developing
known as intine made up of cellulose & pectin. the embryo. Therefore, the correct answer is option B.
Oil content has no role in pollen preservation. 27. Pollen grains of other species are not compatible and
17. Pollen grains can be stored for several years in liquid do not germinate on the stigma of the flower of
nitrogen at -196oC. This technique is known as different species.
Cryopreservation. Pollen seed banks are made in this 28. Apomixis is a special mechanism in certain plants to
way which is very important for plant breeding. produce seeds without fertilization. Apomixis is a form
18. Double fertilization is a unique phenomenon that of asexual reproduction that mimics sexual
occurs in angiosperms only. It involves the fusion of reproduction. For example, Asteraceae and grasses.
one male gamete with an egg cell (syngamy) and a 29. Tapetum is the innermost layer and completely
second male gamete with two polar nuclei or surrounds the sporogenous tissue. The cells of
secondary nucleus (triple fusion). Hence it is known as Tapetum have dense cytoplasm and generally possess
double fertilization. more than one nuclei. Tapetum nourishes the
Syngamy + Triple fusion = Double fertilization developing pollen grains. The layer of the anther wall
19. When unisexual male and female flowers are present that helps in anther dehiscence is endothecium. The
on different plants the condition is called dioecious and cells of endothecium develop fibrous thickenings at
it prevents both autogamy and geitonogamy. maturity which radiate from the inner tangential walls.
20. Entomophily is the pollination where the insects carry These thickenings are made up of alpha cellulose and
the pollen from the anther to the stigma of the flower. traces of lignin. These thickenings are hygroscopic and
Insect pollinated plants provide rewards as edible thus, help in anther dehiscence.
pollen grain and nectar as usual rewards. While some 30. Thalamus is the basal thickened part of the stem to
plants also provide a safe place for the deposition of which all floral appendages are found attached. Petals
eggs. are the colored structural unit of the corolla. The
21. Megaspore is the first cell of female gametophytic placenta is the region of the wall of the ovary to which
generation in angiosperm. It undergoes three ovules are found attached. A stamen consists of anther
successive generations of free nuclear mitosis to form and filament. Anther is a broad knob part of the stamen
an 8-nucleated and 7-celled embryo sac. that contains two long and cylindrical microsporangia
22. Wind pollination or anemophily is favoured by flowers in its lobes. The proximal ends of the filament are
having a single ovule in each ovary, and numerous found attached to thalamus or petals while the distal
flowers packed in an inflorescence. Wind pollination is end carries anther.
non-directional pollination. 31. The coconut water from tender coconut represents the
23. Double fertilization is a characteristic feature exhibited free nuclear or liquid endosperm. During the
by angiosperms. It involves syngamy and triple fusion. development of nuclear type of endosperm, the
During double fertilization, one female gamete unites primary endosperm mother cell divides by free nuclear
with two male gametes. One of the male gametes divisions, and these divisions are not followed by cell
fertilizes the egg resulting in the formation of a zygote wall formation. Thus, the free nuclei remain in the
and the other unites with 2 polar nuclei for the cytoplasm of the embryo sac.
formation of an endosperm. 32. The mature male gametophyte in angiosperms is 3-
24. The archesporial cells (2n) of young ovules cut off the celled and hence, produces two sperms and a
parietal cell and are differentiated into megaspore vegetative cell.
33. Banana is a parthenocarpic fruit as it does not contain 45. Megasporangium is equivalent to the ovule.
seeds. Megasporangium is the actual structure which
34. The coconut water is free nuclear endosperm in which produces female gametes (eggs).
the primary endosperm nucleus divides repeatedly 46. Wind pollinated flowers generally have one or few
without wall formation and produces a large number of ovules in ovaries it increase the probability of
free nuclei. successful pollination of each ovule.
35. Sargassum reproduces by fragmentation. Binary (Ref. Bio. NCERT 12th, Page No. 29)
fission does not occur in Sargassum. 47. Germ pore is the place on pollen exine where the
36. A flower that possesses either stamens or carpels is sporopollen is absent. It helps in formation of pollen
called a unisexual flower. Cucumber is an example of tube by intine.
unisexual flower. 48. In 60% angiosperms the pollen grains are shed in 2
37. The egg apparatus consisting of synergids show special celled, 2 nucleate stage and further development of
cellular thickenings at the micropylar tip called male gametopbyte (Pollen grain) occurs on stigma it
filiform apparatus, which play an important role in leads to formation of mature male gametophyte, 3
guiding the pollen tube into the synergid. celled, 3 nucleated stage, which successfully
38. In angiosperms, male gametophyte is reduced to about participate in double fertilization.
2-3 cells and is called pollen grain. Lilium is an 49. Citrus
angiosperm which possesses the male gametophyte 50. Synergid
with least number of cells. 51. 63
39. Geitonogamy is a type of pollination in which pollen 52. Grasses
grains of one flower are transferred to the stigma of 53. Cleistogamy
another flower belonging to either the same plant or 54. Maternal sporophytic tissue in ovule
genetically similar plant. 55. Geitonogamy
40. Pollen tablets are rich in nutrients and hence, are 56. Small, proudcing large number of dry pollen grains
available in the market for supplementing food. Pollen 57. Pinus
tablets are one of nature’s most completely nourishing 58. Autogamy, but not geitonogamy
foods, containing nearly all nutrients required by 59. Pollen exine
humans. They contain all the essential components of 60. It prevents entry of more than one pollen tube into the
life – they are rich in proteins, free amino acids, and embryo sac
vitamins, including B-complex and folic acid. 61. Egg cell and antipodal cells
41. The filiform apparatus plays an important role in 62. Self fertilization is prevented
guiding the pollen tube into the synergid. Synergid cell 63. A cavity in the ovule in which pollen grains are stored
wall forms a filiform apparatus at the micropylar end. after pollination
Filiform apparatus is the extension of the synergids 64. Generative cell
beyond the apex of embryo sac. It helps in the entry of 65. 24
pollen tubes in the synergids. 66. Styles
42. The perisperm is the remains of the nucellus within the 67. 3 + 2 + 3
seed and is a diploid structure. 68. Degenerated synergid
43. Cleistogamous or closed flowers ensure seed setting 69. Nucellus or integuments
even in the absence of any pollinators. 70. Amphitropous
44. Tapetum is the innermost layer of the anther which 71. Hemitropous
provides nourishment to developing pollen. The hard
outer layer of pollen is exine. Sporogenous tissue is
diploid. Endothecium helps in maturation of pollens.
HUMAN REPRODUCTION (SOLUTIONS)

1. Both Statement I and Statement II are true.
2. Both A and R are true, but R is NOT the correct
explanation of A.
3. Spermiogenesis is the process of transformation of
spermatids to spermatozoa. Spermatids undergo
morphological changes and transform into sperms.
Spermiation is the process of release of sperms from
seminiferous tubules, which remain embedded in the
Sertoli cells after spermiogenesis.
4. - Oogenesis begins at the fetal stages and not at
puberty.
- Meiosis does not occur continuously in case of
oogenesis since it is a discontinuous process in women.
It starts dividing mitotically at the fetal stages to form a
diploid primary oocyte. This primary oocyte enters 10. When sperm nucleus enters into the secondary oocyte
meiosis but remains arrested at prophase I of meiosis during fertilization, it provides the anaphase promoting
up until puberty, after which it resumes division and factor that induces the completion of meiosis in the
completes Meiosis I. Meiosis II is completed only after secondary oocyte.
fertilization. 11. (a) Placenta also acts as an endocrine tissue and
5. Oogenesis is the formation of the ova or the female sex produces several hormones like human chorionic
gamete. It begins in the early fetus when primordial gonadotropin (hCG), human placental lactogen (hPL),
germ cells migrate from the yolk sac of the embryo to estrogens, progestogens, etc.
the genital ridge at 5–6 weeks of gestation. (b) The secondary oocyte forms a new membrane
6. The human primary spermatocyte is a diploid cell that called zona pellucida surrounding it.
is about to undergo meiosis. Since it is diploid, it (c) The male accessory glands include paired seminal
contains 44 autosomes. vesicles, a prostate and paired bulbourethral glands.
7. The hormone relaxin is produced in the later phase of Secretions of these glands constitute the seminal
pregnancy. It is produced by the ovary. Graafian plasma which is rich in fructose, calcium and certain
follicles are not formed when the woman is pregnant. enzymes. The secretions of bulbourethral glands also
Uterus and fetus do not produce relaxin. Relaxin is helps in the lubrication of the penis.
produced by the corpus luteum present in the ovary. A (d) The regions outside the seminiferous tubules called
ruptured Graafian follicle is called the corpus luteum, interstitial spaces, contain small blood vessels and
which has an endocrine function. interstitial cells or Leydig cells synthesise and secrete
8. At the end of gestation, the completely developed testicular hormones called androgens.
foetus is expelled out. This process is called 12. The correct sequence for the transport of sperm cells in
parturition. Parturition is controlled by a complex the male reproductive system is Seminiferous
neuroendocrine mechanism. The estrogen and tubulesRete testisVasa efferentiaEpididymisVas
progesterone ratio increases as estrogen levels rise deferens Ejaculatory duct Urethra Urethral meatus.
significantly. Prostaglandins, which stimulate uterine 13. Extrusion of the second polar body from the egg
contractions are also produced that act on the nucleus occurs after entry of sperm but before
myometrium. Oxytocin, the main hormone, also called fertilization. The entry of sperm into the ovum induces
birth hormone is released by the maternal initiation of completion of the meiotic division of the secondary
parturition. oocyte. Entry of sperm causes breakdown of
9. LH (Luteinizing hormone) is produced by the pituitary metaphase promoting factor (MPF) and turns on
gland in the brain. It triggers ovulation & promotes the anaphase promoting complex (APC).
development of corpus luteum from ruptured graafian 14. The placenta releases a human chorionic gonadotropic
follicle. High concentration of estrogen is released by hormone (hCG) which stimulates the corpus luteum
mature graafian follicle during ovulation. during pregnancy to release estrogen and progesterone
and also rescues corpus luteum from regression.
Human placental lactogen (hPL) is involved in the
growth of the body of the mother and breast.
Progesterone maintains pregnancy and helps in the
development of the foetus, stimulates the growth of
maternal breast tissue, prevents lactation, and
strengthens the pelvic wall muscles for preparation of Rete testis → Efferent ductules → Epididymis → Vas
labour. deferens
15. During the proliferative phase, the follicles start 21. The motile sperms swim rapidly, pass through the
developing, hence, called the follicular phase. The cervix, enter into the uterus and finally reach the
secretory phase is also called the luteal phase mainly junction of the isthmus and ampulla (ampullary-
controlled by progesterone secreted by the corpus isthmic junction) of the fallopian tube. The ovum
luteum. In this phase, estrogen further thickens the released by the ovary is also transported to the
endometrium maintained by progesterone. ampullary-isthmic junction where fertilization takes
Menstruation occurs due to a decline in progesterone place. Fertilization can only occur if the ovum and
level and involves the breakdown of the overgrown sperms are transported simultaneously to the ampullary
endometrial lining. isthmic junction. This is the reason why not all
16. Spermiogenesis is the transformation of spermatids copulations lead to fertilization and pregnancy.
into spermatozoa whereas spermiation is the release of 22. In human females, meiosis II is not completed until
sperms from Sertoli cells into the lumen of fertilisation takes place when the ovum is released and
seminiferous tubules. the sperm cell contacts the plasma membrane of the
17. The extraembryonic membranes are amnion, chorion, oocyte.
allantois, and Yolk sac. Amnion is formed from 23. During the development of antral follicle, a
mesoderm on the outer side and ectoderm on the inner glycoprotein polymer capsule called the zona pellucida
side. is acellular, which separates it from the surrounding
Chorion is formed from trophectoderm and mesoderm granulosa cells.
whereas allantois and yolk sac membranes have 24. Decrease in estradiol is not associated with ovulation
mesoderm on the outer side and endoderm on the inner in human female. However, it results in cessation of
side. menstruation.
18. Capacitation is the phenomenon of sperm activation in 25. Ectopic pregnancies are referred to as implantation of
mammals in which the sperm develops the ability to embryos at sites other than uterus, either in the
fertilise the ova. Capacitation occurs in the female fallopian tubes, cervix or ovary.
reproductive tract. The secretion of the female 26. In human male, urethra is the urinogenital duct which
reproductive tract removes the coating substances carries both urine and sperm. Hence, it is a shared
deposited on the acrosome, thereby, exposing the terminal duct of the reproductive and urinary system in
receptor sites and making the sperm active to penetrate the human male.
the egg. 27. The corpus luteum is a temporary endocrine structure
19. Mons pubis is the rounded mass of fatty tissue lying in human females that secretes a large amount of
over the joint of the pubic bones, in women typically progesterone which is essential for the maintenance of
more prominent and also called the mons Veneris. endometrium of the uterus.
The antrum is a fluid-filled space that develops among 28. At the time of childbirth, oxytocin is released from the
the follicle cells; it starts as multiple small spaces that neurohypophysis of the pituitary gland. Hence, it is not
eventually coalesce into a single large antrum. a function of placenta.
Trophoblast are cells that form the outer layer of a 29. Progesterone functions in maintaining pregnancy. In
blastocyst, and are present four days post fertilization the absence of progesterone, the endometrium along
in humans. Trophoblast invasion of the uterus is a with blood is shed in the form of menstrual flow.
necessary step at implantation of the human blastocyst. 30. The correct sequence of spermatogenesis in human
The zona pellucida is a glycoprotein layer surrounding males is spermatogonia → spermatocyte → spermatid
the plasma membrane of mammalian oocytes. Hence → spermatozoa.
correct matching is: 31. Secretory phase is the phase under corpus luteum
a) - iii), b) - iv), c) - i), d) - ii) which last for 13-14 days in case of absence of
20. In the male sex organ, accessory duct includes Rete pregnancy.
testis, Vasa efferentia, Epididymis and Vas deferens. 32. Implantation occurs on uterine wall in Blastula stage &
The sperm are produced in the Seminiferous tubules human blastula is called blastocyst Refer CP sheet
and Seminiferous tubules of the testis open into the embryology (Human Embryology) Topic Implantation.
Vasa efferentia through Rete testis and the Vasa 33. (III) Infundibulum, (IV) Fimbriae, (V) Cervix
efferentia leave the testis and open into epididymis 34. Testes to epididymis
located along the posterior surface of each testis and 35. Seminiferous tubules and provide nutrition to germ
the epididymis leads to Vas deferens that ascends to cells
the abdomen and loops over the urinary bladder and it 36. Rete testis to vas deferens
receives a duct from seminal vesicle and opens into 37. Fructose and calcium
urethra as the ejaculatory duct. Hence, the correct 38. Placenta as well as fully developed foetus
pathway is: 39. Fifth month
40. Until after the ovum has been penetrated by a sperm
41. The sperm lysins in the acrosome dissolve th egg 50. Spermatogonia-spermatocyte-spermatid-sperms
envelope facilitating fertilisation 51. Pattern of cleavage
42. It has almost equal quantity of cytoplasm as an 52. Marasmus
uncleaved zygote but much more DNA 53. The menstrual fluid can easily clot
43. Infundibulum 54. Amnion
44. Bile pigments passed through bile juice 55. Causes strong uterine contractions during parturition
45. Fructose, calcium and certain enzymes 56. A = (ii), B = (iii), C = (iv), D = (i)
46. A- Vas deferens; B- Seminal vesicle; C- Prostate; D- 57. Combination of estrogen and progesterone
Bulbourethral gland 58. Graffian follicle
47. Fully developed foetus and placenta 59. Progesterone
48. Development of corpus luteum - Secretory phase and 60. Primary follicle starts developing
increased secretion of progesterone. 61. At the end of the proliferative phase
49. Fertilization of the ovum 62. Prolactin
REPRODUCTIVE HEALTH (SOLUTIONS)

