ORIGINAL RESEARCH

published: 07 July 2021

doi: 10.3389/fpls.2021.680859

Efficient Protoplast Regeneration

Protocol and CRISPR/Cas9-Mediated
Editing of Glucosinolate Transporter
(GTR) Genes in Rapeseed (Brassica
napus L.)
Xueyuan Li † , Sjur Sandgrind † , Oliver Moss, Rui Guan, Emelie Ivarson, Eu Sheng Wang,
Selvaraju Kanagarajan* and Li-Hua Zhu*

Department of Plant Breeding, Swedish University of Agricultural Sciences, Lomma, Sweden

Edited by:
Difficulty in protoplast regeneration is a major obstacle to apply the CRISPR/Cas9 gene
Agnieszka Ludwików, editing technique effectively in research and breeding of rapeseed (Brassica napus L.).
Adam Mickiewicz University in
The present study describes for the first time a rapid and efficient protocol for the isolation,
Poznań, Poland
regeneration and transfection of protoplasts of rapeseed cv. Kumily, and its application
Reviewed by:
Yiping Qi, in gene editing. Protoplasts isolated from leaves of 3–4 weeks old were cultured in MI
University of Maryland, College Park, and MII liquid media for cell wall formation and cell division, followed by subculture on
United States
Zahir Ali,
shoot induction medium and shoot regeneration medium for shoot production. Different
King Abdullah University of Science basal media, types and combinations of plant growth regulators, and protoplast culture
and Technology, Saudi Arabia
duration on each type of media were investigated in relation to protoplast regeneration.
*Correspondence:
The results showed that relatively high concentrations of NAA (0.5 mg l−1 ) and 2,4-D
Li-Hua Zhu
[email protected] (0.5 mg l−1 ) in the MI medium were essential for protoplasts to form cell walls and
Selvaraju Kanagarajan maintain cell divisions, and thereafter auxin should be reduced for callus formation and
[email protected]
shoot induction. For shoot regeneration, relatively high concentrations of cytokinin were
† These authors share first authorship required, and among all the combinations tested, 2.2 mg l−1 TDZ in combination with
auxin 0.5 mg l−1 NAA gave the best result with up to 45% shoot regeneration. Our results
Specialty section:
This article was submitted to also showed the duration of protoplast culture on different media was critical, as longer
Plant Biotechnology, culture durations would significantly reduce the shoot regeneration frequency. In addition,
a section of the journal
Frontiers in Plant Science
we have optimized the transfection protocol for rapeseed. Using this optimized protocol,
Received: 15 March 2021
we have successfully edited the BnGTR genes controlling glucosinolate transport in
Accepted: 07 June 2021 rapeseed with a high mutation frequency.
Published: 07 July 2021
Keywords: Brassica napus, CRISPR/Cas9, gene editing, glucosinolate transporter, GTR gene, protoplast
Citation: regeneration
Li X, Sandgrind S, Moss O, Guan R,
Ivarson E, Wang ES, Kanagarajan S
and Zhu L-H (2021) Efficient
Protoplast Regeneration Protocol and
INTRODUCTION
CRISPR/Cas9-Mediated Editing of
Glucosinolate Transporter (GTR) The CRISPR/Cas9 technology has now become a prevailing tool for plant genome editing owing
Genes in Rapeseed (Brassica napus to its high precision, efficiency and simplicity in use (Arora and Narula, 2017). Apart from its
L.). Front. Plant Sci. 12:680859. powerful role in functional genomics analysis, it has also revolutionized the strategy for crop
doi: 10.3389/fpls.2021.680859 breeding and improvement. So far the CRISPR/Cas9 system has been successfully applied to edit

Frontiers in Plant Science | www.frontiersin.org 1 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

genes in a number of plant species, such as Arabidopsis thaliana the regeneration frequency is often species and genotype
(Jiang et al., 2013), Nicotiana tabacum (Nekrasov et al., 2013), dependent, making method improvement very challenging
rice (Shan et al., 2013), maize (Liang et al., 2014), sorghum (Kielkowska and Adamus, 2012). This is mainly because a
(Jiang et al., 2013), wheat (Shan et al., 2013), etc. However, large number of conditions need to be optimized in order
the majority of these studies relied on stable transformation by to obtain reasonably high regeneration frequencies for each
Agrobacterium tumefaciens to deliver the CRISPR vectors. As species. These conditions include protoplast isolation method,
stable transformation of plants normally results in regeneration protoplast density for culture, nutrients, type and concentration
of mutation lines with integration of foreign DNA into the of sugars, concentrations and combinations of plant growth
plant genome, this gene editing system raise regulatory concerns regulators (PGRs) in culture media, culture conditions and
related to genetically modified plants in some countries (Woo the developmental stage of protoplast calli capable of shoot
et al., 2015). induction, etc.
Polyethylene glycol (PEG)-mediated protoplast transfection Apart from providing edible oil, rapeseed also contains a large
is an alternative for delivery of CRISPR vectors or amount of high quality protein, which remains in the seedcake
ribonucleoprotein complexes (RNPs) into plant cells, which after oil extraction. The seedcake is currently used only as
can produce transgene-free mutation lines through transient animal feed due to the presence of antinutritional factors, which
gene expression. However, as protoplast regeneration remains make the seedcake taste bitter and undesirable for food uses
a bottleneck for many plant species, gene editing through (Nour-Eldin et al., 2012). One of such antinutritional factors is
the protoplast approach for trait improvement has not been glucosinolates (GSLs). GSLs are synthesized in vegetative tissues
widely applied in most of the crop species. Application of the and transported to seeds in Brassica species, and this transport
protoplast approach for gene editing in crop species reported is mainly regulated by glucosinolate transporter (GTR) genes
so far were mainly for research purpose (Nicolia et al., 2015; (Nour-Eldin et al., 2012). Eliminating or reducing the quantity
Woo et al., 2015; Malnoy et al., 2016; Kim et al., 2017; Liang of GSLs in seedcake is thus necessary to improve the rapeseed
et al., 2017; Lin et al., 2018), while in most cases no protoplast seedcake for feed and food uses.
regeneration results were reported. Development of an efficient In this study, we report a rapid and efficient protoplast
and reliable protoplast regeneration method is thus essential for transfection and regeneration protocol for rapeseed gene editing
the application of all currently available CRISPR gene editing using CRISPR/Cas9. Using this protocol, we have obtained high
systems for directly producing transgene-free mutants for many transfection and mutation frequencies, and successfully obtained
plant species. mutated plants with the targeted mutations in the BnGTR genes.
Rapeseed is an important oil crop, accounting for about
16% of the total global vegetable oil production (USDA, 2019).
MATERIALS AND METHODS
Cultivated rapeseed is an allotetraploid species (B. napus; 2n
= 38, AACC) that was formed by polyploidization of two Plant Material
diploids ancestors, B. oleracea (genome CC) and B. rapa Seeds of spring rapeseed (B. napus L.) cv. Kumily, kindly
(genome AA) (Chalhoub et al., 2014). Although the gene editing provided by Lantmännen, Svalöf, Sweden, were used in
system of CRISPR/Cas9 has been used in rapeseed for trait this study.
improvement, the published results so far relied on stable
transformation with Agrobacterium (Braatz et al., 2017; Li et al., In vitro Culture Conditions
2018; Huang et al., 2020; Zheng et al., 2020). To the best of our All in vitro cultures in this study were maintained in a controlled
knowledge, only a few studies reported using protoplasts for gene climate chamber which has a temperature of 23 ◦ C/18 ◦ C
editing by CRISPR/Cas9 in rapeseed, while none of them have (day/night) and 16 h photoperiod with a light intensity of 40
reported success in obtaining mutation lines, i.e. no protoplast µmol m−2 s−1 (cool white fluorescent tubes).
regeneration after transfection. Murovec et al. (2018) reported
using RNPs for gene editing of rapeseed, but no mutations were Seed Germination
detected after protoplast transfection. Lin et al. (2018) reported Seeds were surface sterilized using 15% (w/v) calcium
that the rapeseed genome could be mutated by CRISPR/Cas9 hypochlorite (CaCl2 O2 ) for 20 min, and then rinsed thoroughly
using the protoplast approach, but no regenerated plants from with sterile water. Surface sterilized seeds were planted on
the transfected protoplasts were reported. All the published germination medium in sterile plastic boxes. The germination
results indicate that proof-of-concept protoplast regeneration medium contained half strength Murashige & Skoog (MS), 10 g
protocols for CRISPR/Cas9 genome editing are still lacking for l−1 sucrose, 7 g l−1 Bacto agar at pH 5.7. The boxes were placed
most crop species in general, including rapeseed. in the climate chamber as stated above.
Development of protoplast culture technology in Brassica
species started in the 1970s, and received a great amount Protoplast Isolation
of attention in the early 1980s for a variety of applications, Protoplasts were isolated according to Yoo et al. (2007), with
including mutant isolation, somatic hybridization and genetic some modifications. About 40 fully opened young leaves from 3–
transformation. Although intensive studies on protoplast 4 weeks old seedlings were sliced into fine pieces on wetted filter
culture conditions were conducted, protoplast regeneration paper in a sterile Petri dish and incubated in plasmolysis solution
remained at very low levels in most cases. Furthermore, (0.4 M mannitol at pH 5.7) for 30 min at room temperature

