Hindawi

Aquaculture Nutrition
Volume 2024, Article ID 6625061, 14 pages
https://doi.org/10.1155/2024/6625061

Research Article
Growth and Hepatopancreas Health of Juvenile Chinese
Mitten Crab (Eriocheir sinensis) Fed Different Levels of Black
Soldier Fly (Hermetia illucens) Larvae Meal for Fish
Meal Replacement

Han Wang ,1 Erchao Li ,1 Qincheng Huang ,2 Jiadai Liu ,1 Yixin Miao ,1

Xiaodan Wang ,1 Chuanjie Qin ,3 Jianguang Qin ,4 and Liqiao Chen 1
1
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University,
Shanghai 200241, China
2
Xianghu Laboratory, Hangzhou 311231, China
3
Key Laboratory of Sichuan Province for Fishes Conservation and Utilization in the Upper Reaches of the Yangtze River,
Neijiang Normal University, Neijiang, Sichuan 641100, China
4
College of Science and Engineering, Flinders University, Adelaide, South Australia 5001, Australia

Correspondence should be addressed to Erchao Li; [email protected] and Liqiao Chen; [email protected]

Received 22 July 2023; Revised 9 September 2023; Accepted 25 October 2023; Published 23 January 2024

Academic Editor: Houguo Xu

Copyright © 2024 Han Wang et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

A 56-day feeding trial assessed the effects of black soldier fly larvae meal (BSFLM) on the growth performance and hepatopancreas
health of juvenile Eriocheir sinensis. Six isoproteic and isolipidic diets with 0% (FM), 10% (BSFLM10), 20% (BSFLM20), 30%
(BSFLM30), 40% (BSFLM40), or 50% (BSFLM50) replacement of fish meal by BSFLM were formulated. Compared to FM, replacing
10%–40% of fish meal with BSFLM did not significantly affect the weight gain rate (WGR) or specific growth rate (SGR), while
BSFLM50 significantly decreased the WGR and SGR. Crabs fed BSFLM50 had significantly lower T-AOC activity than those fed
other diets, and crabs fed BSFLM30, BSFLM40, or BSFLM50 had significantly lower activities of antioxidant enzymes (SOD and
GSH-Px) in the hepatopancreas than those fed FM or BSFLM10. Compared to FM, BSFLM10, BSFLM20, and BSFLM30 did not
affect the relative expression of genes related to the nonspecific immunity, while BSFLM40 and BSFLM50 upregulated the relative
expression of these genes. Furthermore, histological analysis showed that the hepatopancreas was deformed in the BSFLM50 group,
with widened lumens and loss of basal membrane integrity. In summary, BSFLM replacing 50% of fish meal reduced growth and
structural damage to the hepatopancreas. An immune response was activated when the replacement level was over 30%. Therefore,
the replacement level of dietary fish meal by BSFLM is recommended to be not more than 30% of the juvenile E. sinensis feed.

1. Introduction wide range of sources, easy accessibility, abundance of nutrients,

and environmental friendliness [4–6]. The use of insect proteins
Fish meal is considered the primary protein source of com- in the aquatic animal feed has been widely reported. A study
mercial aquatic feeds due to its high-protein content, bal- showed that fly (Musca domestica) maggot meal could replace
anced amino acid composition, high quality of lipids, and
100% of fish meal without negatively affecting growth perfor-
unknown growth promoters [1]. The decline in the output of
fish meal and the increased demand for the aquaculture feeds mance and nutrient utilization in African catfish (Clarias gar-
have resulted in its increased concurrent price [2]. Therefore, iepinus) fingerlings [7]. The replacement of fish meal by defatted
developing alternative protein sources for fish meal has been yellow mealworm (Tenebrio molitor) improved the growth and
a hot research topic in the aquaculture [3]. In recent years, immunity of Pacific white shrimp (Litopenaeus vannamei) [8].
insect protein has attracted significant attention due to its These studies demonstrated that insect protein has enormous
2 Aquaculture Nutrition

potential to replace fish meal in the feeds of aquatic animals. and blended thoroughly before oil was added. Deionized
More products of different insect species need to be evaluated water (300 mL/kg diet) was added to the mixture, which was
before expanding the variety of insect proteins. then wet-extruded into 2.5-mm-diameter pellets using a double
The black soldier fly (Hermetia illucens) is a fly (Diptera) helix plodder (F-26, SCUT industrial factory, Guangdong,
of the Stratiomyidae family. It was initially reared to dispose China). The pellets were spread out and dried by blowing air
of the organic wastes. Larvae can convert waste into protein- at room temperature until reaching approximately 10%
rich and fat-rich biomass, making the culture of black soldier moisture and then stored in sealed polyethylene bags at
flies environmentally friendly and inexpensive [9, 10]. Black −20°C. The ingredients and proximate compositions of the
soldier fly larvae meal (BSFLM) has a more similar amino six experimental diets are shown in Table 1.
acid pattern to fish meal than other insect protein resources
and is expected to be an alternative to fish meal [11, 12]. A 2.2. Experimental Crabs and Procedure. A 56-day feeding
56-day feeding trial on Jian carp (Cyprinus carpio var. Jian) trial was conducted at the Zhejiang Institute of Freshwater
showed that the growth, biological parameters, proximate Fisheries (Huzhou, Zhejiang, China). The juvenile E. sinensis
composition, amino acid composition, and serum biochemi- were purchased from a local crab farm in Chongming
cal parameters were not affected by BSFLM replacement [13]. (Shanghai, China). Before the feeding trial, crabs were tem-
However, the lipid content of black soldier fly larvae is highly porarily reared in polyethylene tanks (2,000 L) fed commer-
variable and depends on the type of diet: reported values are cial feed for 1 week to acclimate to indoor culture conditions.
15%–49% [14–16]. The fatty acid composition of the larvae Subsequently, 960 crabs (0.70 Æ 0.01 g, mean weight Æ SEM)
also depends on the fatty acid composition of the diet. To with intact limbs were randomly allocated to 24 white poly-
reduce the feeding cost of black soldier flies, animals, and ethylene tanks of 300-L each (four tanks per treatment and
poultry feces or food waste are commonly used as the diet. 40 crabs for each tank). Each tank was supplied with four
This leads to the unbalanced fatty acid composition of larvae, arched tiles and five corrugated plastic pipes (2.5 cm in diam-
especially small amounts of n-3 PUFAs. A study on turbot eter and 8.0-cm long) as hide-outs to reduce attacks among
(Psetta maxima) discovered that fish growth decreased as the crabs. The freshwater used in this study went through a
percentage of BSFLM in test diets increased [17]. In addition, filtration system (Xinyi Water Treatment Equipment Fac-
BSFLM impaired the hepatopancreatic structure of L. vanna- tory, Huzhou, China) and was completely aerated. The crabs
mei when the replacement reached 60% [18]. These related were fed two times daily (15:00 and 21:00) at a daily ratio of
studies demonstrated that the replacement level of BSFLMs 4% body weight, and food consumption was recorded during
should be cautiously implemented. a 56-day feeding trial. Feed residue and excrement were
Given its high-market demand and nutritional value, the cleaned by siphon, and approximately 50% of the water in
Chinese mitten crab (Eriocheir sinensis) has increasingly become each tank was exchanged once a day. The water temperature
an economically critical freshwater species [19]. In China, the was kept within 25–27°C, pH within 7.6–8.4, ammonia
production of E. sinensis exceeded 770,000 tons in 2020 [20]. nitrogen at <0.05 mg/L, and dissolved oxygen at >7.0 mg/L
With the continuous expansion of the culture scale, the throughout the feeding trial.
demand for feed protein sources has increased. Seeking effi-
cient and economical protein sources have become an urgent 2.3. Sample Collection. At the end of the trial, all crabs were
issue in E. sinensis farming. To our knowledge, the effects of fasted for 24 hr, counted and weighed to calculate the sur-
BSFLM replacement on growth performance and hepatopan- vival rate (SR), weight gain rate (WGR), and specific growth
creas health in E. sinensis have not been reported. Therefore, rate (SGR). Then, four crabs at the intermolt period were
this study evaluated the effects of BSFLM, which partially randomly collected from each tank and kept at −20°C for the
replaced fish meal in the diet, on the growth performance analysis of whole-body proximate composition. The hepato-
pancreases from four crabs were collected and kept at −20°C
and hepatopancreas health of juvenile E. sinensis. The results
for analysis of proximate composition and fatty acid compo-
of this study may contribute to the exploitation and utilization
sition. The hepatopancreas from eight crabs was collected,
of new protein sources and alleviate the shortage of feed pro-
immediately frozen in a nitrogen canister, and finally stored
tein sources in the E. sinensis farming industry.
at −80°C to determine the enzyme activities and RNA isola-
tion. Pretreatment of the hepatopancreas for enzyme activity
2. Materials and Methods detection was the same as described by Lin et al. [21]. WGR,
SGR, and SR were evaluated using the following formulae:
2.1. Feed Ingredients and Diet Formulation. Six isoproteic
(37%) and isolipidic (10%) diets were formulated by replacing
WGR; ð%Þ ¼ ½Final weight − initial weightŠ=Initial weight
0% (FM), 10% (BSFLM10), 20% (BSFLM20), 30% (BSFLM30),
40% (BSFLM40), and 50% (BSFLM50) of fish meal with × 100;
BSFLM. The protein sources were fish meal, soybean, ð1Þ
cottonseed, and BSFLM (crude protein, 42%; crude lipid,
27%) (Leijian Technology Company, Sichuan, China). Fish
SGR; ð%Þ day−1 ¼ ½lnðfinal weightÞ − lnðinitial weightފ
oil, soybean oil, soybean lecithin, and cholesterol were the
main lipid sources. Raw materials were ground and sieved × 100=days;
through a 40-μm mesh. All dry ingredients were ground ð2Þ
Aquaculture Nutrition 3

