We are IntechOpen,

the world’s leading publisher of

Open Access books
Built by scientists, for scientists

7,100
Open access books available
188,000
International authors and editors
205M Downloads

Our authors are among the

154
Countries delivered to
TOP 1%
most cited scientists
12.2%
Contributors from top 500 universities

Selection of our books indexed in the Book Citation Index

in Web of Science™ Core Collection (BKCI)

Interested in publishing with us?

Contact [email protected]
Numbers displayed above are based on latest data collected.
For more information visit www.intechopen.com
Chapter

Biological Efficacy of Trichoderma

spp. and Bacillus spp. in the
Management of Plant Diseases
Francisco Daniel Hernández-Castillo, Francisco Castillo-Reyes,
Marco Antonio Tucuch-Pérez and Roberto Arredondo-Valdes

Abstract

This chapter will cover topics about the microbial antagonists Trichoderma spp.
and Bacillus spp. from the perspective of use as potential biological control agents
on plant diseases. Results obtained in the laboratory about from their isolation,
microbial strain collections for both genera, taxonomic identification, antifungal
activity in in vitro tests, obtained evaluation of the antifungal effect of secondary
metabolites from microbial antagonists will be shown. Besides, results obtained
from bioassays in the greenhouse and field are used as biopesticides in the control
of diseases in fruit trees and vegetables and their effects on the promotion of plant
growth and increased crop yield.

Keywords: inhibition, disease, plant pathogen, incidence, severity, antagonist

microorganisms

1. Introduction

The agricultural production systems are generally based on technological

dependence of high-yield varieties and the use of agrochemicals, causing an imbal-
ance in different agroecosystems. The crops had turned to be susceptible to plague
organisms to which before they were not and have proliferated because their natural
enemies have eliminated the selection pressure has been favored by the monocul-
ture or by the excessive use of plaguicides, what has conducted to the rupture of
resistance of host and resistance toward the pesticides.
Those, as mentioned above, do rethink the actual technological management of
the crops, researching less aggressive options with low or without environmental
impact. This focus allows the searching of microbial alternatives as biological con-
trol agents of diseases, as a viable option to reduce their impact, enhancing the yield
and quality of the agricultural products. The economic production losses caused by
pests and diseases worldwide are estimated to be 36.5% on average, where 14.1% is
caused by diseases, 10.2% by insects, and 12.2% by weeds, without considering the
6–12% of agricultural products postharvest losses. Although it estimated that in
developing countries, these could reach up to 50% of production losses, consider-
ing only the disease, it estimates that annual losses worldwide can reach about 220
billion dollars. Overall, the diseases from plants can destroy crops before and after
harvest or yield partial losses and cause loss of quality in the products harvested.

1
Organic Agriculture

For example, the apple scab caused by Venturia inaequalis (Cook) Wint.
(Anamorph: Spilocaea did Fr.) is the most important disease of this fruit at a
worldwide level, which can cause significant economic losses until 100% of the
production, affecting the commercial quality of fruits [1, 2]. Generally, its control
is based on the use of agrochemicals. In vegetables, wilting of chili pepper and
tomato crops is one of the main biological limitations in the production of these
crops and can be caused by Phytophthora capsici, Rhizoctonia solani, and Fusarium
oxysporum [3]; this disease is reported throughout Mexico, estimating losses of
up to 80% due to root rot by invading the vascular system of plants. Likewise,
chemical control is the most used method for disease management and is common
to reduce the inoculum by disinfecting the soil with metam sodium, 2-thiocya-
nomethyl benzothiozole (TCMTB), metalaxyl, azoxystrobin, and propanocarp
fungicide applications to control P. capsici [4]. R. solani and Fusarium spp. are
controlled with tebuconazole, carbendazim, thiabendazole, and methyl thiophan-
ate [5]. The use of this control method significantly increases the production costs
and the negative impact it causes on the environment and to human health and
induces resistance of the pathogens toward the active ingredients. An alterna-
tive is the use of biological control by microorganisms antagonistic to fungi and
stramenopiles from the soil, which has little or no effect on the environment and
human health.

2. Biopesticides market

The worldwide market of biopesticides was of 1213 million dollars in 2010 and
3222 million dollars in 2017; the annual rate increases to 15.8% since 2012 besides
2017. Within this market, bioinsecticides represented 46% in 2011, and biofungi-
cides were of 600.5 million dollars, reaching 1447 million in 2017. The annual rate
from 2012 to 2017 grows up at 16.1%. Given that there currently exists a market
demand for free products of pesticide waste, huge agrochemical companies are in
the market of bioproducts, acquiring biocontrol companies and developing new
biotechnological products.

3. Isolation and identification of Bacillus spp. and Trichoderma spp.

Trichoderma and Bacillus are essential genera of antagonistic microorganisms

for control of a large number of phytopathogens. Trichoderma is a cosmopolitan
soil fungus, which is frequently on soil from the plant root system. This fungus
is attractive for organic management of diseases because present different action
modes against phytopathogens as competition for nutrients, mycoparasitism, and
antibiosis by hydrolytic enzymes and metabolites also produce substances that
promote plant growth [6, 7]. On the other hand, Bacillus spp. is a large and hetero-
geneous group of Gram-positive, rod-shaped, aerobic and facultative anaerobic,
and endospore-forming bacteria; same as Trichoderma, Bacillus is an alternative of
biological control of plant diseases due to its capability to inhibit phytopathogens
and growth promotion in plants [8, 9].
Due to the abovementioned and because there is a large number of species
from both microorganisms, their isolation and identification for their possible
commercial use are necessary; some of the species of Trichoderma are T. virens, T.
harzianum, and T. viride and of Bacillus spp. are reported as antagonists B. amyloliq-
uefaciens, B. licheniformis, B. subtilis, and B. pumilus [10, 11]. Thus a correct identifi-
cation of the species which needs work is necessary.

2
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

3.1 Isolation and identification of Trichoderma spp.

3.1.1 Isolation and morphological identification of Trichoderma spp.

The first step for correct identification of antagonist microorganisms depends

on isolation. In the case of Trichoderma spp., they are present in a great variety of
agricultural and natural soils. The soil sampling for its isolation is relatively simple;
using a shovel at 10–20 cm depth, 500 g of soil is taken and deposited in plastic bags;
after, the samples will be moved to a laboratory and placed on storage at 4°C until
used. Purification of Trichoderma spp. it is essential on investigations and present
many ways or techniques; nevertheless, the monosporic culture is suggested by
Trichoderma on culture media as potato dextrose agar (PDA) or Trichoderma Specific
Medium (TSM), and incubated at 28 ± 2°C for 96 h [11–13]. Once the monosporic
culture is obtained, the identification of Trichoderma species can be realized using
taxonomic keys through its morphological features or with molecular biology,
extracting DNA and utilizing general or specific primers. In case of the use of taxo-
nomic keys, structures as width and length of phialide, length and width of conidia,
and presence of chlamydospores will be observed [7, 14].

3.1.2 Molecular identification

This kind of identification has gained acceptance because it presents more preci-
sion and reliability among several strains of Trichoderma. The phylogeny of this
genus has been based in the sequence analysis of the internal transcribed spacers
of ribosomal DNA using the universal primers ITS1 and ITS4 with a subsequent
sequencing and analysis through databases [15] but also can be identified through
specific primers which are a powerful tool that allows to identify a specific species
of Trichoderma [16] (Table 1). In Mexico, diverse species of Trichoderma have been
isolated and identified [6]; they identified T. atroviride, T. asperellum,
T. citrinoviride, T. ghanense, T. harzianum, T. inhamatum, T. longibrachiatum, and
T. yunnanense (Figure 1) from samples taken from several agricultural regions. In a
similar research, Osorio et al. [23] identified the species as T. asperellum, T. rossicum,
and T. hamatum from different localities of Mexican Northeast region.

