BioGecko Vol 12 Issue 03 2023

ISSN NO: 2230-5807

Enhancing Cisplatin Sensitivity In Skov-3 Through The Antiproliferative Effects
Of Thymoquinone
Shivani S. Tendulkar1, Aishwarya Hattiholi2, Mehul A. Shah3, Suneel Dodamani4*
1, 4
*Dr. Prabhakar Kore Basic Science Research Centre, KLE Academy of Higher Education and Research,
Belagavi, India, PhD Scholar, M.Sc - ORCID ID: https://orcid.org/0000-0002-3936-68731,
https://orcid.org/0000-0002-7463-80372
2
Maratha Mandal’s Central Research Laboratory NGH, Bauxite Road, Belagavi, India,
ORCID ID: https://orcid.org/0000-0003-0533-0350
3
Department of Public Health Dentistry, KLE VK Institute of Dental Sciences, KLE Academy of Higher
Education and Research, Belagavi, India, ORCID ID: https://orcid.org/0000-0003-3291-8716

*Corresponding Author: - Dr. Suneel Dodamani

Basic Science Research Centre, KLE Academy of Higher Education and Research, Belagavi 590010, India.
Contact number: +919901943638, E-mail ID: [email protected]

ABSTRACT

Background: The challenges posed by ovarian cancer (OvCa) malignancy are compounded by the
unfavourable prognosis linked to resistance against platinum-based drugs. The use of phytochemicals has
emerged as an innovative strategy for treating OvCa. Thymoquinone (TQ), recognized for its ability to
inhibit cell proliferation, has shown promising potential in targeting multiple pathways that can potentially
trigger apoptosis. This study seeks to enhance the effectiveness of TQ in overcoming drug resistance induced
by Cisplatin (CDDP) in SKOV-3 cells.

Methods: The cells were subjected to a time-dependent treatment with progressively higher doses of TQ.
After obtaining the IC50 value, the gene expression for PI3KCA/B, RAD51 and BRCA1/2 was analyzed by
reverse transcription polymerase chain reaction (RT-PCR).

Results:The study evaluated the effectiveness of TQ in overcoming CDDP-induced drug resistance in

SKOV-3 cell lines. The minimum inhibitory concentration for CDDP in SKOV-3 cells was found to be 3 μM,
while for TQ, it was 14 μM. In the case of CDDP-resistant SKOV-3 cells, the minimum inhibitory
concentration was 6 μM for CDDP and 14 μM for TQ. The results revealed that TQ treatment reduces the
expression of PIK3CA/B, RAD51 and BRCA1/2 in the cell lines.

Conclusion: TQ exhibits an enhanced apoptotic effect in SKOV-3 cells and demonstrates efficacy against
CDDP-resistant cells. These findings highlight the significant potential of TQ in the treatment of recurrent
OvCa cases that have developed resistance to CDDP.

INTRODUCTION

One of the primary causes of mortality worldwide is cancer, estimating 18.1 million deaths and 9.6 million
new cases. OvCa is the second most common and lethal gynaecological malignancy, often diagnosed at
progressive stages. Signs and symptoms generally occur at advanced stages such as III and IV (Bray, Ferlay,
and Soerjomataram 2018). There are different types of reported OvCa, with epithelial OvCa being the most
prevalent one with a poor prognosis (Stewart, Ralyea, and Lockwood 2019). The symptoms and signs of
OvCa are indistinct, unclear, and vague. The risk factors include age, menstrual period, hormonal and
infertility treatment, family history, genetic mutations, obesity, and socioeconomic status (Momenimovahed
et al. 2019). After a sequence of platinum-based treatment or radiation, the majority of women experience a
relapse of tumour or resistance to the drug and hence it is essential to develop innovative therapeutic
approaches (Kumar, Kushwaha, and Gupta 2019).