TABLE 1: Ingredient formulation of the feed formula (g/kg dry basis) and diet proximate composition (% dry matter, n = 3).
Experimental diets
Ingredients
FM BSFLM10 BSFLM20 BSFLM30 BSFLM40 BSFLM50
Fish meal1 350 315 280 245 210 175
Black soldier fly larvae meal2 0 57 113 169 226 282
Soybean meal 130 130 130 130 130 130
Cotton meal 130 130 130 130 130 130
Fish oil 30 24 18 12 6 0
Soybean oil 30 24 18 12 6 0
Lecithin 5 5 5 5 5 5
Cholesterol 5 5 5 5 5 5
α-Starch 170 170 170 170 170 170
Cellulose 54 44 35 26 16 7
Choline chloride 5 5 5 5 5 5
Butylated hydroxytoluene 1 1 1 1 1 1
Vitamin premix3 40 40 40 40 40 40
Mineral premix4 20 20 20 20 20 20
Alginate-Na 30 30 30 30 30 30
Total 1,000 1,000 1,000 1,000 1,000 1,000
Proximate composition (%)
Moisture 9.08 9.60 10.26 9.80 9.92 10.29
Crude protein 38.02 37.76 38.25 37.94 37.52 38.25
Crude lipid 9.54 10.00 9.57 9.56 9.48 9.58
Crude ash 11.19 11.63 11.67 11.51 11.72 11.66
1
The crude protein concent of fish meal is 68.52% (dry matter). 2The crude protein content of black soldier fly larvae meal is 42.61% (dry matter). 3Vitamin mix
(per 100 g premix) retinol acetate, 0.043 g; thiamin hydrochloride, 0.15 g; riboflavin, 0.0625 g; niacin, 0.3 g; Ca pantothenate, 0.3 g; pyridoxine hydrochloride,
0.225 g; ascorbic acid, 0.5 g; para-aminobenzoic acid, 0.1 g; folic acid, 0.025 g; biotin, 0.005 g; cholecalciferol, 0.0075 g; α-tocopherol acetate, 0.5 g; menadione,
0.05 g; inositol, 1 g. All ingredients were filled with α-cellulose to 100 g. 4Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca(H2PO4)2,
26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4·7H2O, 10.0 g; AlCl3·6H2O, 0.024 g; ZnSO4⋅7H2O, 0.476 g; MnSO4⋅6H2O, 0.143 g; KI, 0.023 g; CuCl2⋅·2H2O, 0.015 g;
CoCl2⋅·6H2O, 0.14 g; calcium lactate, 16.50 g; Fe-citrate, 1 g. All ingredients were diluted with α-cellulose to 100 g.

SR; ð%Þ ¼ ðFinal crab number=initial crab numberÞ × 100: determination were extracted from the untreated samples
following the same method as crude lipid extraction. The
ð3Þ
fatty acid methyl esters were obtained from diet lipids and
hepatopancreas lipids by saponification with methanolic
KOH (0.5 mol/L) and derivatization with 14% boron trifluor-
2.4. Diet, Whole-Body, and Hepatopancreas Composition ide-methanol. The fatty acid methyl esters (1.0 μL) were dis-
Analysis. The proximate composition of the diets and the solved in n-hexane (GC residue analysis, CNW, China) and
whole-body and hepatopancreas of the crabs were analyzed analyzed by gas chromatography–mass spectrometry analy-
following the same methods described by Bu et al. [22]. The sis (GCMS-QP2010 SE, Shimadzu Co., Kyoto, Japan) with a
diets and crabs were dried to a constant weight at 105°C to gas chromatographic column (SH-Rt-2560, 0.25 mm ID,
analyze the moisture. Dried samples were ground for subse- 0.20 μm df, 100 m, Shimadzu, USA). The speed of the helium
quent assays. The crude protein content of the diets, whole- carrier gas was 1.7 mL/min. The injector and flame ioniza-
body, and hepatopancreas was measured by the Kjeldahl tion detector temperatures were 250°C and 200°C, respec-
method (8200, Kjeltec, Foss, Sweden). The crude lipids of tively. The program was 120°C for 1 min and 240°C for
the diets, whole-body, and hepatopancreas were extracted 30 min, and the total measurement time was 61 min for
with a chloroform/methanol mixture and a 0.37 mol/L KCl each sample. The identified fatty acids were expressed as
solution following the method of Bligh and Dyer [23] and the area percentage of total fatty acids. The fatty acid profiles
dried in a vacuum drying oven (DZF-6050, Jinghong, Ltd., of diet lipids and hepatopancreas lipids in each group are
Shanghai, China) before gravimetry [24]. The ash content of shown in Tables 3 and 4.
the diets and whole-body was analyzed by carbonizing
completely on a heating plate (TR-30A, SuDa, China) and 2.5. Biochemical Analysis. The hepatopancreas samples were
incinerating in a muffle furnace (PCD-E3000 Serials, Peaks, weighed and homogenized in 10 volumes (v/w) of ice-cooled
Japan) at 550°C for 6 hr. 0.85% saline solution. The homogenate was centrifuged at
The amino acid compositions of the diets (Table 2) were 1,500 rpm (5415 R, Eppendorf, Germany) at 4°C for 30 min,
measured by a commercial laboratory (Willtest, Sichuan, and the upper lipid layer was discarded. The supernatant was
China). Diet lipids and hepatopancreas lipids for fatty acid carefully collected and stored at −80°C until detection. All
4 Aquaculture Nutrition

TABLE 2: Amino acid composition of six experimental diets (% dry matter, n = 2).
Experimental diets
Amino acids
FM BSFLM10 BSFLM20 BSFLM30 BSFLM40 BSFLM50
EAA
Lys 2.53 2.49 2.57 2.54 2.55 2.44
Met 0.84 0.73 0.79 0.75 0.81 0.71
Leu 2.88 2.81 2.88 2.85 2.86 2.81
Ile 1.64 1.62 1.65 1.65 1.65 1.62
Arg 2.80 2.77 2.81 2.75 2.79 2.73
Phe 1.77 1.78 1.79 1.78 1.77 1.75
Thr 1.64 1.60 1.65 1.61 1.62 1.58
Val 1.92 1.99 1.96 1.98 1.94 1.98
His 1.15 1.18 1.18 1.17 1.15 1.16
NEAA
Asp 3.83 3.85 3.87 3.87 3.82 3.81
Ser 1.63 1.66 1.69 1.64 1.60 1.64
Glu 6.26 6.21 6.29 6.22 6.20 6.08
Gly 2.11 2.04 2.10 2.05 2.09 2.01
Ala 2.26 2.28 2.30 2.28 2.26 2.23
Cys 0.45 0.43 0.43 0.45 0.43 0.42
Pro 1.73 1.86 1.82 1.84 1.76 1.89
Tyr 1.09 1.34 1.21 1.26 1.16 1.38
TAA 36.53 36.64 36.99 36.69 36.46 36.24
ΣEAA 14.64 14.48 14.71 14.54 14.59 14.34
ΣNEAA 19.36 19.67 19.71 19.61 19.32 19.46
ΣEAA/ΣNEAA 0.76 0.74 0.75 0.74 0.76 0.74
ΣEAA/ΣTAA 0.40 0.40 0.40 0.40 0.40 0.40
EAA, essential amino acids; NEAA, nonessential amino acids; TAA, total amino acids.