Frontiers in Plant Science | www.frontiersin.org 2 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

(RT) in the dark. The leaf pieces were then treated with 10 ml TABLE 1 | Effect of PGRs in MI medium on protoplast growth and development of
enzyme solution and incubated for 14–16 h at RT in the dark rapeseed.

with gentle shaking. The enzyme solution consisted of 1.5% PGR conc. Viability PGR conc. Viability
(w/v) cellulase OnozukaTM R-10 (Yakult Pharmaceutical Co., (mg l−1 ) of protoplasts (%)* (mg l−1 ) of protoplasts (%)*
LTD., Tokyo, Japan), 0.6% (w/v) MacerozymeTM R-10 (Yakult
Pharmaceutical Co., Ltd.), 0.4 M mannitol, 10 mM MES, 0.1% TDZ 1.1 0.0 c NAA 0.5 80.0 a
(w/v) BSA, 1 mM CaCl2 and 1 mM β-mercaptoethanol at pH 5.7. 2,4-D 1.0 2,4-D 0.5

The isolated protoplasts were filtered through a 40 µm nylon TDZ 1.1 0.0 c BAP 2.0 0.0 c
2,4-D 0.5 NAA 0.5
cell strainer into a 50 ml Falcon tube, diluted with 30 ml W5
TDZ 1.1 0.0 c Zeatin 1.0 0.0 c
solution (Menczel et al., 1981) and centrifuged at 100 g for 2,4-D 0.25 NAA 0.5
10 min. Pellets were re-suspended in 10 ml W5 solution and
TDZ 0.55 0.0 c BAP 2.0 20.3 b
centrifuged at 100 g for 5 min, and this process was repeated 2,4-D 0.5 2,4-D 0.5
twice. Pellets were then re-suspended in 5 ml W5 solution and Zeatin 1.0 13.3 b
incubated on ice in the dark for 30 min. The supernatant was 2,4-D 0.5
discarded and the protoplasts were diluted with 5–10 ml W5
Medium I composition: 2.18 g l−1 Nitsch medium, 10 g l−1 sucrose, 10 g l−1 glucose,
solution based on the size of pellets. Protoplast solution of 15 µl 100 g l−1 mannitol, 100 mg l−1 casein at pH 5.7. * Percentage of protoplasts maintained
was loaded on a hemocytometer for counting protoplasts under round and compact in form, and green in color, observed under light microscope 7 d after
light microscope. After centrifugation for 3 min at 100 g, the protoplast culture. Values followed by the same letter were not statistically different at p
= 0.05 (n = 3).
protoplast density was adjusted to 400 000 to 600 000 per ml
using 0.5 M mannitol solution. Equal volume of the protoplast
suspension and alginate solution were mixed for making alginate TABLE 2 | Effect of PGRs in MII medium on protoplast development of rapeseed.
disks. The alginate-solution consisted of 2.8% (w/v) sodium
alginate and 0.4 M mannitol according to Kielkowska and PGR conc. Callus formation PGR conc. Callus
(mg l−1 ) (%)* (mg l−1 ) formation (%)*
Adamus (2012). To produce alginate disks, about 500 µl of the
mixed protoplast and alginate suspension were pipetted onto BAP 1.0 0.0 b TDZ 1.1 0.0 b
the calcium-agar plates (0.4 M mannitol, 2.2 g l−1 CaCl2 and NAA 0.5 NAA 0.1
10 g l−1 Phyto agar) and incubated at RT for 30 min. Thereafter, BAP 1.0 0.0 b TDZ 1.1 75.0 a
2 ml of calcium-solution (50 mM CaCl2 , 0.4 M mannitol) was NAA 0.1 NAA 0.05
added onto each disk and incubated for 1 h at RT to complete BAP 2.0 0.0 b TDZ 1.1 0.0 b
polymerization. The disks were then transferred to the culture NAA 0.1 2,4-D 0.1
medium as described below. TDZ 2.2 0.0 b TDZ 1.1 80.0 a
NAA 0.1 2,4-D 0.05
Protoplast Culture in Liquid Medium The protoplasts were cultured in MI medium before being transferred to MII medium.
The prepared protoplast-alginate disks were cultured in 6-well Medium II composition: 2.18 g l−1 Nitsch medium, 10 g l−1 sucrose, 10 g l−1 glucose,
tissue culture plates with one disk in each well and addition 100 g l−1 mannitol, 100 mg l−1 casein at pH 5.7. * The results were recorded when
protoplast colonies were about 0.1 mm in diameter after 30 d in the MII medium. Values
of 2–3 ml MI medium. Plates were covered with aluminium
followed by the same letter were not statistically different at p = 0.05 (n = 3).
foil and kept at RT for 24 h, thereafter placed under fibre
cloth without aluminium foil in the climate chamber under
conditions as stated above. After 3–4 d, the MI medium was
replaced by MII. MI medium consisted of 2.18 g l−1 Nitsch shoot regeneration medium (SRM) in Petri dishes for shoot
medium (Nitsch and Nitsch, 1969), 10 g l−1 sucrose, 10 g regeneration. Different SRM media were designed, in which C-
l−1 glucose, 100 g l−1 mannitol, 100 mg l−1 casein, 0.5 mg and N-sources, types and combinations of PGRs, as well as
l−1 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.5 mg l−1 α- culture duration in MI, MII and on SIM medium were tested.
naphthaleneacetic acid (NAA) at pH 5.7. MII medium was the The detailed experimental designs are presented in (Tables 1–
same as MI, but PGRs were changed to 1.1 mg l−1 thidiazuron 7). The medium was renewed every 3–4 weeks during the shoot
(TDZ) and 0.05 mg l−1 2,4-D instead. During this culture period, regeneration phase.
MII medium was renewed every 5–7 d. The regenerated shoots were transferred to the shoot growing
medium consisting of fullstrength MS, 20 g l−1 sucrose, 0.05 mg
Plant Regeneration, Growth and Rooting l−1 6-benzyladnine (BAP), 0.03 mg l−1 gibberellic acid 3 (GA3 )
on Solid Medium and Bacto agar 7.5 g l−1 at pH 5.7.
After 20–25 d, the protoplast calli from the alginate disks The elongated shoots were transferred to the rooting medium
were directly spread on the shoot induction medium (SIM) in consisting of half strength MS, 20 g l−1 sucrose, 0.05 mg l−1 NAA
Petri dishes for shoot induction. The SIM medium consisted and Bacto agar 7.5 g l−1 at pH 5.7. The rooted shoots were then
of full-strength MS, 30 g l−1 sucrose, 50 g l−1 mannitol, planted in soil in the biotron with standard management. The
1.1 mg l−1 or 2.2 mg l−1 TDZ, 0.05 mg l−1 NAA, 0.5 mg growth conditions in the biotron were 21◦ C/16◦ C (day/night),
l−1 AgNO3 and 2.5 g l−1 Gelrite at pH 5.7. After 10–20 d 16 h photoperiod with a light intensity of 250 µmol m−2 s−1 and
on the SIM medium, the protoplast calli were transferred to 60% humidity.