Species Primer sequences (5′–3′) Product size (bp) References

specificity
T. harzianum HAR-1.6F: GTACCTCGCGAATGCATCTA 1600 [17]
HAR-1.6R: GGCTATGACCATGATTACGC

T. asperellum T2AF: CTCTGCCGTTGACTGTGAACG 507 [18]

T2AR: CGATAGTGGGGTTGCCGTCAA
T. virens TvCTT56f: CTTGATGACAAGCCAAAAGG 289 [19]
TvCTT56r:
GAAGAGAGGACATAGGGTCTGG

T. atroviride Q01_4F: GCACACCAACTGCTGGAGCTT 1017 [20]

Q01_4R: CACGCTGACAATGACCGACAC
T. aggressivum Th-F: CGGTGACATCTGAAAAGTCGTG 444 [21]
Th-R: TGTCACCCGTTCGGATCATCCG

T. pleuroti FPforw1: CACATTCAATTGTGCCCGACGA 218 [22]

PSrev1: GCGACACAGAGCACGTTGAATC

Table 1.
Examples of species-specific primers for Trichoderma spp.

3
Organic Agriculture

Figure 1.
Morphologic characteristics of different Trichoderma spp. isolated from samples of different agricultural
systems of Mexico.

3.2 Isolation and identification of Bacillus spp.

Bacillus spp. is a genus present in the soil of a considerable amount of crops

and naturally is on the rhizosphere; due to this, the traditional tools for determin-
ing the soil bacterial community and diversity are used [24]. The first step is to
make the collecting of the rhizosphere soil, take 10 g of soil with a sterile spoon,
and store the sample at 4°C. Heat or pasteurization treatments are the most com-
monly used techniques to select spores due to this, the sample is diluted in 90 mL
of sterile normal saline and heated at 80°C for 10 min to eliminate vegetative
cells; once heated, the sample is serially diluted (10−1–10−4) and placed on 1 mL
nutrient agar (NA) medium with cycloheximide (100 mg mL−1) to prevent fungal
growth or carboxymethylcellulose (CMC) agar, and it is incubated at 37°C for
24 h [25, 26].
However, the treatment with heat can be different depending on the species
because endospores of some strains are more resistant to heat than others [24].
Due to this, the drying treatment is considered more gentle; this method consists
of placing the samples on a dryer at 70°C for 1 h [25]. The considerable variety
of physiology of Bacillus spp. requires elaborate biochemical and morphological
tests for species identification; as colony growth in artificial media, form cell unit,
presence, number and orientation of flagella, Gram stain, spore form-position and
specific environmental conditions of growth and finally the specific use of carbon
sources gave its metabolic diversity [27].

3.2.1 Molecular identification of Bacillus spp.

Several molecular approaches are currently utilized for the identification of

microorganisms; in this sense, the use of polymerase chain reaction (PCR) in
combination with 16S rRNA is a tool frequently used for identification of Bacillus
spp. from various environments including soil. Using the 16S rRNA sequence, five
groups within biological control of root pathogens by plant growth-promoting
Bacillus spp., the genus Bacillus spp., where group 1 comprises species B. amyloliq-
uefaciens, B. subtilis, B. pumilus, and B. licheniformis, have been identified [24, 25].
Bacillus spp. can identify through specific primers (Table 2). Such as
Trichoderma spp., the Mexican agricultural systems are an excellent source to obtain
Bacillus spp., such as mentioned by Guillén-Cruz et al. [9] and Hernandez-Castillo

4
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

Species specificity Primer sequences (5′–3′) Product References

size (bp)
B. subtilis p-gyrA-f: CAGTCAGGAAATGCGTACGTCCTT 741 [28]
p-gyrA-r: CAAGGTAATGCTCCAGGCATTGCT

B. amyloliquefaciens trpE(G) F: TTTGAATCCGAGCCCTTATG 78 [29]

trpE(G) R: ACATACATTTCGGGGGATGA
B. pumilus GC-U968(F): GCAACGCGAAGAACCTTAC 490 [30]
L1401(R): GCGTGTGTACAAGACCC

B. licheniformis BL8AF: TCACAACCCGTTGACGACAA 247 [31]

BL8AR: CGTGTCCGAGTGTGCGTTATAT

Table 2.
Examples of species-specific primers for Bacillus spp.

et al. [32] whom identified several Bacillus spp. species as B. amyloliquefaciens,

B. pumilus, B. licheniformis, and B. subtilis from samples coming from several
regions of the center and northern of Mexico.

4. Antifungal activity in vitro of Trichoderma spp. and Bacillus spp.

The antifungal activity of Trichoderma species has been evaluated in in vitro

studies against soilborne and foliar fungi, and there have been acceptable results.
The antifungal activity can be determined such a direct manner as indirect manner.
In the case of a direct manner, the most used technique is the dual culture where the
inhibition percentage, Bell scale, and the days to contact are evaluated to determine
the antagonistic activity of Trichoderma species. Dual culture consists of Petri dishes
with PDA where a disk (5 mm in diameter) with mycelium of the plant pathogen is
placed and, on the other side of the Petri dish equidistantly, a disk of mycelium of the
same diameter of Trichoderma strains under study is placed. The plates inoculated are
incubated at 27 ± 1°C until the growth of control treatment (with only plant pathogen
disk) covered the Petri dish. The effect of Trichoderma strains on plant pathogens
is determined by the percentage of mycelial growth inhibition. The days of contact
between plant pathogen antagonistic and antagonistic ability of Trichoderma isolates
according to the methodology proposed by Bell et al. [33] are also determined. Bell
et al. [33] classified the antagonism produced by Trichoderma as follows: Class I,
Trichoderma overgrows completely to pathogen and covers the whole surface of the
medium; Class II, Trichoderma overgrows two-thirds of the surface of the medium;
Class III, Trichoderma and pathogen colonized each half of the surface, and nobody
seems to dominate the other; Class IV, the pathogen colonizes the two-third parts of
the media surface and resists invasion by Trichoderma; and Class V, the plant patho-
gen overgrows completely to Trichoderma and covers an area total culture media [6].
In case of the desire to determine the antifungal activity of an indirect manner, the
volatile compounds are an option; this method is realized as follows. In the center of
a Petri dish having only PDA medium, a disk of 5 mm in diameter with active mycelia
of the plant pathogen is placed, and the top of the dish is replaced with another Petri
dish in which a disk with mycelia of Trichoderma strain is placed; in this case, the lid is
pierced with a punch (10 mm in diameter), and the Petri dishes are joined and sealed
with parafilm paper and incubated at 26 ± 1°C until each pathogen control covered
the Petri dish. The effect of volatile compounds is measured considering the diameter
of pathogen colonies and expressed as percentage of mycelial growth inhibition [6].
Several research were carried out to determine the antifungal activity of
Trichoderma spp. strains, due to its potential as biocontroller of plant pathogens,