TABLE 3: Fatty acid composition of ingredients and six experimental diets (% total fatty acids, n = 3).
Fatty acid BSFLM Fish meal FM BSFLM10 BSFLM20 BSFLM30 BSFLM40 BSFLM50
C12 : 0 17.39 ND ND 10.34 16.74 24.20 29.51 33.45
C14 : 0 5.12 6.91 8.33 8.08 7.68 7.62 7.38 7.26
C15 : 0 0.17 0.49 0.68 0.39 0.53 0.40 0.28 0.25
C16 : 0 15.89 20.47 26.63 24.23 22.34 20.72 19.41 18.20
C16 : 1 3.74 8.84 7.73 6.66 5.65 4.81 4.20 3.59
C17 : 0 0.29 0.65 0.52 0.48 0.35 0.34 0.24 0.22
C17 : 1 0.40 ND 0.23 0.19 0.10 0.16 0.17 0.15
C18 : 0 4.82 5.87 4.14 3.93 4.06 3.27 3.28 2.89
C18 : 1n-9 24.19 15.11 16.18 15.67 15.39 15.05 14.78 14.89
C18 : 2n-6 24.12 0.45 24.75 21.50 20.02 18.03 16.52 15.63
C20 ND 0.96 0.51 0.45 0.32 0.22 0.06 0.10
C18 : 3n-3 2.07 2.71 2.95 2.57 2.34 2.03 1.81 1.69
C20 : 4n-6 0.54 1.85 0.43 0.30 0.30 0.29 0.25 0.23
C20 : 5n-3 0.52 17.34 5.02 3.80 3.13 2.19 1.64 1.18
C22 : 5n-3 ND 2.35 0.30 0.21 0.15 0.08 0.05 ND
C22 : 6n-3 0.74 16.00 1.63 1.26 1.02 0.67 0.50 0.31
SFA 43.68 35.35 40.81 47.88 52.00 56.75 60.16 62.36
MUFA 28.33 23.95 24.14 22.51 21.13 20.01 19.15 18.62
PUFA 27.99 40.70 35.07 29.63 26.94 23.28 20.76 19.03
HUFA 3.87 40.25 10.32 8.13 6.93 5.26 4.24 3.40
∑n-3FA 3.33 38.40 9.89 7.83 6.63 4.97 3.99 3.17
∑n-6FA 24.66 2.30 25.18 21.80 20.31 18.32 16.77 15.86
∑n-3FA/∑n-6FA 0.52 18.30 5.53 4.24 3.45 2.41 1.70 1.28
SFA, saturated fatty acid; C12 : 0, C14 : 0, C15 : 0, C16 : 0, C17 : 0, C18 : 0; MUFA, monounsaturated fatty acid; C16 : 1, C17 : 1, C18 : 1; PUFA, polyunsaturated
fatty acid; C18 : 2n-6, C18 : 3n-6, C18 : 3n-3; HUFA, highly unsaturated fatty acid; C20 : 3n-6, C20 : 4n-6, C20 : 5n-3, C22 : 6n-3; n-3 FA, n-3 fatty acid: C18 : 3n-3,
C20 : 5n-3, C22 : 5n-3, C22 : 6n-3; n-6 FA, n-6 fatty acid: C18 : 2n-6, C18 : 3n-6, C20 : 4n-6; ND, not detected.
 Aquaculture Nutrition

TABLE 4: Fatty acid composition of the hepatopancreas (% total fatty acids, n = 4) in juvenile E. sinensis fed different diets.
Experimental diets ANOVA Regression analysis
Fat acids FM BSFLM10 BSFLM20 BSFLM30 BSFLM40 BSFLM50 Linear Quadratic
P-value Adj. R2 P-Value Adj. R2 P-Value
C12 : 0 NDg 2.30 Æ 0.00a 4.39 Æ 0.08b 4.67 Æ 0.15b 8.01 Æ 0.35c 9.33 Æ 0.05d <0.001 0.938 <0.001 0.938 <0.001
C14 : 0 4.59 Æ 0.21 5.00 Æ 0.49 5.36 Æ 0.12 5.16 Æ 0.23 5.29 Æ 0.24 4.99 Æ 0.37 0.662 −0.031 0.531 0.055 0.233
C15 : 0 0.58 Æ 0.02b 0.53 Æ 0.03b 0.43 Æ 0.02a 0.44 Æ 0.02a 0.41 Æ 0.04a 0.39 Æ 0.01a <0.001 0.606 <0.001 0.646 <0.001
C16 : 0 30.32 Æ 0.56c 29.02 Æ 1.22bc 27.60 Æ 0.24ab 27.84 Æ 0.64ab 26.63 Æ 0.50a 26.39 Æ 0.80a 0.010 0.515 <0.001 0.516 0.001
C16 : 1 10.65 Æ 0.20 10.95 Æ 0.34 11.22 Æ 0.15 10.84 Æ 0.49 10.27 Æ 0.32 10.33 Æ 0.05 0.374 0.048 0.185 0.123 0.136
C17 : 0 0.54 Æ 0.05b 0.47 Æ 0.06b 0.26 Æ 0.01a 0.30 Æ 0.03a 0.24 Æ 0.01a 0.30 Æ 0.03a <0.001 0.455 <0.001 0.678 <0.001
C17 : 1 0.35 Æ 0.01 0.34 Æ 0.01 0.35 Æ 0.02 0.31 Æ 0.02 0.33 Æ 0.01 0.32 Æ 0.01 0.399 0.085 0.096 0.041 0.253
C18 : 0 3.50 Æ 0.15b 3.00 Æ 0.14a 2.62 Æ 0.08a 2.91 Æ 0.26a 2.76 Æ 0.09a 2.60 Æ 0.20a 0.012 0.299 0.003 0.351 0.004
C18 : 1n-9 26.65 Æ 0.30a 26.70 Æ 0.19a 26.92 Æ 0.27a 29.88 Æ 0.69b 30.13 Æ 1.16b 34.55 Æ 0.06c <0.001 0.752 <0.001 0.860 <0.001
C18 : 2n-6 15.69 Æ 0.40c 15.85 Æ 0.39c 15.04 Æ 0.32bc 14.84 Æ 0.35abc 14.46 Æ 0.15ab 13.84 Æ 0.15a 0.005 0.550 <0.001 0.540 <0.001
C18 : 3n-3 0.57 Æ 0.02c 0.54 Æ 0.05c 0.38 Æ 0.00b 0.36 Æ 0.02b 0.29 Æ 0.01a 0.27 Æ 0.01a <0.001 0.830 <0.001 0.846 <0.001
C20 : 0 1.20 Æ 0.19 1.28 Æ 0.23 1.32 Æ 0.09 1.31 Æ 0.06 1.29 Æ 0.05 1.11 Æ 0.12 0.923 −0.062 0.729 −0.029 0.474
C20 : 4n-6 0.69 Æ 0.06b 0.45 Æ 0.01a 0.38 Æ 0.03a 0.49 Æ 0.10a 0.41 Æ 0.07a 0.42 Æ 0.04a 0.026 0.194 0.023 0.291 0.015
C20 : 5n-3 3.57 Æ 0.05e 2.86 Æ 0.07de 2.37 Æ 0.12d 1.94 Æ 0.21c 1.65 Æ 0.08b 1.34 Æ 0.04a <0.001 0.901 <0.001 0.925 <0.001
C22 : 5n-3 0.16 Æ 0.01b 0.13 Æ 0.01a 0.02 Æ 0.02a NDg NDg NDg 0.001 0.746 0.001 0.833 0.001
C22 : 6n-3 1.55 Æ 0.11d 1.00 Æ 0.07cd 0.86 Æ 0.07bc 0.78 Æ 0.17b 0.56 Æ 0.05b 0.43 Æ 0.05a <0.001 0.732 <0.001 0.766 <0.001
∑SFA 35.74 Æ 0.49a 37.75 Æ 0.26b 39.13 Æ 0.34c 39.58 Æ 0.47c 41.89 Æ 0.56d 42.18 Æ 0.06d <0.001 0.876 <0.001 0.878 <0.001
∑MUFA 33.95 Æ 0.21a 35.48 Æ 0.61ab 35.81 Æ 0.47b 36.03 Æ 0.52b 36.35 Æ 0.79b 38.32 Æ 0.92c 0.004 0.531 <0.001 0.508 <0.001
∑PUFA 16.99 Æ 0.59d 16.36 Æ 0.50cd 15.42 Æ 0.32bc 15.20 Æ 0.46abc 14.73 Æ 0.14ab 14.12 Æ 0.14a 0.001 0.689 <0.001 0.680 <0.001
∑HUFA 5.47 Æ 0.30d 3.91 Æ 0.39c 3.61 Æ 0.23c 3.20 Æ 0.46bc 2.59 Æ 0.19ab 2.19 Æ 0.11a <0.001 0.727 <0.001 0.745 <0.001
∑n-3FA 5.35 Æ 0.33e 4.27 Æ 0.30d 3.62 Æ 0.20cd 3.08 Æ 0.39bc 2.48 Æ 0.13ab 2.05 Æ 0.08a <0.001 0.841 <0.001 0.851 <0.001
∑n-6FA 16.82 Æ 0.48d 16.28 Æ 0.55cd 15.66 Æ 0.33bcd 15.38 Æ 0.39abc 14.85 Æ 0.18ab 14.28 Æ 0.12a 0.003 0.674 <0.001 0.655 <0.001
∑n-3FA/∑n-6FA 0.32 Æ 0.01e 0.27 Æ 0.01de 0.24 Æ 0.01d 0.18 Æ 0.01c 0.16 Æ 0.00b 0.14 Æ 0.00a <0.001 0.931 <0.001 0.940 <0.001
The values are the mean Æ standard error (n = 4). Adj. R2, adjusted R2; Linear, linear trend; Quadratic, quadratic trend. Means in the same line with different superscripts are significantly different (P <0:05).
5
6 Aquaculture Nutrition