1. A is false, but R is true transmitted diseases (STD) or venereal diseases (VD)
2. or reproductive tract infections (RTI). Gonorrhoea,
syphilis, genital herpes, chlamydiasis, genital warts,
List I List II trichomoniasis, hepatitis-B are sexually transmitted
A. Vasectomy III. Surgical method diseases. Malaria, filaria are caused by the
B. Coitus interruptus IV. Natural method transmission of the parasite through the mosquitoes
C. Cervical caps II. Barrier method which act as a vector. AIDS is a disease caused by HIV
D. Saheli I. Oral method virus and can be transmitted by several methods
(through body fluids). Cancer is the uncontrollable cell
3. Except for hepatitis-B, genital herpes and HIV division that leads to the formation of tumors and can
infections, other diseases are completely curable if be caused by several factors such as physical,
detected early and treated properly. chemical, and biological factors called carcinogens.
4. Lippes loop is a non-medicated intrauterine device Tuberculosis is a bacterial disease.
which helps in phagocytosis of spermatozoa within the 10. When females cannot conceive then embryo transfer is
uterus. done by using ZIFT (Zygote Intrafallopian transfer)
5. Diaphragms are barrier methods of birth control used and IUT (Intra-uterine transfer) technique. In this
by women. They cover the cervix, blocking the entry method ova from females & sperms from male is
of sperms into the vagina. collected and is induced in the laboratory under
Contraceptive pills contain progesterone or simulated conditions to form zygote. The zygote with
progesterone-oestrogen combinations, and they can upto 8 blastomeres is transferred into the fallopian tube
inhibit processes like ovulation and implantation. through ZIFT or embryos with more than 8
Intrauterine devices can increase the phagocytosis of blastomeres are transferred into the uterus through
sperms within the uterus. IUT.
Lactational amenorrhoea refers to the period after 11. - In lactational amenorrhoea, due to high prolactin
childbirth when there is an absence of the menstrual level, gonadotropin level decreases.
cycle in a lactating woman, which reduces the chances - Oral pills are either progesterone or progestogen-
of conception. estrogen combinations used by the females.
6. Vaults are barriers made of rubber that are inserted into - Emergency contraceptives include the administration
the female reproductive tract to cover the cervix during of progesterone or progestin-estrogen combination or
coitus. They prevent conception by blocking the entry lUDs within 72 hours of coitus.
of sperms through the cervix. IUDs increase So, lactational amenorrhoea, oral pills and emergency
phagocytosis of sperms within the uterus and the Cu 2+ contraceptives involve the role of the hormone.
ions released suppress sperm motility and the 12. Progestasert and LNG-20 are hormone releasing IUDs
fertilizing capacity of sperms. In a vasectomy, a small which make the uterus unsuitable for implantation and
part of the vas deferens is removed or tied up through a the cervix hostile to sperms.
small incision on the scrotum whereas, in tubectomy, a 13. Genital herpes is caused by a type-ll-herpes simplex
small part of the fallopian tube is removed or tied up virus. At present, there is no cure for the type-II-herpes
through a small incision in the abdomen or through the simplex virus and therefore the disease can not be
vagina. cured completely. Other non- curable STIs are
7. The hormone-releasing IUDs are Progestasert, LNG- hepatitis-B and HIV.
20. CuT, Cu7, Multiload 375 are copper releasing 14. Saheli is the first non-steroidal, once-a-week pill. It
IUDs. contains centchroman and its functioning is based upon
8. Diseases or infections which are transmitted through selective estrogen receptor modulation and prevents
sexual intercourse are collectively called sexually eggs from getting implanted.
transmitted diseases (STD) or veneral diseases (VD) or 15. In the case of a couple where a man is having a very
reproductive tract infections (RTI). It can be low sperm count, the sperm cannot travel the female
transmitted by sharing injection needles, surgical genital tract to get fertilized due to its low count. So,
instruments, etc., with infected persons, transfusion of the artificial insemination technique is used to get
blood, or from an infected mother to the foetus too. sperm fertilized inside the female. In this technique,
[Note: Kissing is considered to be low risk, with the sperm is introduced into a female's vagina or/and
respect to veneral disease.] the uterine cavity for the purpose of achieving a
9. Diseases or infections which are transmitted through pregnancy through in-vivo fertilization by means other
sexual intercourse are collectively called sexually than sexual intercourse.
16. Gonorrhoea - Neisseria (Bacteria)
Syphilis - Treponema (Bacteria) uterus and amniotic sac during 14-16 week old
Genital Warts - Human papillomavirus (Virus) pregnancy. Amniotic fluid contains amniotic
AIDS - HIV membrane cells and foetus skin cells which are then
17. Cu2+ interfere in the sperm movement, hence suppress cultured to detect any chromosomal anomaly in the
the sperm motility inside the female reproductive tract, foetus by analysing chromosomal aberration/defects
and hence fertilising capacity of sperms get and also for disclosing the sex of the foetus. Down
suppressed. syndrome is an autosomal disorder (genetic disorder),
18. The uterus is the site of embryo implantation. Fusion caused by an extra copy of chromosome number 21
of the sperm and egg outside the body of the female is and therefore, can be detected by amniocentesis. Cleft
the technique used for in vitro fertilisation. In this, palate is caused by both genetic and environmental
implantation of fertilised egg into the uterus of the factors and can not always be detected using
female is done at the 16 celled stage. The 16 celled amniocentesis.
stage is known as a morula. Therefore, the correct 23. GIFT is Gamete Intra Fallopian Transfer technique
answer is option d. which includes transfer of an ovum collected from a
19. Vas deferens transports sperm from epididymis to donor into the fallopian tube of another female who
ejaculatory duct. Vasectomy refers to the surgical cannot produce a baby, but can provide a suitable
method in which vasa deferentia in human males are environment for fertilisation and further development.
cut and sealed. After this, the seminal fluid devoid of 24. LNG – 20 is a hormone releasing intrauterine device
sperms. Sperms are present in epididymis but not in the (IUD) which prevents implantation and makes the
ejaculatory duct. It is an irreversible method of surgical cervix hostile to sperms.
contraception. Therefore, the correct answer is option 25. Tubectomy is a method of sterilisation in which a
a. small part of the fallopian tube is removed or tied up
20. Lippes loop is IUD impregnated with barium sulfate. which prevents the movement of egg to reach the site
Copper releasing IUDs, namely CuT, Cu7, Multiload of fertilisation.
375 etc, release copper that suppresses the sperm 26, In vitro fertilisation (IVF), ova from the wife/donor
motility which in turn reduces its fertilizing capacity. (female) and sperms from the husband/donor (male)
LNG-20 is IUD that releases 20 micrograms/day of are collected and are induced to form zygote under
levonorgestrel (LNG) which causes endometrial simulated conditions in the laboratory and then the
atrophy and inhibits implantation. It also increases zygote is transferred into the fallopian tube.
sperm phagocytosis in the uterus. 27. Introduction of sperms from a healthy donor into the
21. Vasectomy is a sterilization method in male in which vagina artificially is known as artificial insemination.
they are capable of ejaculation, but the latter consists 28. Amniocentesis is a test to determine the chromosomal
only of secretions of various glands, and has no pattern in the foetal cells within the amniotic fluid
sperms. Sperms are still produced but reabsorbed into surrounding the developing foetus. Jaundice is not a
the body. In barrier methods, ovum and spermatozoa chromosomal disease and thus cannot be detected by
are prevented from coming closer with the help of amniocentesis.
barriers so that fertilization does not occur. Intrauterine 29. One of the legal methods of birth control is abortion by
devices increase phagocytosis of spermatozoa within taking an appropriate medicine with the prescription of
the uterus and the Cu ions released by some IUDs a registered medical partitioner under supervision
suppress motility of sperms as well as their fertilizing within the legally allowed general time limit.
capacity. The hormone releasing IUDs, in addition, 30. IUDs' (Intra uterine devices)
turns the cervix hostile to spermatozoa and brings 31. Twelve weeks
changes in the uterus making it unsuitable for 32. Either zygote or early embryo upto 8 cell stage
implantation. Birth control pills(oral contraceptives) 33. Detecting any genetic abnormality
check ovulation in females by inhibiting the secretion 34. Suppress sperm motility
of FSH and LH that are necessary for ovulation. 35. 1 = (c), 2 = (a), 3 = (d), 4 = (b)
22. Amniocentesis includes extraction of amniotic fluid by
insertion of the needle through the abdomen into the
PRINCIPLES OF INHERITANCE AND VARIATION

(SOLUTIONS)
1. Alfred Sturtevant 9. In organisms like crickets, grasshoppers, and some
2. When a single gene can exhibit multiple phenotypic other insects, the female is XX and is the homogametic
expression. Such a gene is called a pleiotropic gene. sex. The male is the heterogametic sex but only has
3. A. Down’s syndrome was first described by Langdon one sex chromosome. The male in XX-XO systems
Down (1866). produces gametes with (X) or without (O) a sex
C. The affected individual is not short-statured. chromosome.
D. Physical, psychomotor and mental development is 10. Myotonic dystrophy is an autosomal dominant
not retarded. disorder, while both sickle cell anemia and thalassemia
4. Down’s syndrome are autosomal recessive diseases, and haemophilia is a
5. Habitat loss and fragmentation is the most important sex-linked recessive disease.
cause driving animals and plants to extinction. 11. Mendel’s law of Independent assortment states that the
6. The separated DNA fragments can be visualised only alleles of two different genes get sorted into gametes
after staining the DNA with a compound known as independently of one another. However, after
ethidium bromide followed by exposure to UV Morgan’s experiment, it was found that if the genes are
radiation. Bright orange coloured bands of DNA are grouped on the same chromosome, some genes were
visible in a ethidium bromide stained gel exposed to very tightly linked (showed very low recombination)
UV light. while others were loosely linked (showed very high
7. recombination). Due to the process of crossover or
recombination, there is a chance for two genes on the
List I List II same chromosome to behave independently or as if it
A. Logistic II. Limited resource is linked. Two different genes situated close together
growth availability condition on the same chromosome tend to be inherited together,
B. Exponential I. Unlimited resource hence the law of Independent assortment does not hold
growth availability condition goods for the genes that are located closely on the
C. Expanding III. The percent individuals of same chromosome. The isolation of alleles into
age pyramid pre-reproductive age are lar gametes can be under the influence of linkage. The
reproductive and post- assertion statement is correct but the reason is false.
reproductive age groups 12. The frequency of recombination between gene pairs on
gest followed by the same chromosome can be used to measure the
reproductive and post- distance between genes. The distance between two
reproductive age groups genes is equal to this recombination frequency. If
D. Stable age IV. The percent individuals of genes are located on the same chromosome, some
pyramid pre-reproductive and genes can be very tightly linked hence showed very
reproductive age group are low recombination and low recombination frequency.
same If genes are loosely linked, they show higher
recombination (high recombination frequency). As the
8. Mendel studied seven pairs of contrasting traits in pea recombination frequency is smallest in case of a and c,
plants and proposed the Laws of Inheritance. These it means they are closely located to each other (linked
seven pairs of contrasting traits were seed shape, seed genes). Recombination frequency of a and c is slightly
colour, flower colour, pod shape, pod colour, flower higher but they can also be linked. The recombination
position and stem height. frequency of a and d is highest hence the chances are
more for these two genes to be located far apart. The
correct sequence will be a-c-b-d.
13. Colour blindness is a sex-linked recessive disorder due blood cells that carries oxygen throughout the body.
to defect in either red or green cone of eye resulting in This is an autosomal inheritance.
failure to discriminate between red and green colour. Hemophilia is caused by a mutation or change, in one
This defect is due to mutation in certain genes present of the genes, that provides instructions for making the
in the X chromosome. The female is colour blind clotting factor needed to form a blood clot. This
which means she is homozygous (XCXC) for the change or mutation prevents either the formation of
disorder. The man she is marrying is also colorblind clotting protein or its proper functioning. These genes
(XCY). Males have only one X chromosome and are located on the X chromosome.
females have two. The XC in male is coming from his Phenylketonuria or PKU is inherited in families as an
mother’s side. autosomal recessive pattern. A birth defect that causes
If a female (XCXC) marries a man (XCY), the chances an amino acid called phenylalanine to accumulate in
of her progeny having color blindness is 100% . If they the body.
have girls, all of them will be getting diseased X 18. Thomas Hunt Morgan, who studied on fruit flies,
chromosomes (one from mother and one from father). provided the first strong confirmation of the
If they have boys, all of them will be getting the chromosomal theory. Morgan discovered a mutation
diseased X chromosome from their mother. that affected fly eye color. The chromosomal theory of
14. The production of gametes by the parents, the inheritance states that genes are found at specific
formation of the zygotes, the F1 and F2 plants can be locations on chromosomes.
understood from a diagram called Punnett Square. It 19. When and are present together they both express their
was developed by a British geneticist, Reginald C. own types of sugars, because of codominance. Hence
Punnett. It is a graphical representation to calculate the red blood cells have both A and B types of sugars.
probability of all possible genotypes of offspring in a 20. In translation the first phase is activation of amino
genetic cross. The possible gametes are written on two acids in the presence of ATP. The activated amino
sides, usually the top row and left columns. All acids are then linked to their cognate tRNAs, a process
possible combinations are represented in boxes below commonly called as charging of tRNA or
in the squares, which generates a square output form. aminoacylation of tRNAs.
15. According to given question; 21. In birds female heterogamety is found thus sex of
progeny depends on the types of egg rather than the
type of sperm.
Total number of affected progenies = 1