5
Organic Agriculture

as reported by Hernandez et al. [6] who evaluated several strains of Trichoderma

spp. against Sclerotinia sclerotiorum and Sclerotium cepivorum through dual culture
and observed rate of inhibition of 45–63.8% and 50.9–81.5 for S. sclerotiorum with
T. ghanense and T. longibrachiatum, respectively, and 81.5 and 81.2% of S. cepivorum
with T. inhamatum and T. asperellum, respectively. For the Bell scale and contact
days for both phytopathogenic fungi, the mean was of 2 days and scale of I, II,
and III with all the Trichoderma spp. strains. Some research about the inhibition
of secondary metabolites, precisely the volatile compounds, present inhibition of
S. sclerotiorum and S. cepivorum against T. longibrachiatum with 28.1 and 73.8%,
respectively, followed by T. harzianum with 12.5 and 62.5%.
Some studies by Osorio et al. [23] mentioned a Trichoderma spp. as controller.
They reported the overgrowth of Trichoderma spp. strains over Phytophthora capsici;
in total 13 Trichoderma spp. strains showed level 1 according to the Bell scale. This
effect can be attributed to enzyme production (β-1, 3-glucanase, chitinase, prote-
ase, and cellulose) by these Trichoderma spp. strains. As too volatile compounds
produced by the Trichoderma spp. strains, they reported inhibition of P. capsici
mycelial growth ranged between 4.3 and 48.8, the major effect observed with the
T. asperellum and the least with Trichoderma sp. strain. Some studies mentioned that
Trichoderma spp. produces volatile compounds, carbon dioxide, oxygen, ethylene,
and 6-pentyl-α-pyrone (6PP) which cause adverse effect in the development of
phytopathogenic fungus. Furthermore, Trichoderma spp. can inhibit the growth of
foliar fungus as Colletotrichum spp., such as mentioned by Tucuch et al. [34] who
determined the antifungal activity Trichoderma spp. strains and reported antago-
nism level 1 in Bell scale by T. asperellum, while for volatile compounds, the species
T. lignorum affected the fungus inhibiting its developments in 24.02% (Figure 2).
Usually, Trichoderma spp. inhibit several phytopathogenic fungi due to their
capacity to produce enzymes, volatile compounds and compete for nutrients against
phytopathogens. Studies realized by Samaniego-Fernández et al. [35] and Kumar et al.
[7] showed the antagonistic capacity of Trichoderma spp.; in the first case, the species
T. harzianum and T. viride are controlled to S. rolfsii y Fusarium spp.; in the second study,
several Trichoderma spp. showed mycelial growth inhibition of S. rolfsii more than 50%.
Likewise, then Trichoderma spp. strains, the antifungal activity of Bacillus
spp., can be tested by dual culture; nevertheless, the method is different than with
Trichoderma spp. PDA disk (5 mm) with active mycelium of the phytopathogen
is placed in the center of a Petri dish with PDA; on the same plate, at a distance
of 1.5 cm in the four cardinal points, a loopful of antagonistic bacterial isolates is
placed. Plates inoculated with the pathogen culture serve as controls. In order to
quantify the antagonistic potential of bacterial strains, the size of growth inhibi-
tion zones measured after 6 days of incubation at 25–28°C and the percent of radial
growth inhibition (PICR) are calculated [36]. In this sense, study also showed the
capacity of Bacillus spp. to inhibit the growth of phytopathogenic fungi. Thereby

Figure 2.
Inhibition of Colletotrichum spp. by volatile compounds produced by different Trichoderma spp. strains
(a) control, (b) T. asperellum, (c) T. yunnanense, and (d) T. lignorum.

6
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

Figure 3.
Antagonistic effect of Bacillus spp. strains against different phytopathogenic fungus (a) Rhizoctonia solani,
(b) Fusarium oxysporum, (c) Phytophthora capsici, and (d) Colletotrichum spp.

Jimenez et al. [36] reported the inhibition of Venturia inaequalis mycelia by

B. subtilis and B. licheniformis ranged 33.4–41.3%, respectively, and Tucuch et al. [34]
observed 50% of inhibition from B. subtilis against Colletotrichum spp. (Figure 3).

5. Obtaining secondary metabolites of Trichoderma spp. and Bacillus

spp. and their antifungal activity in vitro (PDA methods and
microplate dilution)

Generally, the production of the secondary metabolites from biological agents

such as Trichoderma spp. and Bacillus spp. is carried out using liquid media by a
fermentation process in a reactor, which can be of different types from a simple
bottle to until an automated reactor, where the temperature and shaking rate are the
key variables for the emission of secondary metabolites. The liquid medium is inte-
grated by several components such as carbon sources and mineral salts, where the
biological microorganism is inoculated [37]. The secondary metabolites obtained
from the fermentation of Bacillus spp. and Trichoderma spp. are filtered with nitro-
cellulose membrane of 0.22 um; after the recovery of these metabolites, it is neces-
sary to perform a screening to determine their ability to inhibit phytopathogenic
microorganisms. There are many methods to determine the antifungal activity from
secondary metabolites of antagonistic microorganisms, the most common is the
poisoned medium, adding the substance to evaluate in the culture medium before
solidification, which consists in adding 200 μl of the secondary metabolites on PDA
medium in the center of Petri dish and 5 mm mycelium disk of the phytopathogen,
then Petri dishes are incubated at 28 ± 1°C until the control treatment covers the
petri dish, after that the percentage inhibition is determined [23].
However, our workgroup has standardized the method in microdilution on plate,
which consists in an adaptation of the technique proposed by Masoko et al. [38];
polystyrene microplates of 96 wells are used; in all wells, 100 μl of liquid medium is
placed; column 1 is the negative control, column 2 consists of the positive control,
and column 3 is a control which consists of the fermentation medium. Starting in
column 4, 100 μl of the secondary metabolites from strains is mixed in a pipette
with 100 μl of the liquid medium, and then 100 μl of the mixture is transferred to
the next column, discarding the last 100 μl from column 12, to get serial microdilu-
tions to 50.00% of the secondary metabolites. Once the microdilutions are carried
out, the growth developer 2,3,5-triphenyltetrazolium chloride is added in the
whole plate; the concentration of the growth developer is the lowest reported in the
literature, as an excess of this indicator can interfere with the growth of the patho-
gen or react with reagents from the medium; this indicator measures the respiratory
activity associated with electron transport chains, and when reduced, it precipitates
forming a complex, intense red color; its use is due to its high sensitivity to detect

7
Organic Agriculture

inhibition of microorganisms with deficient amounts of antimicrobial products;

besides that, the red coloration is a visual indicator of the antimicrobial activity of
the treatment. Finally, starting in column 2, 10 μl of a spore solution of the fungus
at a concentration of 1 × 108 in all wells is added, keeping all the wells a volume
of 150 μl in total; each microplate is considered a replicate. The microplates are
incubated in agreement with the necessary conditions of the fungus on absorbance
realized at 490 nm in a spectrophotometer. The secondary metabolites from the
different strains placed in the rows A to F. To calculate the growth and inhibition
percentage, the following formulas used: % Growth = (A − B/C)(100); where A
is treatment absorbance, B is negative control absorbance, C is positive control
absorbance, and % Inhibition = 100 – % Growth.
In general, the selection principle of strains is the determination of their antago-
nistic capacity; the method of microdilution in plate is to some extent interesting since
it allows determined quickly and efficiently in time and costs its capacity of antifungal
inhibition. Several studies demonstrate the effectiveness of secondary metabolites in
the control of phytopathogenic fungi with PDA medium; Osorio et al. [23] mentioned
that the inhibiting effect by T. asperellum and T. hamatum against P. capsici ranged to
15–20%; this inhibition attributed to the concentration of metabolites like glycotox-
ins, viridine, trichodermin, furanone, and 6-pentyl-α-pyrone (Figure 4).
Likewise, the PDA method or the microdilution in plate method can be an
excellent technique to evaluate substance with antifungal activity as the secondary
metabolites; in this sense, Jimenez et al. [36] observed that secondary metabolites
obtained from T. yunnanense and T. harzianum at a concentration of 50 and 25%
showed an inhibiting total effect of 100% of mycelial growth of V. inaequalis, while
the metabolites obtained from T. asperellum and T. lignorum at a concentration
of 50% showed an inhibiting effect from 90 to 84%, respectively (Figure 5). On
the other hand, Jimenez et al. [36] reported that secondary metabolites obtained
from B. licheniformis at a concentration of 50 and 25% showed an inhibiting effect
in 100% against V. inaequalis, while the metabolites obtained from B. subtilis at a
concentration of 50% showed an inhibiting effect near to 78% of the development
of this pathogen (Figure 5).
In another study, Tucuch-Pérez et al. [39] reported six Bacillus spp. strains with
antifungal activity against F. oxysporum; in this case, the species B. licheniformis and
B. subtilis showed the highest inhibition percentages ranged from 80 to 100%, being
the lowest inhibition percentage registered of 50% (Figure 6).
The results generated by the microplate dilution method are consistent with the
results obtained from indirect test by confrontation or dual test, such as shown in
the following results against fungi isolated from crops as melon, pepper, and others,
which are produced in different zones from Mexico. In melon crop, the root and
stem rot disease is a big problem; in this context, Espinoza-Ahumada et al. [40]
studied the in vitro antagonist effects of Trichoderma spp. and found that T. asperel-
lum have excellent biological activity against Fusarium strains, isolated from melon,

Figure 4.
Antifungal activity of secondary metabolites from different Trichoderma spp. strains against phytopathogenic
fungi; (a) T. asperellum vs. Fusarium oxysporum, (b) T. yunannense vs. Phytophthora capsici,
(c) T. longibrachiatum vs. Rhizoctonia solani, (d) T. asperellum vs. Sclerotinia sclerotiorum and
(e) T. asperellum vs. Sclerotium cepivorum.