TABLE 5: Primer pair sequences and product sizes of the genes used for real-time PCR.
Genes Position Primer sequence Product size (bp) References
Forward TCGTGCGAGACATCAAGGAAA 178
β-Actin Lin et al. [21]
Reverse AGGAAGGAAGGCTGGAAGAGTG —
Forward CCCCCAAGAAGATCAAGCACA 179
S27 Lin et al. [21]
Reverse CAGATGGCAGCGACCACAGTA —
Forward TAAAGGCAAGGGAGGCTTCG 97
LITAF GenBank: KC011816.1
Reverse GAATGGAGCTTGAGGTGGCA —
Forward TCAGGATTCGGTGGCAACTC 105
Relish GenBank: GQ871279.1
Reverse ATCTGCACTTGGACCGATGG —
Forward GGGAACTTCGATGCCTGTCA 101
ILF2 GenBank: GU002546
Reverse ATGACCACGATGTCCGCTAC —
Forward CTCCTTCACCTGCCCTAACTGCT 88
Toll GenBank: KC011816.1
Reverse CTCCAGTTTGTATTGCTGTGCGAAA —
Forward GCCATCGCAGTCGCCAAGTT 148
MyD88 GenBank: KC019316.1
Reverse GGCATCCTGTTCATCCAGTTCTGAC —
Forward TGGGAGGTGCCCAAGAGATA 94
p38MAPK GenBank: KF582665.1
Reverse TGGTGTTTGTTTTGGCGTCC —
S27, ubiquitin/ribosomal S27 fusion protein; LITAF, lipopolysaccharide-induced TNF factor; ILF2, interleukin enhancer binding factor 2; MyD88, myeloid
differentiation factor 88; p38MAPK, p38 mitogen-activated protein kinase.

indicators were measured by the diagnostic reagent kits efficiency was determined using E ¼ 10ð−1=SlopeÞ –1 [25]. The
(Nanjing Jiancheng Bioengineering, Nanjing, China): malon- amplification efficiencies of the target genes ranged from 95%
dialdehyde (MDA, Cat. No. A003–1) content, total antioxi- to 105%. The housekeeping gene β-actin and ubiquitin/ribo-
dant capacity (T-AOC, Cat. No. A015–2-1), total superoxide somal S27 fusion protein (S27) were employed as reference
dismutase (SOD, Cat. No. A001–3), and glutathione peroxi- genes, and the stability of β-actin and S27 expression was
dase (GSH-Px, Cat. No. A005–1). confirmed [26]. In this study, the FM group was used as the
reference, and the expression of each target gene in the other
2.6. Histological Analysis of the Hepatopancreas. Hepatopan- treatment was expressed as the fold change relative to the
creas tissue samples were fixed in 4% paraformaldehyde control group. The relative expression levels of target genes
solution. The samples were dehydrated, washed, and equili- were analyzed by the 2−ΔΔCt algorithm [27].
brated using ethanol, toluene, and xylene. Then, the samples
were embedded in paraffin and cut at a thickness of 5 μm 2.8. Statistical Analysis. Statistical analysis was implemented
using a rotary microtome. The hepatopancreas slices were using SPSS 20.0 software (Chicago, IL, USA). Homogeneity
stained with hematoxylin and eosin (HE) and examined on a of variance was checked before a one-way ANOVA, followed
microscope (BX51, Olympus, Japan). by Duncan’s multiple comparison tests to assess the significant
differences among the means (significance level P <0:05). Data
2.7. Analysis of Gene Expression in the Hepatopancreas. Total are presented as the means and the pooled standard error of
RNA from the hepatopancreas was isolated by using RNAiso the means (SEM).
Plus (Takara, Dalian, China). The purity and concentration
of total RNA were estimated by the spectrophotometry at 3. Results
A260 and 280 nm using a NanoDrop 2000 spectrophotometer
(Thermo, Wilmington, USA). First-strand cDNA was synthe- 3.1. Growth Performance. The effects of different levels of
sized using a FastKing RT Kit (with gDNase; Tiangen, Beijing, dietary BSFLM on SR, WGR, and SGR are given in Table 6.
China) according to the manufacturer’s instructions. The spe- WGR and SGR were linearly and quadratically affected by the
cific primers for genes are given in Table 5. Real-time quanti- different levels of dietary BSFLM (P <0:05). There were no
tative PCR was carried out in a volume of 20 μL, including differences in the SR among all groups (P >0:05). Compared
10 μL of 2xSYBR qPCR Mix, 0.4 μL of 10 μM forward and with FM, BSFLM10, BSFLM20, BSFLM30, and BSFLM40 did
reverse primers, and 2 μL of diluted cDNA and 7.2 μL of not significantly affect WGR and SGR (P >0:05). The WGR
DEPC-water with a SYBR Green RT‒PCR kit (PC3302, and SGR of the crabs fed BSFLM50 were lower than those fed
Aidlab, Beijing, China) using a CFX96 real-time PCR system FM (P <0:05).
(Bio-Rad, Richmond, CA). The PCR steps included 94°C for
3 min, then at 94°C for 10 s, 60°C for 30 s for 40 cycles, and a 3.2. Whole-Body and Hepatopancreas Proximate Composition.
melting curve step from 60 to 95°C at an incremental rate of The whole-body proximate compositions of the crabs fed dif-
0.5°C/s. Five dilutions of the cDNA samples (in triplicate) ferent levels of BSFLM are presented in Table 7. The whole-
were used to build the standard curve. The amplification body and hepatopancreas proximate compositions were not
Aquaculture Nutrition 7

TABLE 6: Growth performance of juvenile E. sinensis fed different diets.

Parameter
Experimental diets
SR (%) WGR (%) SGR (%/d)
FM 77.14 Æ 1.65 270.14 Æ 1.47bc 2.34 Æ 0.01bc
BSFLM10 77.71 Æ 4.00 270.88 Æ 4.32bc 2.34 Æ 0.02bc
BSFLM20 84.00 Æ 3.01 277.19 Æ 1.41c 2.37 Æ 0.01c
BSFLM30 82.29 Æ 1.71 266.95 Æ 2.67b 2.32 Æ 0.01b
BSFLM40 83.71 Æ 2.70 266.11 Æ 2.19ab 2.32 Æ 0.01ab
BSFLM50 84.34 Æ 2.70 259.31 Æ 1.76a 2.28 Æ 0.01a
ANOVA
P value 0.759 0.001 0.001
Regression analysis (n = 4)
L
Adj. R2 0.102 0.220 0.221
P value 0.045 0.002 0.002
Quadratic
Adj. R2 0.089 0.348 0.349
P value 0.102 <0.001 <0.001
The values are the mean Æ standard error (n = 4). Adj. R2, adjusted R2; L, linear trend; Quadratic, quadratic trend. Different letters indicate significant
differences (P <0:05).