∴ Percentage of diseased/affected progenies
= ¼ × 100 = 25% 22.
16. A true breeding line refers to the plant that on self
pollination continuously produces offspring of similar
characters and are stable in the inheritance of the
character.
Mendel selected 14 true-breeding pea plant varieties,
as pairs, which were similar except in one character
with contrasting traits.
17. Sickle cell anaemia is an autosome linked recessive
trait that can be transmitted from parents to the
offspring when both the partners are carriers for the We can observe in the above image that no change in
gene (or heterozygous). The disease is controlled by a the reading frame of m-RNA will take place if GGU
single pair of allele, HbA and HbS on chromosome - from 7th , 8th and 9th position is deleted.
11. The defect is caused by the substitution of 23. 1 map unit represents 1 % crossover. Map unit is used
Glutamic acid (Glu) by Valine (Val) at the sixth to measure genetic distance. This genetic distance is
position of the beta globin chain of the haemoglobin based on the average number of cross over or
molecule. The substitution of amino acid in the globin recombinant frequency.
protein results due to the single base substitution at the 24. Genes for flower colour in Snapdragon shows
sixth codon of the beta globin gene from GAG to incomplete dominance which is an exception of
GUG. Mendel's first principle i.e. Law of dominance.
Thalassemia is caused by mutations in the DNA of Whereas the Law of segregation is universally
cells that make hemoglobin — the substance in red applicable.
25. Individuals with Klinefelter's syndrome have trisomy
of sex chromosome as 44 + XXY (47). They show
overall masculine development, gynaecomastia and are color. The nature of trichomes i.e., glandular or non-
sterile. glandular was not considered by Mendel.
26. Alfred Sturtevant explained chromosomal mapping on 36. The given question can be explained with the help of
the basis of recombination frequency which is directly the Punnett square. The genotypes of a husband and
proportional to distance between two genes on the wife are IAIB and IAi.
same chromosome. its unit is centimorgan or map unit. Husband × Wife
27. Progressive degeneration of skeletal muscle mostly due
to genetic disorder is muscular dystrophy whereas
tetany is muscular spasm due to low calcium in body
fluid. Myasthenia gravis is an autoimmune disorder
leading to paralysis of skeletal muscles. Botulism is a
rare and dangerous type of food poisoning caused by
bacterium Clostridium Botulinum.
28. Inheritance of human blood group show following
characteristics: Four different possible genotypes of their children
1. IAIO, IBIO – Dominant-recessive relationship. = 4, i.e., IAIB, IAi, IBi, IAIA
2. IAIB – Codominance The possible number of phenotypes of their children
IA, IB & IO – 3-different allelic forms of a gene are= 3
(multiple allelism) Blood group A= IAIAIAi
29. If a woman has an X-linked condition on one of her X Blood group B = IBi
chromosomes then she is a carrier. Both son & Blood group AB= IAIB
daughter inherit X-chromosome, although the only son 37. Colour-blindness is a X linked recessive disorder. The
will be diseased. son will carry the X chromosome from the mother
30. Starch synthesis in a pea plant is controlled by one which is normal homozygous. Hence son will be
gene but it shows multiple effects. This type of gene is normal.
called the pleiotropic gene and the phenomenon is The genotype of colourblind husband is XCY and the
called pleiotropy. genotype of normal wife is XX. Parents…. Husband ×
31. T.H.Morgan proposed the concept of linkage. Wife
Cross involving an F2 generation × Recessive parent is Genotype…. XCY × XX
called a test cross. Gametes….. XC, Y × X, X
A ribozyme is a catalytic RNA, which is a nucleic acid.
G.Mendel proposed the law of inheritance. X Y
32. Mendel conducted hybridization experiments on the XC XC X XC X
Pea plant for 7 years between 1856 to 1863 and his Y XY XY
data was published in 1865
33. Thalassemia differs from sickle-cell anaemia in that 38. A plant having either dominant or recessive allele of a
the former is a quantitative problem of synthesising too gene is said to be pure breeding or homozygous for
few globin molecules while the latter is a qualitative that gene or trait. Due to the presence of both similar
problem of synthesising an incorrectly functioning types of allele, pure-breeding plants produce progeny
globin. Both thalassemia and sickle cell anemia are of their own kind. A cross pollination of two unrelated
genetic disorders in which hemoglobin synthesis is plants produces heterozygous plants having one
affected. dominant and one recessive allele for a gene. Pure
34. Down’s syndrome is caused by the nondisjunction of breeding plants are obtained by self-pollination only.
the 21st chromosome. It is caused due to the trisomy of Therefore, the correct answer is option b.
the 21 chromosome which is an autosome. It is mainly 39. Linkage group refers to number of types of
caused due to the nondisjunction of the chromosomes. chromosome present in species. Humans have 22
Nondisjunction is the condition when the sister autosomal linkage groups, one X and one Y linkage
chromatids fail to separate during cell division. group. Rearrangement of chromosomal segment
Turner's Syndrome- Lack of one of the X between two non homologous chromosomes i.e.
chromosomes i.e 45 with XO. Translocation moves genes of one linkage group to that
Klinefelter's Syndrome- In this, an additional copy of of another, which occurs due to an induced
X chromosomes is present i.e., 47 with XXY. abnormality and is not part of the regular cell cycle.
Sickle cell anemia- Autosomal recessive condition Inversion and duplication cause rearrangement of
which occurs due to single base substitution. genes on the same chromosome.There is a change in
35. During his experiments, Mendel studied seven the order of genes within the same linkage group.
characters. The 7 characters studied by Mendel using Crossing over results in exchange of genes between
the pea plant were stem height, flower color, flower two homologous chromosomes. A process that occurs
position, pod shape, pod color, seed shape, and seed during
Meiosis I resulting in recombination. 47. The genotype of husband for colour blindness is XCX
Therefore, the correct answer is option b. and the genotype for normal women is XX.
40. The linkage is the tendency of closely placed genes on
a chromosome to stay together during inheritance (no Parents…. Husband × Wife
crossover and independent assortment). Completely Genes…. XCY × XX
linked genes do not show crossover and independent Gametes….. XC, Y × X, X
assortment; thereby produce only parental XC Y
combinations. Linked genes are the genes which are X XXC XY
closely located on the same chromosome. Option A is X XXC XY
incorrect as genes present on different chromosomes Hence, the probability of their son being colour-blind
exhibit crossing over to make more recombinant is 0 and their children will be normal if they marry a
offspring; not linkage. Option B is incorrect as a failure woman with normal sight (neither carrier nor colour
of chromosomes to separate during meiosis results in blind).
chromosomal abnormalities. Option D is incorrect as i. If the carrier daughter marries a normal man then
the production of recombinant and parental offspring is 50% of their grandsons will be colour blind as
determined by presence or absence of crossing over;
not by type of inheritance. Parents…. Husband × Wife
41. Hemophilia A and hemophilia B are inherited in an X- Genes…. XY × XCX
linked recessive pattern. The genes associated with
Gametes….. XY × XC, X
these conditions are located on the X chromosome,
X Y
which is one of the two sex chromosomes. Aneuploidy
XC XCX XCY
refers to a condition when there is an abnormal number
of chromosomes. Down syndrome, also known as X XX XY
trisomy 21, is a genetic disorder caused by the ii. If the carrier daughter marries a colour blind man
presence of all or part of a third copy of chromosome then 50% of the grandsons will be colour blind, 50% of
21. PKU is an autosomal recessive disorder, caused by the granddaughters will be colour blind and 50% of
mutations in both alleles of the gene for phenylalanine granddaughters will be carriers.
hydroxylase (PAH), found on chromosome 12. Sickle
cell anemia is inherited as an autosomal (meaning that Parents…. Husband × Wife
the gene is not linked to a sex chromosome) recessive Genes…. XCY × XCX
condition. This means that the gene can be passed on Gametes…..XCY × XC, X
from a parent carrying it to mal and female children. XC Y
42. (a) Dominance - (ii) In a heterozygous organism only XC XCXC XCY
one allele expresses itself. (b) Codominance - (iii) In a X XCX XY
heterozygous organism both alleles express themselves So, in both cases, the result shows that 50% of
fully. (c) Pleiotropy - (iv) A single gene influences grandsons will be colourblind which in terms of overall
many characters. (d) Polygenic inheritance - (i) Many progenies (son + daughters) comes as 25%, thus
genes govern a single character confirming the probability as 0.25.
43. Mendel crossed a pure tall plant (TT) with a pure 48. The given pedigree shows autosomal recessive
dwarf plant (tt). In the F1 generation, tall plants are disorder in which the individual inherits two mutated
formed (Tt). When F1 plants are subjected to self- genes, one from each parent and are expressed only
pollination, in the F2 generation, 3 tall plants and 1 when the offspring is homozygous recessive. The
dwarf plants are formed. In this one homozygous tall heterozygous individuals are the carriers having 25%
plant (TT), 2 heterozygous tall plants (Tt), one chance of having an unaffected child with normal
homozygous dwarf plant (tt) are formed. The genes, 50% chance of having an unaffected child who
phenotypic ratio is 3:1, genotypic ratio is 1:2:1. also is a carrier and a 25% chance of having an
44. Haemophilia is X-linked recessive gene disorder. It is a affected child with recessive genes.
blood clotting disorder and shows criss-cross 49. T.H. Morgan carried out several dihybrid crosses in
inheritance. In this, characters from father are Drosophila to study genes that were sex-linked and
transmitted to daughter and from mother to son. coined the term ‘linkage’.
45. A pleiotropic gene is a single gene that controls more 50. When both alleles of a pair are fully expressed in the
than one trait in an individual. heterozygote, the genes and traits are said to be
46. In Mendel’s experiments on pea plants, the contrasting codominant.
trait pod length was not used. Mendel used traits such 51. Turner’s syndrome results due to loss of an X
as seed colour, seed shape, pod shape, pod colour, chromosome in human females and has 45
flower colour, plant height and position of flowers for chromosomes with XO.
his experiments. 52. Colour blindness is an autosomal recessive disorder
present on the X chromosome. Thus, a man whose
father was colour blind will be normal (XY), marries a 65. Type O
woman who had a colour blind mother and a normal 66. Heterosis
father, i.e. the woman will be a carrier (XXC). 67. Alleles do not show any blending and both the
When the carrier woman marries a normal man then characters recover as such in F2 generation
50% of their son will be colour blind as 68. Test cross
Parents….. Husband × Wife 69. Four
Genes…. XY × XcX 70. Tightly linked genes on the same chromosome show
Gametes…. X, Y × Xc , X very few recombination
71.
X Y
X C X CX X CY 72. Change in single base pair
X XX XY 73. Caused by a change in a single base pair of DNA
Hence, the probability of the male child being colour 74. Inheritance of a condition like phenylketonuria as an
blind would be 50%. autosomal recessive trait
53. Fruit colour in squash is an example of dominant 75. No antigens A and B on RBCs
epistasis in which the dominant/epistatic gene masks 76. Baldness is a sex limited trait
the effect of recessive gene giving it a white colour 77. Autogamy, but not geitonogamy
appearance. In summer squash, the fruit colour may be 78. All mutations, whether dominant or recessive are
white, yellow or green. White fruits are produced by a expressed in haploids
domain epistatic allele 'W'. At another locus, Y for 79. Polygenic inheritance
yellow fruits is dominant to its allele y for green fruits. 80. Crossing of one F1 progeny with male parent
Dominant white hides the effect of yellow or green. A 81. Higher number of the parental types
consequence of this dominant epistasis is that the 82. 50 : 50
hybrid ratio is modified into 12 white: 3 yellow: 1 83. AaBb
green. So, dominant epistasis suppresses the expression 84. Genotype and environment interactions
of a non-allelic gene (dominant or recessive). 85. Cytoplasmic
54. Thalassaemia is an autosomal recessive disease. Each 86. Two
carrier will have frequency of 1/2 for the disease 87. Skin colour in humans
occurrence. Hence overall will be 1/2*1/2=1/4=25% 88. Round seeds with yellow cotyledons, and wrinkled
55. Haemophilia is a sex-linked recessive disease in which seeds with yellow cotyledons
a single clotting factor protein is affected. 89. Crossing the F1 hybrid with a double recessive
56. In codominance, the alleles from both parents are genotype
expressed in the F1 generation. Therefore, it resembles 90. All colourblind
both parents. Individuals receive one version of a gene, 91. Loss of half of the short arm of chromosome 5
called an allele, from each parent. If the alleles are 92. It provides immunity against malaria
different, the dominant allele usually will be expressed, 93. Congenital disorders
while the effect of the other allele, called recessive, is 94. 0.48
masked (Law of dominance). In incomplete 95. aabb
dominance, progeny does not resemble either of the 96. Cretinism
two parents. The dominant allele does not completely 97. May be colour blind or may be normal vision
mask the effects of recessive allele. 98. TATA box
57. When IA and IB antigens are present together within the 99. This disease is due to an X-linked recessive mutation
RBCs, they both express their own type of sugar on the 100. Down syndrome
surface of RBCs. This phenomenon is called 101. Sex-linked recessive
codominance. 102. 50% colour-blind
58. Tightly linked genes have 0% recombination 103. Expressed in males
frequency. 104. Transition
59. (NCERT, Class-XIIth, Page No. 117) 105. 1/8
60. (NCERT, Class-XIIth, Page No. 74) 106. 8 different gametes and 64 different zygotes
61. Criss cross inheritance is present in X-linked character 107. Linkage
ex-Haemophilia. 108. AB
62. Point mutation NCERT pg. 113 (Class-XII) 109. 50% will be tall with red fruit
63. Gamma radiation 110. Protein structure
64. XO type of sex chromosomes determine male sex in 111. None of the progenies
grasshopper 112. Tetraploidy
MOLECULAR BASIS OF INHERITANCE (SOLUTIONS)