8
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

Figure 5.
Percentage of inhibition of secondary metabolites obtained from Bacillus spp. (a) and Trichoderma spp.
(b) against Venturia inaequalis.

Figure 6.
(a) Percentage inhibition of microbial extracts from Bacillus spp. metabolite dilutions against F. oxysporum.
(b) Microplate with treatments to several concentrations, and the pathogen elapsed 48 h after incubation.
Row A= B-AN1, B = B-AN2, C = B-AN3, D = B-AN4, E = B-AN5, F = B-AN6; column 1 = negative witness,
column 2 = positive witness, 3 = growth medium of Bacillus spp., 5 = 50%, 5 = 25%, 6 = 12.50%, 7 = 6.25%,
8 = 3.13%, 9 = 1.56%, 10 = 0.78%, 11 = 0.39%, and 12 = 0.20%.

shown in Table 3. In general, these authors report that the inhibition of Fusarium
spp. is higher when Trichoderma spp. are used (62.4–54.8%), in contrast when
Bacillus spp. (44.5–36.9%) is used (Figure 7).
In a work carried out by Francisco et al. [41], where the behavior of Bacillus spp.
against Fusarium species was studied, it showed low inhibition values. However,
they report that the species B. pumilus and B. liquefaciens can be used effectively
against many Fusarium species. On the other hand, higher effectiveness of Bacillus

Antagonistic agent Fusarium strain

FRR-1 FRG-2 FAF-3 FRE-4 FCA-5 FHA-6

B. liquefaciens 46.9A,ab 38.4B,abc 31.4BC,bc 34.8CD,bc 28.2CD,c 41.6DE,ab
B. amyloliquefaciens 51.4AB,ab 38.9B,c 37.8B,c 42.9BC,bc 41.2BC,bc 55.2C,a

B. subtilis 45.7B,a 38.6B,a 37.2B,a 42.4B,ca 34.6C,a 46.4D,a

T. asperellum 57.2A,b 61.5A,ab 64.3A,ab 62.3A,ab 54.9A,b 74.1A,a

T. harzianum 54.9AB,b 55.4A,b 56.1A,ab 60.5A,ab 57.9A,b 64.7B,a

T. viride 49.8A,ab 58.3A,a 54.9A,a 51.1A,ab 50.3BC,a 64.7B,a

High letters indicate comparison between columns; low letters indicate comparison between rows. Percentages of
inhibition with different letters are significantly different (p ≤ 0.5).

Table 3.
Percentage of antagonism of different biological agents against Fusarium spp. strains.

9
Organic Agriculture

Figure 7.
Microbial agents antagonist to Fusarium oxysporum (FAF-3, FRE-4, FHA-6) and Fusarium solani (FRR-1,
FRG-2, FCA-5).

spp. was observed when applied in the early stage of growth [42], showing that B.
cereus was most effective against Fusarium dry rot when applied as young cul-
tures (24 h), however B. thuringiensis strains was most effective when applied as
older cultures (48–72 h). Nevertheless, different studies revealed that B. pumilus
produced different antifungal compounds as “iturin” which inhibits the growth
of Aspergillus sp. and their production of aflatoxins [30]. Osorio et al. [23] found
an inhibition ranged between 4.3 and 48.8% of P. capsici mycelial growth induced
by the volatile compounds produced by Trichoderma spp. strains. The Tukey test
indicated that 21 Trichoderma spp. strains showed the highest percentage inhibition.
T. asperellum (T25) strain present the best result for activity inhibition, strain (T9)
being the one with the least inhibition activity. It observed that the 31 Trichoderma
spp. strains were able to produce volatile compounds with inhibitory properties
against P. capsici.

6. Antifungal activity bioassay under greenhouse conditions

From different research projects under greenhouse conditions, we have found

satisfactory results both in the disease suppression and in the promotion of growth and
quality in crops. Hernández-Castillo et al. [24], made an experiment under greenhouse
conditions using silty clay soil from an experimental batch previously plot with chile
crop and were symptoms of wilting incidence were express. The experiment included
three bacterial strains of the genus Bacillus spp. (B1, B3, and B13), a chemical control
(thiabendazole, T), and control (TA) without fungicide. Before the application of the
suspension, an initial colony-forming units (CFU) count of the pathogen involved by
the dilution method is performed. The application of spores of the bacterial strains is
performed at the time of the transplant. The seedlings are immersed in a spore suspen-
sion at a concentration of 108 (CFU/mL for 15 min). Subsequently, at 20 and 40 days
after transplantation, the same spore suspension was applied to the stem base. In the
final evaluation of each treatment (10 adult plants), plant height, fresh fruit weight
per cut, root length, dry root weight, and incidence and severity of wilt are measured.
The determination of the severity of the disease was with the scale reported by Copes
and Stevenson [43]. As a result of this work, a very low wilt incidence found for plants

10
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

is inoculated with biological strains (B13 and B3) with an incidence of less than 10%,
while values of 60 and 40% for TA and T, respectively, were observed (Figure 8A).
Likewise, the wilting showed a reduction in severity in those treatments where three
bacterial strains were applied (Figure 8B), in contrast to the control treatments where
the severity of the damage was more considerable.
In Figure 9, we can see that the harmful microbiological population rate also
reduced with the use of organisms considered as beneficial, according to the final
count at the end of the experiment; that could be because antagonistic bacteria are
capable of influencing biocontrol mechanisms against phytopathogenic fungi such
as antibiosis, siderophores, competition for nutrients, and production of hydrolytic
enzymes. Similarly, Ulacio et al. [44] evaluated organic matter and antagonistic
microorganisms as management strategies against white rot in garlic cultivation.
These authors reported that the fungus Sclerotium cepivorum is significantly reduced
and there was a lower incidence of the disease in the treatments where the fungus
T. harzianum, the bacteria B. firmus, and vermicompost were combined.
Some microorganisms posess the ability by several ways to reduce the incidence
and severity of diseases in crops, and also can participate in the stimulation of
plant growth, yield, and crop quality. Figure 10A and B shows the values related
to the promotion of root length (A) and its weight (B), where this effect is clearly
observed. In Figure 10C and D, it was observed that Bacillus spp. strains increase
the height of the plant by 28% compared to treatment T, and 34.5% concerning the
TA. These results coincide with previous work where the biological effectiveness

Figure 8.
Incidence (A) and severity (B) in plant traits with Bacillus spp. strains (B1, B2, B3) in contrast with control
(TA) and chemical control (T = thiabendazole).

Figure 9.
Colony-forming units from initial (Pi) and final populations of phytopathogenic soil fungi after applying
Bacillus spp. strains (B1, B2, B3) against chemical (T = thiabendazole) and control (TA).

11
Organic Agriculture

Figure 10.
Root length (A), dry rot weight (B), height (C), fresh fruit weight (D), and increments in chile pepper plant
by effect Bacillus strains (B1, B3, B13) against chemical (T = thiabendazole) and control (TA). Different
letters with bars indicate significant differences among treatments (p ≤ 0.05).

of 57 strains of the genus Bacillus spp. isolated from the rhizosphere of commercial
sowing chile plants in Northeast Mexico was analyzed, which showed an apparent
antagonistic effect against P. capsici, F. oxysporum, and R. solani fungi. The plants
inoculated with Bacillus spp. strains significantly increased height and dry weight
in 191 and 60.2%, respectively [12]. The application of native Bacillus spp. strains
shows a clear tendency to produce more biomass compared to chemical (T) and
control (TA) treatments.
Likewise, del Ángel et al. [45] found a decrease in the incidence and severity of the
disease caused by Rhizoctonia solani and Fusarium oxysporum with formulated endo-
phytic bacteria, which induce a positive effect on the promotion of growth in the bean
crop, increasing height and stem diameter in the treatments. Those formulated with
bacteria in the absence of the phytopathogen stood out for their stimulating effect on
the growth of the plants under study. This stimulating growth effect is observed in

Figure 11.
Effect of endophytic bacteria on plant height and stem diameter in bean crop under greenhouse condition.
Fusarium solani: height (A), diameter (B), and Rhizoctonia solani: height (C), diameter (D). Means with
the same letter are not significantly different according to the Tukey test (p ≤ 0.05). Error bars are a standard
error of the mean.

