Series SSRR3/3 SET-2

àíZ-nÌ H$moS>
Q.P. Code 57/3/2
amob Z§. narjmWu àíZ-nÌ H$moS> >H$mo CÎma-nwpñVH$m Ho$
Roll No. _wI-n¥ð >na Adí` {bIo§ &
Candidates must write the Q.P. Code
on the title page of the answer-book.

ZmoQ> NOTE
(I) H¥$n`m Om±M H$a b| {H$ Bg àíZ-nÌ _o§ _w{ÐV (I) Please check that this question paper
n¥ð> 27 h¢ & contains 27 printed pages.

(II) H¥$n`m Om±M H$a b| {H$ Bg àíZ-nÌ _| (II) Please check that this question paper
>33 àíZ h¢ & contains 33 questions.

(III) àíZ-nÌ _| Xm{hZo hmW H$s Amoa {XE JE (III) Q.P. Code given on the right hand
àíZ-nÌ H$moS H$mo narjmWu CÎma-nwpñVH$m Ho$ side of the question paper should be
_wI-n¥ð> na {bI| & written on the title page of the
answer-book by the candidate.
(IV) H¥$n`m àíZ H$m CÎma {bIZm ewê$ H$aZo go (IV) Please write down the serial
nhbo, CÎma-nwpñVH$m _| àíZ H$m H«$_m§H$ number of the question in the
Adí` {bI| & answer-book before attempting it.
(V) Bg àíZ-nÌ 15 {_ZQ >H$m (V) 15 minute time has been allotted to
g_` {X`m J`m h¡ & àíZ-nÌ H$m {dVaU read this question paper. The
10.15 ~Oo {H$`m OmEJm & question paper will be distributed
10.15 ~Oo go 10.30 ~Oo VH$ N>mÌ Ho$db at 10.15 a.m. From 10.15 a.m. to
10.30 a.m., the students will
àíZ- read the question paper only and
do CÎma-nwpñVH$m na H$moB© CÎma Zht {bI|Jo & will not write any answer on the
answer-book during this period.
Ord {dkmZ (g¡ÕmpÝVH$)
BIOLOGY (Theory)

:3 : 70
Time allowed : 3 hours Maximum Marks : 70

57/3/2-13 1 P.T.O.
 :

:
(i) 33
(ii)
(iii) 1 16 1
(iv) 17 21 2

(v) 22 28 3

(vi) 29 30 4

(vii) 31 33 5
(viii)

(ix)
(x)

IÊS> H$
1 16 1 16 1=16

1. ~rOmÊS>mdaU H$mo{eH$mAm| VWm ghm` H$mo{eH$mAm| go {dH${gV hmoZo dmbo Ag§JO{ZV ^«yUm|
H$s gyÌJwUVm hmoJr H«$_e: :
(A) n, 2n (B) 2n, n
(C) 3n, 2n (D) 2n, 3n

2. EH$ S>rEZE I§S> _| 2500 240 ½dmZrZ h¢ & Vmo Bg S>rEZE

I§S> _| Xmo hmBS´>moOZ ~§Y dmbo jmam| (~ogm|) H$s g§»`m {H$VZr hmoJr ?
(A) 480 (B) 720
(C) 1010 (D) 2020

57/3/2-13 2
General Instructions :
Read the following instructions carefully and follow them :
(i) This question paper contains 33 questions. All questions are compulsory.
(ii) Question paper is divided into five sections Sections A, B, C, D and E.
(iii) Section A questions number 1 to 16 are multiple choice type questions. Each
question carries 1 mark.
(iv) Section B questions number 17 to 21 are very short answer type questions.
Each question carries 2 marks.
(v) Section C questions number 22 to 28 are short answer type questions. Each
question carries 3 marks.
(vi) Section D questions number 29 and 30 are case-based questions. Each
question carries 4 marks. Each question has subparts with internal choice in
one of the subparts.
(vii) Section E questions number 31 to 33 are long answer type questions. Each
question carries 5 marks.
(viii) There is no overall choice. However, an internal choice has been provided in
Sections B, C and D of the question paper. A candidate has to write answer for
only one of the alternatives in such questions.
(ix) Kindly note that there is a separate question paper for Visually Impaired
candidates.
(x) Wherever necessary, neat and properly labelled diagrams should be drawn.