Frontiers in Plant Science | www.frontiersin.org 3 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

TABLE 3 | Effect of PGRs in shoot induction medium (SIM) on protoplast TABLE 6 | Effect of culture duration in MI and MII media on protoplast
regeneration of rapeseed. regeneration of rapeseed.

PGR conc. Regeneration (%)* PGR conc. Regeneration (%)* Regeneration (%)*
(mg l−1 ) (mg l−1 ) Duration 3d 5d 10d 15d 20d 30d 40d

TDZ 1.1 0.0 b TDZ 2.2 0.0 b In MI 35.0 a 15.0 b 0.0 c 0.0 c 0.0 c - -
NAA 0.05 NAA 0.05
In MII - - 0.0 c 20.0 a 40.0 b 15.0 c 0.0 c
TDZ 1.1 35.0 a TDZ 2.2 40.0 a
NAA 0.05 NAA 0.05 Medium I composition: 2.18 g l−1 Nitsch medium, 10 g l−1 sucrose, 10 g l−1 glucose,
Mannitol 50,000 Mannitol 50,000 100 g l−1 mannitol, 100 mg l−1 casein, 2.2 mg l−1 NAA, 0.5 mg l−1 2,4-D at pH 5.7.
Medium II composition: 2.18 g l−1 Nitsch medium, 10 g l−1 sucrose, 10 g l−1 glucose,
SIM medium composition: Full strength MS, sucrose 30 g l−1 , 0.5 mg l−1 AgNO3 , 2.5 g 100 g l−1 mannitol, 100 mg l−1 casein, 1.1 mg l−1 TDZ, 0.05 mg l−1 2,4-D at pH5.7.
* The results were recorded after one month on the SRM medium, which consisted of full
l−1 Gelrite at pH 5.7. * The results were recorded after one month on the SIM media.
Values followed by the same letter were not statistically different at p = 0.05 (n = 3). strength MS, 2.2 mg l−1 TDZ, 0.5 mg l−1 NAA, 0.5 mg l−1 AgNO3 , 2.5 g l−1 Gelrite at pH
5.7. Values followed by the same letter were not statistically different at p = 0.05 (n = 3).

TABLE 4 | Effect of PGRs in shoot regeneration medium (SRM) on protoplast

regeneration of rapeseed. TABLE 7 | Effect of culture duration on shoot induction medium (SIM) on
protoplast regeneration of rapeseed.
PGR conc. Regeneration (%)* PGR conc. Regeneration (%)
(mg l−1 ) (mg l−1 ) Regeneration (%)*
Duration 15d 20d 25d 30d 40d 50d 60d
BAP 2.0 0.0 c Kinetin 2.0 0.0 c
NAA 0.1 NAA 0.1 SIM1 17.0 c 39.7 a 40.0 a 26.0 b 14.0 c 5.0 d 0.0 d
BAP 3.0 0.0 c TDZ 0.5 0.0 c SIM2 17.0 bc 45.0 a 45.0 a 20.0 b 10.0 c 8.0 cd 0.0 d
NAA 0.2 NAA 0.1
SIM1 composition: Full strength MS, 30 g l−1 sucrose, 50 g l−1 mannitol, 1.1 mg l−1 TDZ,
BAP 5.0 1.0 c TDZ 1.1 5.0 c
0.05 mg l−1 NAA, 0.5 mg l−1 AgNO3 , 2.5 g l−1 Gelrite at pH 5.7. SIM2 composition: Full
NAA 0.5 NAA 0.1
strength MS, 30 g l−1 sucrose, 50 g l−1 mannitol, 2.2 mg l−1 TDZ, 0.05 mg l−1 NAA,
Zeatin 1.0 0.0 c TDZ 2.2 45.0 a 0.5 mg l−1 AgNO3 , 2.5 g l−1 Gelrite at pH 5.7. * The results were recorded after two months
NAA 0.1 NAA 0.5 on the SRM medium. Values followed by the same letter were not statistically different at
Zeatin 2.0 0.0 c TDZ 2.2 22.0 b p = 0.05 (n = 3).
NAA 0.2 NAA 1.0

SRM medium composition: Full strength MS, sucrose 20 g l−1 , 0.5 mg l−1 AgNO3 , 2.5 g
l−1 Gelrite at pH 5.7. * The results were recorded after one month on the SRM medium. LOC106369007, LOC106405453, LOC106411192 and
Values followed by the same letter were not statistically different at p = 0.05 (n = 3). LOC106424883) were found (Table 8). Genomic and full-length
open reading frames of six BnGTR1 and six BnGTR2 paralogs
were amplified from genomic DNA and cDNA of cv. Kumily,
TABLE 5 | Effect of C-sources in shoot regeneration medium (SRM) on protoplast
regeneration of rapeseed.
respectively, using gene specific primers according to published
protocols (Kim et al., 2020; Muthusamy et al., 2020), with minor
Sugar conc. Regeneration (%)* Sugar conc. Regeneration (%) modifications, and confirmed by sequencing. Genomic DNA
(g l−1 ) (g l−1 ) sequences of different paralogs from the BnGTR1 and BnGTR2
were aligned to find conserved target sites among the paralogs
Sucrose 15 30.6 b Glucose 10 11.3 c
of each gene. Based on the location in the target gene sequence,
Sucrose 20 41.0 a Glucose 20 10.0 c
off target potential and the GC content, two target sequences
Sucrose 30 31.4 ab
for all six BnGTR1 paralogs (one in exon 2 and one in exon 3)
SRM composition: Full strength MS, 2.2 mg l−1 TDZ, 0.5 mg l−1 NAA, 0.5 mg l−1 AgNO3 , and two target sequences for all six BnGTR2 paralogs (both in
2.5 g l−1 Gelrite at pH 5.7. * The results were recorded after one month on the SRM exon 2) (Table 9) were designed using CRISPR MultiTargeter
medium. Values followed by the same letter were not statistically different at p = 0.05
(Prykhozhij et al., 2015). All the chosen target sequences were 20
(n = 3).
bp and tested for their off-target potential in the rapeseed genome
using Cas-Offinder (Bae et al., 2014). Each target sequence was
integrated into a single guide RNA (sgRNA) expression cassette
Identification and Cloning of GTR Genes, (Addgene plasmids# 66201, 66198, 66202, 66203) using the
sgRNA Design and Vector Construction primers listed in Supplementary Table S1. Thereafter, all four
Two known BnGTR orthologs from A. thaliana, AtGTR1 sgRNA expression cassettes were sequentially ligated into the
(AT3G47960) and AtGTR2 (AT5G62680) were used for a pYLCRISPR/Cas9Pubi -N vector according to the protocol
BLAST query in the NCBI database against the rapeseed described by Ma et al. (2015), resulting in a vector designated
reference genome cv. ZS11 (Bra_napus_v2.0) and six paralogs as pYLCRISPR/Cas9Pubi -GTR Supplementary Figure S1.
of BnGTR1 (LOC106397267, LOC106408997, LOC106410496, Moreover, in order to examine if the transgene integration
LOC106414122, LOC106445255 and LOC111202315) and happened or not in the mutants, PCR was performed on the
six paralogs of BnGTR2 (LOC106347844, LOC106366161, Cas9 and nptII genes in the pYLCRISPR/Cas9Pubi -GTR vector