TABLE 7: Approximate composition (% original substance) of the whole-body and hepatopancreas in juvenile E. sinensis fed different diets.
Parameter
Experimental diets Whole-body (%) Hepatopancreas (%)
Moisture Crude protein Crude lipid Crude ash Crude protein Crude lipid
FM 66.93 Æ 2.31 13.17 Æ 0.65 4.06 Æ 0.74 0.36 Æ 0.01 10.31 Æ 0.27 27.32 Æ 2.69
BSFLM10 66.17 Æ 1.80 13.37 Æ 0.70 4.18 Æ 0.42 0.37 Æ 0.03 9.91 Æ 0.28 29.27 Æ 3.57
BSFLM20 66.36 Æ 0.79 12.92 Æ 0.20 4.79 Æ 0.08 0.36 Æ 0.01 9.47 Æ 0.52 34.72 Æ 1.38
BSFLM30 66.49 Æ 2.13 13.14 Æ 0.82 4.01 Æ 0.39 0.37 Æ 0.01 9.65 Æ 0.59 29.26 Æ 3.31
BSFLM40 66.65 Æ 0.68 13.05 Æ 0.29 4.03 Æ 0.36 0.36 Æ 0.01 9.38 Æ 0.16 29.26 Æ 1.68
BSFLM50 66.91 Æ 1.35 13.33 Æ 0.63 4.29 Æ 0.25 0.37 Æ 0.02 9.47 Æ 0.58 26.07 Æ 2.79
ANOVA
P value 0.999 0.996 0.743 0.541 0.659 0.322
Regression analysis (n = 4)
L
Adj. R2 −0.045 −0.053 −0.035 0.015 0.070 −0.018
P value 0.906 0.988 0.930 0.278 0.113 0.557
Quadratic
Adj. R2 −0.088 −0.105 −0.073 −0.045 0.058 −0.016
P value 0.932 0.948 0.984 0.546 0.815 0.500
The values are the mean Æ standard error (n = 4). Adj. R2, adjusted R square; L, linear trend; Quadratic, quadratic trend. Different letters indicate significant
differences (P <0:05).

linearly or quadratically affected by the different levels were linearly and quadratically affected by dietary BSFLM
of dietary BSFLM (P >0:05). Replacing fish meal with (P <0:05). The crabs fed BSFLM had higher SFA levels than
BSFLM did not significantly affect the whole-body and those fed FM (P <0:05). The levels of C12 : 0 in the
hepatopancreas proximate composition (P >0:05). hepatopancreas increased with increasing dietary BSFLM,
while the levels of C15 : 0, C16 : 0, C17 : 0, and C18 : 0 in the
3.3. Fatty Acid Composition of the Hepatopancreas. The fatty hepatopancreas were negatively correlated with the increasing
acid composition of the hepatopancreas in the crabs fed dietary BSFLM (P <0:05). The crabs fed BSFLM20, BSFLM30,
different levels of BSFLM is given in Table 4. The current BSFLM40, and BSFLM50 had higher MUFA levels in the
study showed that the levels of saturated fatty acids (SFA), hepatopancreas than those fed FM (P <0:05). The C18 : 1n-9
monounsaturated fatty acids (MUFA), polyunsaturated fatty level was higher in BSFLM50 than in the other groups
acids (PUFA), and highly unsaturated fatty acid (HUFA) (P <0:05), and crabs fed BSFLM30, BSFLM40, and BSFLM50
8 Aquaculture Nutrition

TABLE 8: Antioxidant parameters in the hepatopancreas of juvenile E. sinensis fed different diets.
Parameter
Experimental diets
MDA (nmol/mgprot) SOD (U/mgprot) GSH-Px (U/mgprot) T-AOC (nmol/gprot)
FM 7.32 Æ 1.04b 11.80 Æ 0.54b 252.98 Æ 13.71b 38.09 Æ 1.75b
BSFLM10 5.88 Æ 0.32ab 10.94 Æ 1.05 b
251.67 Æ 16.16b 37.96 Æ 1.31b
BSFLM20 5.85 Æ 1.16ab 9.70 Æ 0.71ab
220.05 Æ 10.63ab 27.95 Æ 6.08ab
BSFLM30 5.51 Æ 0.72ab 7.81 Æ 0.49 a
207.16 Æ 4.82a 27.45 Æ 8.70ab
BSFLM40 5.39 Æ 0.21ab 7.68 Æ 0.17 a
206.10 Æ 7.14a 24.56 Æ 2.02ab
BSFLM50 4.27 Æ 0.18a 7.54 Æ 1.24 a
206.66 Æ 20.65a 21.31 Æ 2.68a
ANOVA
P value 0.063 0.004 0.015 0.091
Regression analysis (n = 4)
L
Adj. R2 0.401 0.624 0.242 0.296
P value 0.001 <0.001 0.001 0.002
Quadratic
Adj. R2 0.369 0.635 0.244 0.269
P value 0.006 <0.001 0.002 0.010
The values are the mean Æ standard error (n = 4). Adj. R2, adjusted R2; L, linear trend; Quadratic, quadratic trend. Different letters indicate significant
differences (P <0:05). MDA, malondialdehyde; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; T-AOC, total antioxidation capability.

had a higher level than those fed FM, BSFLM10 and BSFLM20 higher gene expression of Toll, MyD88, LITAF, Relish, ILF2,
(P <0:05). Compared with the crabs fed FM, those fed BSFLM20, and p38MAPK in the hepatopancreas (P <0:05).
BSFLM30, BSFLM40, and BSFLM50 had lower PUFA levels
in the hepatopancreas (P <0:05). Additionally, the C18 : 2n-6 3.6. Histological Analysis of the Hepatopancreas. The crabs fed
level decreased in the crabs fed BSFLM40 and BSFLM50 FM had normal hepatopancreatic structures with clear lumens,
compared with those fed FM (P <0:05). The levels of HUFAs, columnar hepatopancreas cells, circular cell nuclei at the base,
C20 : 4n-6 and C22 : 5n-3 in crabs fed BSFLM were lower than and a basal membrane with structural integrity (Figure 2(a)).
those in the crabs fed FM (P <0:05). The levels of C18 : 3n-3, As the inclusion of BSFLM increased, deformation of the
C20 : 5n-3, and C22 : 6n-3 in the hepatopancreas were decreased hepatopancreatic structure, widened lumens, and loss of
in the crabs fed BSFLM20, BSFLM30, BSFLM40, and BSFLM50 integrity of the basal membrane were observed (Figure 2(b)–
compared with those fed FM (P <0:05). The value of n-3 fatty 2(e)). The hepatopancreas of the crabs fed BSFLM50 was
acids/n-6 fatty acids was decreased in the crabs fed BSFLM20, severely damaged, and the cell contents were scattered in
BSFLM30, BSFLM40, and BSFLM50 when compared with the cells (Figure 2(f)).
those fed FM (P <0:05).
4. Discussion
3.4. Hepatopancreas Antioxidant Indices. The effects of dif-
ferent levels of dietary BSFLM on the antioxidant indices in In this study, the replacement of fish meal by BSFLM did not
the hepatopancreas are shown in Table 8. The present study affect the amino acid composition of the diet, as presented in
indicated that the MDA content, SOD activity, GSH-Px Table 2. This is consistent with the report that BSFLM has a
activity, and T-AOC activity in the hepatopancreas were similar amino acid pattern to fish meal [15]. In that case, the
linearly and quadratically affected by the different dietary effects on crabs were less likely related to the amino acid
BSFLM levels (P <0:05). Compared with FM, BSFLM30, composition of the protein resource. Compared to fish
BSFLM40, and BSFLM50 decreased the SOD and GSH-Px meal, BSFLM contained almost no n-3 PUFAs. It was rich
activities in the hepatopancreas (P <0:05). The crabs fed in SFAs (C12 : 0 and C16 : 0), MUFAs (C18 : 1n-9), and
BSFLM50 had lower T-AOC activity in the hepatopancreas PUFAs (18 : 2n-6). Moreover, due to the high lipid content
than those fed FM (P <0:05). Additionally, compared (27%, DM) of BSFLM, dietary fish oil was also replaced with
with FM, BSFLM50 decreased the MDA content in the black soldier fly larvae oil. In BSFLM50, the addition of fish
hepatopancreas (P <0:05). oil was down to 0%. Hence, the fatty acid composition of the
diet was significantly changed by the addition of BSFLM, as
3.5. Gene Expression Related to Nonspecific Immunity. The seen in the fatty acid composition data of Table 3. Increasing
expression of genes related to nonspecific immunity (Toll, levels of BSFLM led to a significant increase in dietary SFAs,
MyD88, LITAF, Relish, ILF2, and p38MAPK) in the hepato- such as C12 : 0, and a decrease in n-3 PUFAs, such as C18 :
pancreas is presented in Figure 1. The Toll, MyD88, LITAF, 3n-3, C20 : 5n-3, C22 : 5n-3, and C22 : 6n-3. n-3 PUFAs can
Relish, ILF2, and p38MAPK genes were linearly and quadrat- improve the absorption, digestion, and transport of nutri-
ically affected by dietary BSFLM (P <0:05). Compared to the ents, enhancing the molting and development of swimming
crabs fed FM, the crabs fed BSFLM40 and BSFLM50 had crabs (Portunus trituberculatus) [28], and they are important
Aquaculture Nutrition 9

Regression analysis Regression analysis

ANOVA ANOVA
L Quadratic L Quadratic
P value Adj. R2 P value Adj. R2 P value P value Adj. R2 P value Adj. R2 P value
0.038 0.271 0.001 0.277 0.003 0.014 0.356 0.003 0.366 0.008