A Journal for New Zealand Herpetology 4019

BioGecko Vol 12 Issue 03 2023
ISSN NO: 2230-5807
Histopathological and clinical features determine the stages of ovarian cancer (OvCa) and are associated
with mutations and gene expression patterns that contribute to its malignant transformation. Genes like
PI3KCA/B, RAD51, and BRCA1/2 play a role in malignancy across various cancer types. Mutation in
BRCA1/2 tumour suppressor genes can lead to resistance to cisplatin (CDDP) in OvCa cells. Overexpression
of RAD51, involved in DNA repair, contributes to acquired drug resistance in malignancies. RAD51 levels
affect responsiveness to CDDP, carboplatin, paclitaxel, docetaxel, and PARP inhibitors. BRCA1/2 and
RAD51 mutations in OvCa disrupt genomic stability. The PI3K/AKT/PTEN/mTOR pathway is pivotal in
OvCa, promoting cell proliferation, tumorigenesis, and drug resistance(Feng et al. 2021; Ghoneum and Said
2019a).

Phytochemicals, plant-based compounds, have shown anti-carcinogenic effects in various cancers, including
OvCa, cervical, and endometrial cancer. They inhibit early-stage carcinogenesis and have chemo-preventive
properties(Woźniak et al. 2021). TQ, abundantly present in black cumin seeds, exhibits various beneficial
properties such as anti-cancer, anti-oxidant, anti-inflammatory, anti-microbial, anti-histaminic, and analgesic
effects. It exerts its anti-cancer effects by reducing anti-apoptotic genes and increasing the production of
reactive oxygen species (ROS), leading to apoptosis induction. TQ also inhibits cell migration and metastasis
by targeting multiple phosphorylated pathways, increasing the expression of tumor suppressor genes, and
preventing DNA methylation. When combined with CDDP, TQ enhances the inhibition of SKOV-3 cell
proliferation by up-regulating Bax and down-regulating Bcl-2(Liu et al. 2017). TQ possesses diverse
pharmacological properties that make it a promising intervention for cancer treatment. It directly targets
phosphorylated pathways and interferes with up-regulated pathways involved in cell survival, such as PI3K,
mTOR, PTEN, and AKT. TQ has demonstrated effectiveness in combination therapy with chemotherapeutic
agents, counteracting proliferation, angiogenesis, migration, and metastasis. As a novel drug for OvCa, TQ
offers improved safety and efficacy by providing cryoprotection in healthy cells(Mostofa et al. 2017).

MATERIALS AND METHODS

Chemicals and reagents

Cisplatin and Thymoquinone (Sigma Aldrich), Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, Cat.
No.-11965092), Antibiotic –Antimycotic (100X) solution (Thermofisher Scientific, Cat. No.-15240062), and
Fetal bovine serum (FBS) (Gibco, Cat No.-10270106), MTT (3-(4,5-dimethylthiazol- 2-yl)-2,5-
diphenyltetrazolium bromide (Sigma Aldrich). Dimethyl sulfoxide (DMSO) and paraformaldehyde were
procured from Qualigens, India.

Methodology

Cell culture

The human ovarian cell line SKOV-3 was acquired from NCCS, Pune, India. SKOV-3 cells were cultured in
Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1%
antibiotic-antimycotic solution. The cells were maintained in a CO2 incubator at 37°C (New Brunswick
Galaxy 170R, Eppendorf India Private Ltd., India).

Cell viability assay

The cells were grown in the culture medium until they reached 80% confluency for cell viability. After
washing the cells with phosphate-buffered saline (PBS), they were detached using trypsin-EDTA and
counted using a hemocytometer. Next, 1X102 cells were seeded in a 96-well plate and allowed to incubate
for 24 hours. Subsequently, the cells were treated with varying concentrations of CDDP and TQ for 24 and
48 hours. After the incubation period, the cells were suspended in 100μl of MTT solution and incubated at
37°C for 3 hours. The formazan crystals formed were dissolved in 100μl of dimethyl sulfoxide (DMSO). The
optical density (OD) of the solution was measured at 490nm using a Lisa plus Microtitre Reader. Untreated
cells were used as a control group. The cell viability percentage for each group was calculated by comparing
A Journal for New Zealand Herpetology 4020
BioGecko Vol 12 Issue 03 2023
ISSN NO: 2230-5807
it with the control group. The inhibitory concentration (IC50), which represents the concentration at which
50% of cell death occurred, was determined for each drug. Statistical analysis was performed using
GraphPad Prism 5.1 software. We also developed CDDP resistant cell line and used it for MTT and RT-PCR
(referredto as R_SKOV_3)