SECTION A

Questions no. 1 to 16 are Multiple Choice Type Questions, carrying 1 mark

each. 16 1=16

1. The ploidy of the apomictic embryos developing from the integument cells
and synergids respectively would be :
(A) n, 2n (B) 2n, n
(C) 3n, 2n (D) 2n, 3n

2. A DNA fragment has 2500 nucleotides, out of which 240 are Guanine.
How many bases having double hydrogen bonds between them does this
DNA fragment possess ?
(A) 480 (B) 720
(C) 1010 (D) 2020

57/3/2-13 3 P.T.O.
3. {ZfoMZ Ho$ {~Zm ~rO CËnÞ H$aZo H$s àUmbr H$m {dH$mg Bg Hw$b Ho$ nwînr nmXnm| _| hþAm
h¡ :
(A) EñQ>oaogr (B) gmoboZogr
(C) _mbdogr (D) {b{bEgr >

4. bwB© nmíMa Zo ñdV: OZZ Ho$ {gÕmÝV H$mo AnZo à`moJm| Ûmam Im[aO H$a {X`m & BgHo$ {bE
CgZo Cn`moJ {H$`m, nhbo go OrdmUwa{hV âbmñH$ VWm : $
(A) Or{dV `rñQ> (B) _¥V `rñQ>
(C) Or{dV OrdmUw (D) _¥V OrdmUw

5. B§½b¢S> _| 1850 Ho$ XeH$ Ho$ níMmV² níM-Am¡ÚmoJrH$aU `wJ _| àmH¥${VH$ daU Ho$ à^md Ho$
\$bñdê$n ídoV n§Im| dmbo eb^m| H$s g§»`m, Jhao (H$mbo) n§Im| dmbo eb^m| H$s g§»`m H$s
Anojm :
(A) H$_ Wr (B) A{YH$ Wr
(C) XmoZm| H$s g§»`m H$_ Wr (D) XmoZm| H$s g§»`m A{YH$ Wr

6. bmb nwîn dmbo ñZonS´>oJZ nm¡Yo H$m g§H$aU ídoV nwîn dmbo ñZonS´>oJZ nm¡Yo Ho $ gmW H$am`m
J`m & F1
(A) 50% bmb : 50% ídoV
(B) 25% Jwbm~r : 50% ídoV : 25% bmb
(C) 50% bmb : 50% Jwbm~r
(D) 25% bmb : 50% Jwbm~r : 25% ídoV

7. {ZåZ{b{IV H«$mo_mogmo_r` {dH$ma _| go H$m¡Z-go ì`pîQ> (ì`{º$) N>moQ>o H$X (~m¡Zo),

Aën{dH${gV ñÌrdV² bjU VWm ~§Ü` A§S>me` `wº$ hmoVo h¢ ?
(A) S>mCZ qgS´>mo_ (B) Q>Z©a qgS´>m_o
(C) \o$ëQ>a qgS´>mo_ (D) nQ>mD$ qgS´>mo_

57/3/2-13 4
3. The mechanism to produce seeds without fertilisation has evolved in the
given family of the flowering plants :

(A) Asteraceae (B) Solanaceae

(C) Malvaceae (D) Liliaceae

4. Louis Pasteur dismissed the theory of spontaneous generation by his

experiments using pre-sterilised flasks and :
(A) Live yeast (B) Killed yeast
(C) Live bacteria (D) Killed bacteria

5. After the 1850s in the post-industrialization era in England, the expected

effect of natural selection on the number of white-winged moths as
compared to the dark-winged moths was :

(A) Less in number (B) More in number

(C) Both were less in number (D) Both were more in number

6. A Snapdragon plant bearing red colour flowers was crossed with a

Snapdragon plant bearing white colour flowers. The F1 progeny on
selfing produced the progeny in the ratio of :
(A) 50% Red : 50% White
(B) 25% Pink : 50% White : 25% Red
(C) 50% Red : 50% Pink
(D) 25% Red : 50% Pink : 25% White

7. In which of the following chromosomal disorders do individuals have

short stature, underdeveloped feminine character and sterile ovaries ?
(A) Dow s syndrome (B)
(C) s syndrome (D) Patau s syndrome

57/3/2-13 5 P.T.O.
8. PCR _| S>rEZE Ho$ àdY©Z Ho$ {bE {ZåZ{b{IV _| go H$m¡Z-gm CnH«$m_H$m| Ho$ VmnmZwerbZ
H$mo ghr àH$ma go {Zê${nV H$aVm h¡ ?

9. EH$ amoJr Áda, {R>Rw>aZ, Im±gr, {gaXX© VWm Zrbo ZmIyZm| d hm|R>m|
`h A{^bjU Xem©Zo dmbm amoJ h¡ :
(A) _bo[a`m (B) Q>mB\$m°BS>
(C) gm_mÝ` OwH$m_ (D) Ý`y_mo{Z`m