Frontiers in Plant Science | www.frontiersin.org 4 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

using the gene specific primers (Supplementary Table S2). The Randomly selected single colonies were analyzed by Sanger
PCR analyses were performed using Phusion High-Fidelity PCR sequencing (Eurofins Genomics, Konstanz, Germany).
Master Mix with GC Buffer (Thermo ScientificTM ) according to
the manufacturer’s recommendations. The PCR conditions were Statistical Analysis
98◦ C for 3 min, followed by 30 cycles at 98◦ C for 10 s, 63◦ C for For the protoplast viability test, protoplast solution was loaded
30 s, 72◦ C for 30 s, with a final extension at 72◦ C for 8 min and on a Hemocytometer and five 1 mm2 squares were observed
the PCR products were separated on a 1% agarose gel. under light microscope seven days after culture, and this was
repeated three times. For the callus and shoot regeneration tests,
Protoplast Transfection each treatment consisted of 40–50 protoplast colonies, and was
For approximation of transfection efficiency, protoplasts were repeated three times. The regeneration results were recorded
transfected with the vector pCW498-35S-GFiP-OcsT (14 about 1–3 months after shoots started to appear, depending
743bp) harboring the green fluorescent protein gene (GFP) on experiment. The detailed information is presented at the
(Wood et al., 2009). For inducing mutations in the BnGTR1 bottom of each corresponding table in the result section. Data
and BnGTR2 genes, protoplasts were transfected with the was analyzed with ANOVA and Tukey’s test using the statistical
pYLCRISPR/Cas9Pubi -GTR vector (18537 bp). software Minitab (LLC) version 19.2020.1.
After isolating and washing protoplasts as described above,
∼120 000 protoplasts were re-suspended in 200 µl freshly RESULTS
prepared MMG solution (0.5 M mannitol, 15 mM MgCl2 , 4 mM
MES) in a 2 ml Eppendorf tube. The solution was mixed with Effect of PGRs in MI Medium on Protoplast
40 µg pCW498-35S-GFiP-OcsT vector or pYLCRISPR/Cas9Pubi - Viability at the Initial Stage
GTR vector DNA and equal volume of freshly prepared PEG- Protoplasts are very fragile and sensitive to the growth
calcium solution (25% (w/v) PEG 4000, 0.5 M mannitol and environment when they are freshly isolated due to lacking the
0.1 M CaCl2 ). The reaction was stopped after 5 min by addition cell wall. The medium composition, especially PGRs, is crucial
of 1.5 ml W5 and mixed by inversion of the tubes, followed to the initial protoplast culture. We thus tested several PGR
by centrifugation at 100 g for 3 min and immediate removal combinations in MI medium, and found that the combination
of supernatant. of 0.5 mg l−1 2,4-D and 0.5 mg l−1 NAA gave the best result
Protoplasts transfected with the pCW498-35S-GFiP-OcsT in terms of protoplast viability among all PGR combinations
vector DNA were re-suspended in 1 ml MI, transferred to 12- tested. In this medium, most protoplasts remained viable, as
well tissue culture plates and incubated in the dark at RT. they were observed under a light microscope to be round
The protoplasts transfected with the pYLCRISPR/Cas9Pubi -GTR and compact in form and green in color (Figure 1A) 7 d
vector DNA were re-suspended in 200 µl 0.5 M mannitol and after protoplast culture. The protoplasts in the MI medium
embedded in alginate disks as described above. containing other PGR combinations became inviable (Table 1),
namely shrunk and pale or brownish in color. This result is
Detection of GFP Gene Expression and in agreement with the results from a previous report, which
Identification of BnGTR Mutants indicated that 2,4-D was essential for cell wall formation
For estimation of transfection efficiency, the protoplasts and initial protoplast growth (Glimelius, 1984). Moreover, our
transfected with the GFP vector were observed after 48 h with results showed that addition of cytokinin, like TDZ, BAP
Zeiss LSM 880 Airyscan confocal laser scanning microscope or zeatin, in combination with auxin in MI medium did
using an EC-Plan-Neofluar 10x/0.30 M27 objective for not improve protoplast viability or growth compared with
validation of GFP expression. Excitation wavelength was auxin alone.
488 nm and detection wavelength was 490–585 nm. Non-
transfected protoplasts were used as control to verify that no Effect of PGRs in MII Medium on
auto-fluorescence could be observed. Protoplast Growth and Development
To identify mutations in the BnGTR genes, genomic After the cell wall has formed, the protoplasts would undergo
DNA was extracted from the regenerated shoots using Phire a rapid cell division (Figures 1B, C), and a suitable PGR
Plant Direct PCR kit (Thermo Fisher ScientificTM ) and used combination in MII medium was found to be essential during
as template for PCR amplification of the target sequences this stage. We investigated different PGR combinations in
with fluorescently labeled forward primers using Phusion MII medium. The results showed that the combinations
High-Fidelity PCR Master Mix with GC Buffer (Thermo of 1.1 mg l−1 TDZ with 0.05 mg l−1 2,4–D and 1.1 mg l−1
ScientificTM ) (Supplementary Table S3). The PCR amplicons TDZ with 0.05 mg l−1 NAA gave better results than the
were subjected to high-resolution fragment analysis (HRFA) other PGR combinations tested, as the protoplasts divided
as described by Andersson et al. (2017). For confirmation rapidly and formed multiple protoplast colonies on these
of the mutations by sequencing, PCR amplicons with non- two media (Table 2), indicating that a relatively lower
labeled primers were ligated into the pJET1.2/blunt cloning concentration of auxin was necessary for protoplast growth
vector (Thermo ScientificTM ) and transformed into StellarTM and further development during this stage. The results
chemically competent cells of E. coli (Takara Bio, Shiga, Japan). also showed that TDZ as cytokinin source was much more

Frontiers in Plant Science | www.frontiersin.org 5 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

TABLE 8 | Features of the BnGTR paralogs used in this study.

Arabidopsis orthologs B. napus genes Locus number Genomic sequence length (bp) Number of exons Coding region (bp)

AtGTR1 BnGTR1 LOC106397267 2798 4 1905

BnGTR1 LOC106408997 2673 4 1848
BnGTR1 LOC106410496 2649 4 1848
BnGTR1 LOC106414122 2666 4 1848
BnGTR1 LOC106445255 2988 4 1905
BnGTR1 LOC111202315 2685 4 1848
AtGTR2 BnGTR2 LOC106347844 2842 4 1839
BnGTR2 LOC106366161 2755 4 1839
BnGTR2 LOC106369007 8538 4 1839
BnGTR2 LOC106405453 2453 4 1839
BnGTR2 LOC106411192 2868 4 1836
BnGTR2 LOC106424883 2754 4 1839

TABLE 9 | CRISPR target sequences (sgRNAs). all other PGR combinations resulted in a significantly decreased
regeneration frequency.
Name Sequence (5′ -3′ ) Target gene

sgRNA1 AATGAGACATTTGAGAAGAT BnGTR1

Effect of C-Source in SRM Medium on
sgRNA2 GAATCAACAGTTTCTTCAAC BnGTR1 Protoplast Regeneration
sgRNA3 TTTGAGAAGCTTGGGATCAT BnGTR2 Sugar plays an important role in protoplast growth and
sgRNA4 TTCCTTTGCGACACTTACTT BnGTR2 development. We tested two types of sugars commonly used
in protoplast culture as carbon source in the SRM media. The
results showed that sucrose resulted in better shoot regeneration
frequency than glucose, which seemed to be less effective
efficient than BAP for facilitating the normal growth of in promoting shoot regeneration (Table 5). When comparing
the protoplasts. different concentrations of sucrose, we found that 20 g l−1
sucrose resulted in 41.0% regeneration frequency after two
Effect of Mannitol in SIM Medium on months, compared to 31.4% for 30 g l−1 .
Protoplast Regeneration Effect of Culture Duration in MI, MII and
Our results showed that culture of the protoplasts in MII SIM Media on Protoplast Growth and
medium longer than 20 d would result in brownish and inviable
protoplasts (Table 6), likely due to inhibitory effect of high Regeneration
concentration of mannitol (100 g l−1 ) on growth. To solve this We found that the culture duration in MI and MII media at
problem, the protoplasts were transferred to SIM medium after the early stage of protoplast development was critical for shoot
20 d, which contained half amount of mannitol compared to regeneration. The results in (Table 6) show that the culture
MII. As shown in (Table 3), the presence of mannitol in the SIM duration in MI medium should not be longer than 5 d, while
medium was still necessary for callus growth (Figure 1D), and 15–20 d in MII medium was the most suitable duration for
thereby facilitating shoot regeneration (Figure 1E). Otherwise, shoot regeneration. After 30 d in MII medium, the regeneration
the calli could become brownish, and no shoot regeneration percentage decreased rapidly.
would occur. This suggests that osmotic protection by mannitol The culture duration on SIM medium also seemed to be
was needed for maintaining the normal growth and development important for shoot regeneration, as shown in (Table 7). The
of protoplasts during this stage of protoplast culture. duration of 20–25 d on SIM medium was shown to be the
most suitable duration among all durations tested for shoot
regeneration. After 30 d, the regeneration percentage was
Effect of PGRs in SRM Medium on significantly decreased.
Protoplast Regeneration
In this study, we found that the combination of TDZ as Cloning of BnGTR Paralog Genes
cytokinin-source and NAA as auxin-source in SRM medium All the 12 paralogs were amplified in cv. Kumily in this study,
gave the best result with regards to shoot regeneration and the gene sequences were submitted in the GenBank database
among all the combinations tested (Table 4). Relatively high under the accession numbers, MW759464 to MW759475. The
concentrations of cytokinin and auxin gave better effect on shoot homology between different paralogs of the same gene family
regeneration, in which 2.2 mg l−1 TDZ in combination with ranged between 86% to 99% for BnGTR1 and 88% to 98%
0.5 mg l−1 NAA gave the highest regeneration frequency, while for BnGTR2.