1. Alfred Hershey and Martha Chase binding of RNA polymerase on the promoter sequence.
2. There are at least three RNA polymerases in the Lactose in the medium, which is the inducer, cannot
nucleus (in addition to the RNA polymerase found in bind to the repressor because of the mutation.
the organelles). The RNA polymerase I transcribes Thus if the operator is blocked by the repressor, there
rRNAs (28S, 18S, and 5.8S), whereas the RNA will be no transcription and the structural genes z, y
polymerase III is responsible for transcription of and a will not get transcribed and translated.
tRNA, 5srRNA, and snRNAs (small nuclear RNAs). 15. The length between two base pairs is 0.34nm.
The RNA polymerase II transcribes precursor of Total length of double helix DNA = total number of
mRNA, the heterogeneous nuclear RNA (hnRNA). base pairs * distance between two bp
3. All genes that are expressed as RNA. Hence, total no. of base pairs =
4. 80 (Total length of double helix DNA) / (distance between
5. A probe is a single-stranded sequence of DNA or RNA two bp)
used to search for its complementary sequence in a 1.1m/0.34 nm
sample genome. = (1.1 x 109 nm) / (0.34 nm)
6. = 3.235 x 109 base pairs
List I List II = 3.3 x 109 base pairs
A. Gene ‘a’ II. Transacetylase 16. The bacterium Escherichia coli can divide every 20
B. Gene ‘y’ III. Permease minutes. Therefore, in 60 minutes, 3 rounds of
C. Gene ‘I’ IV. Repressor protein divisions will take place.
D. Gene ‘z’ I. β-galactosidase First round of division:
20 daughter cells are formed from the 10 parent E. coli
7. Statement I: In prokaryotes, the negatively charged cells. All 20 cells have hybrid 15N-14N DNA.
DNA is held with some positively charged proteins in Second round of division:
a region called nucleoid. Each DNA forms two daughter cells, one of which is a
8. Both Statement I and Statement II are true. hybrid and the other is completely 14N-14N. Therefore,
9. 5′ ATCGATCGATCGATCGATCGATCGATCG 3′ 20 cells form 40 daughter DNA molecules, out of
10. Translation of mRNA or protein synthesis starts when which 20 are hybrids and 20 are free from 15N.
the small subunit of the ribosome encounters an Third round of division:
mRNA. 20 14N-14N cells from the previous generation give rise
11. Polymorphism in DNA is the basis of DNA to 40 14N-14N cells
fingerprinting and genetic mapping. Satellite DNA 20 hybrid cells from the previous generation give rise
shows a high degree of polymorphism or variation, to 20 hybrids + 20 14N-14N cells.
which is why satellite DNA regions are important in Therefore, the total number of 14N-14N cells at the end
DNA fingerprinting. of 3 rounds of division is 40+20 = 60.
12. Heterochromatin are regions of DNA that are tightly 17. Francis Crick proposed the Central dogma in
packed with histone proteins and are transcriptionally molecular biology, which states that genetic
inactive, contrary to euchromatin. A nucleosome information flows from DNA-RNA-Protein.
typically contains 200 bp of DNA helix.
13. One of the methods of sequencing the entire genome of
human beings in the Human Genome Project, was the
Sequence annotation method. This blind approach
involved sequencing the whole genome (coding and 18. The strand which does not code for anything is referred
non-coding) and later assigning functions to the to as the coding strand. The non-coding or template
different regions. strand is copied to an mRNA. RNA polymerase
14. The i gene codes for the repressor of the lac operon. associates with ρ factor (Rho factor) and it alters the
An inducer (allolactose or an analog) binds to the specificity of the RNA polymerase to terminate the
repressor and prevents its binding to the operator, processes. In eukaryotes, the monocistronic structural
thereby releasing the repression and allowing genes have interrupted coding sequences – the genes in
transcription of the lac operon. eukaryotes are split. In capping an unusual nucleotide
If the i gene is mutated in such a way that the repressor (methyl guanosine triphosphate) is added to the 5'-end
molecule is unable to bind with the inducer, the of hnRNA.
repressor which is now free from the inducer will now 19. DNA fingerprinting involves identifying differences in
bind to the operator sequence. This will prevent the some specific regions in a DNA sequence called
repetitive DNA because, in these sequences, a small double helix in a typical mammalian cell is around 6.6
stretch of DNA is repeated many times. These × 109 bp × 0.34 × 10-9 m/bp = 2.2 metres.
repetitive DNA are separated from bulk genomic DNA 28. RNA polymerase holoenzyme binds to the promoter,
as different peaks during density gradient unwinds DNA (open complex) and forms
centrifugation. phosphodiester bonds between the incoming
20. RNA polymerase III is responsible for the transcription nucleotides. DNA polymerase, DNA ligase & DNA
of tRNA, 5srRNA, and snRNAs (small nuclear RNAs). helicase are involved in the process of replication and
The RNA polymerase II transcribes a precursor of not in transcription.
mRNA, the heterogeneous nuclear RNA (hnRNA). 29. In translation the first phase is activation of amino
The RNA polymerase I transcribe rRNAs. acids in the presence of ATP. The activated amino
21. siRNA are small interfering RNA also called silencing acids are then linked to their cognate tRNAs, a process
RNA. It is a class of double-stranded RNA, non-coding commonly called as charging of tRNA or
RNA molecules. mRNA is messenger RNA that carries aminoacylation of tRNAs.
genetic information provided by DNA. tRNA carries 30. Expressed Sequence Tags (ESTs) are DNA sequences
amino acids to the mRNA during translation. rRNA is (genes) that are expressed as mRNA for protein
structural RNA that forms ribosomes that are involved synthesis. These are used in the Human Genome
in translation. Project.
22. Erwin Chargaff proposed three rules which are termed 31. In lac operon
Chargaff's rules. These rules played an important role
in the discovery of the double-helix structure of DNA, Column I Column II
they are (A) i gene Repressor
1. In any double-stranded DNA, the number of guanine (B) z gene β-galactosidase
units equals the number of cytosine units whereas the (C) y gene Permease
number of adenine units equals the number of thymine (D) a gene Transacetylase
units (i.e no of A = no of T and no of C = no of G and
vice versa ). 32. Purines found both in DNA and RNA are adenine and
2. The sum of purines (A and G) equals that of guanine, whereas pyrimidine, cytosine, and thymine
pyrimidines (C and T). The composition of DNA are found in DNA, and cytosine and uracil are found in
varies from one species to another. RNA.
According to the question, the percentage of adenine is 33. In recombinant DNA technology bacteria is able to
30. Thus, the percentage of thymine will be 30 as per produce human insulin because genetic code is nearly
the first rule. The sum of A and T would be 60 %. The mRNA.
remaining % of bases is 40% which has to be divided 34. Coding strand and mRNA have the same nucleotide
equally between G and C since no of G= no of C. Thus sequence except, ‘T’-Thymine is replaced by ‘U’-
G=C=20%. Uracil in mRNA.
23. In prokaryotes, the DNA-dependent RNA polymerase 35. Enhancer sequences are present in eukaryotes.
is a holoenzyme that is made of polypeptides. It is Operon concept is given for regulation of gene
responsible for initiation, elongation, and termination expression in prokaryotes.
during transcription. DNase degrades DNA. DNA- 36. Francois Jacob and Jacque Monod proposed a model of
dependent DNA polymerase is involved in the gene regulation in bacteria E. coli known as lac
replication of DNA. DNA ligase joins the operon.
discontinuously synthesized fragments of DNA. - Alec Jeffreys proposed DNA fingerprinting
24. AUG has dual functions, it codes for methionine. It technique.
also acts as an initiator codon. AUG does not code for - Matthew Meselson and F.Stahl proved
phenylalanine. Statement II is true. semiconservative DNA replication in E. coli.
25. Histones are rich in basic amino acids residue lysine - Alfred Hershey and Martha Chase proved DNA is the
and arginine with charged side chains. There are five genetic material not protein by experiment on
types of histone proteins i.e., H1 , H2A, H2B, H3, and bacteriophage.
H4 . Four of them occur in pairs to produce a unit of 8 37. Semi-conservative DNA replication was proved by
molecules (histone octamer). The pH of histones is Matthew Meselson and Franklin Stahl by their
basic. experiment in the bacterium Escherichia coli.
26. In the double helix of DNA adenine pairs with thymine 38. Punnett square was developed by a British geneticist,
through two hydrogen bonds and guanine pair with Reginald C. Punnett.
cytosine through three hydrogen bonds. - Franklin Stahl proved a semi-conservative mode of
27. A diploid cell of human genome contain 6.6 × 10 9 base replication.
pairs. The distance between two consecutive base pairs - Transduction was discovered by Zinder and
is 0.34 nm (0.34 × 10-9m), so the length of DNA Lederberg.
- Spliceosomes take part in a post-transcriptional 49. A genetic material should be chemically and
modification in Eukaryotes. structurally stable so as to maintain its integrity with
39. DNA (Deoxyribonucleic acid) is made up of a age, cell cycle and different physiology of individuals.
deoxyribose sugar, phosphate group, and nitrogenous At the same time, it should be prone to random
bases. DNA fragments are negatively charged because changes that impart genetic variations and serve as raw
of the presence of a phosphate group. The phosphate material for evolution.
groups are negatively charged and they impart a Inheritance of genetic material requires its replication
negative charge to DNA. with each cell division to ensure its transmission to
40. Spliceosomes are used in the removal of introns during progeny.
post-transcriptional processing of mRNA in eukaryotes It should carry the information required for regulation
only as split genes are absent in prokaryotes. of whole cell functioning and the information should
41. The association of histone H1 protein indicates the be expressed as functional proteins.
complete formation of the nucleosome. Histone So, the correct answer is option B.
proteins are the proteins that coil around the DNA in 50. Bacteria have 70S ribosomes. The 30S subunit has 16S
the eukaryotes and forms a rigid structure known as rRNA and 50S subunit has 23S and 5S rRNA. 23S
nucleosomes. Therefore, the DNA is in condensed rRNA has peptidyl transferase activity and catalyzes
form. the synthesis of peptide bond formation between amino
42. DNA replication in bacteria occurs prior to fission. The acids in bacteria. This rRNA also serves as a structural
formation of new DNA from parent DNA is called component for a large subunit of bacterial ribosome.
DNA replication. In bacteria, DNA replication prior to Therefore, the correct answer is option b.
fission. It occurs with the help of mesosomes. 51. Structural genes are the continuous stretch of DNA that
43. Ribosomal RNA or rRNA is most abundant in animal regulates a particular genetic trait. A cistron is defined
cells. It constitutes 80% of the total RNA of the cell. It as a unit of function that exhibits cis-trans test and is
provides the site for protein synthesis. The rRNA is synonymous with the gene. Muton is the smallest unit
single-stranded and shows the presence of intra-chain in a chromosome that can be changed by mutations.
hydrogen bonds. The smallest unit capable of undergoing recombination
44. If deletion occurs at the 901st position then the first 900 is called recon. A cistron has multiple recons and
bases will be normal. The remaining 99 bases will be mutons. An operon is a functioning unit of DNA
altered. 3 bases stand for 1 codon, so, 99 bases = 33 containing a cluster of genes under the control of a
codons will be altered due to deletion of one base at single promoter. Therefore, the correct answer is
901 position. option a.
45. Two DNA polymerase molecules work simultaneously 52. Codons are the nucleotide base triplets that specify a
at the DNA fork, one on the leading strand and the particular amino acid in proteins. The start codon
other on the lagging strand. Each Okazaki fragment is specifies the first codon of mRNA transcript that is
synthesized by DNA polymerase at a lagging strand in translated. It codes for methionine in eukaryotes and
a 5 ′ → 3′ direction. New Okazaki fragments appear as modified methionine in prokaryotes. "AUG '' is the
the replication fork opens further. As the first Okazaki most common start codon. The remaining are stop
fragment appears away from the replication fork, the codons.
direction of elongation would be away from the 53. Polymerase chain reaction is used to amplify DNA into
replication fork. large amounts. Zinc finger is a kind of structural motif
46. Hershey and Chase gave unequivocal proof which that is characterized by coordination between zinc ions
ended the debate between protein and DNA as genetic to stabilize the tertiary structure of proteins. Restriction
material. They proved that the bacteriophages inject enzymes are the endonucleases that make a cut at
their genetic material into the host cell leaving their specific positions within the DNA. DNA-DNA
protein coat outside the cell. hybridisation is a technique of molecular biology
47. Taylor treated root tip cells of Vicia faba with which is used to measure the similarity between DNA
radioactive thymidine to label the DNA and then grew sequences. Hence, zinc finger analysis which is related
them in the normal medium to demonstrate semi- to proteins, is not required for DNA.
conservative mode of chromosome replication. 54. The lac z, lac y, and lac a genes in lac operon are the
Therefore, the correct answer is option a. structural genes that code for beta-galactosidase
48. The template DNA strand serves in RNA synthesis (converts lactose into glucose and galactose), beta-
during transcription is also called anticoding or galactoside permease (transports lactose into the cell)
antisense strand while the other strand is called coding and beta- galactoside transacetylase respectively. In the
or sense strand as its base sequence is same as that of presence of lactose, allolactose; an isomer of lactose,
newly synthesized mRNA. binds to the repressor and causes an allosteric shift.
Therefore, the correct answer is option d. The altered repressor cannot bind to the operator,
allowing RNA polymerase to transcribe the lac genes.
Thus lactose is required for expression of the lac 62. Transcription is the process of formation of m-RNA
operon. from DNA during protein synthesis. It is not writing
55. Satellite DNA is important because it shows a high information from DNA to t-RNA.
degree of polymorphism in population and also the 63. Commonly used vectors for human genome
same degree of polymorphism in an individual, which sequencing are BAC (Bacterial Artificial
is heritable from parents to children and thus, forms the Chromosome) and YAC. BAC is a DNA construct,
basis of DNA fingerprinting. based on a functional fertility plasmid (F plasmid) used
56. The part of Ti plasmid transferred into plant cell DNA for transforming and cloning in bacteria ( E.coli ).
is called t-DNA. Ti plasmid (tumour inducing) from Yeast artificial chromosomes (YACs) are genetically
the soil bacterium Agrobacterium tumefaciens . engineered chromosomes derived from the DNA of the
Agrobacterium tumefaciens a plant pathogenic yeast, Saccharomyces cerevisiae, which is then ligated
bacterium that carries Ti plasmid. into a bacterial plasmid. By inserting large fragments
It can transfer a particular segment of the tumor- of DNA, from 100–1000 kb, the inserted sequences
inducing (Ti) plasmid into the nucleus of infected cells. can be cloned and physically mapped using a process
The transferred T-DNA is then integrated into the host called chromosome walking.
genome and transcribed with it. 64. The mRNA is synthesised on the DNA template in 5′ –
This ability of Agrobacterium tumefaciens to transfer 3′ direction and so, successive nucleotides are attached
the T-DNA in the host genome is explored in genetic at the 3’–OH end of the growing mRNA strand. The
engineering to transfer the desired DNA segment, strand that has the polarity 3′ – 5′ acts as a template,
carrying the gene of the interest, into the genome of and is also referred to as template strand.
selected organisms. 65. Nonsense mutation is a point mutation that results in a
57. Balbiani rings are large uncoiled regions of polytene premature stop codon that terminates transcription.
chromosomes where RNA transcription and protein Because the nonsense mutation takes place in the lac Y
synthesis occurs. gene, all enzymes coded before the lac Y gene will be
58. Genome is the total genetic material of an organism. transcribed, and hence, only β − galactosidase will be
Chromosome is the packed DNA molecule in the synthesized.
nucleus of the cell. Gene is the unit of inheritance 66. The central dogma of molecular biology represents the
located on chromosomes. Nucleotide is one of the flow of genetic information from DNA --> RNA -->
structural components or building blocks of DNA and Protein.
RNA. i. It was proposed by Francis Crick and can be
59. Chargaff's rule states that in the double-stranded DNA represented as below:
of an organism, the amount of adenine (A) is equal to
that of thymine (T) and the amount of guanine (G) is
equal to that of cytosine (C). Hence, Chargaff's rule is
not applicable to RNA as it is single-stranded and this
rule is applicable on double-stranded DNA molecules.
ii. All organisms follow the central dogma with the
60. Transformation is the genetic alteration of a cell
exception of some viruses, in which the flow of
resulting from the direct uptake and incorporation of
information is opposite (DNA is formed from RNA
exogenous genetic material from its surroundings and
through reverse transcription).
taken up through the cell membrane. Transformation
iii. Process 'd' refers to transcription and 'e' refers to
was first demonstrated in 1928 by British
translation. Transcription occurs in the nucleus while
bacteriologist Frederick Griffith.
translation occurs in the cytoplasm.
61. The steps of southern hybridization includes the
iv. 'a' is the DNA and 'b' is mRNA. DNA does not
digestion of DNA or genomic source with a restriction
contain uracil.
enzyme and its separation by electrophoresis. The
v. tRNA is found only during translation, which is 'e'.
DNA is denatured into single strands by incubation
vi. Protein synthesis takes place in the cytoplasm. So 'c'
with NaOH. The DNA is transferred to a membrane
(proteins) are formed in the cytoplasm itself.
which is a sheet of special blotting paper. The DNA
Hence, statements i, ii and v are correct.
fragments retain the same pattern of the separation as
67. Pallindromic sequence are DNA sequence which are
on the gel (blotting). The blot is incubated with many
same in both strand from 5'→3' direction.
copies of a probe which is single-stranded DNA. This
68. In frogs & humans NH3 is convered into urea in liver
probe will form base pairs with its complementary
for excretion Refer CP Sheet Ecretory system,
DNA sequence and bind to form a ds DNA molecule.
elimination of nitrogenous waste
The probe is radioactive. The location of the probe is
69. 23 s RNA
revealed when it is exposed to X-ray film
70. Nucleosomes
(autoradiography). It does not involve PCR
71. (b) and (d)
(polymerase chain reaction).
72. Ambiguous
73. Forensic science 90. Antiparallel

74. HIV 91. mRNA
75. Gene 92. Beadle and Tatum
76. A codon in mRNA is read in a non-contiguous fashion 93. 3.4 nm
77. Splicing 94. The phosphate groups at the start of two DNA strands
78. Escherichia coli are in opposite position (pole)
79. Nirenberg and Mathaei 95. They cannot synthesize functional beta galactosidase
80. Adenine, Thymine — Purines 96. Reverse transcriptase
81. There are two strands which run antiparallel one in 97. Base-sugar-phosphate
5'→ 3' direction and other in 3'→ 5' 98. Endonuclease
82. UAG, UGA — Stop 99. Ribonucleoprotein
83. Neurospora crassia 100. Molecular analysis of profiles of DNA samples
84. DNA sequence 101. UAUGC
85. Polymerize in the 5'-to-3' direction and explain 3'- to 5' 102. G + C / A+ T
DNA replication 103. Moves in bi-directional way
86. Transcription factor 104. t-RNA
87. Prevent chromosome loss 105. Prototroph
88. TATA 106. Guanine rich repeats
89. Super-coiling in nucleosomes
EVOLUTION 214
EVOLUTION (SOLUTIONS)
1. Numbat, Spotted cuscus, Flying phalanger 9. Analogous organs have similar functions but different
2. In some cases of natural selection, organisms which origins. Flippers of penguins and dolphins have a
acquire a different value other than the mean value get similar function (helps in swimming). However,
selected. This is called directional selection. Penguin and dolphin are not closely related to each
3. Flippers of penguins and dolphins have a similar other, and hence their flippers have different origins
function as both help in swimming. Their origin is and are called analogous organs. Analogous organs are
different hence they are called analogous organs. the cause of convergent evolution.
Analogous structures are a result of convergent 10. S.L. Miller conducted an experiment to prove the
evolution in which different structures evolve for the theory of chemical origin. In their experiment, the
same function and hence have similarity. conditions of primitive earth were created in the
4. Change in gene frequency in a small population by laboratory. The electric discharge was stimulated into a
chance is known as genetic drift. Genetic drift has two closed flask containing CH4 , H2 , NH3 and water
ramifications, one is the bottleneck effect and another vapour at 800 ºC temperature. This proved that life
is the founder's effect. When accidentally a few originates from non- living components.
individuals are dispersed and act as founders of a new 11. According to Hugo de Vries, mutations are random
isolated population, the founder's effect is said to be and directionless. Devries believed mutation caused
observed. Crossing over which occurs during gamete speciation and hence called saltation (single-step large
formation results in genetic recombination. Mutations mutation).
are random and directionless. 12. The volume of the human brain has increased as
5. Adaptive radiation is the process of evolution of humans have evolved. As early humans faced new
different species in a given geographical area starting environmental challenges and evolved bigger bodies,
from a point and literally radiating to other areas of they evolved larger and more complex brains. Large,
geography, for example, Darwin's finches. Analogous complex brains can process and store a lot of
organs which are not anatomically similar structures information. The correct match of hominids and their
though they perform similar functions are a result of brain sizes are:
convergent evolution, for example, Wings of Homo habilis - 650-800cc
butterflies and of birds. Homologous organs are Homo neanderthalensis - 1400 cc
anatomically similar structures but perform different Homo erectus - 900 cc
functions. according to their needs, are a result of Home sapiens - 1350 cc
divergent evolution, for example, Bones of forelimbs 13. The given data shows stabilising selection as most of
in man and whale. Evolution by anthropogenic action the newborn having average weight between 3 to 3.3
means evolution due to human interference, for kg survive and babies with less and more weight have
example, Antibiotic-resistant microbes, herbicides low survival rate.
resistant varieties, and pesticide-resistant varieties. 14. Frequency of dominant allele (say p) = 0.4
6. Polar seals generally have shorter ears and limbs Frequency of recessive allele (say q) = 1 - 0.4 = 0.6
(extremities) to minimize heat loss. This is with According to Hardy Weinberg law p² + 2pq + q² = 1
reference to Allen's rule. Kangaroo rats exhibit Frequency of homozygous dominant individuals (AA)
physiological adaptation. Desert lizard shows = p2 = (0.4)2 = 0.16
behavioural adaptation. They lack the physiological Frequency of heterozygous individuals (Aa)
ability to cope-up with extreme temperatures but = 2pq = 2(0.4)(0.6) = 0.48
manage the body temperature by behavioural means. Frequency of homozygous recessive individuals (aa)
Marine fishes at depth are adapted biochemically to = q2 = (0.6)2 = 0.36
survive in great depths in the ocean. 15. In different vertebrates, bones of forelimbs are similar
7. Karl ernst von baer proposed four rules to explain the in origin and structure but their forelimbs are adapted
observed pattern of embryonic development in in different ways as per their requirement, hence an
different species, it is called Von Bare’s law of example of homology.
embryology. He disapproved of embryological support Convergent evolution is related to the evolution of
for evolution. different structures but performs the same function
8. Evolution by Anthropogenic action is because of the (analogous structure).
interference by human beings. Anthropogenic action Adaptive radiation is related to the evolution of
produced herbicide resistant weeds, drug resistant different species from a single ancestor in a particular
eukaryotes and man created breeds of domesticated area.
animals like dogs. Darwin’s Finches of Galapagos Example- Darwin finches.
islands is an example of natural selection.
EVOLUTION 215
16. Divergent evolution occurs if the origin and internal 24. Analogous structures have the same function but are
structure of the organ are the same, but due to different evolved from a different ancestor. They are the result
needs they have developed in different directions, for of the convergent evolution that different organisms
example-forelimbs, the heart, and the brain of shared a common environment. Convergent evolution
vertebrates. whereas eyes of octopus, bat and man are describes the independent evolution of similar features
examples of analogous organs showing convergent in species of different lineages. The two species came
evolution. to the same function, flying, but did so separately from
17. According to the mutation theory given by Hugo de each other. They have "converged" on this useful trait.
Vires, evolution is a discontinuous phenomenon or 25. The earliest organisms that appeared on the earth were
saltatory phenomenon/saltation. non-green and presumably anaerobes. The first beings
18. Horse belongs to order Perissodactyla of class were probably much like coacervates. As a group,
Mammalia. Perissodactyla includes odd-toed these bacteria are called heterotrophic anaerobes.
mammals. Because there was virtually no oxygen in the
Classification of Horse is as follows: atmosphere at this time, these bacteria were necessarily
Kingdom: Animalia anaerobic, meaning they did not breathe oxygen. So,
Phylum: Chordata "heterotrophic anaerobes" means they were creatures
Order: Perissodactyla which ate some naturally occurring food and did not
19. Artificial selection to obtain cow yielding higher milk breathe oxygen. The first autotrophic organisms were
output will shift the peak to one direction, hence, will the chemoautotrophs that never released oxygen.
be an example of directional selection. In stabilizing Chemotrophs are organisms that obtain energy by the
selection, the organisms with the mean value of the oxidation of electron donors in their environments.
trait are selected. In disruptive selection, both extremes 26. Flipper of Whale is homologous to the wing of a bird.
get selected. Homologous organs - The structure which are similar
20. The sequence of the origin of life events is as follows- in their morphology, anatomy, genetics and
The organic monomers were synthesised first and then embryology, but dissimilar in their functions. Flipper
the formation of the organic polymers took place. All of whale and wing of bird has similar morphology and
these organic compounds were then aggregated anatomy, but differ in their functions according to their
together and surrounded by a feeble membrane. This species as well as the habitat where they live in. A
structure was known as the protobionts. Much more dolphin’s flipper, bird’s wing, cat’s leg, and the human
complex DNA based genetic system evolved after that. arm are considered homologous structures. Bats,
So, the correct option is 'II, III, I, IV'. whales, and many other animals have very similar
21. The chronological order of human evolution from early homologous structures, demonstrating that these
to the recent is as follows: Dryopithecus and creatures all had a common ancestor.
Ramapithecus existed about 15 million years ago. 27. Industrial melanism is the replacement of white-
Australopithecus africanus existed about 5 million colored moths by dark-colored moths due to the
years ago. emission of industrial smoke. It is an example of
Australopithecus evolved the Homo habilis. Homo natural selection.
erectus were replaced by Homo sapiens. 28. The wings of a bird and the wings of an insect are
22. The Hardy-Weinberg equation is given by : analogous structures as they are dissimilar in structure
p² + 2pq + q² = 1 yet perform the same function. It represents convergent
Here, p and q represent the individual allele evolution.
frequencies. 29. The total number of individuals = 1000
Therefore, p² = frequency of homozygous condition Genotype frequency of AA = 360÷1000 = 0.36
represented by p. Genotype frequency of aa = 160÷1000 = 0.16
q² = frequency of homozygous alleles represented by q. Genotype frequency of Aa = 480÷1000 = 0.48
and 2pq = frequency of heterozygous condition. Now, according to the Hardy Weinberg equilibrium,
So, the correct answer is '2pq' (A+a)2 = AA + 2Aa + aa = 1
23. Genetic drift is a change in gene frequency in Thus, allele frequency of A = √0.36 = 0.6
successive generations of a small population due to Allele frequency of a = √0.16 = 0.4
chance alone rather than natural selection or gene 30. The same structure developed along different
transfer. The effect of genetic drift on a small directions due to adaptations to different needs are
population is large as compared to that in the larger homologous and the evolution is divergent. Whereas
population which, owing to its large size and a large analogy refers to a situation exactly opposite,i.e.the
number of gametes produced, has a greater probability structures are not anatomically similar though they
to accurately represent the allelic frequency of a perform similar functions. It occurs due to convergent
parental population. Therefore, the correct answer is evolution.
option d. The flippers of penguins and dolphins are analogous
structures. Thorns of Bougainvillea and tendrils of
EVOLUTION 216
Cucurbita and forelimbs of bats and humans are 40. Natural selection whereby the darker forms were
homologous structures. selected.
31. Forelimbs of cat and lizard used in walking, forelimbs 41. Homologous organs
of whale used in swimming and forelimbs of bats used 42. Adaptive radiation
in flying are examples of homologous organs as they 43. They were able to reproduce
are similar in structure and origin but are dissimilar in 44. Nephridia of earthworm and malpighian tubules of
function and form.Analogous organs are those organs cockroach — Excretory organs
which have similar functions but different origins. An 45. Scales on their hind limbs
example includes wings of insects, bats and birds 46. Weismann — Theory of continuity of germplasm
which are evolved independently. 47. Convergent evolution
32. The eyes of octopus and cat are analogous organs 48. Evolution of different species from acommon ancestor
because they are structurally different but perform the 49. Biogeographical Evolution
same function. Analogous organs are not anatomically 50. Speciation through reproductive isolation
similar structures though they perform similar 51. Melanism is a pollution-generated feature
functions. Hence, analogous structures are a result of 52. Possible origin of life by combination of chemicals
convergent evolution, different structures evolving for under suitable environmental conditions
the same function and hence, having similarity. 53. Homo neanderthalensis
33. According to Darwinism, competition between two 54. Fitness is the end result of the ability to adapt and gets
different species is the key factor for organic evolution selected by nature
because it results in divergent evolution. 55. Glutamic acid
34. According to the Hardy-Weinberg principle, allele 56. Homologous and vestigial organs
frequency in a population remains stable or constant 57. Archaeopteryx
from generation to generation unless there is migration, 58. Gymnosperms are dominant plants and first birds
mutation, genetic drift or gene flow. appear
35. Convergent evolution occurs in the unrelated group of 59. Phylogeny
organisms. It is the development of structures with a 60. Meat was not spoiled, when heated and kept sealed in a
similar function in an unrelated group of organisms vessel
because of similar environmental conditions in which 61. Prevalence of pesticide resistant insects
they live. 62. Electron-spin resonance method
36. If variation in gene frequencies within a population 63. Greater variation in Asia than in Africa
occurs because of chance, then it is termed genetic 64. Oenothera lamarckiana
drift. 65. Electron spin resonance (ESR) & fossil DNA
37. (NCERT-XIIth, Page No. 146) (Chapter – Evolution 66. Evidence from DNA extracted from sex chromosomes,
(7.6)) autosomes & mitochondria
38. Increasing brain capacity 67. Oxygen
39. Adaptive radiation 68. Frogs evolved from gilled ancestors
HUMAN HEALTH AND DISEASES (SOLUTIONS)

