Lab: Biotechnology

Outside of identical twins and clones, everyone inherits a unique packet of DNA (in fact, even
identical twins have some variation due to random mutations). Small differences in DNA
sequences that occur between individuals can be used as a means of identification and we can
use them as a powerful tool for:
1. Identifying bodily remains (if a known sample is also available).
2. Establishing paternity (specifically who is not the parent based upon probable
inheritance).
3. Identifying criminals from trace biological samples left at crime scenes.
4. Exonerate people who have been falsely accused of a crime.

A traditional method of identifying individuals at a crime scene is analyzing fingerprints,

because each person has a unique pattern. (Even identical twins have unique fingerprints, which
is evidence of the strong effect of environmental influences on development).
There are five types of fingerprint patterns. Over 65% of the general American population has
loops, 30-35% have whorls, and 5% have arches. The probability of having a match on one
finger with someone else is quite good. The probability of having all 10 fingers matching is 1 in
1060 (that’s 10 with 60 zeros behind it)!
In this exercise, you will map your own fingerprints and compare with classmates.

Figure 2: Fingerprint Types

ARCH TENT ARCH LOOP DOUBLE LOOP
WHORL

Materials:
 Ink pad (highlighting markers also work well)
 Rubbing Alcohol and paper towels to clean up
 Magnifying lens

Procedure:
Use Table 2 to record the print for each of your fingers using the roll technique. To do this you
will need a partner to do your prints so that enough pressure is evenly applied as your finger is
rolled.
In the roll technique, the finger is placed on an ink pad so that it can be rolled from left to right
and so that the ink lightly coats both the sides and main area of the fingertip. That same
finger is then placed within the appropriate square and also rolled gently but firmly ONCE

1
 from left to right to obtain a relatively square clear print similar to the ones in Figure 3. (Do
not roll back and forth!). Practice a few times before starting. The print should appear square
when done.
Once you have obtained your prints, determine what specific pattern is on each one and record
your choices below the print. If you do not have whorls, loops or arches as shown above,
write ‘unknown.’ If you have multiple types of patterns, record those as well.

Table 2: Fingerprints
Left Hand
Thumb Index Middle Ring Little

Right Hand
Thumb Index Middle Ring Little

Quick guide to forensic DNA: Just like fingerprints, everyone’s DNA is unique. Several
techniques are available to generate DNA fingerprints. Here you will investigate the use of PCR
and gel electrophoresis of DNA fragments.

Objectives:
1. To learn how PCR amplifies samples of DNA.
2. To learn about restriction enzymes and how they can cut DNA fragments.
3. Two separate DNA fragments in a sample gel electrophoresis gel.
4. To compare and interpret the banding patterns on an electrophoresis gel.

Part 1: Polymerase Chain Reaction (PCR)

Often, samples of DNA (or RNA, in the case of some viruses) are so small that they need to be
amplified to have enough material to analysis. PCR is a process that makes this possible. Watch
this video to learn more: https://www.youtube.com/watch?v=WfiBa2Exdr4

2
To practice, do this interactive: https://learn.genetics.utah.edu/content/labs/pcr/
Then answer the questions on the Report Sheet.

Part 2: Gel Electrophoresis

Once a sample of DNA has been amplified by PCR, it can be analyzed using gel electrophoresis.
Gel electrophoresis is a process used to visualize the fragment pattern produced from restriction
enzyme digestion of a DNA sample.

Forensic scientists use gel electrophoresis, in which the different fragments are sorted according
to size. This video will explain: https://www.youtube.com/watch?v=uLUhT_JvFHc

Restriction enzymes are naturally occurring proteins produced by bacteria. They function like
DNA scissors. The scissors look for specific sequences within a piece of DNA and, where those
sequences occur, they cut the DNA through both strands.

Example: If a restriction enzyme that recognizes the sequence 5’ – GGATCC – 3’ is applied to

the piece of DNA as shown below, the enzyme will cut the DNA between the A-T of the top
strand and the T-A of the bottom strand. By counting the number of base pairs in the cut
fragments we can see that the original DNA strand that contains 25 base pairs now consists of
three fragments with 7, 8, and 10 base pairs respectively.

5’ – ACATGGATCCACGGATCCGACATTG – 3’
3’ – TGTACCTAGGTGCCTAGGCTGTAAC – 5’

Restriction Enzyme (GGATCC)

5’ – ACATGGA – 3’ 5’ – TCCACGGA – 3’ 5’ – TCCGACATTG – 3’

3’ – TGTACCT – 5’ 3’ – AGGTGCCT – 5’ 3’ – AGGCTGTAAC – 5’
7 bp 8bp 10bp

(Use this example when you get to the forensics section below).

Now you will “run a gel” using this simulation: https://learn.genetics.utah.edu/content/labs/gel/

Using gel electrophoresis in criminal investigations:

Paternity Testing
You are a technician in a lab that analyzes DNA to settle paternity suits. You extract DNA
samples from individuals involved in a case and use a restriction enzyme to prepare for gel
electrophoresis. You obtain the gel electrophoresis pattern shown in Figure 2 to determine who
could not be the father.

Figure 2

3
  Who is the most likely father of the
child in this case?

 Is it 100% certain that this person is

the father? Why or why not?

Forensics
In this activity, you will be given DNA isolated from two samples from a crime scene. Sample 1
was isolated from the bloody candlestick and sample 2 came from under the fingernails of the
victim. Use the restriction enzyme, 5’ -GGATCC- 3’, to process these samples.

 Examine the DNA sequences for the presence of the restriction enzyme recognition
sequence. Box the whole sequence with a color marker. Wherever the sequence
occurs, use pencil lines to cut the DNA through both strands. (Cut between the A-T of the
top strand and the T-A of the bottom strand). So, GGATCC breaks into GGA / TCC.

DNA Sample 1: Blood from Candlestick

5’-
AAACGCGGGATCCCCGATTAGGATGGATCCGGATCCAGAGGATCCAGAGGATACGC-
3’
3’-
TTTGCGCCCTAGGGGCTAATCCTACCTAGGCCTAGGTCTCCTAGGTCTCCTATGCG-5’

DNA Sample 2: Biological material under victim’s fingernails

5’-
GAAACGCGGGATCCCCGATTAGGATGGATCCGGATCCAGAGGATCCAGAGCATCCG
C-3’
3’-
CTTTGCGCCCTAGGGGCTAATCCTACCTAGGCCTAGGTCTCCTAGGTCTCGTAGGCG-
5’

 Determine the number of base pairs (bp) that occur in each of the fragments that will be
produced from cutting the DNA. (If you did not produce five fragments in each DNA
sample, check your cuts again).

Fragment sizes for sample 1

4
 Fragment sizes for sample 2

 Place your fragments into Figure 2. Put sample 1 in lane 1 and sample 2 in lane 2.

Figure 2: DNA Electrophoresis Gel

1 2 3 4 5 6 7 8
1 2 3 4 5 6 7 8

20
Lane 1: Blood from candlestick
18 Lane 2: From under fingernails
Lane 3: Victim’s DNA
16
Lane 4: Col. Mustard’s DNA
14 Lane 5: Mrs. White’s DNA
Lane 6: Professor Plum’s DNA
12 Lane 7: Miss Scarlet’s DNA
Lane 8: Mr. Green’s DNA
10

 Who is the probable human source(s) of the blood samples?

Sample 1 on candlestick
Sample 2 under fingernails