Formula:

Surviving cells (%) = Mean OD of sample /Mean OD of Negative control ×100

RNA extraction

The cells were seeded in a 6-well plate at a density of 1X106 cells and incubated at 37°C with 5% CO2. After
24 hours, the cells were treated with different concentrations of TQ. Following the treatment, the cells were
collected by trypsinization and resuspended in 200-300μl of TRIzol reagent (Invitrogen). The cell suspension
was incubated for 5 minutes at room temperature for complete dissociation and then transferred to 1.5 ml
Eppendorf tubes. The tubes were centrifuged at 12,000 rpm, and the upper layer was carefully collected
using an Eppendorf centrifuge 5810 R. The collected RNA pellet was subjected to quantification using a
Biophotometer (Eppendorf BioPhotometer plus)(Rio et al. 2010).

Real‐time PCR (RT-PCR)

The cells were plated in a 6-well plate at a density of 1X106 cells and maintained in a 37°C incubator with
5% CO2. After 24 hours, the cells were treated with varying concentrations of TQ. Following the treatment,
the cells were harvested by trypsinization and suspended in 200-300μl of TRIzol reagent (Invitrogen). The
cell suspension was incubated at room temperature for 5 minutes to ensure complete dissociation and then
transferred to 1.5 ml Eppendorf tubes. The tubes were centrifuged at 12,000 rpm using an Eppendorf
centrifuge 5810 R, and the supernatant was carefully collected. The collected RNA pellet was quantified
using a Biophotometer (Eppendorf BioPhotometer plus)(Kugaji et al. 2019a).

No. Primer Sequence 5’ to 3’ Length

name
1. PI3KCA-F GGTTGTCTGTCAATCGGTGACTGT 24
PI3KCA-R GAACTGCAGTGCACCTTTCAAGC 23

2. PI3KCB-F TTGTCTGTCACACTTCTGTAGTT 23
PI3KCB-R AACAGTTCCCATTGGATTCAACA 23

3. RAD51-F TCTCTTCCCATTGCACACCTT 21
RAD51-R ACCTGGAAGCTTTCCTAACTAGAG 24

4. BRCA1-F TGAATGACTGCCTTGGGTCC 20
BRCA1-R AGGTGATTTCAATTCCTGTGCT 22

5. BRCA2-F CCCTTCTTTGGGTGTTTTATGCT 23
BRCA2-R CCTTCCTGTGATGGCCAGAG 20

6. β-actin- F GCCCTGGCACCCAGCACAAT 20
β-actin- R GGAGGGGCCGGACTCGTCAT 20

Table 1: Primer sequence of PI3KCA/B, RAD51, BRCA1/2 and β-actin.

A Journal for New Zealand Herpetology 4021

BioGecko Vol 12 Issue 03 2023
ISSN NO: 2230-5807

Statistical analysis

Statistical analysis was performed to evaluate the significance of cell viability changes over time. The results
indicated a significant difference in viability between 24 hours and 48 hours (p < 0.0001). However, no
significant changes were observed when comparing data between 48 hours and 72 hours. All experiments
mentioned above were conducted in triplicates, and statistical analysis was performed using GraphPad Prism
5.1.

RESULTS

TQ stimulates anti-proliferative effects in SKOV-3 and R_SKOV-3 cells

The objective of this study was to investigate the effects of CDDP and TQ on SKOV-3 and R_SKOV-3
cells(Almosa et al. 2020). The MTT assay was performed in a time and concentration-dependent manner in
both cell lines (Fig. 1). The IC50 values for CDDP were determined to be 2 μM and 3 μM for 24 hours and
48 hours, respectively. Similarly, the IC50 values for TQ were found to be 16 μM and 14 μM. For further
experiments, the IC50 values obtained at 48 hours were used. CDDP resistance was induced in SKOV-3 cells
by exposing them to increasing concentrations of CDDP (Fig. 2). The IC50 value of CDDP after resistance
development was found to be 6 μM, while TQ at a concentration of 14 μM effectively inhibited 50% of the
R_SKOV-3 cells. Subsequent assays were conducted in both SKOV-3 and R_SKOV-3 cell lines to evaluate
the gene expressions.