Frontiers in Plant Science | www.frontiersin.org 6 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

FIGURE 1 | Isolation, regeneration and transfection of protoplasts of rapeseed. (A) Freshly isolated protoplasts. (B, C) Protoplasts undergoing cell divisions and
multiplication. (D) Protoplast colonies. (E) Shoot regeneration from protoplast colonies. (F) Transfected protoplasts expressing GFP protein observed under confocal
laser scanning microscope.

Protoplast Transfection Efficiency Out of 50 calli, 16 shoots were regenerated, resulting in a

In order to estimate the efficiency of protoplast transfection, regeneration frequency of over 30%. Out of the 16 regenerated
we transfected protoplasts with a vector harboring the GFP shoots, 3 were found to be mutated, giving a mutation efficiency
gene. The results showed that transfection efficiencies ranging of over 18%. The results were based on three biological replicates.
from approximately 40 to 80% could routinely be observed, The sequencing results revealed various types of mutations
as measured by intact protoplasts exhibiting GFP fluorescence consisting of single base insertions, 1-13 bp deletions and a
(Figure 1F) 48 h after transfection. This suggests that a large substitution among the three mutant lines analyzed (Figure 2),
proportion of the protoplasts can express the transgene for indicating successful gene editing using our optimized protoplast
a sustained time-period, and that the transfection protocol is protocol. No mutations at the target sites of sgRNA2 and sgRNA3
working well for rapeseed under our culture conditions. were detected. Sequencing results revealed that the mutations in
deletion and insertion could lead to frameshift mutations and
Identification of Mutation in the BnGTR introduce premature stop codons to disrupt the open-reading
Genes frames. The PCR results showed no presence of the Cas9 and
We designed four highly conserved 20 bp target sequences nptII genes in the three mutants (Supplementary Figure S2).
(sgRNAs) for BnGTR1 (sgRNA1 and sgRNA2) and BnGTR2
(sgRNA3 and sgRNA4), for knocking out all paralogs of the DISCUSSION
two gene families. The sgRNA1 and sgRNA4 sequences shared
100% identity with the target regions in four paralogs of BnGTR1 Creation of more genetic variation is necessary to improve
and BnGTR2, but had a single nucleotide mismatch 14 bp important agronomic traits of rapeseed, as the natural gene pool
upstream of the PAM site in two paralogs of each targeted gene of the species has a low genetic diversity (Bus et al., 2011). Apart
family (Figure 2). The sgRNA2 and sgRNA3 sequences had 100% from crossbreeding, induced mutations has been used to increase
identity in five paralogs of BnGTR1 and BnGTR2, but had a single genetic variation of the species. In recent years, the CRISPR/Cas9
nucleotide mismatch 12 bp upstream of the PAM site in one technology has been proven to be a powerful tool for plant genetic
paralog of BnGTR1 and one nucleotide mismatch in one paralog modification, while its great potential has not been explored
of BnGTR2 17 bp upstream of the PAM site. fully yet for trait improvement, and this is particularly true for
Using the above optimized protoplast regeneration and rapeseed. One of the main reasons for this is the lack of an
transfection protocols and the CRISPR vector harboring the four efficient method for delivering CRISPR vectors or complexes
sgRNAs, we have successfully mutated multiple BnGTR genes. into plant cells for production of transgene-free mutation lines.

Frontiers in Plant Science | www.frontiersin.org 7 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

FIGURE 2 | Types of mutations in the BnGTR1 and BnGTR2 genes detected in the three mutants in comparison with wild type of rapeseed cv. Kumily, determined by
DNA sequencing. PAM sites are highlighted in bold letters. Mismatches with the sgRNAs are highlighted in green. Mutated nucleotides were highlighted in different
colors, in which deletions are shown with hyphens in blue, substitution and insertions are highlighted in red and pink, respectively.

Frontiers in Plant Science | www.frontiersin.org 8 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

The protoplast transient transfection system is a promising Low regenerative capacity is the major obstacle affecting
approach for delivering CRISPR complexes, but the bottleneck the application of protoplasts for rapeseed. With induction
of this approach is the difficulty in protoplast regeneration. and appropriate manipulations, the protoplasts are able to
Protoplasts are plant cells that lack the cell wall, but possess undergo a series of differentiation stages, and finally form whole
plasma membrane and all other cellular components. The first plants under optimal or suitable conditions. Among all factors
developmental stage of protoplasts is formation of the cell affecting protoplast regeneration, PGRs is thought to be the
wall, followed by cell divisions. The cell wall formation starts most important one. A general concept is that high auxin to
within a few hours after isolation, and may take several days cytokinin ratio is suitable to stimulate cell divisions and cell
to complete (Kartha et al., 1974). In this period, the protoplasts wall formation of protoplasts, and high cytokinin to auxin ratio
are very fragile and sensitive to the culture conditions and is required for shoot regeneration. However, this ratio varies
surrounding environment. It has been reported that for the a lot from species to species (Kao and Seguin-Swartz, 1987),
culture of rapeseed hypocotyl protoplasts, the auxins 2,4-D and thus needs to be optimized for each crop. We found in
and NAA were both necessary for cell wall formation and cell our study that TDZ gave the best shoot regeneration among
division. The ratio of NAA to 2,4-D content that stimulates all types of cytokinin tested. Moreover, high concentration of
protoplast colony growth best appears to be species- and even cytokinin in combination with a relatively high level of auxin
genotype-dependent. It has been reported that, in one case, a (2.2 mg l−1 TDZ and 0.5 mg l−1 NAA) had a great positive effect
higher level of NAA than 2,4-D was either similar or better on protoplast regeneration in rapeseed. Although BAP is widely
in stimulating protoplast colony growth of all genotypes tested used for many crops for in vitro cultures, it did not seem to
(Glimelius, 1984), while in another study, higher levels of 2,4-D be effective for protoplast regeneration in rapeseed, as shown in
than NAA was reported to be beneficial for hypocotyl protoplast this study.
development in rapeseed (Barsby et al., 1986). In this study, we We also found in this study that the culture duration
used identical quantities of 2,4-D and NAA, and it turned out to in different culture media at different developmental stages
work well in this case. played an important role in protoplast regeneration of rapeseed,
Osmotic pressure must be maintained at the initial stage in which prolonged culture durations at earlier stages of
of protoplast culture. The isolated and cultured protoplasts development would reduce regeneration rapidly. For instance,
require osmotic protection until they have developed cell walls the culture duration in MI medium should not be longer than
(Kao and Seguin-Swartz, 1987), while the osmolarity should be 5 d, the duration in MII should be shorter than 30 d and not
gradually reduced to a normal level in order to maintain normal more than 20 d in SIM medium. These findings suggest that it
growth and development. In this study, mannitol was used to is crucial to transfer protoplast cultures into the successive media
maintain osmotic pressure. We first used a high concentration in a timely manner.
of mannitol (100 g l−1 ) in MI and MII media, which was In this study, the BnGTR genes were successfully edited
then reduced to 50 g l−1 in SIM until the protoplasts became by CRISPR/Cas9 in rapeseed using our optimized protoplast
small colonies, and thereafter removed completely in the SRM regeneration and transfection protocols, demonstrating for the
medium. If mannitol was removed from the medium too early, first time the high capacity of the protoplast approach in
the protoplasts would become brownish and eventually die. On genetic improvement of rapeseed by CRISPR/Cas9. We believe
the other hand, if the mannitol was removed from medium that this optimized protoplast regeneration protocol will be
too late, the growth and regeneration of protoplasts would be beneficial to other researchers working with rapeseed or other
negatively affected. The reason could be that continuous presence Brassica species. We are still working on generating more
of mannitol would form an inappropriate cell environment for mutation lines in order to get desirable and more homozygous
normal growth, e.g., affecting negatively the uptake of nutrients mutation lines. It should be kept in mind that modern widely
and water. cultivated cultivars are allotetraploid. This allopolyploidization
The culture density of protoplasts is also an important factor leads to multiple homologs of most genes controlling the
affecting protoplast growth and development. Some studies same traits in the rapeseed genome compared with the related
suggested that higher culture densities would promote the growth diploid model species A. thaliana (Chalhoub et al., 2014).
and division of protoplast cells (Chuong et al., 1985; Kielkowska In order to develop a knockout mutant in rapeseed, it is
and Adamus, 2012). The reason for this could be that cultured imperative to edit all paralogous sequences of the BnGTR genes.
protoplasts stimulate growth and mitotic division of adjacent Therefore, selfing for a couple of generations might be needed
cells by releasing growth factors into the surrounding medium to obtain homozygous mutation lines in all paralogs of the
(Davey et al., 2005). In this study, we also found that a low density BnGTR genes.
of protoplasts could result in poor cell division and thus reduced
callus formation. However, too high density of protoplasts would
result in brownish colonies, likely because of rapidly depleted
available nutrients that caused a large number of protoplasts to DATA AVAILABILITY STATEMENT
fail to undergo divisions (Chuong et al., 1985). The most suitable
plating density in this study was 0.4 million protoplasts per ml for The original contributions presented in the study are included
rapeseed, while up to 1 million per ml also lead to regeneration of in the article/Supplementary Material, further inquiries can be
plants in many cases. directed to the corresponding author/s.