1. humans which infects the alveoli (air filled sacs) of the
lungs. Wuchereria the filarial worms cause a slowly
List I List II developing chronic inflammation filariasis.
A. Ringworm II. Trichophyton Plasmodium a protozoa is responsible for different
B. Filariasis III. Wuchereria bancrofti types of malaria.
C. Malaria IV. Plasmodium vivax 9. Active immunity is slow and takes time to give its full
D. Pneumonia I. Haemophilus influenzae effective response. Foetus receiving some antibodies
from their mother, through the placenta during
2. pregnancy is an example of passive immunity. Active
immunity is the immunity in which when the host is
List I List II exposed to antigens either living or dead, antibodies
A. Heroin II. Slows down body function are produced in the host body. In passive immunity,
B. Marijuana I. Effect on cardiovascular readymade antibodies are directly given to protect the
system body against foreign agents.
10. Colostrum, the yellowish fluid secreted by the mother
C. Cocaine IV. Interfere with transport of
dopamine during the initial days of lactation is very essential to
impart immunity to the newborn infant because it
D. Morphine III. Painkiller
contains Immunoglobulin A. It imparts acquired
passive immunity to the newborn.
3. TH cells
11. Heroin, commonly called smack and is chemically
4. Rheumatoid arthritis, or RA, is an autoimmune and
diacetylmorphine which is synthesized by acetylation
inflammatory disease, which means that your immune
of morphine.
system attacks healthy cells in your body by mistake,
12. The body is able to differentiate self and non-self and
causing inflammation (painful swelling) in the affected
the cell-mediated response is responsible for graft
parts of the body. RA mainly attacks the joints, usually
rejection. It is mediated by killer T cells which induces
many joints at once.
apoptosis of target cells.
5. Non-specific type of defense present at the time of
13. Asthma is a difficulty in breathing which causes
birth is innate immunity. Acquired immunity develops
wheezing due to inflammation of bronchi and
later in life upon encounter with antigens. It is
bronchioles. It can be due to increasing air-borne
therefore also called specific immunity, since it tailors
allergens and pollutants. Asthma is an allergic
its attack to a specific antigen previously encountered.
condition. Many people in urban areas are suffering
6. Filariasis is the disease caused by Wuchereria
from this respiratory disorder.
bancrofti, a filarial worm. Amoebiasis/Amoebic
14. Salmonella typhi is the causative agent of typhoid fever
dysentery is caused by a protozoan parasite Entamoeba
and the confirmatory test is Widal test. Widal test is
histolytica in the large intestine of humans. Pneumonia
based on antigen-antibody reaction.
is caused by bacteria like Streptococcus pneumoniae
15. Rheumatoid arthritis is an autoimmune disorder in
and Haemophilus influenzae. Ringworm is caused by
which antibodies are produced against the synovial
fungi belonging to genera Microsporum, Trichophyton,
membrane and cartilage.
and Epidermophyton.
Vitiligo causes white patches on the skin also
7. The life cycle of Plasmodium that infects humans
characterised as an autoimmune disorder.
follows three stages: (i) infection of a human with
Psoriasis is a skin disease that causes itchy or sore
sporozoites; (ii) asexual reproduction and (iii) sexual
patches of thick red skin and is also an autoimmune
reproduction. The first two take place exclusively in
disorder.
the human body, while the third one starts in the
Alzheimer’s disease is due to a deficiency of the
human body and is completed into the mosquito. The
neurotransmitter acetylcholine.
human infection begins when an infected female
16. Elephantiasis is caused by roundworm, Wuchereria
Anopheles mosquito bites a person and injects infected
bancrofti and it is transmitted by the bite of female
saliva containing sporozoites into the blood circulation
mosquito vector. It causes chronic inflammation of
i.e., the first life stage of Plasmodium (stage of
lymphatic vessels.
infection).
17. ‘Smack’ also called brown sugar/Heroin is formed by
8. Salmonella typhi is a pathogenic bacterium which
acetylation of morphine. It is obtained from the latex of
causes typhoid fever in human beings. Bacteria like
the unripe capsule of the poppy plant.
Streptococcus pneumoniae and Haemophilus
18. Non-acceptance or rejection of graft or transplanted
influenzae are responsible for the disease pneumonia in
tissues/organs is due to cell-mediated immune
response. The cell-mediated immune response is the serum globulin is tested for a confirmatory
mainly involved in the rejection of the transplanted evidence.
organs. The cell-mediated immune response mainly 27. lgA immunoglobulins that protect us from inhaled and
involves T cells which release cytokines in response to ingested pathogens constitute the largest percentage in
foreign objects. human milk.
19. MALT is Mucosa Associated Lymphoid Tissue and it 28. Hallucinogen is the psychoactive agent that causes
constitutes about 50 percent of the lymphoid tissue in hallucination. It can be found in some plants and
the human body. It consists of T cells, B cells, and mushrooms. Amanita muscaria or fly amanita is a
macrophages. It is distributed in association with mushroom and psychoactive basidiomycete fungus, in
mucosal tissue. the genus Amanita produces muscimol which has
20. Tetanus is caused by Clostridium tetani bacteria and hallucinogenic properties.
Cholera is caused by Vibrio cholerae. Mumps, herpes 29. HIV released in the blood attacks other helper T-
(herpes simplex virus), influenza (influenza viruses) lymphocytes leading to a decrease in the number of
and small pox (variola strain) are viral diseases. helper T-lymphocytes in the body of the infected
Therefore, the correct answer is option d. person and the person starts suffering from infections
21. AIDS is caused by HIV (Human Immuno Deficiency and hence shows symptoms of AIDS.
Virus). HIV is a member of a group of the retrovirus. 30. The given image shows the flowers of the Datura
Retrovirus is an envelope virus enclosing the RNA plant. Datura is a psychedelic plant. It contains tropane
genome. HIV is also an enveloped virus that contains alkaloids which can cause hallucinations. The drug
two identical molecules of single-stranded RNA and obtained from Datura is hallucinogenic which
two molecules of reverse transcriptase. So the correct produces dream-like state and can even cause
option is a. psychosis, a condition of loss of contact with external
22. The ability to maintain functional telomeres may be reality. Hallucinogenic drugs change mood, behaviour,
one mechanism that allows cancer cells to grow in thoughts and perceptions.
vitro for decades. Telomerase activity is necessary 31. T–lymphocytes are responsible for cell-mediated
to preserve many cancer types and is inactive in immunity.
somatic cells, creating the possibility that telomerase 32. Infection of Ascaris occurs because of the consumption
inhibition could selectively repress cancer cell growth of food and water contaminated with eggs of Ascaris.
with minimal side effects. If a drug or mutation can 33. (NCERT, Class- XII 1h, Page No. 158 to 159)
inhibit telomerase in cancer cells, the telomeres of 34. All are paracites Plasmodium & Trypanosoma both are
successive generations will progressively shorten, protozoans & Cuscuta - plant
limiting tumor growth. 35. P.falciparum-protozoan pathogen cause malignant
23. Antivenom injection is an antiserum (performed malaria or cerebral malaria and may cause death.
antibodies) that is given to the person with a snake 36. NCERT-pg.152 (Class-XII)
bite. It is used to provide immediate immunity in case 37. Tears
of an emergency. Polio vaccines are vaccines used to 38. Saliva of infected female Anopheles mosquito
prevent poliomyelitis (polio). Two types of polio 39. When HIV replicates rapidly in helper T-lymphocytes
vaccines are used - an inactivated poliovirus (antigen) damages larger number of these
given by injection and an attenuated poliovirus 40. Morphine is often given to persons who have
(antigen) given by mouth. The inactivated polio undergone surgery as a pain killer
vaccines are very safe. Mild redness or pain may occur 41. Fungi
at the site of injection. Oral polio vaccines cause 42. Typhoid
vaccine-associated paralytic poliomyelitis. 43. The causative HIV retrovirus enters helper T-
24. Our body's immune system protects us from disease lymphocytes thus reducing their numbers
and infection. But if we have an autoimmune disease, 44. (a) and (b)
our immune system attacks healthy cells in our body 45. Malignant tumours may exhibit metastasis
by mistake. Autoimmunity is the presence of self- 46. Common Cold, AIDS
reactive immune response (e.g., auto-antibodies, self- 47. Preformed antibodies
reactive T-cells), with or without damage or pathology 48. (iii) and (iv)
resulting from it. 49. (i), (iii)
25. Babesiosis is a malaria-like parasitic disease caused by 50. Physiological barriers
a single-celled protozoan. 51. Barbiturates cause relaxation and temporary euphoria
Syphilis is a bacterial disease. 52. Serum globulins
Influenza is a viral disease. 53. Inhalation of seasonal pollens
Blastomycosis is a fungal disease. 54. An obligate anaerobe
26. Globulin is one of the proteins found in serum. So, if a 55. Borderline Personality Disorder (BPD)
major deficiency of antibodies is suspected in a person, 56. Histamine
57. Glycoproteins
58. Prion 62. DNA is not present at any stage in the life cycle of
59. Helper T-lymphocytes retroviruses.
60. Valium 63. Undergoing rapid division
61. T4 lymphocytes 64. Anopheles culifaciens – Leishmaniasis
MICROBES IN HUMAN WELFARE (SOLUTIONS)

1. Cyclosporin is an effective immunosuppressant used in 10. Suspended solids are removed during the primary
the treatment of autoimmune disorders (such as treatment. Primary treatment is a physical process that
rheumatoid arthritis) and in organ transplantation to involves sequential filtration and sedimentation.
prevent rejection. Cyclosporin lowers the activity of T- 11. Saccharomyces cerevisiae is commonly called
cells and hence, suppressing the activity of the immune Brewer’s yeast. It causes the fermentation of
system. Cyclosporin is isolated from the fungus carbohydrates producing ethanol. Ethanol fermentation
Trichoderma polysporum. can be defined as a biological process in which glucose
2. Aspergillus niger is involved in the production of citric is converted into ethanol followed by the release of
acid. Acetobacter aceti is involved in the production of carbon dioxide.
acetic acid. Clostridium butylicum is involved in the 12. Aspergillus sp. produces citric acid through
production of butyric acid whereas Lactobacillus is fermentation.
involved in the production of lactic acid. Cyclosporin A, a Trichoderma product, is an
3. Clostridium butylicum is (a bacterium) used for the immunosuppressant that blocks the activation of T
production of butyric acid. Cyclosporin A which is helper cells and interferes with the release of
used as an immunosuppressive agent during organ- interleukin-2 and thereby prevents organ rejection in
transplant, is produced by the fungus Trichoderma transplantation processes.
polysporum. From Monascus purpureus a blood Statins are the competitive inhibitor of enzyme HMG-
cholesterol lowering agent, statins is produced which is CoA reductase, an enzyme of cholesterol biosynthesis,
commercialised as blood-cholesterol lowering agent. and are produced by Monascus species.
Aspergillus niger (a fungus) is used for the production Clostridium butylicum is anaerobic bacteria that
of citric acid. produce butyric acid.
4. Major portion of activated sludge is pumped into large Therefore, the correct matching is:
tanks called anaerobic sludge digesters. So, here other a) - iii), b) - i, c) - iv), d) - ii)
kinds of bacteria which grow anaerobically, digest the 13. Methanogens are present in the gut of several ruminant
flocks of fungi and bacteria of the sludge and produce animals such as cows and buffaloes and they are
methane, water and carbon dioxide. Methane is used as responsible for the production of methane (biogas)
biogas. from the dung of these animals.
5. Microbes are used in the production of several 14. Cyclosporin A and C are immunosuppressive drugs
household and industrial products – that are obtained from Trichoderma polysporum.
Lactobacillus is used for the production of curd. Statins produced by the yeast Monascus purpureus is
Saccharomyces cerevisiae is used in bread making. used as the blood-cholesterol-lowering agent. It acts by
Aspergillus niger is used for the production of citric competitively inhibiting the enzyme responsible for the
acid. synthesis of cholesterol. Streptokinase is an enzyme
Acetobacter aceti is used for the production of acetic secreted by several species of Streptococci that can
acid. bind and activate human plasminogen. It is used as an
6. Fungus Trichoderma, Baculoviruses (NPV) and effective thrombolysis medication. Clostridium
Bacillus thuringiensis are used as biocontrol agents. butylicum is used for the production of butyric acid. It
Rhizobium, Nostoc, Azospirillum and Oscillatoria are has a wide range of applications such as paints,
used as biofertilizers, whereas TMV is a pathogen for coatings, etc.
tobacco plants and aphids are pests that harm crop 15. a. Saccharomyces cerevisiae is used for the
plants. commercial production of ethanol.
7. Statin is obtained from yeast called Monascus b. Monascus purpureus has been commercialised as a
purpureus. It acts as a blood cholesterol-lowering blood-cholesterol lowering agent.
agent by competitively inhibiting the enzyme c. Trichoderma polysporum is used for the production
responsible for the synthesis of cholesterol. of immunosuppressive agents.
8. The natural method of eliminating and controlling the d. Propionibacterium sharmanii is used for the
insects, pests and other disease-causing agents using ripening of Swiss cheese.
their natural, biological enemies is called biocontrol or 16. In anaerobic sludge digesters, other kinds of bacteria
biological control. Fungus Trichoderma is a biological which grow anaerobically, digest the bacteria and the
agent being developed for use in the treatment of plant fungi in the sludge and produce a mixture of gases
diseases.control such as methane, hydrogen sulphide and carbon
9. Curd is more nourishing than milk. It has enriched the dioxide.These gases are produced during biogas
presence of vitamins especially vitamin B12. production by the activity of bacteria called
methanogens.
17. During sewage treatment, the biogases produced in the 28. Activated sludge-sediment in settlement tanks of
anaerobic sludge digester by anaerobic bacteria include sewage treatment plant is a rich source of aerobic
carbon dioxide, hydrogen sulphide and methane. bacteria
18. Aspergillus niger is used for the production of citric 29. Trichoderma
acid. 30. Snail
19. The major component of Bio/Gobar gas is 60% to 70% 31. Availability of oxygen throughout the process
methane. 32. Increases when sewage gets mixed with river water
20. In waste water treatment plant, the secondary treatment 33. Xanthomonas Campestris
includes the biological treatment where the aerobic 34. Paecilomyces lilacinus
bacteria and anaerobic bacteria fungi are involved 35. Biological control of soil-borne plant pathogens
Ref. NCERT (Eng.) Chapter-10 page no. 184 36. SE < S < PE < DE
21. Cattle yard 37. Extensive use of chemical fertilizers may lead to
22. Sanccharomyces eutrophication of nearby water bodies
23. Biological process 38. Live microbial food supplement
24. Agrobacterium 39. Coliforms – Vinegar
25. Marsh gas 40. < 30 ppm
26. Obtain antibiotics 41. Phenyl
27. Rhizobium 42. Butyric acid bacteria
43. Fermentation
BIOTECHNOLOGY PRINCIPLES AND PROCESSES