12
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

plants treated with those formulated and inoculated at the same time with pathogens.
It is essential to mention that the plants grew under no chemical treatment. Therefore,
they did not receive fertilization by any chemical source (Figure 11).

7. Bioassays of antifungal activity under field conditions

7.1 Fruits results

Jimenez et al. [36] report results obtained on apple fruit and trees under the direct
influence of the application of CFU from Bacillus spp., and Trichoderma spp., as
control agents against the incidence and severity of Venturia inaequalis under field
conditions in commercial apple cultivar. Table 4 shows the incidence of fungus
Venturia inaequalis in fruit, and this incidence varied from 5.6 to 6.25 when biological
agents (Trichoderma spp. and Bacillus spp.) were used in maxima doses (2 L ha−1) to
19.3% for the control, respectively, after 15 days of a first application. After 60 days
from the start of the applications, the incidence is expressed in a range of 42.5–
46.62% for Bacillus spp. and Trichoderma spp. at doses of 2 L ha−1 and for the control
observed a 91.2%. The range of severity is observed between 1.8 and 2.6 of lesions per
fruit by treatment Trichoderma spp. 2 L ha−1 and control, respectively, after 15 days of
application initiation. After 60 days of treatment application appears first symptoms,
so it was evaluated on a range of the number of lesions per fruit (severity) from 5.3 to
14.5 corresponding to Bacillus spp., 2 L ha−1, and control, respectively (Table 4). The
treatment with the best antagonism effect under field conditions was Bacillus spp.,
2 L ha−1, who expressed 42.5% by incidence and five lesions per fruit in contrast to
the control, which showed 91.2% incidence and 14.5 lesions per fruit (Figure 12).
The field experiment is carried out to test biocontrol agents for control V.
inaequalis in commercial apple cultivar; the statistical analysis showed highly
significant differences between treatments (p ≤ 0.5), the incidence in foliage
treated with Trichoderma spp. 2 L ha−1 was lower in first evaluation (after 15 days of
first application) and until harvest. This treatment expressed 10.6% incidence and
two lesions per leaf, in contrast to the control which showed 31.8% and three lesions
per leaf (Table 5). On the other hand, severity did not show significant differences
among treatments.

7.2 Vegetable results

Espinoza-Ahumada et al. [40] aimed to find more environmentally friendly

alternatives to the wilting of chile pepper; they evaluated the application of

Treatment Incidence (%) in fruit Severity (lesions) in fruit

15 days 60 days 15 days 60 days

Bacillus spp. 1 L ha−1 18.12 ± 2.4a 51.87 ± 5.5b 1.82 ± 0.6ab 8.02 ± 0.7b
−1
Bacillus spp. 2 L ha 6.25 ± 5.2b 42.50 ± 6.5b 1.07 ± 0.8b 5.30 ± 0.5b
Trichoderma spp. 1 L ha−1 15.00 ± 3.5a 55.00 ± 5.4b 1.77 ± 0.5ab 7.62 ± 0.2b
−1
Trichoderma spp. 2 L ha 5.62 ± 4.7b 45.62 ± 5.2b 1.00 ± 0.0b 6.32 ± 0.7b

Control 19.37 ± 4.7a 91.25 ± 4.3a 2.65 ± 0.5a 14.57 ± 0.3a

Treatments with the same letter are statistically equal to each other (p < 0.05).

Table 4.
The incidence in apple fruits by Venturia inaequalis.

13
Organic Agriculture

Figure 12.
Expression of symptoms caused by Venturia inaequalis in apple trees. (a) Without treatment, (b) Bacillus
spp. effect, and (c) Trichoderma spp. effect.

Treatments Incidence (%) in leaves

15 days 30 days 45 days 60 days
−1
Bacillus spp. 1 L ha 8.12 ± 6.9ab 11.25 ± 1.2bc 13.12 ± 2.1bc 22.50 ± 4.8b
Bacillus spp. 2 L ha−1 6.25 ± 2.1ab 11.25 ± 2.5bc 11.87 ± 2.4bc 17.50 ± 4.6b
−1
Trichoderma spp. 1 L ha 8.13 ± 3.8ab 13.12 ± 5.5bc 13.75 ± 4.7bc 20.62 ± 2.4b

Trichoderma spp. 2 L ha−1 2.50 ± 1.7b 6.25 ± 1.4c 6.25 ± 1.4c 10.62 ± 1.3c
Control 18.12 ± 4.1a 21.87 ± 3.1a 23.75 ± 4.3a 31.87 ± 3.8a
Treatments with the same letter are statistically equal to each other (p < 0.05).

Table 5.
The incidence in apple leaves by Venturia inaequalis.

biological agents for this purpose under field conditions. For this, an experiment
is established where different genotypes of chile pepper are evaluated (Serrano,
HS-52, Coloso, HS-44, Centauro, Paraíso and Tampiqueño 74 cv.) generated by
INIFAP-Mexico. In this experiment, the microbial agents T. asperellum, T. harzia-
num, T. yunnanense [23, 29], B. amyloliquefaciens, B. licheniformis, and B. subtilis
[24] under a mixture of microbial propagative ferment (consortium ferment) are
based on Trichoderma spp. and Bacillus spp. Treatments of bioassay by Trichoderma
spp. were different: consortium treatment one consists of a Trichoderma spp. at
1×108 CFU; treatment two consists of ferment consortium; treatment three consists
of a B. consortium at 1×108 CFU; treatment four consists of a chemical control by
thiabendazole prepared at 60% W/V; and the treatment five consists of an absolute
control. A dose of 1 L.ha−1 was applied for treatments one, two, and three, while
the dose applied for thiabendazole was 0.5 kg.ha−1. Field sowing is done with chile
seedlings (10 cm), transplanted in 1.5 m double row beds. The application is made
to drench with a manual sprinkler at 7, 28, and 49 days after the transplant (DDT).
After 85, 105, 125, and 145 DDT, the yield per block (4.5 m2) is determined and
transformed to t ha. To determine yields and improvements of treatments, ten fruits
were evaluated, where the weight (g) and size (mm) per fruit were determined. In
the first and last harvest, the incidence assessed and transformed into a percentage.
The severity is evaluated through the visual scale, where 0 = no visible symptoms;
1 = initial light chlorosis and presence of flowers and fruits; 2 = intermediate, par-
tial wilt, severe chlorosis, and premature ripening of fruits; and 3 = advanced. For
total wilt without recovery, the leaves and fruits remain stuck to the stem. The field
results observed as the effects of biological agents are shown in Table 6. The disease
incidence values between HS-52 and Coloso treatments were statistically different
(p ≤ 0.05); in the other varieties, there were no differences between treatments.
The treatment based on Trichoderma is the biological one that suppresses in higher

14
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

Microbial agents Serrano chile pepper varieties

HS-52 Coloso HS-44 Centauro Tampiqueño 74 Paraíso

Trichoderma spp. 10.67a 18.17ab 16.84a 19.17a 12.5a 10.00a

Consortium 26.67ab 15.5ab 10.50a 15.33a 19.83a 10.67a

Bacillus spp. 29.17ab 29.67b 20.07a 20.5a 21.83a 19.5a

Thiabendazole 21.00ab 6.83a 19.51a 24.17a 10.33a 16.17a

Control 31.83b 21.33ab 21.51a 23.33a 24.67a 22.33a

Mean values on the same column indicated by different letters are statistically different (p < 0.05) according to the
LSD test.