Frontiers in Plant Science | www.frontiersin.org 9 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

AUTHOR CONTRIBUTIONS ACKNOWLEDGMENTS

L-HZ led the research and, together with XL and SK, designed the We thank Helle Turesson and Niklas Olsson for initial screening
studies. XL, SS, and SK performed the most of the experiments. of mutation lines by the HRFA method, Lantmännen for
XL, L-HZ, SK, and SS wrote the manuscript. OM, RG, EI, and providing the seeds of rapeseed cv. Kumily and Yao-Guang
EW contributed to the protoplast transfection and regeneration Liu from South China Agricultural University for providing
studies. All authors have read the manuscript and approved the the vector, pYLCRISPR/Cas9Pubi -N and expression cassettes,
submitted version. pYLsgRNA-AtU3d/LacZ, pYLsgRNA-AtU3b, pYLsgRNA-AtU6-
1, and pYLsgRNA-AtU6-29.
FUNDING
Financial support to this research by SLU Grogrund - Centre SUPPLEMENTARY MATERIAL
for Breeding of Food Crops, Trees and Crops for the Future
(TC4F), SLU strategic research environment, and FORMAS - The Supplementary Material for this article can be found
The Swedish Research Council for sustainable development is online at: https://www.frontiersin.org/articles/10.3389/fpls.2021.
highly acknowledged. 680859/full#supplementary-material

REFERENCES Kartha, K. K., Michayluk, M. R., Kao, K. N., Gamborg, O. L., and Constabel, F.
(1974). Callus formation and plant regeneration from mesophyll protoplasts
Andersson, M., Turesson, H., Nicolia, A., Falt, A. S., Samuelsson, M., and of rape plants (Brassica napus L. cv. Zephyr). Plant Sci. Lett. 3, 265–271.
Hofvander, P. (2017). Efficient targeted multiallelic mutagenesis in tetraploid doi: 10.1016/0304-4211(74)90097-2
potato (Solanum tuberosum) by transient CRISPR-Cas9 expression in Kielkowska, A., and Adamus, A. (2012). An alginate-layer technique for culture
protoplasts. Plant Cell Rep. 36, 117–128. doi: 10.1007/s00299-016-2062-3 of Brassica oleracea L. protoplasts. In Vitro Cell Dev. Biol. Plant 48, 265–273.
Arora, L., and Narula, A. (2017). Gene editing and crop improvement using doi: 10.1007/s11627-012-9431-6
CRISPR-Cas9 system. Front Plant Sci. 8:1932. doi: 10.3389/fpls.2017.01932 Kim, H., Kim, S. T., Ryu, J., Kang, B. C., Kim, J. S., and Kim, S. G. (2017).
Bae, S., Park, J., and Kim, J. S. (2014). Cas-OFFinder: a fast and versatile algorithm CRISPR/Cpf1-mediated DNA-free plant genome editing. Nat. Commun.
that searches for potential off-target sites of Cas9 RNA-guided endonucleases. 8:14406. doi: 10.1038/ncomms14406
Bioinformatics 30, 1473–1475. doi: 10.1093/bioinformatics/btu048 Kim, S.-Y., Bengtsson, T., Olsson, N., Hot, V., Zhu, L.-H., and Åhman, I. (2020).
Barsby, T. L., Yarrow, S. A., and Shepard, J. F. (1986). A rapid and Mutations in two aphid-regulated β-1,3-glucanase genes by CRISPR/Cas9 do
efficient alternative procedure for the regeneration of plants from hypocotyl not increase barley resistance to Rhopalosiphum padi L. Front. Plant Sci.
protoplasts of Brassica napus. Plant Cell Rep. 5, 101–103. doi: 10.1007/BF00 11:1403. doi: 10.3389/fpls.2020.01043
269244 Li, C., Hao, M., Wang, W., Wang, H., Chen, F., Chu, W., et al. (2018). An efficient
Braatz, J., Harloff, H. J., Mascher, M., Stein, N., Himmelbach, A., and Jung, C. CRISPR/Cas9 platform for rapidly generating simultaneous mutagenesis of
(2017). CRISPR-Cas9 targeted mutagenesis leads to simultaneous modification multiple gene homoeologs in allotetraploid oilseed rape. Front. Plant Sci. 9:442.
of different homoeologous gene copies in polyploid oilseed rape (Brassica doi: 10.3389/fpls.2018.00442
napus). Plant Physiol. 174, 935–942. doi: 10.1104/pp.17.00426 Liang, Z., Chen, K., Li, T., Zhang, Y., Wang, Y., Zhao, Q., et al.
Bus, A., Korber, N., Snowdon, R. J., and Stich, B. (2011). Patterns of molecular (2017). Efficient DNA-free genome editing of bread wheat using
variation in a species-wide germplasm set of Brassica napus. Theor. Appl. Genet. CRISPR/Cas9 ribonucleoprotein complexes. Nat. Commun. 8:14261.
123, 1413–1423. doi: 10.1007/s00122-011-1676-7 doi: 10.1038/ncomms14261
Chalhoub, B., Denoeud, F., Liu, S., Parkin, I.,a,. P., Tang, H., Wang, X., et al. Liang, Z., Zhang, K., Chen, K., and Gao, C. (2014). Targeted mutagenesis in Zea
(2014). Early allopolyploid evolution in the post-neolithic Brassica napus mays using TALENs and the CRISPR/Cas system. J. Genet. Genomics 41, 63–68.
oilseed genome. Science 345, 950–953. doi: 10.1126/science.1253435 doi: 10.1016/j.jgg.2013.12.001
Chuong, P. V., Pauls, K. P., and Beversdorf, W. D. (1985). A simple Lin, C. S., Hsu, C. T., Yang, L. H., Lee, L. Y., Fu, J. Y., Cheng, Q. W., et al. (2018).
culture method for Brassica hypototyl protoplasts. Plant Cell Rep. 4, 4–6. Application of protoplast technology to CRISPR/Cas9 mutagenesis: from
doi: 10.1007/BF00285492 single-cell mutation detection to mutant plant regeneration. Plant Biotechnol.
Davey, M. R., Anthony, P., Power, J. B., and Lowe, K. C. (2005). Plant J. 16, 1295–1310. doi: 10.1111/pbi.12870
protoplasts: status and biotechnological perspectives. Biotechnol. Adv. 23, Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., et al. (2015).
131–171. doi: 10.1016/j.biotechadv.2004.09.008 A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex
Glimelius, K. (1984). High growth rate and regeneration capacity of genome editing in monocot and dicot plants. Mol. Plant 8, 1274–1284.
hypocotyl protoplasts in some Brassicaceae. Physiol. Plant 61, 38–44. doi: 10.1016/j.molp.2015.04.007
doi: 10.1111/j.1399-3054.1984.tb06097.x Malnoy, M., Viola, R., Jung, M. H., Koo, O. J., Kim, S., Kim, J. S., et al.
Huang, H., Cui, T., Zhang, L., Yang, Q., Yang, Y., Xie, K., et al. (2020). (2016). DNA-free genetically edited grapevine and apple protoplast using
Modifications of fatty acid profile through targeted mutation at BnaFAD2 CRISPR/Cas9 ribonucleoproteins. Front. Plant Sci. 7:1904. doi: 10.3389/fpls.20
gene with CRISPR/Cas9-mediated gene editing in Brassica napus. Theor. Appl. 16.01904
Genet. 133, 2401–2411. doi: 10.1007/s00122-020-03607-y Menczel, L., Nagy, F., Kiss, Z. R., and Maliga, P. (1981). Streptomycin resistant
Jiang, W., Zhou, H., Bi, H., Fromm, M., Yang, B., and Weeks, D. P. (2013). and sensitive somatic hybrids of Nicotiana tabacum + Nicotiana knightiana:
Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification correlation of resistance to N. tabacum plastids. Theor. Appl. Genet. 59,
in arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res. 41:e188. 191–195. doi: 10.1007/BF00264975
doi: 10.1093/nar/gkt780 Murovec, J., Gucek, K., Bohanec, B., Avbelj, M., and Jerala, R. (2018).
Kao, H. M., and Seguin-Swartz, G. (1987). Study of factors affecting the culture of DNA-free genome editing of Brassica oleracea and B. rapa protoplasts
Brassica napus L. and B. juncea Coss. mesophyll protoplasts. Plant Cell Tissue using CRISPR-Cas9 ribonucleoprotein complexes. Front. Plant Sci. 9:1594.
Organ Cult. 10, 79–90. doi: 10.1007/BF00035906 doi: 10.3389/fpls.2018.01594