10. EH$ à`moJ _| H$mo 14NH4Cl `wº$ g§dY©Z _mÜ`_ _| {dH${gV {H$`m
(14N ZmBQ´>moOZ H$m hëH$m g_ñWm{ZH$ h¡) & CgHo$ níMmV² Bgo ZmBQ´>moOZ Ho$ ^mar
g_ñWm{ZH$ (15N) `wº$ g§dY©Z _mÜ`_ _| 6 6
Ho$ ~mX CZHo$ S>rEZE H$mo {ZîH${f©V {H$`m J`m VWm CsCl KZËd àdUVm na AnHo$ÝÐU Ûmam
{ZîH${f©V {H$`m J`m & CsCl KZËd àdUVm> AnHo$ÝÐU na S>rEZE Ho$ ghr KZËd
(hëH$m/g§H$[aV/^mar) Am¡a n{Å>`m| Ho$ AZwnmV H$s nhMmZ H$s{OE &
(A) g§H$[aV : ^mar, 1 : 16
(B) hëH$m : ^mar, 1 : 31
(C) g§H$[aV : ^mar, 1 : 31
(D) hëH$m : ^mar, 1 : 05

57/3/2-13 6
8. Which one of the following represents the correct annealing of primers to
the DNA to be amplified in the PCR ?

9. A patient is suffering from fever, chills, cough, headache and bluish

finger nails and lips. These symptoms are of the disease :
(A) Malaria (B) Typhoid
(C) Common cold (D) Pneumonia

10. In an experiment, E. coli is grown in a medium containing 14NH4Cl.

(14N is the light isotope of Nitrogen) followed by growing it for six
generations in a medium having heavy isotope of nitrogen (15N). After six
generations, their DNA was extracted and subjected to CsCl
density gradient centrifugation. Identify the correct density
(Light/Hybrid/Heavy) and ratio of the bands of DNA in CsCl density
gradient centrifugation.
(A) Hybrid : Heavy, 1 : 16
(B) Light : Heavy, 1 : 31
(C) Hybrid : Heavy, 1 : 31
(D) Light : Heavy, 1 : 05

57/3/2-13 7 P.T.O.
11. àW_ nwZ`m}JO S>rEZE Ho$ à{VH¥$Vr`Z Ho$ {bE, ñQ>¡Zbo H$mohoZ VWm ha~Q>© ~mo`a Ûmam Cn`moJ
{H$E JE S>rEZE nm°br_aoµO H$m òmoV h¡ :
(A) (B)
(C) (D)

12. àH¥${V _| CJZo dmbr g_pîQ> {OgHo$ {bE gr{_V g§gmYZ CnbãY h¢, Ho$ {bE {Zê${nV
g_pîQ> d¥{Õ dH«$ h¡ :

13 16 (A)
(R) (A), (B), (C)
(D)

(A) A{^H$WZ (A) Am¡a H$maU (R XmoZm| ghr h¢ Am¡a H$maU (R), A{^H$WZ (A) H$s
ghr ì¶m»¶m H$aVm h¡ &

(B) A{^H$WZ (A) Am¡a H$maU (R) XmoZm| ghr h¢, naÝVw H$maU (R), A{^H$WZ (A) H$s
ghr ì¶m»¶m H$aVm h¡ &

(C) A{^H$WZ (A) ghr h¡, naÝVw H$maU (R) µJbV h¡ &

(D) A{^H$WZ (A) µJbV h¡, naÝVw H$maU (R) ghr h¡ &
57/3/2-13 8
11. For the replication of the first recombinant DNA, Stanley Cohen and
Herbert Boyer used the DNA polymerase of :
(A) Thermus aquaticus (B) Salmonella typhimurium
(C) Escherichia coli (D) Haemophilus influenzae

12. The population growth curve applicable for a population growing in

nature with limited resources available to them will be :

For Questions number 13 to 16, two statements are given one labelled as
Assertion (A) and the other labelled as Reason (R). Select the correct answer to these
questions from the codes (A), (B), (C) and (D) as given below.

(A) Both Assertion (A) and Reason (R) are true and Reason (R) is the
correct explanation of the Assertion (A).

(B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not
the correct explanation of the Assertion (A).

(C) Assertion (A) is true, but Reason (R) is false.

(D) Assertion (A) is false, but Reason (R) is true.

57/3/2-13 9 P.T.O.
13. (A) : A{YH$Va Amd¥V~r{O`m| _| `w½_ZO öX`mH$ma ^y«U ~ZmVm h¡, Omo CgHo$
níMmV² àmH²$^«yU _| {dH${gV hmo OmVm h¡ &
(R) : `w½_ZO ~rOmÊS>Ûma Ho$ {ZH$Q> ^«yU-H$mof _| pñWV hmoVm h¡ VWm EH$ ^«yU _|
{dH${gV hmo OmVm h¡ &
14. (A) : gwH|$Ð{H$`m| _| àma§{^H$ AZwboI (à{V{b{n) go Aì`ºo$H$ H$mo hQ>mZo Ho$
{bE g_~§YZ (ñß
(R) : gwH|$Ð{H$`m| _| àma§{^H$ AZwboI (à{V{b{n) _| ì`ºo$H$ d Aì`ºo$H$ XmoZm|
hmoVo h¢ VWm Aì`ºo$H$ A{H«$` hmoVo h¢ &
15. (A) : {dbmoS>H$ ~m`mo[aEo CnbãYVm Am¡a CgHo$ EH$g_mZ
{_lU _| ghm`Vm H$aVm h¡ &
(R) : {dbmo{S>V-hm¡O ~m`mo[aEo
16. (A) : {H$gr ì`{º$ Ûmam EoëH$mohm°b Ho$ {MaH$mbr (~hþV A{YH$ g_` VH$)
à`moJ go `H¥$V H$mo j{V ({gamo{gg) nhþ±MVr h¡ &
(R) : BgHo$ AmXr ì`{º$ Ho$ nyao n[adma Ho$ {bE
_mZ{gH$ VWm Am{W©H$ H$îQ> H$m H$maU ~Z OmVr h¡ &