Fig. 1: Illustration of various concentrations of CDDP and TQ treatment for 24 and 48h of cytotoxicity in
SKOV-3 and R_SKOV-3.

(TQ24 = Treatment of SKOV-3 cells with TQ for 24h; CIS24 = Treatment of SKOV-3 cells with CDDP for
24h; TQ48 = Treatment of SKOV-3 cells with TQ for 48h; CIS48 = Treatment of SKOV-3 cells with CDDP
for 48h; RTQ24 = Treatment of CDDP-R_SKOV-3 cells with TQ for 24h; RCIS24 = Treatment of CDDP-
R_SKOV-3 cells with CDDP for 24h; RTQ48 = Treatment of CDDP- R_SKOV-3 cells with TQ for 48h;
RCIS48 = Treatment of CDDP- R_SKOV-3 cells with CDDP for 48h)

TQ-mediated gene expression changes in SKOV-3

After treatment with TQ, alterations in the expression levels of PI3KCA/B, RAD51, and BRCA1/2 were
observed. In PIK3CA, the mean fold after TQ treatment decreased when compared to the control andCDDP.
Similar effects were observed in PIK3CB, RAD51 and BRCA1. Correspondingly, for BRCA2 the mean fold
changereduced the highest in SKOV_3 as compared to control and R_SKOV-3.

A Journal for New Zealand Herpetology 4022

BioGecko Vol 12 Issue 03 2023
ISSN NO: 2230-5807

Fig. 2: RT-PCR was used to analyze the expression levels of PI3KCA/B, RAD51, and BRCA1/2 genes
in two cell lines, SKOV-3 and R_SKOV-3. The results are presented as mean ± standard deviation (S.D.) of
the fold change in gene expression. The data represent the average ± SD of three independent experiments.
Statistical significance p < 0.05, and non-significant differences were observed between control cells and
treated cells.

DISCUSSION

There has been limited progress in improving the survival rates of OvCa patients, and the outcomes of
targeted therapies have been unfavourable. Conventional treatments often fail due to the development of
drug resistance, and the recurrence of tumours is common in women with OvCa. During recurrence, the
focus of treatment shifts towards managing patient symptoms, controlling disease progression, and
maintaining the quality of life(Lheureux, Braunstein, and Oza 2019). Phytochemicals (PCs) have
demonstrated chemo-protective effects in various types of cancer, and they can be administered at lower
doses with moderate toxicity. These compounds sensitize cancer cells to chemotherapy by limiting
proliferation and inhibiting metastasis. Among the PCs, TQ has exhibited anti-cancer activity through
multiple mechanisms, such as promoting apoptosis by regulating the balance between Bax and Bcl-2
proteins, increasing interferon levels, inhibiting phosphorylated STAT3, and reducing JAK2
activity(Choudhari et al. 2020).

To determine the anti-cancer effects of potential compounds, it is important to evaluate their ability to inhibit
cell proliferation. The MTT assay is commonly used for this purpose, as it allows viable cells to convert the
MTT reagent into a formazan product, which can be detected at a specific wavelength, usually 570nm. In this
study, a time-dependent MTT assay was conducted to examine the cytotoxic effects of TQ at two-time
points: 24 hours and 48 hours.

Furthermore, we investigated the expression levels of key genes that have been implicated in the
development and advancement of OvCa. The impact of TQ on the expression of these genes was observed,
providing valuable insights into potentially significant pathways. These findings warrant further investigation
to gain a deeper understanding of their significance and potential implications in OvCa progression. The
genes PI3KCA/B play a crucial role in the initiation and progression of diverse types of cancer, including
OvCa(Ghoneum and Said 2019a; Zhao et al. 2018a). Increased copy numbers of PIK3CA/B have been
observed in ovarian cancer, contributing to the activation of cancer-promoting pathways. These genes aid in
the proliferation of cancer cells and enable them to evade apoptosis. Interestingly, in this study, it was noted
that TQ induces apoptosis in SKOV-3 and R_SKOV-3 cells without downregulating PIK3CA/B expression.
This suggests that TQ induces apoptosis in a manner independent of PI3K signalling. The expression levels
of RAD51 provide insights into the development of resistance mechanisms(Ghoneum and Said 2019b; Zhao
et al. 2018b).