Frontiers in Plant Science | www.frontiersin.org 10 July 2021 | Volume 12 | Article 680859

Li et al. Protoplast Regeneration and CRISPR Editing in Rapeseed

Muthusamy, S., Vetukuri, R. R., Lundgren, A., Ganji, S., Zhu, L.-H., Brodelius, Woo, J. W., Kim, J., Kwon, S. I., Corvalan, C., Cho, S. W., Kim, H., et al.
P. E., et al. (2020). Transient expression and purification of β-caryophyllene (2015). DNA-free genome editing in plants with preassembled CRISPR-Cas9
synthase in Nicotiana benthamiana to produce β-caryophyllene in vitro. PeerJ ribonucleoproteins. Nat. Biotechnol. 33, 1162–1164. doi: 10.1038/nbt.3389
8:e8904. doi: 10.7717/peerj.8904 Wood, C. C., Petrie, J. R., Shrestha, P., Mansour, M. P., Nichols, P. D., Green,
Nekrasov, V., Staskavicz, B., Wigel, D., Jones, J. D. G., and Kamoun, S. (2013). A. G., et al. (2009). A leaf-based assay using interchangeable design principles
Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 to rapidly assemble multistep recombinant pathways. Plant Biotechnol. J. 7,
RNA-guided endonuclease. Nat. Biotechnol. 31, 691–693. doi: 10.1038/nbt.2655 914–924. doi: 10.1111/j.1467-7652.2009.00453.x
Nicolia, A., Proux-Wera, E., Ahman, I., Onkokesung, N., Andersson, M., Yoo, S. D., Cho, Y. H., and Sheen, J. (2007). Arabidopsis mesophyll protoplasts:
Andreasson, E., et al. (2015). Targeted gene mutation in tetraploid potato a versatile cell system for transient gene expression analysis. Nat. Protoc. 2,
through transient TALEN expression in protoplasts. J. Biotechnol. 204, 17–24. 1565–1572. doi: 10.1038/nprot.2007.199
doi: 10.1016/j.jbiotec.2015.03.021 Zheng, M., Zhang, L., Tang, M., Liu, J., Liu, H., Yang, H., et al. (2020). Knockout
Nitsch, J. P., and Nitsch, C. (1969). Haploid plants from pollen grains. Science 163, of two BnaMAX1 homologs by CRISPR/Cas9-targeted mutagenesis improves
85–87. doi: 10.1126/science.163.3862.85 plant architecture and increases yield in rapeseed (Brassica napus L.). Plant
Nour-Eldin, H. H., Andersen, T. G., Burow, M., Madsen, S. R., Jorgensen, Biotechnol. J. 18, 644–654. doi: 10.1111/pbi.13228
M. E., Olsen, C. E., et al. (2012). NRT/PTR transporters are essential for
translocation of glucosinolate defence compounds to seeds. Nature 488, Conflict of Interest: The authors declare that the research was conducted in the
531–534. doi: 10.1038/nature11285 absence of any commercial or financial relationships that could be construed as a
Prykhozhij, S. V., Rajan, V., Gaston, D., and Berman, J. N. (2015). CRISPR potential conflict of interest.
multitargeter: a web tool to find common and unique CRISPR single
guide RNA targets in a set of similar sequences. PLoS ONE 10:e0119372. Copyright © 2021 Li, Sandgrind, Moss, Guan, Ivarson, Wang, Kanagarajan and
doi: 10.1371/journal.pone.0119372 Zhu. This is an open-access article distributed under the terms of the Creative
Shan, Q., Wang, Y., Li, J., Zhang, Y., Chen, K., Liang, Z., et al. (2013). Commons Attribution License (CC BY). The use, distribution or reproduction in
Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. other forums is permitted, provided the original author(s) and the copyright owner(s)
Biotechnol. 31, 686–688. doi: 10.1038/nbt.2650 are credited and that the original publication in this journal is cited, in accordance
USDA (2019). Oil Crops Yearbook. Available online at: https://www.ers.usda.gov/ with accepted academic practice. No use, distribution or reproduction is permitted
data-products/oil-crops-yearbook/ (accessed April 19, 2019). which does not comply with these terms.

Frontiers in Plant Science | www.frontiersin.org 11 July 2021 | Volume 12 | Article 680859

 1

SUPPLEMENTARY MATERIAL

Supplementary Figure S1. Schematic representation of the CRISPR/Cas9 vector,

pYLCRISPR/Cas9Pubi-GTR containing four sgRNA expression cassettes, designed for
mutagenesis of the six BnGTR1 and six BnGTR2 paralogs in rapeseed. The sgRNA1, driven by
A. thaliana U3d promoter along with LacZ gene as a cloning selection marker; the sgRNA2
driven by A. thaliana U3b promoter; the sgRNA3, driven by A. thaliana U6–1 promoter; the
sgRNA4, driven by A. thaliana U6–29 promoter.