(SOLUTIONS)
1. DNA nucleotides to form complete strands of DNA. Hence
2. In a method, suitable for plants, cells are bombarded the sequence of steps is denaturation, annealing,
with high velocity micro-particles of gold or tungsten extension.
coated with DNA in a method known as biolistics or 11. After the bands are stained, they are viewed in UV
gene gun. light. The bands appear bright orange in color.
3. B. Cutting of DNA at specific location by restriction Ethidium bromide is the intercalating agent that stacks
enzyme. in between the nitrogenous bases of DNA.
C. Isolation of desired DNA fragment. 12. pBR322 is a commonly used cloning vector. When the
D. Amplification of gene of interest using PCR. gene for β-galactoside is inserted in the ampicillin
A. Insertion of recombinant DNA into the host cell. resistance gene by using Pst I, the recombinant E.coli
4. Polymerase chain reaction (PCR) is used in DNA will lose ampicillin resistance due to insertional
amplification. Selectable markers are not used in PCR. inactivation of the antibiotic resistance gene. The host
Selectable markers like the antibiotic resistance genes (recombinant) cell will produce β-galactoside which is
are useful during transformation. not a novel protein nor does it have the dual ability.
5. No chromogenic substrates are used during gel The transformed cells cannot resist ampicillin as they
electrophoresis. Instead EtBr is used which intercalates have lost ampicillin resistance. A recombinant E. coli
between the DNA and it becomes visible under UV is produced and the host cell will not undergo lysis due
light. DNA bands are not visible in the gel unless they to the insertion of the β-galactoside gene.
are illuminated by UV light. 13. Each restriction endonuclease recognizes a specific
6. The sequence 5’ GAATTC 3’ ; 3’ CTTAAG 5’ is a palindromic nucleotide sequence in the DNA. Once it
palindromic sequence and therefore can be cut easily finds its specific recognition sequence it binds to DNA
by a restriction endonuclease. The rest of the and cuts each of the two strands of DNA. During post-
sequences are not palindromic. 5’ GAATTC 3’ ; 3’ transcriptional modification in eukaryotes, poly(A) tail
CTTAAG 5’ is, in fact, the recognition sequence of the (200–300 adenylate residues) are added at the 3' end of
restriction enzyme EcoRI. hnRNA. During DNA replication Okazaki fragments
7. Restriction endonucleases recognise specific sequences are synthesized discontinuously and joined by DNA
to cut DNA known as palindromic nucleotide ligase. A PCR primer sequence is termed degenerate if
sequences. However, the restriction enzymes cut the some of its position has several possible bases.
strand of DNA a little away from the centre of the 14. The separated DNA fragments can be visualised only
palindrome site, but between the same two bases on the after staining the DNA with a compound known as
opposite strands. ethidium bromide followed by exposure to UV
8. In order to link the alien DNA, the cloning vector radiation (you cannot see pure DNA fragments in the
needs to have very few, preferably single recognition visible light and without staining). You can see bright
sites for the commonly used restriction enzymes. orange coloured bands of DNA in a ethidium bromide
Presence of more than one recognition sites within the stained gel exposed to UV light.
vector will generate several fragments, which will 15. EcoRI is the restriction enzyme which recognises 6
complicate the gene cloning. base pair palindromic sequences and cuts both the
9. During the purification process for recombinant DNA strands of DNA at second base in the sequence from 5’
technology, the addition of chilled ethanol precipitates end. It produces sticky ends.
out DNA. This can be seen as a collection of fine
threads in the suspension. The RNA can be removed G A A T T C
by treatment with ribonuclease whereas proteins can be C T T A A G
removed by treatment with protease. Histones are basic
proteins that help condense DNA in a cell. 16. DNA ligase is an enzyme that can connect two DNA
10. Polymerase chain reaction or PCR consists of the molecules together by forming a phosphodiester bond
following three steps: between them. Nucleases cleave the phosphodiester
i)Denaturation- The two DNA strands of template bonds of nucleic acids and can be endo- or exo-
DNA separate from each other when heated to 92℃. nuclease based on the position where it makes the cut.
ii) Annealing- The primers anneal to the 3’ end of Exonucleases make cuts at the ends of the DNA strand.
single strands of DNA. iii)Extension- The primers are Polymerases help in the polymerization of a DNA or
extended by DNA polymerase by the addition of
RNA molecule. DNA polymerases and RNA bromide is used to stain the DNA fragments and will
polymerases are the enzymes that perform this function appear as orange coloured bands under UV light.
respectively. 25. In recombinant DNA technology, selectable markers
17. (a) Bacillus thuringiensis contains cry proteins, which helps in identifying and eliminating non-transformants
roduces are Bt toxins and have insecticidal properties. and selectively permitting the growth of the
(b) The highly thermostable DNA polymerase from transformants after the process of recombination.
Thermus aquaticus is ideal for in- vitro DNA These marker genes are resistant to various antibiotics
polymerization because it remains active during the and are used in cloning vectors.
high temperature required for denaturation of double 26. Biosynthetic stage for the synthesis of products in
stranded DNA. recombinant DNA technology is called the
(c) The tumor-inducing (Ti) plasmid of Agrobacterium upstreaming process while after completion of the
tumefaciens has been modified into a cloning vector. It biosynthetic stage, the product has to be subjected to a
is used to deliver required genes into plants. series of processes which include separation and
(d) First recombinant DNA was constructed by cutting purification are collectively referred to as downstream
the piece of DNA from a plasmid carrying antibiotic processing.
resistance gene from Salmonella typhimurium and 27. Gel electrophoresis is used to segregate DNA
linking it to the plasmid of E.coli. fragments according to size. During gel
18. (a) Genetic engineering or recombinant DNA electrophoresis, DNA fragments separate (resolve)
technology can be accomplished only if we have the according to their size through the sieving effect
key tools, i.e., restriction enzymes, polymerase provided by agarose gel. DNA is negatively charged
enzymes, ligases, vectors and the host organism. and hence it travel towards the positive electrode. The
(b) The sticky ends in DNA that result from the action mobility of DNA fragments is directly proportional to
of restriction endonucleases cannot be joined by the the size. Smaller the fragment, farther it moves, and
restriction enzymes, but by DNA ligases. vice versa. Hence, the (d) option is correct.
(c) Restriction enzymes begin their action by first 28. SalI is a restriction endonuclease isolated from
scanning the length of the DNA sequence and then Streptomyces albus. It produces sticky ends by making
recognising a specific sequence. This specific base the cut in the nucleotide sequence G/TCGAC
sequence is known as the recognition sequence. EcoRV is type II restriction endonuclease isolated
(d) Each restriction endonuclease recognises a specific from Escherichia coli which produces blunt ends by
palindromic nucleotide sequence in the DNA. making a cut in the center of the nucleotide sequence
19. Origin of replication (ori): This is a sequence from GAT/ATC.
where replication starts and any piece of DNA when XhoI is a restriction endonuclease isolated from
linked to this sequence can be made to replicate within Xanthomonas campestris. It produces sticky ends by
the host cells. This sequence is also responsible for making a cut in the recognition sequence C/TCGAG.
controlling the copy number of the linked DNA. HindIII is a type II restriction enzyme isolated from
20. Restriction enzymes cut DNA molecules at a particular Haemophilus influenzae. It produces sticky ends by
point (restriction site) by recognising a specific making a cut in the nucleotide sequence A/AGCTT.
sequence known as recognition site. Each restriction 29. Downstream processing is the recovery of biological
endonuclease functions by inspecting the length of a products which includes following stages:
DNA sequence. Once it finds its specific recognition Extraction, separation, purification and preservation of
sequence, it binds to the DNA and cuts each of the two the biotechnological products. After the purification
strands of the double helix at specific points in their step, the product is formulated with suitable
sugar-phosphate backbone. preservatives. Hence, expression is not a part of
21. During the isolation of desired genes, chilled ethanol is downstream processing.
used for the precipitation of DNA. Due to which DNA 30. Polymerase III and Taq polymerase are enzymes of
form pallets and other biomolecules are present in the DNA polymerization and add deoxyribonucleotides to
supernatant. the primer in 5' to 3' direction. EcoRI is a restriction
22. To produce enzymes in large quantities for the enzyme from E. coli that digest DNA at specific
commercial purpose required equipment is bioreactors. recognition sites. DNA ligase enzyme joins two DNA
23. The technique used for making multiple copies of the fragments together by a phosphodiester bond between
gene (or DNA) of interest in vitro is called PCR. Each 3’ hydroxyl at the end of one fragment and a 5’
cycle of this technique has three steps: phosphate at the end of another fragment. Foreign
(i) Denaturation DNA and a plasmid having complementary ends can
(ii) Primer annealing be ligated using DNA ligase.
(iii) Extension of primer Therefore, the correct answer is option c.
24. Agarose gel electrophoresis is used to segregate DNA 31. Stirred-tank bioreactor is usually cylindrical or with a
fragments according to the mass and size. Ethidium curved base to facilitate the mixing of the reaction
contents. The stirrer facilitates even mixing and and is easy to use, thus considered to be suitable
oxygen availability throughout the bioreactor. techniques for assessment of genetic fidelity of in vitro
32. Restriction enzymes are traditionally classified into regenerated plantlets.
four types on the basis of subunit composition, 39. The colonies of recombinant bacteria appear white in
cleavage position, sequence specificity and cofactor contrast to blue colonies of non-recombinant bacteria
requirements. There are four classes of restriction because of insertional inactivation of alpha-
endonucleases: types I, II,III and IV. HindII is a type II galactosidase in recombinant bacteria.
restriction enzyme found in Haemophilus influenzae. 40. In algae, the cell wall is made up of cellulose, and thus,
33. Taq polymerase is a thermostable DNA polymerase cellulase is used for its degradation. Methylase is used
named after the thermophilic bacterium Thermus for the process of methylation.
aquaticus from which it was originally isolated. It is 41. DNA fragments generated by restriction endonuclease
frequently used in the polymerase chain reaction are separated using gel electrophoresis. It separates
(PCR), a method for greatly amplifying the quantity of DNA fragments according to their size. The rate of
short segments of DNA. T. aquaticus is a bacterium migration is proportional to size, i.e., smaller
that lives in hot springs and hydrothermal vents, and fragments move more quickly, and wind up at the
Taq polymerase was identified as an enzyme able to bottom of the gel.
withstand the protein-denaturing conditions (high 42. NCERT-XTI-page-199
temperature) required during PCR. Antibiotics medium are used to mark or select
34. Plasmids are extrachromosomal genetic material transformant & Recombinant bacteria so we can say
present in bacteria. They are capable of independent antibiotics used as a selectable markers with marker
replication. They are a separate entity present in the gene (Antibiotics resistant gene).
cytoplasm. They are circular double stranded DNA 43. C indicate the extension of DNA in presence of Taq
molecules and contain some specialized genes like DNA polymerase.
antibiotic resistant genes. They are transferable. 44. Biolistic gun or gene gun method is used for transfer
35. Vector is an intermediate carrier, a phage, plasmid or the gene in plant cell directly. It is a method of
virus DNA into which another DNA is inserted for vectorless gene transfer in plant.
introduction into bacterial or other cells for 45. Gel electrophoresis
amplification. 46. Palindromic sequence of base pairs
36. Restriction enzymes recognize a short specific 47. Coli
sequence on the DNA and cleave the molecule. 48. Retrovirus
37. Plasmids are autonomously replicating circular 49. 5'______GAATTC ______3'
extrachromosomal DNA. They are the standard 3'______CTTAAG______5'
cloning vectors and the ones most commonly used. 50. Probe
Most general plasmids may be used to clone DNA 51. Make cuts at specific positions within the DNA
insert of up to 15 kb in size. molecule
38. Molecular techniques are at present powerful and 52. DNA ligase
valuable tools for assessing the genetic stability among 53. Separation of DNA fragments according to their size
in vitro micropropagated plants. Random amplified 54. Escherichia coli and Agrobacterium tumefaciens
polymorphic DNA (RAPD) is polymerase chain 55. Cuts the DNA molecule at specific sites
reaction (PCR) based techniques widely used for the 56. Promoter
determination of the genetic fidelity of in vitro 57. Are synthesized by bacteria as part of their defense
regenerated plantlets. RAPD does not require prior mechanism
sequence information, uses a small amount of DNA
BIOTECHNOLOGY: AND ITS APPLICATION 225
BIOTECHNOLOGY: AND ITS APPLICATION