IÊS> I
17. (H$) EH$ ñWbr` nm[aV§Ì _| AnKQ>Z MH«$ Ho$ Xm¡amZ ~ZZo dmbo øy_g Ho$ _hÎdnyU©
A{^bjU {b{IE & 2

AWdm
(I) (i) bm°J-
Ho$ ~rM g§~§Y H$m J«m\$s` {Zê$nU H$s{OE &
(ii) EH$ bKwJUH$ n¡_mZo na Bg g§~§Y H$m g_rH$aU {b{IE & 2

18. ?O~ Bgo eara _| à{dîQ> H$am`m OmVm h¡, Vmo `h {H$g AmYma na
(àH$ma) H$m`© H$aVm h¡, {b{IE & 2

57/3/2-13 10
13. Assertion (A) : The zygote gives rise to heart-shaped embryo and
subsequently proembryo in most angiosperms.
Reason (R) : The zygote is present at the micropylar end of the embryo
sac and develops into an embryo.

14. Assertion (A) : Primary transcripts in eukaryotes are subjected to

splicing to remove the introns.
Reason (R) : Primary transcripts contain both exons and introns and
the introns are non-functional in eukaryotes.

15. Assertion (A) : The stirrer facilitates the even mixing of oxygen
availability in a bioreactor.
Reason (R) : Stirred-tank bioreactors generally have a flat base.

16. Assertion (A) : The chronic use of alcohol by a person leads to cirrhosis.
Reason (R) : Alcohol addiction at times becomes the cause of mental
and financial distress to the entire family of the addicted
person.

SECTION B

17. (a)
decomposition cycle in a terrestrial ecosystem. 2

OR
(b) (i) Graphically represent the relationship between species
richness and area on a log-log scale for bats and fishes.
(ii) Write the equation for the relationship as on a logarithmic
scale. 2

18. What is a vaccine ? Write the basis on which it acts when administered in
the body. 2

57/3/2-13 11 P.T.O.
19. Cë~doYZ (EopåZ`mog|Q>o{gg) VH$ZrH$ _| AnZmB© OmZo dmbr H$m`©{d{Y H$m CëboI H$s{OE &
Bg VH$ZrH$ Ho$ {H$Ýht Xmo bm^m| H$s gyMr ~ZmBE & 2

20. m-RNA H$m EH$ H$mën{ZH$ bKw I§S> Omo EH$ g{H«$` nm°brnoßQ>mBS> ûm¥§Ibm H$m Hy$Q> boIZ
AmJo {XE JE àíZm| Ho$ CÎma
{b{IE :
mRNA 5 UCAUUACCACGAUUCUUUAAAAGA 3
(H$) `{X 5d| (nm±Md|) àHy$Q> (H$moS>m°Z) _| Ho$ ñWmZ na à{VñWm{nV hmo OmE, Vmo
{XE JE àHy$Q>m| (H$moS>m°Zm|) go {H$VZo Eo_rZmo Aåb ~Z|Jo ? AnZo CÎma H$s ì`m»`m
H$s{OE &
(I) Cn`w©º$ mRNA Ho$ g_mZ mRNA _| Ohm± Mm¡Wo àHy$Q> (H$moS>m°Z) _| `{X Ho$
ñWmZ na hmo, Vmo g§íbo{fV hmoZo dmbo nm°brnoßQ>mBS> _| Eo_rZmo Aåbm| H$s g§»`m
{b{IE & AnZo CÎma H$s Ý`m`g§JVVm {gÕ H$s{OE & 2

21. {d{^Þ b§~mB© dmbo S>rEZE I§S>m| Ho$ {_lU go d¡ÚwV H$U g§MbZ ( \$moao{Q>H$) n¥W
Ho$ {bE g§`moOZm| A, B VWm C H$m AÜ``Z H$aHo$ AmJo {XE JE àíZm| Ho$ CÎma Xr{OE :

(H$) Xmo g§`moOZm| A VWm B _| go {H$g_| Amn S>rEZE I§S>m| H$mo n¥WH$ hþAm XoI|Jo VWm
? AnZo CÎma H$s Ý`m`g§JVVm {gÕ H$s{OE &