Supplementary Figure S2. | PCR analysis of the Cas9- and nptII genes in the mutants using the gene
specific primers. Lane 1, 1kb ladder; lane 2, negative control (no template); lane 3, wildtype; lane 4,
mutant 1; lane 5, mutant 2; lane 6, mutant 3; lane 7, positive control (pYLCRISPR/Cas9Pubi-GTR
vector); lane 8, 1kb ladder. The PCR product was 567 bp for Cas9 and 630 bp for nptII.
 2

Supplementary Table S1. List of primers used for expression cassette construction

Primer Plasmid Sequence (5’-3’) Description

Name

BnFP1 pYLsgRNA-AtU3d/LacZ GTCAATGAGACATTTGAGAAGAT sgRNA1-GTR1

BnRP1 pYLsgRNA-AtU3d/LacZ AAACATCTTCTCAAATGTCTCAT sgRNA1-GTR1

BnFP2 pYLsgRNA-AtU3b GTCAATGAAACATTTGAGAAGAT sgRNA2-GTR1

BnRP2 pYLsgRNA-AtU3b AAACATCTTCTCAAATGTTTCAT sgRNA2-GTR1

BnFP3 pYLsgRNA-AtU6-1 ATTGAATCAACAGTTTCTTCAAC sgRNA3-GTR2

BnRP3 pYLsgRNA-AtU6-1 AAACGTTGAAGAAACTGTTGATT sgRNA3-GTR2

BnFP4 pYLsgRNA-AtU6-29 ATTGAATCAATAGTTTCTTCAAC sgRNA4-GTR2

BnRP4 pYLsgRNA-AtU6-29 AAACGTTGAAGAAACTATTGATT sgRNA4-GTR2

Supplementary Table S2. | List of primers used in PCR for transgene detection

Primer Name Gene Sequence (5’-3’)

Cas9 FOR Cas9 CTGCTTCCATGATCAAGCGC

Cas9 REV Cas9 CCTTCTCGTTGGGGAGGTTC

nptII FOR nptII CTATTCGGCTATGACTGGGC

nptII REV nptII AATATCACGGGTAGCCAACG

 3

Supplementary Table S3. List of primers used in HRFA analysis

Primer Name Gene Sequence (5’-3’)

BnGTR1 LOC106397267- BnaA06g20740D GTTGTTACTTTATGGTTTGACT

LOC106445255 F FAM
BnaCnng63460D

BnGTR1 LOC106397267- BnaA06g20740D AAATGACGCAGGCCAAGAA

LOC106445255 R
BnaCnng63460D

BnGTR1 LOC106414122- BnaA01g20270D TCTTGTCACGTTGGCTTGAC

LOC111202315 F HEX
BnaC01g25280D

BnGTR1 LOC106414122- BnaA01g20270D TGAGCGAGATGATCTGCGCG

LOC111202315 R
BnaC01g25280D

BnGTR1 LOC106408997- BnaC03g75950D CTCAACACGGTCCAGAAACT

LOC106410496 F PET
BnaA06g16980D

BnGTR1 LOC106414122- BnaC03g75950D TGAGCGAGATGATCTGCGCG

LOC111202315 R
BnaA06g16980D

BnGTR2 LOC106405453 F BnaA02g33530D TCTTGTTTGATTCTTCGTTTGGTTGC

FAM TAAGG

BnGTR2 LOC106405453 R BnaA02g33530D TGGGACTGCAGCAGTCAATA

BnGTR2 LOC106347844- BnaA06g22160D AACCTTCCTCCGCCGTGTAC

LOC106424883 F HEX
BnaC03g51560D

BnGTR2 LOC106347844- BnaA06g22160D CGCCTGCTCCAACTACAAGA

LOC106424883 R
BnaC03g51560D

BnGTR2 LOC106369007 F BnaC02g42260D GGCGTGTTCACCGTAACAGA

PET

BnGTR2 LOC106405453 R BnaC02g42260D TGGGACTGCAGCAGTCAATA

BnGTR2 LOC106347844- BnaA06g22160D AGAGGCTGGAAAGTCATGCC

LOC106411192 F FAM
BnaC09g05810D
 4

BnGTR2 LOC106347844- BnaA06g22160D AGAAACGCTATCTGGCCACC

LOC106411192 R
BnaC09g05810D

BnGTR2 LOC106347844- BnaA06g22160D AACCTTCCTCCGCCGTGTAC

LOC106366161 F HEX
BnaA09g06190D

BnGTR2 LOC106347844- BnaA06g22160D AGAAACGCTATCTGGCCACC

LOC106411192 R
BnaA09g06190D
 TYPE Correction
PUBLISHED 22 March 2023
DOI 10.3389/fpls.2023.1183684

Corrigendum: Efficient
OPEN ACCESS protoplast regeneration protocol
APPROVED BY
Frontiers Editorial Office,
Frontiers Media SA, Switzerland
and CRISPR/Cas9-mediated
*CORRESPONDENCE
Li-Hua Zhu
editing of glucosinolate
[email protected]
Selvaraju Kanagarajan transporter (GTR) genes in
rapeseed (Brassica napus L.)
[email protected]
†
These authors share first authorship

SPECIALTY SECTION
This article was submitted to
Plant Biotechnology, Xueyuan Li †, Sjur Sandgrind †, Oliver Moss, Rui Guan,
a section of the journal Emelie Ivarson, Eu Sheng Wang, Selvaraju Kanagarajan *
Frontiers in Plant Science

RECEIVED 10 March 2023

and Li-Hua Zhu*
ACCEPTED 13 March 2023 Department of Plant Breeding, Swedish University of Agricultural Sciences, Lomma, Sweden
PUBLISHED 22 March 2023
KEYWORDS
CITATION
Li X, Sandgrind S, Moss O, Guan R, Brassica napus, CRISPR/Cas9, gene editing, glucosinolate transporter, GTR gene,
Ivarson E, Wang ES, Kanagarajan S and protoplast regeneration
Zhu L-H (2023) Corrigendum: Efficient
protoplast regeneration protocol and
CRISPR/Cas9-mediated editing of
glucosinolate transporter (GTR) genes in
rapeseed (Brassica napus L.).
A Corrigendum on
Front. Plant Sci. 14:1183684.
doi: 10.3389/fpls.2023.1183684 Efficient protoplast regeneration protocol and CRISPR/Cas9-mediated
COPYRIGHT editing of glucosinolate transporter (GTR) genes in rapeseed (Brassica
© 2023 Li, Sandgrind, Moss, Guan, Ivarson, napus L.)
Wang, Kanagarajan and Zhu. This is an open-
access article distributed under the terms of By Li X, Sandgrind S, Moss O, Guan R, Ivarson E, Wang ES, Kanagarajan S and Zhu L-H (2021)
the Creative Commons Attribution License Front. Plant Sci. 12:680859. doi: 10.3389/fpls.2021.680859
(CC BY). The use, distribution or
reproduction in other forums is permitted,
provided the original author(s) and the
copyright owner(s) are credited and that
the original publication in this journal is In the published article, there was an error in the Funding statement. The Funding
cited, in accordance with accepted statement “FORMAS -The Swedish Research Council for sustainable development” missed
academic practice. No use, distribution or
reproduction is permitted which does not the parentheses for the full name of FORMAS and grant numbers. The correct statement is
comply with these terms. “FORMAS (The Swedish Research Council for sustainable development) grants 2016-
01401 and 2018-01301”.
The correct Funding statement appears below.

Funding
Financial support to this research by SLU Grogrund – Centre for Breeding of Food
Crops, Trees and Crops for the Future (TC4F), SLU strategic research environment, and
FORMAS (The Swedish Research Council for sustainable development) grants 2016-01401
and 2018-01301 is highly acknowledged.
The authors apologize for this error and state that this does not change the scientific
conclusions of the article in any way. The original article has been updated.

Frontiers in Plant Science 01 frontiersin.org

Li et al. 10.3389/fpls.2023.1183684

Publisher’s note organizations, or those of the publisher, the editors and the
reviewers. Any product that may be evaluated in this article, or
All claims expressed in this article are solely those of the authors claim that may be made by its manufacturer, is not guaranteed or
and do not necessarily represent those of their affiliated endorsed by the publisher.

Frontiers in Plant Science 02 frontiersin.org