2.0 1.5 C BC

Relative mRNA expression of MyD88

Relative mRNA expression of Toll

BC C A AB AB
1.5 A
AB AB 1.0
A AB
1.0

0.5
0.5

0.0 0.0
FM

BSFLM10

BSFLM20

BSFLM30

BSFLM40

BSFLM50

FM

BSFLM10

BSFLM20

BSFLM30

BSFLM40

BSFLM50
ðaÞ ðbÞ

Regression analysis Regression analysis

ANOVA ANOVA
L Quadratic L Quadratic
P value Adj. R2 P value Adj. R2 P value P value Adj. R2 P value Adj. R2 P value
0.001 0.565 < 0.001 0.277 0.003 < 0.001 0.455 < 0.001 0.612 < 0.001
2.5 3 C
Relative mRNA expression of LITAF

Relative mRNA expression of Relish

B B
2.0 AB
A 2
A B
1.5 AB
A A
1.0 A A
1

0.5

0.0 0
FM

BSFLM10

BSFLM20

BSFLM30

BSFLM40

BSFLM50

FM

BSFLM10

BSFLM20

BSFLM30

BSFLM40

BSFLM50

ðcÞ ðdÞ
FIGURE 1: Continued.
10 Aquaculture Nutrition

Regression analysis Regression analysis

ANOVA ANOVA
L Quadratic L Quadratic
P value Adj. R2 P value Adj. R2 P value P value Adj. R2 P value Adj. R2 P value
0.007 0.325 0.002 0.396 0.002 0.017 0.380 < 0.001 0.357 0.001
2.5 2.5

Relative mRNA expression of P38MAPK

Relative mRNA expression of ILF2

B BC
2.0 B 2.0
ABC BC
AB
1.5 A 1.5 AB
A A A
A
1.0 1.0

0.5 0.5

0.0 0.0
FM

BSFLM10

BSFLM20

BSFLM30

BSFLM40

BSFLM50

FM

BSFLM10

BSFLM20

BSFLM30

BSFLM40

BSFLM50
ðeÞ ðfÞ
FIGURE 1: Relative mRNA expression levels of immunity-related genes in the hepatopancreas of juvenile E. sinensis fed different experimental
diets. (a) Toll. (b) MyD88, myeloid differentiation factor 88. (c) LITAF, lipopolysaccharide-induced TNF factor. (d) Relish. (e) ILF2,
interleukin enhancer binding factor 2. (f ) p38MAPK, p38 mitogen-activated protein kinase. Adj. R2, adjusted R square; L, linear trend;
Quadratic, quadratic trend. Different letters show significant differences among treatments (P <0:05).

Bm
Bm

Lu Lu
Bm
Lu
ðaÞ ðbÞ ðcÞ

Bm

Bm Lu

Bm Lu
Lu

ðdÞ ðeÞ ðf Þ
FIGURE 2: Histopathological analysis of the hepatopancreas of juvenile E. sinensis fed different experimental diets. (a) FM, (b) BSFLM10,
(c) BSFLM20, (d) BSFLM30, (e) BSFLM40, and (f ) BSFLM50. Scale = 100 μm. Lu, lumen; Bm, basal membrane.

for supporting growth performance [29, 30]. In this study, that replacing 30% of fish oil with black soldier fly larvae
when the replacement of fish meal was not higher than 40%, oil did not affect growth performance while replacing 60%
there was no impairment in the growth performance of significantly decreased growth performance in juvenile
crabs. However, the growth performance significantly Totoaba macdonaldi [31].
declined when the replacement reached 50%. The dimin- In our study, the value of whole-body and hepatopan-
ished performance in BSFLM50 is more likely due to creas lipid content reached the highest in BSFLM20 and
increased n-3 PUFA deficiencies. A study demonstrated decreased afterward. This may be the result of a combination
Aquaculture Nutrition 11

of factors. Saturated fatty acids are not easily utilized and transcription factor, NF-κB can trigger the release of proin-
tend to accumulate in the hepatopancreas [32]. On the other flammatory cytokines to induce inflammation [42]. Relish is
hand, chitin and its derivatives can bind with triacylglycerol the homolog of NF-κB in E. sinensis and has the same func-
and cholesterol and play a critical role in decreasing fatty tion as NF-κB [43]. Moreover, the activation of p38MAPK
acid synthesis and increasing the hydrolysis of lipoproteins can also release proinflammatory cytokines [44]. Thus, die-
and triglycerides in the liver [33]. A high dose of chitin and tary BSFLM might promote the expression of Relish and
its derivatives can also reduce lipid absorption [34]. As the p38MAPK to release proinflammatory cytokines in the hepa-
dietary chitin content increased, lipid absorption and syn- topancreas. LITAF is a critical transcription factor that binds
thesis were inhibited. These findings might explain the vari- to promoter regions and promotes the expression of proin-
ation in lipid content in the whole-body and hepatopancreas. flammatory cytokines such as TNF-α and IL-2 [45, 46]. TNF-α
Overall, the absorption and utilization of BSFLM by juvenile is an important mediator of chronic inflammation as a pleio-
E. sinensis warrants further study. tropic cytokine [47]. Research has found that soybean antigen
Crustaceans have a set of antioxidant enzymes, such as induces the expression of LITAF to impair the health of Chi-
GSH-Px and SOD, to offset ROS toxicity [35]. MDA is the nese mitten crab [48]. In the present study, crabs fed high
product of lipid peroxidation and directly reflects the level of levels of BSFLM also had higher expression of LITAF and
lipid peroxidation [36]. The MDA content in the hepatopan- ILF2, indicating that BSFLM might promote the expression
creas decreased significantly compared with that of crabs fed of proinflammatory cytokines. In addition, n-3 PUFAs are
FM when the replacement level reached 50%. PUFAs are considered important components of the cell membrane,
allylic or bis-allylic, which makes them readily susceptible and they can effectively maintain cell membrane homeostasis
to autoxidation [37]. Therefore, PUFAs in the diet are easily and perform anti-inflammatory functions [49]. The n-6
oxidized and produce reactive oxygen species (ROS). A study PUFAs give rise to the eicosanoid family of mediators (pros-
on rats demonstrated a significant increase in lipid peroxi- taglandins, thromboxanes, leukotrienes, and related metabo-
dation products when fed a fish oil-containing diet for lites). These have inflammatory actions in their own right and
4 weeks [38]. Our results showed that the relative content regulate the production of other mediators, including proin-
of PUFAs in the hepatopancreas lipid dramatically decreased flammatory cytokines. A high ratio of dietary n-3/n-6 PUFAs
as dietary BSFLM increased. The lower PUFA content in the could improve the inflammation [50]. The decrease in n-3
hepatopancreas would decrease the risk of lipid peroxidation. PUFAs and a low ratio of n-3/n-6 PUFAs in diets might
The results showed that the activities of antioxidant enzymes aggravate the activation of the inflammatory response in
(SOD and GSH-Px) in the hepatopancreas decreased as the the hepatopancreas. The hepatopancreatic histopathological
dietary BSFLM level reached 30%, and the activity of T-AOC structural change is an indispensable indicator of the health
in the hepatopancreas was significantly lower than that in the status of invertebrates [51, 52]. In our study, pathological
hepatopancreas of crabs fed FM when replacement reached injury was distinctly observed in the hepatopancreas when
50%. This might be because replacing fish meal with BSFLM the replacement of fish meal with BSFLM reached 50%.
decreased dietary PUFA levels and consequently decreased This was similar to the observations in L. vannamei [18]
ROS production. The activities of antioxidant enzymes were and Jian carp [53]. The variation in n-3 PUFAs may partly
not activated. In contrast, a study in European seabass explain the observation among all groups [53]. Additionally,
(Dicentrarchus labrax) demonstrated a significant elevation in excessive amounts of proinflammtatory cytokines result in
SOD activities and MDA content in serum when the replace- hepatopancreas injury. Overall, high substitution of fish
ment was over 25% [39]. Another study reported no significant meal by BSFLM should be avoided in E. sinensis in case of
difference in MDA levels and the activities of SOD and GSH-Px damage to the hepatopancreas.
in hepatic and renal tissues of rainbow trout (Oncorhynchus The replacement of 40% fish meal with BSFLM did not
mykiss) when dietary fish meal was partly replaced by BSFLM significantly impact the growth performance of crabs. How-
[40]. The difference in antioxidant responses of aquatic animals ever, it was observed that antioxidant enzyme activities and
toward the dietary inclusion of BSFLM may be attributed to immunity were significantly affected when the replacement
several factors, such as different species, different feeding periods, level reached 40% or even 30%. This could be attributed to
inclusion doses of BSFLM, the experimental setup, or the feeding the rapid change in biochemical indexes compared to growth
regimes. Thus, further research needs to be performed to better performance. It is important to note that sometimes growth
understand the potential antioxidant mechanisms of BSFLM in may not be significantly affected, but the health status can
the aquatic animals. already be at risk [53, 54]. Therefore, besides focusing on the
Chitin in BSFLM is a potent stimulator of innate immune growth, attention should also be given to maintain the health
responses. This activation is mediated mainly via the toll-like of juvenile E. sinensis by considering fish meal replacement
receptor-2–nuclear factor-κB (TLR-2-NF-κB) pathway [41]. with BSFLM.
In this study, we measured the expression of innate immune-
related genes in the hepatopancreas, and the results showed 5. Conclusions
that the expression of Toll and MyD88 was upregulated in
BSFLM40 and BSFLM50, demonstrating that dietary BSFLM This study demonstrates that a 40% replacement level of
could activate nonspecific immunity in crabs by activating dietary fish meal by BSFLM did not impact the growth per-
the Toll pathway in the hepatopancreas. As an essential formance of juvenile E. sinensis. However, BSFLM activated
12 Aquaculture Nutrition