(I) g§`moOZ-C _| I VWm II _| go H$m¡Z-gr nÅ>r b§~o S>rEZE I§S>m| dmbr h¡ & AnZo CÎma
H$s Ý`m`g§JVVm {gÕ H$s{OE & 2

57/3/2-13 12
19. State the procedure followed in the technique of amniocentesis. List any
two advantages of this technique. 2

20. Consider the given data of a hypothetical small portion of mRNA that
codes for a functional polypeptide chain and answer the questions that
follow :
mRNA 5 UCAUUACCACGAUUCUUUAAAAGA 3
(a) How many amino acids will be formed from the given codons, if
substitution of U by C takes place at the 5th codon ? Explain your
answer.
(b) Write the number of amino acids that would be in the polypeptide
synthesised by a similar mRNA as above, where in the fourth
2

21. With reference to the set-ups (A, B and C) given below, of the
electrophoretic separation of a mixture of DNA fragments of varied
lengths, answer the questions that follow :

(a) In which one of the two Set-ups, A or B, would you see the DNA
fragments separated and why ? Justify your answer.

(b) In Set-up C, which one of the two, I / II, are the bands of longer
fragments of DNA ? Justify your answer. 2

57/3/2-13 13 P.T.O.
 IÊS> J

22. (H$) _mZd ewH«$mUw H$m {MÌ ~ZmBE VWm BgHo$ {ZåZ{b{IV ^mJm| H$mo Zm_m§{H$V
H$s{OE :
(i) Omo ewH«$mUw H$s J{VerbVm _| ghm`H$ h¡
(ii) Omo Aar` {H$arQ> (H$moamoZm ao{S>EQ>m) VWm µOmoZm noë`w{gS>m Ho$ doYZ _|
ghm`H$ h¡
(iii) Omo _mZd A§S>mUw Ho$ H$mo{eH$mÐì` _| àdoe H$aVm h¡

(I) _mZd _| {ZfoMZ Ho$ Xm¡amZ ~hþewH«$mUwVm H$mo H¡$go Adamo{YV {H$`m OmVm h¡ ? CëboI
H$s{OE & 3

23. (H$) (i) ~m`moJ¡g g§`§Ì _| Kaoby dm{hV _b H$s Anojm Jmo~a H$m Cn`moJ H$aZo Ho$ Xmo
à_wI H$maUm| H$s gyMr ~ZmBE &
(ii) ~m`moJ¡g g§`§Ì _| ~Mr hþB© H$X©_ (ñbar) Ho$ {H$gr EH$ Cn`moJ H$m CëboI
H$s{OE & 3

AWdm
(I) {M{H$ËgH$m| Ûmam gm_mÝ`V: {ZåZ{b{IV amo{J`m| Ho$ CnMma _| Cn`moJ {H$E OmZo dmbo
O¡dg{H«$` AUw VWm CZHo$ gyú_Ordr` òmoV H$m Zm_ {b{IE : 3

(i) _m`moH$m{S>©`b B§\

(ii)

(iii) A§J à{VamonU

57/3/2-13 14
 SECTION C

22. (a) Draw a diagram of a human sperm. Label the following parts in it :

(i) Which helps in the motility of the sperm

(ii) Which helps in penetrating through the corona radiata and

zona pellucida

(iii) Which enters into the cytoplasm of the human egg

(b) Mention how is polyspermy prevented during the course of

fertilization in humans. 3

23. (a) (i) List two major reasons for using cow-dung in a biogas plant
instead of using domestic sewage.

(ii) Mention one use of the unspent slurry of the biogas plant. 3

OR

(b) Name the bioactive molecule and its microbial source generally
used by physicians to treat the patients for : 3

(i) Myocardial infarction

(ii) High blood cholesterol level

(iii) Organ transplantation

57/3/2-13 15 P.T.O.
24. _Q>a Ho$ nm¡Ym| Ho$ nwîn a§J (dU©) ~¢JZr/g\o$X (V/v) VWm nwîn H$s pñW{V Ajr`/A§Ë`
(A/a) dmbo nm¡Ym| Ho$ ~rM VrZ H«$m°g (g§H$aU) H$amE JE & ZrMo Xr JB© Vm{bH$m _|
VWm H«$m°g _| OZH$ Ho$ Ñí`àê$n (\$sZmoQ>mBn) VWm F1 g§V{V Ho$ \$sZmoQ>mBn H$m AÜ``Z
H$s{OE &