Table 6.
Incidence of the disease (%) in serrano chile pepper varieties inoculated with microbial agents in the field.

percentage the incidence of wilting disease in chile pepper crops; in this case, the
lowest incidence was in the HS-52 variety which showed a value of 10.67%, while
that in the witness it was 31.87%, which represents a decrease of 71% concerning
the latter.
Disease evaluation in the presence of treatments of consortium and Trichoderma
demonstrates the lowest incidence percentage with values between 14.39 and
16.39%, while the control and Bacillus spp. were having high levels of the presence
of symptoms (24.08 and 23.36%). In the case of severity, it also behaves differently
between treatments. Table 7 shows the values related to the severity of the disease

Treatment Serrano chile pepper varieties

HS-52 Coloso HS-44 Centauro Tampiqueño 74 Paraíso

Trichoderma 11.3ab 18.43a 10.8a 6.83a 7.83ab 6.93a

Consortium 8.33a 16.28a 24.45a 12.76a 14.35ab 6.46a

Bacillus spp. 14.4ab 19.16a 15.09a 11.54a 17.6b 16.22ab

Thiabendazole 20.04b 14.07a 17.97a 15.74a 6.56a 18.24b

Control 19.45ab 24.35a 24.07a 13.65a 17.96b 18.43b

Mean values on same column indicated by different letters are statistically different (p < 0.05) according to
LSD test.

Table 7.
Severity of the disease (%) in serrano pepper with respect to treatments.

Microbial agents Total yield in chile pepper varieties (t ha−1)

HS-52 Centauro Paraíso HS-44
Trichoderma spp. 15.67a 13.22a 8.48b 7.55a
Consortium 10.37ab 11.52ab 10.59a 13.04a

Bacillus spp. 7.26b 8.18ab 5.41b 10.3a

Thiabendazole 10.02ab 8.69ab 7.44b 10.62a

Control 5.98b 5.15b 2.59b 6.94a
Mean values on the same column indicated by different letters are statistically different (p < 0.05) according to the
LSD test.

Table 8.
Total yield, length, and weight of fruit of the serrano chile pepper crop obtained with the use of microbial
agents.

15
Organic Agriculture

Figure 13.
Expression of incidence of coffee rust. (a) Plants with treatment based on bio formulate based on Bacillus spp.,
and (b) plants without treatment, where leaf defoliation is clearly expressed.

as transformed percentages (p ≤ 0.05). It can be seen that Trichoderma spp.-based

treatments alone or in combination have lower severity values.
The effects on yield as the weight and size of the fruit showed by the use of
microbial agents applied alone or in combination as shown in Table 8. When
Trichoderma is used, the yield increased; for example, its increase in the production
was 62% when used alone and up to 76% when used as a mixture in comparison with
the control.
This behavior of positive effect has already evidenced with the use of differ-
ent Trichoderma species on habanero pepper plants (Capsicum chinense) [46],
lettuce (Lactuca sativa), and radish (Raphanus sativus) [47]. In the same context,
Cubillos-Hinojosa et al. [48] tested T. harzianum in the passion fruit crops
(Passiflora edulis) where they were able to determine an antagonist to F. oxysporum
and F. solani, in addition to stimulating germination, increased biomass, and root
length.
In other field tests with Bacillus spp. bioformulate prototypes, a reduction in
incidence and severity of coffee rust (Hemileia vastatrix) was observed. It was
observed that the control presented 38% of incidence; nevertheless, it showed
defoliation compared with the prototype treatments, which present an incidence
between 5 and 15%, while with the chemist, the incidence was 9% (Figure 13).
The positive interaction between Trichoderma spp. and the host plant is attrib-
uted to a complex chemical activity of volatile and diffusible secondary metabolites
and release of phytohormones and antibiotics in the rhizosphere, which promote
root development and increased nutrient absorption, which helps control phyto-
pathogens and increase yield [49]; this effect explains the results produced in this
research. Microbial extracts as biofertilizers can generate hormones that stimulate
development and increase yield, which are verified with the application of exudates
from consortium Trichoderma spp. and Bacillus spp., which showed an effect on
disease control and crop development in the same or better percentage than when
using microorganisms.

8. Resistance induction by Trichoderma spp. and Bacillus spp.

In addition to the above aspects, plants can develop an increase in resistance to

pathogen infection by treatment with a wide variety of biotic and abiotic inducers.
Among the biotic inducers, we have the same phytopathogens, the growth-promot-
ing rhizobacteria, and the microbial agents of the species of the genera Bacillus spp.,
Streptomyces, Pseudomonas, Burkholderia, and Agrobacterium and nonpathogenic
microorganisms such as Trichoderma species (antibiotics or siderophores that lead
to induction of resistance).

16
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

Figure 14.
(a) Salicylic acid production on potato leaves in a different time. T1 = Bacillus spp. and Pseudomonas
fluorescens, T2 = jasmonic ac. 1500 ppm, T3 = mezcla T1 0.5% + T2 0.1%, T4 = Milor®, and T5 = control
(agua). Different letters indicate significant difference. (b) Jasmonic acid production on potato leaves in
different time. T1 = Bacillus spp. and Pseudomonas fluorescens, T2 = jasmonic ac. 1500 ppm, T3 = mezcla T1
0.5% + T2 0.1%, T4 = Milor®, and T5 = control.

Among the abiotic inducers are salicylic acid (SA), jasmonic acid (JAS),
β-aminobutyric acid, ethylene, chitosan, potassium, sodium or magnesium phos-
phate, acibenzolar-S-methyl (ASM), menadione, sodium bisulfite, and phosphites.
The application of these inducers causes specific biochemical changes that occur
after their application such as expression of genes that code for PR proteins; the
increase of certain defense-related enzymes such as polyphenol oxidase, lipoxygen-
ase, peroxidase, superoxide dismutase, and phenylalanine ammonia-lyase (PAL);
the accumulation of phytoalexins and phenolic compounds; and the reinforcement
of the cell wall with lignin deposition.
In this regard, we have observed changes in the endogenous levels of sali-
cylic acid and jasmonic acid in potato plants in response to foliar application of
microbial consortiums based on Bacillus spp. and Pseudomonas fluorescent. The
microbial consortium of Bacillus spp. significantly increased the production of SA
3 h after spraying raising to 114.02 μg/g DW. This is 496% more than the control
(Figure 14a). Jasmonic acid is not detected in control plants but detected in plants
treated with the microbial consortium. The level of jasmonic acid, 6 h later, reached
a level of 550 μg/g DW (Figure 14b).
The resistance induction is associated with some defense gene expression as
encoding pathogenicity-related proteins (PR), for example, phenylalanine ammo-
nia-lyase, which is crucial in the synthesis of phytoalexins, because these constitute
highly toxic compounds to the pathogen. On the other hand, PAL is part of the
synthesis of salicylic acid and phenolic compounds that reduce the incidence of
diseases in plants. It has also shown that B. amylolicheniformis, B. subtilis, B. pumilus,
and B. cereus are capable of eliciting and activating the induced systemic resistance
by increasing the levels of biochemical compounds related to resistance induction.
Besides, it reported that some Pseudomonas species could induce systemic resistance
in plants.

9. Conclusions

The results shown in this chapter allow to demonstrate the efficacy of Bacillus
and Trichoderma, as agents of biological control of fungi and stramenopiles that are
causatives of plant diseases; these beneficial microorganisms can be used under a
sustainable agriculture program or under integrate management pest program in a
conventional agriculture. The microbial agents also express other advantages due

17
Organic Agriculture

to their beneficial effects on the increase of the yields, growth, and development of
plants, as well as the induction of systemic resistance in plants to phytopathogens.
Currently our workgroup has any projects on the development of prototypes based
on these microbial agents, alone or in consortium, as well as micro- and nanoencap-
sulated formulations.

Acknowledgements

The authors acknowledge the financial support for the development of research
from the National Council of Science and Technology of Mexico (CONACYT),
University Autonomy Agrarian Antonio Narro and Greencorp Biorganiks of
Mexico, S.A. de C.V corporation.

Conflict of interest

The authors declare no conflict of interest.

Author details

Francisco Daniel Hernández-Castillo1*, Francisco Castillo-Reyes2,

Marco Antonio Tucuch-Pérez1 and Roberto Arredondo-Valdes3

1 Departamento de Parasitología, Universidad Autónoma Agraria Antonio Narro,

Saltillo, Coahuila, Mexico

2 Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Saltillo,

Coahuila, Mexico

3 Departamento de Nanobiociencias, Universidad Autónoma de Coahuila, Saltillo,

Coahuila, Mexico

*Address all correspondence to: [email protected]

© 2020 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms
of the Creative Commons Attribution License (http://creativecommons.org/licenses/
by/3.0), which permits unrestricted use, distribution, and reproduction in any medium,
provided the original work is properly cited.