the immune responses when the replacement level reached 40%. aquaculture and insects,” Advances in Food and Nutrition
Moreover, 50% replacement resulted in structural impairment Research, vol. 89, pp. 259–295, 2019.
to the hepatopancreas. Based on the growth performance and [7] A. O. Aniebo, E. S. Erondu, and O. J. Owen, “Replacement of
hepatopancreas health, it is recommended that the replace- fish meal with maggot meal in African catfish (Clarias
ment of fish meal by BSFLM be not more than 30% in the gariepinus) diets,” Revista Cientifica UDO Agricola, vol. 9,
no. 3, pp. 666–671, 2009.
juvenile E. sinensis diet.
[8] C. Motte, A. Rios, T. Lefebvre, H. Do, M. Henry, and
O. Jintasataporn, “Replacing fish meal with defatted insect
Data Availability meal (yellow mealworm Tenebrio molitor) improves the
growth and immunity of pacific white shrimp (Litopenaeus
All data are available upon request by contact with the cor-
vannamei),” Animals, vol. 9, no. 5, Article ID 258, 2019.
responding author. [9] S. Diener, C. Zurbrügg, F. R. Gutiérrez et al., “Black soldier fly
larvae for organic waste treatment-prospects and constraints,”
Conflicts of Interest Proceedings of the WasteSafe, vol. 2, pp. 13–15, 2011.
[10] A. V. Huis, J. V. Itterbeeck, H. Klunder et al., “Edible insects:
The authors declare that they have no known competing future prospects for food and feed security: food and agriculture
financial interests or personal relationships that could have organization of the United Nations,” 2013.
appeared to influence the work reported in this paper. [11] S. St-Hilaire, K. Cranfill, M. A. McGuire et al., “Fish offal
recycling by the black soldier fly produces a foodstuff high in
Authors’ Contributions omega-3 fatty acids,” Journal of the World Aquaculture Society,
vol. 38, no. 2, pp. 309–313, 2007.
Xiaodan Wang and Liqiao Chen conceived the project. Han [12] W. M. Sealey, T. G. Gaylord, F. T. Barrows et al., “Sensory
Wang, Xiaodan Wang, and Liqiao Chen designed the experi- analysis of rainbow trout, Oncorhynchus mykiss, fed enriched
ments. Han Wang, Qincheng Huang, Jiadai Liu, and Yixin black soldier fly prepupae Hermetia illucens,” Journal of the
Miao performed the experiments. Chuanjie Qin provided the World Aquaculture Society, vol. 42, no. 1, pp. 34–45, 2011.
experimental materials. Han Wang wrote the manuscript [13] J. Zhou, S. Liu, H. Ji, and H. Yu, “Effect of replacing dietary fish
draft. Xiaodan Wang, Erchao Li, Jianguang Qin, and Liqiao meal with black soldier fly larvae meal on growth and fatty
Chen revised this manuscript. acid composition of Jian carp (Cyprinus carpio var. Jian),”
Aquaculture Nutrition, vol. 24, no. 1, pp. 424–433, 2018.
[14] G. P. A. Gutiérrez, R. A. V. Ruiz, and M. V. Humberto,
Acknowledgments “Compositional, microbiological and protein digestibility
This work was supported by grants from the Research and analysis of larval meal of Hermetia illucens (Diptera :
Stratiomyidae),” Revista Facultad Nacional de Agronomía
Development Project in Key Areas of Guangdong Province
Medellín, vol. 57, no. 2, pp. 2491–2500, 2004.
(2020B0202010001), the China Agriculture Research System [15] G. Newton, C. Booram, R. Barker, and O. Hale, “Dried larvae
of MOF and MARA (CARS-48), the National Natural Science meal as a supplement for swine,” Journal of Animal Science,
Foundation of China (32072986), the Agriculture Research vol. 44, no. 3, pp. 395–400, 1977.
System of Shanghai, China (202304), and the opening fund [16] T. Barry, Evaluation of the Economic, Social, and Biological
of Key Laboratory of Sichuan Province for Fishes Conserva- Feasibility of Bioconverting Food Wastes with the Black Soldier
tion and Utilization in the Upper Reaches of the Yangtze Fly (Hermetia illucens), University of North Texas, 2004.
River (NJTCCJSYSYS01). [17] S. Kroeckel, A. G. E. Harjes, I. Roth et al., “When a turbot
catches a fly: evaluation of a pre-pupae meal of the black
References soldier fly (Hermetia illucens) as fish meal substitute—growth
performance and chitin degradation in juvenile turbot (Psetta
[1] M. Henry, L. Gasco, G. Piccolo, and E. Fountoulaki, “Review maxima),” Aquaculture, vol. 364-365, pp. 345–352, 2012.
on the use of insects in the diet of farmed fish: past and future,” [18] G. Wang, K. Peng, J. Hu, W. Mo, Z. Wei, and Y. Huang,
Animal Feed Science and Technology, vol. 203, pp. 1–22, 2015. “Evaluation of defatted Hermetia illucens larvae meal for
[2] S. S. D. Silva and M. R. Hasan, “Feeds and fertilizers: the key Litopenaeus vannamei: effects on growth performance, nutrition
to long-term sustainability of Asian aquaculture,” FAO retention, antioxidant and immune response, digestive enzyme
Fisheries Technical Paper, vol. 497, Article ID 19, 2007. activity and hepatic morphology,” Aquaculture Nutrition,
[3] L. Gasco, F. Gai, G. Maricchiolo et al., “Fishmeal alternative vol. 27, no. 4, pp. 986–997, 2021.
protein sources for aquaculture feeds,” in Feeds for the [19] L. Sui, M. Wille, Y. Cheng, X. Wu, and P. Sorgeloos,
Aquaculture Sector, pp. 1–28, Springer, 2018. “Larviculture techniques of Chinese mitten crab Eriocheir
[4] H. P. S. Makkar, G. Tran, V. Heuzé, and P. Ankers, “State-of- sinensis,” Aquaculture, vol. 315, no. 1-2, pp. 16–19, 2011.
the-art on use of insects as animal feed,” Animal Feed Science [20] Q. Huang, X. Wang, J. Liu et al., “Effect of vitamin A
and Technology, vol. 197, pp. 1–33, 2014. supplementation on growth performance, lipid deposition,
[5] A. Collavo, R. H. Glew, Y.-S. Huang, L.-T. Chuang, R. Bosse, antioxidant ability, and immunity in juvenile Chinese mitten
and M. G. Paoletti, “House cricket small-scale farming, crab Eriocheir sinensis fed diet with fish oil totally replaced by
ecological implications of minilivestock: potential of insects, palm oil,” Aquaculture Nutrition, vol. 2022, Article ID
rodents,” Frogs and Snails, vol. 27, pp. 515–540, 2005. 3746245, 19 pages, 2022.
[6] B. Gómez, P. E. Munekata, Z. Zhu et al., “Challenges and [21] Z. Lin, F. Han, J. Lu et al., “Influence of dietary phospholipid on
opportunities regarding the use of alternative protein sources: growth performance, body composition, antioxidant capacity
Aquaculture Nutrition 13