F1

(a) ~¢JZr, Ajr` g\o$X, Ajr` 6/16 g\o$X, Ajr`

2/16 g\o$X, A§Ë`
6/16 ~¢JZr, Ajr`
2/16 ~¢JZr, Ajr`

(b) ~¢JZr, Ajr` g\o$X, A§Ë` 1/4 ~¢JZr, Ajr`

1/4 ~¢JZr, A§Ë`
1/4 g\o$X, Ajr`
1/4 g\o$X, A§Ë`

(c) ~¢JZr, Ajr` ~¢JZr, Ajr` 3/4 ~¢JZr, Ajr`

1/4 g\o$X, Ajr`

H«$m°g VWm Ho$ àË`oH$ H«$m°g _§o àË`oH$ OZH$ Ho$ OrZmoQ>mBn H$m AmH$bZ H$s{OE
(nVm bJmBE) & 3

25. (H$) EAmaQ>r Ho$ bm^m| H$m CëboI H$s{OE &

(I) ghm`H$ OZZ àm¡Úmo{J{H$`m| H$s AmB©grEgAmB© VWm EAmB© {d{Y`m| H$s ì`m»`m
H$s{OE & 3

57/3/2-13 16
24. Three crosses were carried out in pea plants with respect to flower colour
violet/white (V/v) and flower position axial/terminal (A/a). Study in the
table the crosses 1
progeny phenotypes are given.

Parental plants (Phenotypes) F1 Progeny (Phenotypes)

(a) Violet, axial white, axial 6/16 white, axial

2/16 white, terminal
6/16 violet, axial
2/16 violet, axial

(b) Violet, axial white, terminal 1/4 violet, axial

1/4 violet, terminal
1/4 white, axial
1/4 white, terminal

(c) Violet, axial violet, axial 3/4 violet, axial

1/4 white, axial

25. (a)

(b)
technologies. 3

57/3/2-13 17 P.T.O.
26. (H$) Cg OrdmUw H$m d¡km{ZH$ Zm_ {b{IE {OgH$m Cn`moJ JmobH$ eb^ H¥${_ amoYr OrE_
(GM) H$nmg \$gb Ho$ nm¡Yo V¡`ma H$aZo _| O¡d -
h¡ &
(I) OrE_ (GM) H$nmg \$gb H$sQ>m| Ho$ AmH«$_U H$m à{VamoY H$aZo _| {H$g àH$ma g_W©
hmoVr h¡, ì`m»`m H$s{OE & 3

27. _o{S>Q>oao{Z`Z Am°{H©$S> VWm _{jH$m H$s EH$ Om{V Ho$ ~rM ghmonH$m[aH$
(å`yÀ`yA{bpñQ>H$) g§~§Y H$m dU©Z H$s{OE & 3

28. EH$ ^yao aoV (_¥Xm) dmbo _éñWb _| ahZo dmbo gm±nm| H$s g_pîQ> _| hmoZo dmbo n[adV©Z H$mo Xmo
g_`md{Y`m| EH$ VWm Xmo H$mo {ZåZ {MÌ Ûmam Xem©`m J`m h¡ & BZH$m AÜ``Z H$s{OE
VWm CgHo$ AmJo {XE JE àíZm| Ho$ CÎma Xr{OE & ^yao gn© VWm Yyga gn© Ebrbm| A/a
(à^mdr/Aà^mdr) Ûmam {Zê${nV {H$E JE h¢ &
g_pîQ-EH$ g_pîQ>-Xmo
(n{j`m| H$m àdmgZ)

(H$) `{X g_pîQ>-EH$ _| Aà^mdr {deofH$ H$s Amd¥{Îm 9% h¡, Vmo g_`w½_Or à^mdr VWm
{df_`w½_Or à^mdr gm±nm| (gnmªo) H$s Amd¥{Îm H$m n[aH$bZ H$s{OE &

(I) {dH$mg H$s Cg {H«$`m{d{Y H$m Zm_ {b{IE {OgHo$ \$bñdê$n g_pîQ>-EH$ go
g_pîQ>-Xmo H$m {dH$mg hþAm & 3
57/3/2-13 18
26. (a) Give the scientific name of the bacteria widely used in
biotechnology to create a GM cotton crop resistant to bollworm
attacks.
(b) Explain how GM cotton crop is able to resist insect attacks. 3

27. Describe the mutualistic relationship that exists between the

Mediterranean orchid Ophrys and a bee species. 3

28. A population of snakes lived in a desert with brown sand. Study the
drawings given below showing the change in the population from to
over time and answer the question that follows. Brown snakes and
Grey snakes are represented by alleles A/a (Dominant/recessive).