(SOLUTIONS)
1. Using conventional methods of diagnosis (serum and 6. Gene therapy is a collection of methods that allows the
urine analysis, etc.) early detection is not possible. correction of a gene defect that has been diagnosed in a
Recombinant DNA technology, Polymerase Chain child/embryo. Here genes are inserted into a person’s
Reaction (PCR) and Enzyme Linked Immuno-sorbent cells and tissues to treat a disease. Correction of a
Assay (ELISA) are some of the techniques that serve genetic defect involves the delivery of a normal gene
the purpose of early diagnosis. into the individual or embryo to take over the function
2. A transposable element (TE, transposon, or jumping of and compensate for the non-functional gene. The
gene) is a DNA sequence that can change its position first clinical gene therapy was given in 1990 to a 4-
within a genome. Transposons are currently being used year old girl with adenosine deaminase (ADA)
to facilitate large-scale DNA sequencing in a cost- deficiency. Molecular diagnosis refers to the act or
efficient and accurate manner. When using a process of determining the nature and cause of a
transposon-based approach to genome sequencing, disease. Biopiracy is the term used to refer to the use of
large clones are broken into smaller redundant and bio-resources by multinational companies and other
overlapping clones that are subsequently subjected to organizations without proper authorization from the
transposon mutagenesis. countries and people concerned without compensatory
3. In some children ADA deficiency can be cured by payment.
bone marrow transplantation; in others it can be treated 7. It is possible to detect the mutated gene causing cancer
by enzyme replacement therapy, in which functional by allowing a radioactive probe to hybridize its
ADA is given to the patient by injection. But the complementary DNA in a clone of cells, followed by
problem with both of these approaches is that they are its detection using autoradiography because a single-
not completely curative. As a first step towards gene stranded DNA or RNA, tagged with a radioactive
therapy, lymphocytes from the blood of the patient are molecule (probe) is allowed to hybridize to its
grown in a culture outside the body. A functional ADA complementary DNA in a clone of cells followed by
cDNA (using a retroviral vector) is then introduced detection using autoradiography. The clone having the
into these lymphocytes, which are subsequently mutated gene will hence not appear on the
returned to the patient. However, as these cells are not photographic film, because the probe will not have
immortal, the patient requires periodic infusion of such complementarity with the mutated gene.
genetically engineered lymphocytes. 8. In mammals, including humans, insulin is synthesized
4. In mammals, including humans, insulin is synthesised as a prohormone (like a pro-enzyme, the pro-hormone
as a pro-hormone which contains an extra stretch also needs to be processed before it becomes a fully
called the C peptide. The pro-hormone needs to be mature and functional hormone) which contains an
processed before it becomes fully mature and extra stretch called the C peptide. This C peptide is not
functional. However, in case of genetically engineered present in the mature insulin and is removed during
insulin, there is no C-peptide, hence no proinsulin is maturation into insulin. A and B chain of insulin are
formed. Genetically engineered insulin that is used for connected by disulphide bridges.
diabetes is produced using yeast and bacteria, unlike 9. ELISA can be used for early detection of infection
natural insulin which was earlier extracted from either by detecting the presence of pathogenic antigen
pancreas of slaughtered cattle and pigs. or by detecting the antibodies synthesized against the
5. PCR is Polymerase Chain Reaction. It is used for pathogen. In the hybridization technique, an
making multiple copies of the gene. Hence PCR is ssDNA/ssRNA tagged with a radioactive molecule
used for: (probe) is allowed to hybridize its complementary
• Gene amplification. DNA in a clone of cells followed by detection using
• PCR-based assays have been developed that detect autoradiography. It is used to find a mutated gene. The
the presence of gene sequences of the infectious western blotting technique is used to detect a specific
agents. protein molecule among a mixture of proteins.
• It is also used in detecting mutations. Southern blotting is used to detect a specific DNA
• Protein is not the target of PCR. Hence, plays no role sequence in the given sample and can be detected prior
in its purification. to antibody formation. One can detect the presence of
Majorly the PCR is used in analyzing and determining pathogenic DNA/RNA.
purposes only. 10. The adenosine deaminase (ADA) enzyme is crucial for
the immune system to function. Hence, its deficiency
results in the dysfunction of the immune system. 17. The GEAC is the apex biotech regulatory body in
Hyposecretion of hormones of the adrenal cortex India. It is a statutory body. It is responsible for the
causes Addison's disease. Parkinson's disease is a long- appraisal of activities involving large-scale use of
term degenerative disorder of the central nervous hazardous microorganisms and recombinants in
system. Disorders that affect GIT & associated glands research and industrial production from the
are called digestive disorders. environmental angle. The committee is also
11. Bacillus thuringiensis forms protein crystals during a responsible for the appraisal of proposals relating to
particular phase of their growth. These protein crystals the release of genetically engineered (GE) organisms
are a toxic insecticidal protein which kills the insect and products into the environment including
pest. Bt cotton is an insect-resistant transgenic crop experimental field trials.
designed to combat the bollworm. 18. Biopiracy term refers to the use of bioresources by
12. The functional insulin molecule has two chains A and multinational companies and other organizations
chain B, that are linked together by disulphide bridges, without proper authorization and compensation from
not by hydrogen bonds. the countries or to the indigenous people themselves.
While the remaining statements are correct. 19. Retrovirus is commonly used as a vector for
13. (a) Bt toxin is produced by a bacterium called Bacillus introducing a DNA fragment in human lymphocytes.
thuringiensis (Bt for short). Bt toxin gene has been This technique is known as gene therapy. In this
cloned from the bacteria and been expressed in plants technique, lymphocytes from the blood of the patient
to provide resistance to insects without the need for are grown in the culture outside the body. A functional
insecticides; in effect creating a bio-pesticide. gene is introduced by using a retroviral vector into
Examples are Bt cotton, Bt corn, rice, tomato, potato, these lymphocytes, which then subsequently returned
soybean etc. to the patient's body.
(b) The first clinical gene therapy was given in 1990 to 20. Adenosine deaminase (ADA) deficiency is a
a 4-year old girl with adenosine deaminase (ADA) genetically inherited disorder that will damage the
deficiency. immune system. It causes SCID (Severe combined
(c) RNAi (RNA interference) is a biological process in Immunodeficiency). 1st successful gene transfer in
which RNA molecules inhibit gene expression or humans was performed by F. Anderson. A 4-year girl
translation, by neutralizing targeted mRNA molecules was treated by replacing ADA gene (Adenosine
and taking place in all eukaryotic organisms as a deaminase) deficiency in lymphocytes.
method of cellular defense. 21. A nematode Meloidegyne incognitia infects the roots
(d) Polymerase chain reaction can be used in the of tobacco plant. They exist in soil in areas with hot
detection of HIV infection as it detects the genetic climates or short winters. Root-knot nematode larvae
material of HIV i.e. its RNA. infect plant roots, causing the development of root-
14. Bacillus thuringiensis forms protein crystals during a knot galls that drain the plant's nutrients.
particular phase of their growth. These crystals contain 22. Insulin is composed of two peptide chains referred to
a toxic insecticidal protein. These proteins exist as as the A chain and B chain. A and B chains are linked
inactive protoxins but once an insect ingest the inactive together by two disulfide bonds, and an additional
toxin, it is converted into an active form of toxin due to disulfide is formed within the A chain. In most species,
alkaline pH of the gut which solubilize the crystals. the A chain consists of 21 amino acids and the B chain
The activated toxin binds to the surface of midgut of 30 amino acids.
epithelial cells and creates pores that cause cell 23. Golden rice is a rice designed to produce beta-
swelling and lysis and eventually cause death of carotene, a precursor of vitamin A, in the edible part
insects. called endosperm of rice. Hence, golden rice is a
15. Golden rice is vitamin A enriched rice, which contains genetically modified crop plant where the incorporated
a gene from daffodil and is rich in carotene. It is used gene is meant for biosynthesis of Vitamin A.
to cure deficiency of vitamin A. 24. Insulin is the first human hormone produced by
16. In 1997, an American company got patent rights on recombinant DNA. In 1983, Eli Lilly, an American
Basmati rice through the US patent and trademark company, prepared two DNA sequences corresponding
office that had actually been derived from Indian to A and B chains of human insulin and introduced
farmers’ varieties. them in plasmids of E. coli to produce insulin chains.
The diversity of rice in India is one of the richest in the 25. Bt cotton is grown by Indian farmers. Other than this
world, 27 documented varieties of Basmati are grown no other transgenic crop is permitted for cultivation in
in India. India.
Indian basmati rice was crossed with semi-dwarf 26. Nematode or pest resistant tobacco were developed by
varieties and claimed as an invention or a novelty. RNA interference technology, which involve formation
Sharbati Sonora and Lerma Rojo are varieties of of sense and antisense RNA both.
wheat. 27. Refer NCERT Pg 177 Topic tissue culture Par 9.4
Co-667 is a variety of soyabean. 28. NCERT - pg. 21 1 (Class-XU)
29. Mice 41. Boll worms

30. Nematodes 42. Golden rice
31. ELISA 43. Eliminate weeds from the field without the use of
32. Molasses manual labour
33. Insect-resistance 44. (i) and (iii)
34. Transgenic mice for testing safety of polio vaccine 45. Alleviation of vitamin A deficiency
before use in humans 46. High vitamin – A content
35. High yield and resistance to bollworms 47. Bioinsecticidal plants
36. Gives high yield and is rich in vitamin A 48. The genetic code is universal
37. The inactive protoxin gets converted into active form 49. Gall formation on certain angiosperms by
in the insect gut Agrobacterium
38. Introducing bone marrow cells producing ADA into 50. Random mutations
cells at early embryonic stages 51. Alkaline phosphatase is the key reagent
39. Escherichia 52. Agrobacterium
40. When a piece of RNA that is complementary in
sequence is used to stop expression of a specific gene
ORGANISMS AND POPULATIONS 228
ORGANISMS AND POPULATIONS (SOLUTIONS)

1. structure. Mortality is the ratio of deaths in an area,
List I List II(Species A expressed per 1000 per year.
(Interaction) and B) Sex ratio is the ratio of males to females in a
A. Mutualism IV. +(A), +(B) population.
B. Commensalism I. +(A), O(B) Natality is defined as the birth rate which is the total
C. Amensalism II. –(A), O(B) number of live births per 1000 in a given population
D. Parasitism III. +(A), –(B) during a given time period or a year.
2. Statement II: In general, herbivores are more 11. Saprophytes are associated with decomposition of dead
adversely affected by competition than carnivores. organic materials.
3. In predation, the predator is benefitted whereas the Parasites grow on/in living plants and animals, and can
prey population is negatively impacted since they are be ecto or endo parasites.
preyed on by the predator. Lichens is the symbiotic association of algae and fungi.
4. In case of predation, one organism is benefited while Mycorrhiza is the symbiotic association of fungi with
the other is harmed. Therefore predation can be plant roots such as in Pinus.
denoted by (+/-). 12. Fungus associated with roots of Pinus increases
In amensalism, one organism is harmed while the other minerals & water absorption for the plant by increasing
is neither benefited, nor harmed (unaffected). Hence, it surface area and in turn, fungus gets food from the
can be denoted as (-/0). plant, this association is called mycorrhizae. Therefore,
In commensalism, one organism is benefited while the the mycorrhizal association is obligatory for Pinus
other organism is unaffected. Hence it is (+/0). seed germination.
In case of competition, both the organisms are harmed. 13. Wherever the pre-reproductive individuals or the
Hence it is (-/-). younger population size is larger than the reproductive
5. Death rate is given by = (number of dead individuals) / group, the population will be an increasing population.
(total population). It appears as following:
Therefore, the death rate of Drosophila in this case
would be: 8/80 = 1/10 = 0.1.
6. Amensalism is an interaction between two organisms
of different species in which one species inhibits the
growth of other species by secreting certain chemicals.
The first species neither get benefited nor harmed.
Therefore, amensalism can be represented as Species A
( - ) ; Species B (0).
7. In resource partitioning, if two species compete for the
same resource, they could avoid competition by
14. Amensalism/Antibiosis(0, -)
choosing, for instance, different times for feeding or
Antibiotics are chemicals secreted by one microbial
different foraging patterns. MacArthur showed that
group (eg: Penicillium) which harm other microbes
five closely related species of warblers living on the
(eg: Staphylococcus).
same tree were able to avoid competition and co-exist
It has no effect on Penicillium or the organism which
due to behavioral differences in their foraging
produces it.
activities.
15. Ecological niche term was given by J. Grinnel. It refers
8. The integral form of the exponential growth equation
to the functional role played by the organism where it
as Nt = N0 ert where Nt = Population density after time
lives.
t, N0 = Population density at time zero, r = intrinsic
16. Natality refers to the birth rate. It is the number of
rate of natural increase, e = the base of natural
births per 1000 individuals per year.
logarithms.
The death rate is called mortality.
9. Altitude sickness can be experienced at high altitudes
The number of individuals entering a habitat is called
where the body does not get enough oxygen due to low
immigration.
atmospheric pressure and causes nausea, fatigue, and
The number of individuals leaving the habitat is called
heart palpitations.
emigration.
10. Species interaction refers to direct and indirect
17. Yucca has an obligate mutualism with a species of
interrelationship between different organisms, while on
moth i.e., pronuba. The flower of the yucca plant relies
the other hand population attributes include population
on the moth for the pollination process. In turn, the
size, population density, population spacing, and age
moth is benefited by laying its eggs on the flower and 25. In ecology, the competitive exclusion principle,
feeding the larvae with the seeds. sometimes referred to as Gause's law of competitive
18. A population growing in a habitat with limited exclusion or just Gause's law states that two species
resources shows a logistic growth curve. competing for the same resource cannot coexist at
For logistic growth constant population values if other ecological factors
remain constant. When two competing life forms
attempt to occupy the same niche, only one outcome is
possible that is one life form will drive out the other.
26. Competition is a type of interaction in which both the
partners are adversely affected by each other in search
of food, shelter, and mate.
Predation and Parasitism- In this, one organism gets
the benefit and the other is harmed.
the population reaches an asymptote. Mutualism- Both the organisms get the benefits.
19. The tropical rain forest has five vertical strata on the 27. Ecological succession refers to the definite and orderly
basis of the height of plants. i.e., ground vegetation, sequences of community change in an area.
shrubs, short canopy trees, tall canopy trees, and tall 28. Biotic community is an association of individuals of
emergent trees. different species living in the same habitat and having
20. The principle of competitive exclusion was proposed functional interaction.
by G.F. Gause which states that two species competing 29. national parks are examples of in-situ conservation. In
for the same resources cannot coexist. This law is also winters, thousands of migratory birds from Siberia and
known as Gause’s law. other extremely cold northern regions move to this
21. Commensalism refers to a relationship wherein one park. The birds are called Siberian cranes. Over 230
organism is benefited while the other remains species of birds are known to be resident. It is a major
unaffected and is denoted by + 0. center of tourist attraction.
Amensalism refers to association wherein one partner 30. Detritivores are heterotrophs that obtain nutrients by
is inhibited while the other remains nearly unaffected consuming detritus or decomposing plant and animal
and is denoted by - 0. parts as well as faeces. Earthworms are a detrivore. In
Association of organisms which benefits one of the succession, pioneer species like lichen, algae, and
partners at the expense of others is called parasitism fungi, as well as other abiotic factors like wind and
and is denoted by + -. water start to 'normalize' the habitat. Pollination is a
Mutualism is the association of organisms wherein type of ecosystem service which enhances the service
both are benefited and is denoted by ++. provided by insects/birds through behavioral
Therefore, the correct answer is option c. interaction. Natality is the crude birth rate or specific
22. The production of numerous small offspring followed birth rate and is the greatest influence on a population's
by exponential population growth is the defining increase.
characteristic of r-selected species. They require short 31. The association between the sea anemone and hermit
gestation periods, mature quickly (and thus require crab is commensalism. In such interaction, one species
little or no parental care), and possess short life spans. is benefitted while the other is neither harmed nor
Unlike K-selected species, members of this group are benefitted.
capable of reproduction at a relatively young age; Symbiosis- In this, both the organisms get the benefit.
however, many offspring die before they reach Example- Lichens (Algae and fungal association).
reproductive age. Amensalism- In this, one organism is harmed and the
23. Metabolic rate is directly proportional to the size of an other is unaffected. For example- Penicillin production
animal. Larger the animal, lower is the metabolic from Penicillium notatum against Staphylococci
rate.Small animals can run uphill than a large animal bacteria.
because of their fast metabolic rate. Ectoparasitism- In this, one organism gets the benefit
24. Logistic growth of a population size occurs when and the other is harmed. Example- Lice on humans.
resources are limited. The formula we use to calculate 32. Natality = 250, Immigration = 20, Mortality = 240,
logistic growth adds the carrying capacity as a Emigration = 30
moderating force in the growth rate. The logistic model Therefore, increases in population = [(Natality +
is given as dN/dt= rN(1-N/K). When the value of N/K Immigration) – (Mortality + Emigration)]
is one, then, dN/dt = rN(1-N/K) dN/dt = rN(1-1) = [(250 + 20) − (240 + 30)]
dN/dt = rN(0) =0
dN/dt = 0 (zero) 33. Cuscuta is a total shoot parasite of many plants lives on
So, the growth rate of the population will be equal to body of plant, so a ectoparasite.
zero, when the value of N/K is equal to one. 34. (a), (c)
35. Head louse living on the human scalp as well as laying 41. Population
eggs on human hair 42. Its population growth curve is of J-type
36. (a)- regulator; (b)- conformer; (c)- partial regulator 43. dN/dt = rN
37. "A" is more recent shows slight reduction in the 44. Sharing of one or more resources between the two
growth rate species
38. (ii) and (iii) 45. Enlargement of body size by swallowing air in puffer
39. A normal distribution fish
40. Intra specific competition 46. Exponential phase
ECOSYSTEM 231
ECOSYSTEM (SOLUTIONS)
1. Gross primary productivity of an ecosystem is the rate
of production of organic matter during photosynthesis. 9.
A considerable amount of GPP is utilised by plants in Column I Column II
respiration. Gross primary productivity minus (a) Fourth trophic level (ii) Vulture
respiration losses (R), is the net primary productivity (b) Second trophic level (iii) Rabbit
(NPP). (c) First trophic level (iv) Grass
GPP – R = NPP (d) Third trophic level (i) Crow
2. The detritus food chain begins with detritus.
Earthworms break down detritus into smaller particles 10. The gross primary productivity of an ecosystem is the
by a process called fragmentation. rate of production of organic matter during
Solanaceae - Androecium: stamens five, epipetalous photosynthesis. Some of this organic matter is lost
Liliaceae - Androecium: stamen six, 3+3, because of the respiration of plants. The remaining
epitepalous primary productivity is the net primary productivity,
3. Decomposition rate is slower if detritus is rich in lignin hence it is always less than gross primary productivity.
and chitin, and quicker, if detritus is rich in nitrogen 11. In an aquatic ecosystem, the pyramid of biomass is
and water - soluble substances like sugars. generally inverted because biomass of fishes far
4. Phosphorus moves in a cycle through rocks, water, soil exceeds that of phytoplankton
and sediments and organisms. Over time, rain and
weathering cause rocks to release phosphate ions and
other minerals. This inorganic phosphate is then
distributed in soils and water. Plants take up inorganic
phosphate from the soil.
5. Fragmentation of detritus is done by detritivores. It is a
process in which detritivores feed on the dead organic
matter, turning it into smaller fragments.
6. The pyramids of biomass indicate the relationship 12. The given data depicts the inverted pyramid of
between different trophic levels with regard to biomass, usually found in aquatic ecosystems. In an
biomass. In the deepwater ecosystem, the pyramid of inverted pyramid, biomass gradually increases in
biomass is inverted. successive trophic levels as shown in the given data.
The pyramid of biomass in the sea is generally inverted A pyramid of energy is always upright.
because the biomass of fishes far exceeds that of 13. The forest ecosystem has maximum biomass. The
phytoplankton. forest ecosystem has the largest total biomass, which
7. The gross primary productivity of an ecosystem is the represents about 70% of the whole terrestrial
rate of production of organic matter during ecosystem. The forest ecosystem has the maximum
photosynthesis. A considerable amount of GPP is biomass because it includes organisms of all trophic
utilized by plants in respiration. Gross primary levels as compared to the pond, lake, or grassland
productivity minus respiration losses (R), is the net ecosystem. In forest ecosystems, productivity is also
primary productivity (NPP). high that contributes to maximum biomass.
GPP – R = NPP. 14. Primary producers of the deep sea hydrothermal vent
Net primary productivity is the available biomass for ecosystem are chemosynthetic bacteria. Sulfide-
the consumption to heterotrophs (herbivores and oxidizing bacteria are chemolithotrophic in nature.
decomposers). They are found in the deep sea hydrothermal vent
8. The amount of nutrients, such as carbon, nitrogen, ecosystem. They provide the primary food for the
phosphorus, calcium, etc., present in the soil at any invertebrates found in the immediate vicinity of the
given time is referred to as a standing state. It varies in vent ecosystem. Thus, the correct answer is option a.
different kinds of ecosystems and also on a seasonal 15. The first living things to invade such an area and
basis. Each trophic level has a certain mass of living establish themselves in it are known as pioneer
material at a particular time called the standing crop. A organisms. A typical pioneer organism populating bare
climax community is the last stage of ecological rock is lichens. Some lichens grow on rocks without
succession. A climax community is one that has soil, so may be among the first of life forms, and break
reached a stable stage. down the rock into soil for other plants.
16. Ecosystem is a segment of the biosphere consisting of
a community of living beings and the abiotic or
physical environment both interacting and exchanging
ECOSYSTEM 232
materials between them. Word 'ecosystem' was first 25. Fragmentation is one of the steps during
coined by Tansley in 1935 and previously the term decomposition in which detritus is converted to small
'biocoenosis' was used. fragments. Humification leads to the accumulation of
17. Least genetic diversity is a characteristic feature of dark coloured substance humus which undergoes
cropland ecosystems. A crop land ecosystem will have microbial action at an extremely slow rate.
a major crop cultivated in a given area. It shows that Catabolism is the third step of decomposition in which
the diversity in that particular area will be least. fungal and bacterial action takes place under anaerobic
Whereas it is the opposite when forest ecosystems are conditions.
considered. This is manmade ecosystem. Man has been Leaching is the process in which water-soluble
doing his best in modifying the croplands to get inorganic nutrients that go down into the soil horizon
maximum benefit out of them. A cropland ecosystem and get precipitated as unavailable soil.
may be illustrated by crops like wheat, maize, rice, 26. The natural reservoir of phosphorus is rock, which
sugarcane etc. contains phosphorus in the form of phosphates.
18. Biomagnification refers to an increase in concentration Seawater, animal bones and fossils are reservoirs of
of the toxicant at successive trophic levels. This carbon.
happens because a toxic substance accumulated by an 27. 4- Photoautotroph
organism cannot be metabolised or excreted, and is Nostoc, Chara, Porphyra, Wolfia
thus passed on to the next higher trophic level. 2-chemo-autotroph
19. Most animals that live in deep oceanic waters are Nitrosomonas and nitrobacter total autotrophs = 6
detritivores, also called benthos. These organisms 28. The rate of accumulation of biomass at primary
survive in harsh conditions such as high pressure, no consumer level is secondary productivity.
light, cold, etc. Hence, the (d) option is correct. 29.
20. The UN conference of Parties on climate change took
place from Monday 26 November to Saturday 8
December 2012, at the Qatar National Convention
Centre in Doha.
21. In a gaseous type of nutrient cycle, the reservoir is 30. Second stage of hydrosere is submerged hydrophyle
located either in the atmosphere or the hydrosphere. stage Yallisenaria is a submerged hydrophyte plant
Hence, carbon and nitrogen cycles are gaseous nutrient 31. Less than 50%
cycles. 32. Standing crop
In a sedimentary type of nutrient cycle, the reservoir 33. It is similar to primary succession except that it has a
exists in earth’s crust. Hence, sulphur and phosphorus relatively fast pace
are sedimentary nutrient cycles. 34. Declining population
22. Biotic community is an association of individuals of 35. It is inverted in shape
different species living in the same habitat and having 36. c and d
functional interaction. 37. Net primary productivity
23. Phosphorus is a major constituent of the biological 38. Stratification
membrane, nucleic acids and cellular energy transfer 39. Frankia
system. Detritus is leaf litter and other organic matter 40. In a pond ecosystem, fish occupy more than one
intermixed with soil, which is referred to as humus. trophic level. In the food chain of pond ecosystems,
Rocks are composed of one or more minerals. Primary phytoplanktons are the producers which are consumed
producers are organisms in an ecosystem that produce by the zooplanktons and fish directly and these are
biomass from inorganic compounds (autotrophs). called primary consumers. However, the fish may also
Litterfall is dead plant material, such as leaves, bark, act as a consumer in other trophic levels by feeding on
needles, and twigs, that has fallen to the ground. This zooplanktons or even other small fish.
detritus or dead organic material and its constituent 41. Volvox → Hydrilla → Pistia → Scirpus →Lantana →
nutrients are added to the top layer of soil, commonly Oak
known as the litter layer. 42. (ii), (iii)
24. Energy trapped at producer level, plant = 20 J. So, 43. Low moisture content
according to the 10% law of energy, only 10% of the 44. Tropical rain forest
energy is transferred from one trophic level to the next 45. Fresh weight
and the rest is lost in the form of heat. 46. A species which makes up only a small proportion of
Energy trapped by mice = 20 x 10% = 2 J the total biomass of a community, yet has a huge
Energy trapped by snake = 2 x 10% = 0.2 J impact on the community's organization and survival
Energy trapped by peacock = 0.2 x 10% = 0.02 J 47. Gross production (GP)
48. Low stability and high resilience
BIODIVERSITY AND CONSERVATION (SOLUTIONS)