18
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

References

[1] Doolotkeldieva T, Bobusheva S. Scab characterization of Trichoderma spp.

disease caused by Venturia inaequalis on for antagonistic activity against root rot
apple trees in Kyrgyzstan and biological and foliar pathogens. Indian Journal of
agents to control this disease. Advances Microbiology. 2012;52(2):137-144. DOI:
in Microbiology. 2017;7:450-466. DOI: 10.1007/s12088-011-0205-3
10.4236/aim.2017.76035
[8] Avşar C, Koyuncu H, Aras ES.
[2] Jha G, Thakur K, Thakur P. Isolation and molecular characterization
The Venturia apple pathosystem: of Bacillus spp. isolated from soil for
Pathogenicity mechanisms and plant production of industrial enzymes.
defense responses. BioMed Research Biological and Chemical Research.
International. 2010;1:1-10. DOI: 2017;3(9):72-86
10.1155/2009/680160
[9] Guillén-Cruz R, Hernández-
[3] Albañil-Juárez JA, Mariscal- Castillo FD, Gallegos-Morales G,
Amaro LA, Martínez-Martínez TO, Rodríguez-Herrera R, Aguilar-
López A, Luis J, Cisneros-López HC, González CN, Padrón-Corral E, et al.
et al. Estudio regional de fitopatógenos Bacillus spp. como biocontrol en un suelo
asociados a la secadera del chile en infestado con Fusarium spp., Rhizoctonia
Guanajuato, México. Revista Mexicana solani Kühn y Phytophthora capsici
de Ciencias Agrícolas. 2015;6:2191-2197. Leonian y su Efecto en el Desarrollo
DOI: 10.29312/remexca.v0i11.797 y Rendimiento del Cultivo de Chile
(Capsicum annuum L.). Revista Mexicana
[4] Perez L, Rodriguez ME, Rodriguez F, de Fitopatología. 2006;24(2):105-114.
Roson C. Efficacy of acibenzolar-S- Available from: https://www.redalyc.
methyl, an inducer of systemic acquired org/pdf/612/61224204.pdf
resistance against tobacco blue mould
caused by Peronospora hyoscyami [10] Hermosa MR, Grondona I,
f. sp. tabacina. Crop Protection. Iturriaga ET, Diaz-Minguez JM, Castro C,
2003;22(2):405-413. DOI: 10.1016/ Monte E, et al. Molecular characterization
S0261-2194(02)00198-9 and identification of biocontrol
isolates of Trichoderma spp. Applied
[5] Yossen VE, Conles MY. Eficacia de and Environmental Microbiology.
fungicidas in vitro para el control de 2000;66(5):1890-1898. DOI: 10.1128/
Fusarium oxysporum y F. proliferatum, AEM.66.5.1890-1898.2000
agentes causales de marchitamiento en
el cultivo de orégano en la Argentina. [11] Parvathi A, Krishna K,
Revista Industrial y Agrícola de Jose J, Joseph N, Nair S. Biochemical
Tucumán. 2014;91(1):19-25 and molecular characterization of
Bacillus spp. pumilus isolated from
[6] Hernandez C, Berlanga P, Gallegos M, coastal environment in Cochin, India.
Cepeda S, Rodriguez H, Aguilar G, et al. Brazilian Journal of Microbiology.
In vitro antagonist action of Trichoderma 2009;40(2):269-275. DOI: 10.1590/
spp. strains against Sclerotinia S1517-83822009000200012
sclerotiorum and Sclerotium cepivorum.
American Journal of Agricultural and [12] Acurio-Vásconez RD,
Biological Sciences. 2011;6(3):410-417. España-Imbaquingo CK. Aislamiento,
DOI: 10.3844/ajabssp.2011.410.417 caracterización y evaluación de
Trichoderma spp. como promotor de
[7] Kumar K, Amaresan N, Bhagat S, crecimiento vegetal en pasturas de
Madhuri K, Srivastava RC. Isolation and raygrass (Lolium perenne) y trébol

19
Organic Agriculture

blanco (Trifolium repens) [thesis]. identify and quantify root-endophytic

Universidad Politécnica Salsiana; 2017 strains. Diversity. 2015;7(4):360-384.
DOI: 10.3390/d7040360
[13] López CG, González PAG. Selección
de cepas nativas de Trichoderma spp. con [20] Skoneczny D, Oskiera M,
actividad antagónica sobre Phytophthora Szczech M, Bartoszewski G. Genetic
capsici Leonian y promotoras de diversity of Trichoderma spp. atroviride
crecimiento en el cultivo de chile strains collected in Poland and
(Capsicum annuum L.). Revista Mexicana identification of loci useful in detection
de Fitopatología. 2004;22(1):117-124. of within-species diversity. Folia
Available from: https://www.redalyc. Microbiologica. 2015;60:297-307. DOI:
org/pdf/612/61222115.pdf 10.1007/s12223-015-0385-z

[14] Gams W, Bissett J. Morphology [21] Chen X, Romaine CP,

and Identification of Trichoderma. Ospina-Giraldo MD, Royse DJ. A
In: Kubicek C, Harman G, editors. polymerase chain reaction-based test for
Trichoderma and Gliocladium. 1st ed. the identification of Trichoderma spp.
Salisbury, UK: Christian P Gams; 1998. harzianum biotypes 2 and 4, responsible
pp. 3-31 for the worldwide green mold epidemic
in cultivated Agaricus bisporus. Applied
[15] Rivero MV, Maniscalco DP. Microbiology and Biotechnology.
Identificación de cepas del hongo 1999;52:246-250. DOI: 10.1007/
Trichoderma spp. por métodos s002530051516
moleculares. Faraute. 2016;8(2):1-9
[22] Kredics L, Kocsubé S, Nagy L,
[16] Kredics L, Chen L, Kedves O, Komon-Zelazowska M, Manczinger L,
Büchner R, Hatvani L, Allaga H, et al. Sajben E. Molecular identification of
Molecular tools for monitoring Trichoderma spp. species associated with
Trichoderma spp. in agricultural Pleurotus ostreatus and natural substrates
environments. Frontiers in of the oyster mushroom. FEMS
Microbiology. 2018;9:1-17. DOI: Microbioly Letter. 2009;300:58-67. DOI:
10.3389/fmicb.2018.01599 10.1111/j.1574-6968.2009.01765.x

[17] Meena SN. Development of [23] Osorio E, Hernández FD,

species-specific SCAR markers for Gallegos G, Rodríguez R, Castillo F.
the identification of Trichoderma In-vitro behavior of Trichoderma spp.
spp. species [thesis]. Dharwad: against Phytophthora capsici Leonian.
Department of Biotechnology, College African Journal of Agricultural
of Agriculture, Dharwad University of Research. 2011;6(19):4594-4600. DOI:
Agricultural Sciences; 2009 10.5897/AJAR11.1094

[18] Devi TP, Prabhakaran N, [24] Hernández-Castillo FD,

Kamil D. Development of species Lira-Saldivar RH, Gallegos-Morales G,
specific markers for the identification Hernandez-Suarez M, Solis-Gaona S.
of Trichoderma spp. asperellum and Biocontrol of pepper wilt with three
Trichoderma spp. harzianum. Vegetos— Bacillus species and its effect on growth
An International Journal of Plant and yield. Phyton, International Journal
Research. 2017;30:94-100 of Experimental Botany. 2014;83:49-55.
Available from: http://ppct.caicyt.gov.
[19] Geistlinger J, Zwanzig J, ar/index.php/phyton/article/view/8684
Heckendorff S, Schellenberg I. SSR
markers for Trichoderma spp. virens: [25] Foysal MJ, Lisa AK. Isolation and
Their evaluation and application to characterization of Bacillus sp. strain

20
Biological Efficacy of Trichoderma spp. and Bacillus spp. in the Management of Plant Diseases
DOI: http://dx.doi.org/10.5772/intechopen.91043