Population-one Population-two
(Migration of Birds)

(a) If the frequency of the recessive trait is 9% in population-one, work

out the frequency of homozygous dominant and heterozygous
dominant snakes.
(b) Name the mechanism of evolution that must have operated so that
population-two evolved from population-one. 3
57/3/2-13 19 P.T.O.
 IÊS> K
29 30 3

29. ZrMo {XE JE AmaoIm| _| ñdrS>Z VWm adm§S>m H$s _mZd g_pîQ> (OZg§»`m) Ho$ VwbZmË_H$
Am`w {dVaU H$mo Xem©`m J`m h¡ (A§Vam©îQ´>r` S>mQ>m ~og 2003) & BgH$m AÜ``Z
H$aHo$ g§~{§ YV {ZåZ{b{IV àíZm| Ho$ CÎma {b{IE :
ñdrS>Z

nwéf ñÌr
Am`w (dfm] _|)

g_{ï> H$m à{VeV

adm§S>m
Am`w (dfm] _|)

nwéf ñÌr

g_{ï> H$m à{VeV

57/3/2-13 20
 SECTION D
Questions no. 29 and 30 are case-based questions. Each question has
3 sub-questions with internal choice in one sub-question.
29. Study the figures given below that depict the comparative age
distribution of human populations in Sweden and Rwanda. (International
Data Base 2003) and answer the questions that follow :

Sweden

Males Females
Age (years)

Percent of population

Rwanda
Age (years)

Males Females

Percent of population
57/3/2-13 21 P.T.O.
 (H$) adm§S>m ?
Zo CÎma H$m g_W©Z (nwpîQ>) H$s{OE & 2
(I) ñdrS>Z H$s OZg§»`m H$m Am`w {dVaU AmYma go erf© VH$ bJ^J EH$ O¡gm
? 1
(J) D$na {XE JE ñdrS>Z Ho$ OZg§»`m Am`w {na¡{_S> Ho$ àH$ma H$m Zm_ {b{IE & 1
AWdm
(J) Cn`w©º$ Xem©E JE adm§S>m Ho$ Am`w {na¡{_S> H$m àH$ma {b{IE & 1

30.

S>rEZE _| {d{eîQ> AZwH«$_ H$mo nhMmZ H$a Cg q~Xþ na H$mQ>Vo h¢ & BamH I Bgr àH$ma H$m
EH$ à{V~§YZ E§µOmB_ h¡, Omo 5 G-G-A-T-C-C 3 Ho$ nhMmZ AZwH«$_ go ~§Y H$a àË`oH$
aÁOwH$ H$mo G VWm G Ho$ ~rM H$mQ>Vm h¡ & O~{H$ Alu I nhMmZ AZwH«$_ 5 A-G-C-T 3
go ~§Y H$a BZ AZwH«$_m| Ho$ àË`oH$ aÁOwH$ H$mo G VWm C Ho$ ~rM go H$mQ>Vm h¡ &
(H$) `{X {XE JE S>rEZE aÁOwH$ H$mo H$mQ>Zo Ho$ {bE Alu I H$m Cn`moJ {H$`m OmE, Vmo
S>rEZE Ho$ {H$VZo I§S> ~Z|Jo ? ~ZZo dmbo àË`oH$ I§S> H$m AZwH«$_ CgH$s Y«wdUVm Ho$
gmW {b{IE & 1
5 C C G T A G C T A T C A G C T G G 3
| | | | | | | | | | | | | | | | |
3 G G C A T C G A T A G T C G A C C 5
(I) {XE JE Cgr S>rEZE aÁOwH$ na nwZ`m©oJO S>rEZE AUw ~ZmZo Ho$ {bE BamH I
AWdm Alu I à{V~§YZ E§µOmB_m| _| go {H$gH$mo A{Y_mZVm (àmW{_H$Vm) Xr OmEJr
? 1

(J) {ÛHw$ÊS>br S>rEZE Ho$ Xmo aÁOwH$m| go ~§YZ Ho$ níMmV² S>rEZE Ho$ Xmo aÁOwH$m| H$mo
H$mQ>Zo Ho$ {bE {H$g {d{eîQ> ñWb (q~Xþ) na à{V~§YZ E§µOmB_ H$m`© H$aoJm ?
à{V~§YZ EÊS>mo
AZwH«$_ H$m nm[a^m{fH$ nX/d¡km{ZH$ Zm_ {b{IE & 2
AWdm
(J) EcoRI Ûmam S>rEZE na nhMmZo OmZo dmbo {d{eîQ> nhMmZ
AZwH«$_ H$mo {b{IE & 2

57/3/2-13 22
 (a)
pyramid ? Support your answer with the data provided in the figure. 2
(b) Sweden has an age distribution that is approximately of the same
width near its base as at the apex. What does this indicate ? 1
(c) Name the type of age pyramid shown above for Sweden. 1
OR
(c) Name the type of age pyramid shown above for Rwanda. 1

30. Read the passage given below and answer the questions that follow.
In recombinant DNA technology, restriction enzymes are used as they
recognize and cut DNA within a specific recognition sequence. BamH I is
one such restriction enzyme which binds at the recognition sequence
5 G-G-A-T-C-C 3 and cleaves this sequence between G and G on each
strand, whereas Alu I binds at the recognition sequence 5 A-G-C-T 3
and cleaves these sequences between G and C on each strand.