and lipid metabolism of Chinese mitten crab Eriocheir sinensis,” Cardiovascular Diseases: NMCD, vol. 15, no. 4, pp. 316–328,
Aquaculture, vol. 516, Article ID 734653, 2020. 2005.
[22] X. Bu, J. Zhu, S. Liu et al., “Growth, osmotic response and [37] H. W. Gardner, “Oxygen radical chemistry of polyunsaturated
transcriptome response of the euryhaline teleost, Oreochromis fatty acids,” Free Radical Biology and Medicine, vol. 7, no. 1,
mossambicus fed different myo-inositol levels under long-term pp. 65–86, 1989.
salinity stress,” Aquaculture, vol. 534, Article ID 736294, 2021. [38] M. D’Aquino, P. C. Benedetti, M. Di Felice et al., “Effect of fish
[23] E. G. Bligh and W. J. Dyer, “A rapid method of total lipid oil and coconut oil on antioxidant defence system and lipid
extraction and purification,” Canadian Journal of Biochemistry peroxidation in rat liver,” Free Radical Research Communica-
and Physiology, vol. 37, no. 8, pp. 911–917, 1959. tions, vol. 12, no. 1, pp. 147–152, 1991.
[24] J. Folch, M. Lees, and G. H. S. Stanley, “A simple method for [39] H. M. R. Abdel-Latif, M. Abdel-Tawwab, R. H. Khalil et al.,
the isolation and purification of total lipids from animal “Black soldier fly (Hermetia illucens) larvae meal in diets of
tissues,” The Journal of Biological Chemistry, vol. 226, no. 1, European seabass: effects on antioxidative capacity, non-
pp. 497–509, 1957. specific immunity, transcriptomic responses, and resistance to
[25] N. Jothikumar, T. L. Cromeans, B. H. Robertson, X. J. Meng, the challenge with Vibrio alginolyticus,” Fish & Shellfish
and V. R. Hill, “A broadly reactive one-step real-time RT–PCR Immunology, vol. 111, pp. 111–118, 2021.
assay for rapid and sensitive detection of hepatitis E virus,” [40] A. C. Elia, M. T. Capucchio, B. Caldaroni et al., “Influence of
Journal of Virological Methods, vol. 131, no. 1, pp. 65–71, Hermetia illucens meal dietary inclusion on the histological traits,
2006. gut mucin composition and the oxidative stress biomarkers in
[26] M. W. Pfaffl, A. Tichopad, C. Prgomet, and T. P. Neuvians, rainbow trout (Oncorhynchus mykiss),” Aquaculture, vol. 496,
“Determination of stable housekeeping genes, differentially pp. 50–57, 2018.
regulated target genes and sample integrity: bestkeeper-excel- [41] C. G. Lee, C. A. Da Silva, C. S. Dela Cruz et al., “Role of chitin
based tool using pair-wise correlations,” Biotechnology Letters, and chitinase/chitinase-like proteins in inflammation, tissue
vol. 26, no. 6, pp. 509–515, 2004. remodeling, and injury,” Annual Review of Physiology, vol. 73,
[27] K. J. Livak and T. D. Schmittgen, “Analysis of relative gene no. 1, pp. 479–501, 2011.
expression data using real-time quantitative PCR and the [42] M. S. Hayden and S. Ghosh, “NF-κB in immunobiology,” Cell
2−ΔΔCT method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. Research, vol. 21, no. 2, pp. 223–244, 2011.
[28] F. Fang, Y. Yuan, M. Jin, B. Shi, and Q. Zhou, “Hepatopancreas [43] J. Bollrath and F. R. Greten, “IKK/NF-κB and STAT3
transcriptome analysis reveals the molecular responses to pathways: central signalling hubs in inflammation-mediated
different dietary n-3 PUFA lipid sources in the swimming crab tumour promotion and metastasis,” EMBO Reports, vol. 10,
Portunus trituberculatus,” Aquaculture, vol. 543, no. 3, no. 12, pp. 1314–1319, 2009.
Article ID 737016, 2021. [44] J. Sun and G. Nan, “The mitogen-activated protein kinase (MAPK)
[29] B. Glencross, W. Hawkins, and J. Curnow, “Restoration of the signaling pathway as a discovery target in stroke,” Journal of
fatty acid composition of red seabream (Pagrus auratus) using Molecular Neuroscience, vol. 59, no. 1, pp. 90–98, 2016.
a fish oil finishing diet after grow-out on plant oil based diets,” [45] J. C. Merrill, J. You, C. Constable, S. E. Leeman, and S. Amar,
Aquaculture Nutrition, vol. 9, no. 6, pp. 409–418, 2003. “Whole-body deletion of LPS-induced TNF-α factor (LITAF)
[30] C. Han, Q. Zheng, and L. Feng, “Effects of total replacement of markedly improves experimental endotoxic shock and
dietary fish oil on growth performance and fatty acid compositions inflammatory arthritis,” Proceedings of the National Academy
of hybrid tilapia (Oreochromis niloticus × O. aureus),” Aquaculture of Sciences of the United States of America, vol. 108, no. 52,
International, vol. 21, pp. 1209–1217, 2013. pp. 21247–21252, 2011.
[31] C. A. Maldonado-Othon, R. V. Enrique, M. L. Perez-Velazquez, [46] J. Yang, L. Wang, M. Huang et al., “An interleukin-2 enhancer
and M. Gonzalez-Felix, “Replacement of fish oil by camelina and binding factor 2 homolog involved in immune response from
black soldier fly larvae oils in diets for juvenile Totoaba Chinese mitten crab Eriocheir sinensis,” Fish & Shellfish
macdonaldi and their effect on growth, fatty acid profile, and Immunology, vol. 30, no. 6, pp. 1303–1309, 2011.
gene expression of pancreatic lipases,” Aquaculture, vol. 552, [47] I. Mohammadi, A. H. Mahdavi, F. Rabiee, M. H. N. Esfahani,
2022. and K. Ghaedi, “Positive effects of conjugated linoleic acid
[32] V. H. Marques, R. G. Moreira, G. S. Branco et al., “Different (CLA) on the PGC1-α expression under the inflammatory
saturated and monounsaturated fatty acids levels in fish oil- conditions induced by TNF-α in the C2C12 cell line,” Gene,
free diets to cobia (Rachycentron canadum) juveniles: effects in vol. 735, Article ID 144394, 2020.
growth performance and lipid metabolism,” Aquaculture, [48] F. Han, X. Wang, J. Guo et al., “Effects of glycinin and
vol. 541, Article ID 736843, 2021. β-conglycinin on growth performance and intestinal health in
[33] J. Zhang, J. Liu, L. Li, and W. Xia, “Dietary chitosan improves juvenile Chinese mitten crabs (Eriocheir sinensis),” Fish &
hypercholesterolemia in rats fed high-fat diets,” Nutrition Shellfish Immunology, vol. 84, pp. 269–279, 2019.
Research, vol. 28, no. 6, pp. 383–390, 2008. [49] X. Rong, C. J. Albert, C. Hong et al., “LXRs regulate ER stress
[34] S. Koide, “Chitin-chitosan: properties, benefits and risks,” and inflammation through dynamic modulation of membrane
Nutrition Research, vol. 18, no. 6, pp. 1091–1101, 1998. phospholipid composition,” Cell Metabolism, vol. 18, no. 5,
[35] P. Sun, M. Jin, L. Jiao et al., “Effects of dietary lipid level on pp. 685–697, 2013.
growth, fatty acid profiles, antioxidant capacity and expression [50] H. Liu, Y. Qiu, Y. Mu et al., “A high ratio of dietary n-3/n-6
of genes involved in lipid metabolism in juvenile swimming polyunsaturated fatty acids improves obesity-linked inflam-
crab, Portunus trituberculatus,” British Journal of Nutrition, mation and insulin resistance through suppressing activation
vol. 123, no. 2, pp. 149–160, 2020. of TLR4 in SD rats,” Nutrition Research, vol. 33, no. 10,
[36] D. D. Rio, A. J. Stewart, and N. Pellegrini, “A review of recent pp. 849–858, 2013.
studies on malondialdehyde as toxic molecule and biological [51] P. S. Bhavan and P. Geraldine, “Histopathology of the
marker of oxidative stress,” Nutrition, Metabolism, and hepatopancreas and gills of the prawn Macrobrachium
14 Aquaculture Nutrition

malcolmsonii exposed to endosulfan,” Aquatic Toxicology,

vol. 50, no. 4, pp. 331–339, 2000.
[52] P. A. Collins, “Environmental stress upon hepatopancreatic
cells of freshwater prawns (Decapoda: Caridea) from the
floodplain of Paraná river,” Natural Science, vol. 2, no. 7,
2010.
[53] S. Li, H. Ji, B. Zhang, J. Zhou, and H. Yu, “Defatted black
soldier fly (Hermetia illucens) larvae meal in diets for juvenile
Jian carp (Cyprinus carpio var. Jian): growth performance,
antioxidant enzyme activities, digestive enzyme activities,
intestine and hepatopancreas histological structure,” Aquacul-
ture, vol. 477, pp. 62–70, 2017.
[54] G. Wang, K. Peng, J. Hu et al., “Evaluation of defatted black
soldier fly (Hermetia illucens L.) larvae meal as an alternative
protein ingredient for juvenile Japanese seabass (Lateolabrax
japonicus) diets,” Aquaculture, vol. 507, pp. 144–154, 2019.