BC01 from soil displaying potent sobre el complejo de hongos de

antagonistic activity against plant and la marchitez del chile. Phyton.
fish pathogenic fungi and bacteria. 2005;54:171-180
Journal of Genetic Engineering and
Biotechnology. 2018;16(2):387-392. [33] Bell D, Well H, Markham C. In vitro
DOI: 10.1016/j.jgeb.2018.01.005 antagonism of Trichoderma species
against six fungal plant pathogens.
[26] Manzum AA, Al Mamun MA. Phytopathology. 1982;73:379-382. DOI:
Isolation of Bacillus spp. bacteria from 10.1094/Phyto-72-379
soil for production of cellulase. Nepal
Journal of Biotechnology. 2018;6(1): [34] Tucuch MA, Labastida A,
57-61. DOI: 10.3126/njb.v6i1.22338 Hernández FD, Roberto A.
Determinación in vitro de la actividad
[27] Schaad NW, Jones JB, Chun W. Plant antifúngica de productos biológicos
Pathogenic Bacteria. Estados Unidos: y naturales contra Colletotrichum sp.
APS Press; 2001 (Glomerellales: Glomerellaceae) de café.
In: Proceedings of the XLIIC Congreso
[28] Chun J, Bae KS. Phylogenetic Nacional de Control Biológico;
analysis of Bacillus spp. subtilis November. Vol. 2019. México: Boca
and related taxa based on partial del rio, Veracruz; 2019. p. 139. DOI:
gyrA gene sequences. Antonie Van 10.13140/RG.2.2.13709.08161
Leeuwenhoek. 2000;78(2):123-127. DOI:
10.1023/A:102655583 [35] Samaniego-Fernández LM,
Harouna M, Corbea O, Rondón-
[29] Johansson AH, Bejai S, Castillo AJ, Placeres-Espinosa I.
Niazi A, Manzoor S, Bongcam-Rudloff E, Aislamiento, identificación y evaluación
Meijer J. Studies of plant colonisation de cepas autóctonas de Trichoderma
by closely related Bacillus spp. spp. spp. antagonistas de patógenos del
amyloliquefaciens biocontrol agents suelo. Revista de Protección Vegetal.
using strain specific quantitative PCR 2018;33(3):1-11
assays. Antonie Van Leeuwenhoek.
2014;106(6):1247-1257. DOI: 10.1007/ [36] Jimenez MDCM, Hernández FD,
s10482-014-0295-0 Alcalá EIL, Morales GG, Valdés RA,
Reyes FC. Biological effectiveness of
[30] Huang X, Zhang N, Yong X, Yang X, Bacillus spp. spp. and Trichoderma
Shen Q. Biocontrol of Rhizoctonia solani spp. spp. on apple scab (venturia
damping-off disease in cucumber inaequalis) in vitro and under field
with Bacillus spp. pumilus SQR- conditions. European Journal of
N43. Microbiological Research. Physical and Agricultural Sciences.
2012;167(3):135-143. DOI: 10.1016/j. 2018;6(2):7-17. Available from:
micres.2011.06.002 http://www.idpublications.org/
wp-content/uploads/2018/09/
[31] de Almeida MEM. Bacillus spp. Full-Paper-BIOLOGICAL-
licheniformis specific DNA markers for EFFECTIVENESS-OF-BACILLUS-
identification and culture-independent SPP.-AND-TRICHODERMA-SPP.-ON-
monitoring [thesis]. Universidad Do APPLE-SCAB.pdf
porto; 2014
[37] Ragazzo JA, Robles A, Lomelí L,
[32] Hernandez-Castillo FD, De la Luna G, Calderón M. Selección de
Garza-Rodriguez R, Gallegos-Morales G, cepas de Bacillus spp. productoras de
Padrón-Corral E, Sanchez-Arizpe A, antibióticos aisladas de frutos tropicales.
Lira-Saldivar RH. Efectividad biológica Revista Chapingo Serie Horticultura.
de bacterias rizosféricas esporuladas 2011;17(1):5-11

21
Organic Agriculture

[38] Masoko P, Picard J, Eloff JN. antagonistas como estrategias de manejo

Antifungal activities of six de Sclerotium cepivorum Berk. y su
south African Terminalia species impacto en el progreso de la pudrición
(Combretaceae). Journal of blanca en ajo (Allium sativum L.).
Ethnopharmacology. 2005;99(2):301- Revista Mexicana de Fitopatología.
308. DOI: 10.1016/j.jep.2005.01.061 2003;21(3):346-354

[39] Tucuch-Pérez MA, Daniel F, [45] del Ángel EC, Hernández FD,
Arredondo-Valdés R, Laredo-Alcalá EI. Fuentes YMO, Morales GG, Reyes FC,
Antifungal activity of metabolites from Tucuch FM. Endophytic bacteria
Bacillus spp. against Fusarium oxysporum controlling Fusarium oxysporum and
using micro dilution in plate method. Rhizoctonia solani in Solanum tuberosum.
European Journal of Biotechnology and European Journal of Physical and
Genetic Engineering. 2018;5(1):22-30 Agricultural Sciences. 2017;5(1):29-
39. Available from: https://pdfs.
[40] Espinoza-Ahumada CA, Gallegos- semanticscholar.org/8ce0/019bd26c7bc5
Morales G, Ochoa-Fuentes YM, 177efc49bbf6aea8798fb5de.pdf
Hernández-Castillo FD, Méndez-
Aguilar R, Rodríguez-Guerra R. [46] Candelero DJ, Cristóbal AJ,
Antagonistas microbianos para Reyes RA, Gamboa AMM, Ruíz SE,
biocontrol de la marchitez y su efecto Tun SJM. Trichoderma spp. fostering
promotor en el rendimiento de chile growth on Capsicum chinense Jacq.
serrano. Revista Mexicana de Ciencias seedlings and antagonistic against
Agrícolas. 2019;23:187-197. DOI: Meloidogyne incognita. International
10.29312/remexca.v0i23.2020 Journal of Experimental Botany.
2016;84(1):113-119. Available from:
[41] Francisco FN, Gallegos-Morales G,
http://ppct.caicyt.gov.ar/index.php/
Ochoa-Fuentes YM, Delgado-Ortiz JC, phyton/article/view/8136
Hernández-Castillo FD. In vitro
antagonism of Bacillus spp. strains
[47] Ortuño N, Miranda C, Claros M.
against Fusarium species.
Selección de cepas de Trichoderma spp.
Mycopathologia. 2016;14:15-19
generadoras de metabolitos secundarios
de interés para su uso como promotor
[42] Sadfi N, Cherif M, Fliss I,
de crecimiento en plantas cultivadas.
Boudabbous A, Antoun H. Evaluation
Journal of the Selva Andina Biosphere.
of bacterial isolates from salty soils
2013;1(1):16-32
and Bacillus thuringiensis strains for the
biocontrol of Fusarium dry rot of potato
tubers. Journal of Plant Pathology. [48] Cubillos-Hinojosa J, Valero N,
2001;83(2):101-117. Available from: Mejía L. Trichoderma harzianum como
https://www.jstor.org/stable/41998046 promotor del crecimiento vegetal
del maracuyá (Passiflora edulis var.
[43] Copes WE, Stevenson KL. A flavicarpa Degener). Agronomía
pictorial disease severity key and the Colombiana. 2009;27(1):81-86.
relationship between severity and Available from: https://www.redalyc.
incidence for black root rot of pansy org/pdf/1803/180314730011.pdf
caused by Thielaviopsis basicola. Plant
Disease. 2008;92(10):1394-1399. DOI: [49] López-Bucio J, Pelagio-Flores R,
10.1094/PDIS-92-10-1394 Herrera-Estrella A. Trichoderma as
biostimulant: Exploiting the multilevel
[44] Ulacio D, Zavaleta E, García R, properties of a plant beneficial fungus.
Delgadillo F, Pedroza A, Martínez A. Scientia Horticulturae. 2015;196:109-
Materia orgánica y microorganismos 123. DOI: 10.1016/j.scienta.2015.08.043

22