1. Endarch and exarch are the terms often used for (c) Transition zone - human settlement, grazing
describing the position of primary xylem in the plant cultivation, etc., are allowed.
body. 13. Ex-situ conservation is an offsite strategy for the
2. National parks are a method of in situ conservation of conservation of animals and plants in the zoological
biodiversity where organisms are protected within their parks and botanical gardens. In this method, the
natural habitat. endangered species are brought out of their habitats
3. 'The Evil Quartet' of biodiversity loss is a concept that and protected in artificial habitats. In the given
describes the reason that causes extinction of species. question, wildlife safari parks is an example of ex-situ
These main four reasons are overexploitation, loss of conservation as it protects animals and plants in an
habitat, extinction of species continuously and artificial environment. The rest of the options are in
introduction of the exotic species. situ conservation.
4. In situ conservation of biodiversity attempts to conserve 14. Bandhavgarh National Park, Madhya Pradesh is
organisms at their natural habitat. It not only is aimed at famous for Bengal tiger.
protecting the organisms themselves, but also the Eaglenest or Eagle's Nest Wildlife Sanctuary is famous
ecosystem where they live. for its birds and tiger.
5. Species diversity is the number of different species that Dachigam National Park, Jammu and Kashmir is
are present in a given community. Amazon forest is the famous for Hangul, Kashmir stag.
richest ecosystem on earth. It contains millions of Keibul Lamjao National Park, Manipur is famous for
species of plants, insects, birds and other forms of life, brow-antlered deer and flagship species. Therefore, the
many are still unrecorded by scientists. correct answer is option c.
6. Robert May was a theoretical ecologist who established 15. Red list of IUCN is a step to conserve biodiversity and
the field of theoretical ecology and population biology. it includes names of all threatened species. Threatened
According to him, the global species diversity is about 7 species are the species which are prone to be
million. endangered in near future. For example, red pandas.
7. The botanical garden comes under ex-situ conservation Therefore, the correct answer is option b.
(off-site conservation) i.e. living plants (flora) are 16. Parthenium hysterophorus is a common invasive weed
conserved in artificial human-managed systems. and causes damage to the wheat crop. Its infection
While others are examples of in-situ conservation causes dermatitis and respiratory disorders in human
methods. and dermatitis in cattle.
8. The United Nations Conference on Environment and Stratification is the key character of the ecosystem and
Development, also known as Earth Summit (Rio refers to the arrangement of flora and fauna in vertical
Summit) held in 1992, called upon all nations to take layers.
appropriate measures for conservation of biodiversity Parenchyma with large intercellular spaces filled with
and sustainable utilisation of its benefits. air are termed as aerenchyma which serves to maintain
9. Habitat loss and fragmentation is the most important buoyancy of aquatic plants in aquatic medium and
cause of driving animals and plants to extinction. eg: allow them to float.
Loss of tropical rainforest reducing the forest cover Opuntia is a xerophyte plant. Age pyramid represents
from 14% to 6%. distribution of organisms of a population in different
10. Sacred groves are an example of in-situ conservation. age groups.
Sacred groves are forest fragments, which are protected Therefore, the correct answer is option b.
by religious communities and have a significant 17. The concept of biodiversity hotspot was given by
religious connotation for the protecting community. Myers who first recognized 10 hotspots that have high
Sacred groves are mini forests with rich diversity. biodiversity. A hotspot is a natural habitat that has at
11. Alexander Von Humbolt discovered species-area least more than 0.5% of total vascular plants as
relationships. Species area relationships are the endemic species and is under threat by human
relationship between the area and the particular habitat. activities. Total 34 hotspots have been identified till
It is dependent on immigration, extinction, and date that cover only 2.3% of earth surface but are
clustering, etc. This relation can be graphically habitat for 77% of the world's species.
expressed as a rectangular hyperbola. Therefore, the correct answer is option b.
12. Biosphere reserve is a protected area with multipurpose 18. The accelerated rates of species extinction are largely
activities. It has three zones due to human activities. The major cause of
(a) Core zone - without any human interference biodiversity loss is habitat loss and fragmentation. The
(b) Buffer zone - with limited human activity most dramatic example of habitat loss is the tropical
rainforests. Once covering more than 14% of earth's
land surface, these rainforests now don't cover even 6% animal species that are found in a particular
of the land surface. geographical region and nowhere else in the world. A
19. River Dolphin is the National Aquatic Animal of India. species is vulnerable when it is not critically
This mammal is also said to represent the purity of the endangered or endangered but is facing a high risk of
holy Ganga as it can only survive in pure and fresh extinction in the medium-term future.
water. 25. Fungi represent the maximum number of species
20. The species confined to a particular region and not among global biodiversity.
found elsewhere is termed as endemic species. 26. Shifting cultivation is a type of deforestation and not a
21. Phylum-Arthropoda is the largest phylum of the animal conservation strategy.
kingdom with its largest group, i.e. Insecta (A). The 27. Westem Ghats of India are biodiversity hot spot, have
second largest population is of phylum Mollusca (B). high degree of species riclmess and high degree of
The third one is occupied by crustaceans (C). All other endemism of species.
animals together indicate the (D) portion of the pie 28. Sacred grooves are method for insitu conservation of
chart. biodiversity and conserving rare and threatened species.
22. IUCN is the International Union for Conservation of Ref. NCERT 12th (Eng) page no. 267 Chapter-15
Nature and Natural Resources publishes the Red List of 29. Insects
species facing the risk of extinction. 30. Tropical rainforests
23. Ex-situ conservation is the preservation of samples of 31. IUCN = International Union for Conservation of Nature
biological origin outside their natural habitats. This and Natural Resources
involves conservation of genetic resources as well as 32. Rice
wild and cultivated species. A seed bank stores seeds as 33. Seed bank
a source for planting in case seed reserves elsewhere 34. Wheat
are destroyed. It is a type of gene bank. The seeds 35. Gir
stored may be food crops or those of rare species to 36. Lesser inter-specific competition
protect biodiversity. Whereas in-situ conservation is the 37. d
conservation and maintenance of samples of living 38. Lantana camara, Water hyacinth
organisms in their natural habitat. Wildlife sanctuary, 39. Podophyllum
sacred groves and national parks are examples of in- 40. Botanical garden
situ conservation. 41. Western Ghats
24. A species facing extremely high risk of extinction in 42. 2002
the immediate future is called critically endangered 43. 660 North and South
species. A species that has no living members is called 44. By creating biosphere reserve
as extinct species. Endemic species are plant and
Creating Impact at Scale
65 Million+
Monthly
Youtube Views
49 Million+ 40+ Countries

Monthly Where Students
Web + App Visitors Take Live Classes
25 Million+ 26 Million+
Monthly Active Hours of
Users Live Learning
25 43
Parents
Happy
Trust
Students
Vedantu
MILLION+ MILLION+

NEET 2004 To 23 Chapterwise PYQs - Biology

Uploaded by

Copyright:

Available Formats

NEET 2004 To 23 Chapterwise PYQs - Biology

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

NEET 2004 To 23 Chapterwise PYQs - Biology

Uploaded by

Copyright:

Available Formats

Published by

Vedantu Innovations Pvt. Ltd.

Aspiring medical professionals, welcome! As the founder of Vedantu, it is with immense

 Exam pattern familiarization: Immerse yourself in the actual questions asked

 Comprehensive revision: Revisit and practice questions from every single

This extensive volume serves as a testament to our unwavering commitment to your

With best wishes,

Solutions ................................................................................................................................................................ 185

THE LIVING WORLD

15. Methanogens belong to 25. Choose the wrong statement.

47. Spore dissemination in some liverworts is aided by : (a) A –L ; B –J; C –M ; D – N ; E – K

(a) (a)-(iii), (b)-(ii), (c)-(iv), (d)-(i) (b) D-glucosamine

MORPHOLOGY OF FLOWERING PLANTS

31. Tricarpellary, syncarpous gynoecium is found in (c) Groundnut (d) Gram

ANATOMY OF FLOWERING PLANTS

STRUCTURAL ORGANISATION IN ANIMALS

CELL: THE UNIT OF LIFE

28. Mitochondria and chloroplast are (c) Mesosome

10. Identify the incorrect pair. 17. Concanavalin A is

Column I Column II (a) Exothermic reaction with energy A in presence of

24. A non-proteinaceous enzyme is (c) A aturated or unsaturated fatty acid esterified to a

CELL CYCLE AND CELL DIVISION

PHOTSYNTHESIS IN HIGHER PLANTS

PLANT GROWTH AND DEVELOPMENT

BREATHING AND EXCHANGE OF GASES

(a) Tidal Volume

BODY FLUIDS AND CIRCULATION

(c) Osmotic balance of body fluids (b) White blood cells

EXCRETORY PRODUCTS AND THEIR ELIMINATION

(d) A-AMMONOTELIC-Pigeon, Humans; B- (d) Ascending limb of Loop of Henly is impermeable

LOCOMOTION AND MOVEMENT

NEURAL CONTROL AND COORDINATION

(b) Post-synaptic membrane [NEET (2014)]

CHEMICAL COORDINATION AND INTEGRATION

(a) A- Placenta; B- Glucagon; C- Calcitionin (c) Higher levels of cortisone

SEXUAL REPRODCTION IN FLOWERING PLANTS

(c) Free nuclear proembryo (c) Ex situ conservation

(c) Central cell (a) Amphitropous (b) Anatropous

Column I Column II (a) a → (i); b → (iii); c → (ii)

PRINCIPLES OF INHERITANCE AND VARIATION

(a) Duplication (b) Translocation (c) 3 : 1 : : Tall : Dwarf

MOLECULAR BASIS OF INHERITANCE

[NEET (2020)] 34. AGGTATCGCAT is a sequence from the coding strand

(a) Blotting 67. Which one of the following represents a palindromic

(a) tRNA (b) mRNA 99. Telomerase is an enzyme which is a -

22. In Hardy-Weinberg equation, the frequency of (a) 0.5 (b) 0.6

HUMAN HEALTH AND DISEASES

(d) a – iii; b – iv; c – i; d – ii 16. In which disease does mosquito-transmitted pathogen

(d) Attenuated pathogens (a) Depressant (b) Stimulant

(i) Medical Termination of Pregnancy (MTP) during (c) Mood disorders

MICROBES IN HUMAN WELFARE

(d) Secondary treatment (a) (a)-(iii); (b)-(iv); (c)-(i); (d)-(ii)

(c) Mechanical process (c) Has no relationship with concentration of oxygen in

BIOTECHNOLOGY PRINCIPLES AND PROCESSES

55. Restriction endonuclease - 57. Restriction endonucleases :-

BIOTECHNOLOGY AND ITS APPLICATION

ORGANISMS AND POPULATION

Lactobacillus, Nostoc, Chara, Nitrosomonas,

BIODIVERSITY AND CONSERVATION