(a) If Alu I is used to cut the given DNA strand, how many DNA
fragments would be formed ? Write the sequence of each fragment
formed with its polarity. 1
5 C C G T A G C T A T C A G C T G G 3
| | | | | | | | | | | | | | | | |
3 G G C A T C G A T A G T C G A C C 5

(b) Which one of the two restriction enzymes BamH I or Alu I will
preferably be used on the same given DNA strand to make a
recombinant DNA molecule and why ? 1

(c) After binding to the two strands of the double helix DNA, where
specifically does the restriction enzyme act to cut the two strands of
DNA ? Write the specific term used for the specific nucleotide
sequences of DNA recognised by a restriction endonuclease. 2
OR
(c) Write the specific sequence of DNA segment recognised by the
restriction endonuclease EcoRI. 2

57/3/2-13 23 P.T.O.
 IÊS> L>
31. (H$) (i) Ho$ _mZd eara _| à{dîQ> hmoZo Ho$ ~mX go g§H$« {_V ì`{º$ H$mo
_mXm _ÀN>a Ûmam H$mQ>o OmZo VH$ H$s Ad{Y _| Ho$
OrdZ MH«$ H$m dU©Z H$s{OE &
(ii) Ho$ OrdZ MH«$ _| _mXm Ho$ eara _| gånÞ hmoZo
dmbr Xmo n[aKQ>ZmAm| H$m CëboI H$s{OE & 5
AWdm
(I) (i) gwX_ A~w©X VWm XþX©_ A~©wX Ho$ ~rM Xmo A§Va {b{IE &
(ii) H¢$ga Ho$ A{^kmZ hoVw {H$Ýht VrZ {ZXmZmË_H$ VH$ZrH$m| H$s ì`m»`m
H$s{OE & 5

32. (H$) (i) nanamJU H$mo àmoËgm{hV H$aZo hoVw nwînr nm¡Ym| Ûmam {dH${gV {H$Ýht Mma
`w{º$`m| H$s ì`m»`m H$s{OE &
(ii) ? H$moB© EH$ H$maU {b{IE & 5

AWdm
(I) EH$ gm_mÝ` _mZd ñÌr Ho$ AmV©d MH«$ H$s A§S>me`r VWm J^m©e`r àmdñWmAm| H$s
ì`m»`m nr`yf VWm A§S>me`r hm°_m}Zm| H$s ^y{_H$m Ho$ gmW {ZåZ{b{IV àmdñWmAm|
Ho$ A§VJ©V H$s{OE : 5

(i) nwQ>H$s` àmdñWm/àMwamoX²^d àmdñWm

(ii) òmdr àmdñWm
(iii) AmV©d àmdñWm

33. (H$) {df_`w½_Or AdñWm _| XmoZm| Ebrbm| Ho$ à^md H$s ñnîQ> A{^ì`{º$ ghà^m{dVm
(H$moS>mo{_Z|g) _| n[ab{jV hmoVr h¡ & _mZd é{Ya dJ© ABO H$s d§emJ{V H$s
ghm`Vm go H$WZ H$s ì`m»`m H$s{OE & 5
AWdm

57/3/2-13 24
 SECTION E

31. (a) (i) Describe the life cycle of Plasmodium from the time it enters
the human body till a female Anopheles mosquito bites an
infected person.
(ii) Mention the two events of Plasmodium life cycle that occur
within the female Anopheles body. 5
OR
(b) (i) Write two differences between malignant tumor and benign
tumor.
(ii) Explain any three diagnostic techniques for the detection of
cancer. 5

32. (a) (i) Explain any four devices that flowering plants have developed
to encourage cross-pollination.
(ii) Why do plants discourage self-pollination ? State any one
reason. 5
OR
(b) Explain the ovarian and uterine events taking place along with the
role of pituitary and ovarian hormones, during menstrual cycle in a
normal human female under the following phases : 5
(i) Follicular phase/proliferative phase
(ii) Luteal phase/secretory phase
(iii) Menstrual phase

33. (a)

ABO blood group in humans. 5

OR

57/3/2-13 25 P.T.O.
 (I) àMmboH$ ( -Amonao m°Z) _| OrZm| Ho$ EH$ g_yh H$m {Z`_Z VWm A{^ì`{º$
EH$ gmW EH$ BH$mB© Ho$ ê$n _| hmoVm h¡ &

(i) Amonoam°Z _| g§aMZmË_H$ OrZm| H$s g{H«$`Vm Ho$ Ama§^Z (pñdqMJ

Am°Z) H$s H$m`©{d{Y (àUmbr) H$s ì`m»`m H$s{OE &

(ii) àMmboH$ Ho$ {Z`_Z H$mo G$UmË_H$ {Z`_Z H$hm OmVm h¡ & H$maU
5

57/3/2-13 26
 (b)
lac

(i) ctural
genes of lac operon.

(ii) lac
5

57/3/2-13 27 P.T.O.