A Journal for New Zealand Herpetology 4023

BioGecko Vol 12 Issue 03 2023
ISSN NO: 2230-5807
RAD51 is upregulated in OvCa and serves as a marker for malignant behaviour. Given its significance as an
oncogene in ovarian cancer, it has been targeted for therapeutic interventions, with ongoing studies
investigating various inhibitors. Additionally, RAD51's involvement in DNA repair mechanisms contributes
to drug resistance in cancer cells, making it a valuable indicator of drug responsiveness. Notably, RAD51
directly interacts with the BRCA1/2 genes to facilitate DNA replication and repair processes(Golmard et al.
2017; Wang et al. 2015).Despite previous suggestions that TQ indirectly downregulates the expression of
RAD51, our study did not find substantial evidence to support this claim. However, our findings demonstrate
that RAD51 expression is indeed decreased in ovarian cancer cells following treatment with TQ. This
highlights the potential sensitizing effect of TQ on ovarian cancer cells, as reported in other studies, by
diminishing the repair and replication capabilities of these cancer cells. Nevertheless, it is important to note
that certain studies have indicated a suppressive impact of TQ on the regulation of BRCA1/2 genes(Kugaji et
al. 2019b; Linjawi et al. 2015).

In this particular study, the cells treated with TQ exhibited a decrease in the expression levels of BRCA1/2.
This observation suggests that TQ plays a role in effectively targeting and exhibiting anti-cancer activities in
both ovarian cancer cells and their resistant counterparts. Further investigations will be conducted to explore
the specific expressions induced by TQ in resistant cells, thus expanding our understanding of its potential
mechanisms of action in overcoming resistance.

CONCLUSION

The identification and characterization of various types of OvCa have provided opportunities for innovative
therapies and their translation into clinical practice. In rare forms of ovarian cancer, establishing a robust
network that bridges the gap between research and medical care is crucial for enhancing patient outcomes
and quality of life. Plant-based compounds (PCs) have shown promise in this regard, as they exhibit dual
roles at optimal doses with minimal side effects. However, they may also present certain limitations,
including inconsistent metabolism, challenges in targeted delivery, and shortcomings in pharmacokinetics
and pharmacodynamics.

Acknowledgements

We would like to thank Maratha Mandal’s Central Research Laboratory NGH, Belagavi for guidance,
providing the required facilities, and technical support for the smooth conduction of this research

Conflict of Interests

The authors declare no conflicts of interest.

References

1. Almosa, Heba et al. 2020. “Cytotoxicity of Standardized Curcuminoids Mixture against Epithelial
Ovarian Cancer Cell Line SKOV-3.” Scientia Pharmaceutica 88(1).
2. Bray, Freddie, Jacques Ferlay, and Isabelle Soerjomataram. 2018. “Global Cancer Statistics 2018 :
GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries.” A
Cancer Journal for Clinicians 68(4): 394–424.
3. Choudhari, Amit S. et al. 2020. “Phytochemicals in Cancer Treatment: From Preclinical Studies to
Clinical Practice.” Frontiers in Pharmacology 10.
4. Feng, Yuchen et al. 2021. “Predictive Value of RAD51 on the Survival and Drug Responsiveness of
Ovarian Cancer.” Cancer Cell International 21(1).
5. Ghoneum, Alia, and Neveen Said. 2019a. “PI3K-AKT-MTOR and NFkB Pathways in Ovarian Cancer:
Implications for Targeted Therapeutics.” Cancers 11(7).

A Journal for New Zealand Herpetology 4024

BioGecko Vol 12 Issue 03 2023
ISSN NO: 2230-5807
6. ———. 2019b. “PI3K-AKT-MTOR and NFkB Pathways in Ovarian Cancer: Implications for Targeted
Therapeutics.” Cancers 11(7).
7. Golmard, Lisa et al. 2017. “Contribution of Germline Deleterious Variants in the RAD51 Paralogs to
Breast and Ovarian Cancers /631/208/68 /631/67/1347 Article.” European Journal of Human Genetics
25(12): 1345–53.
8. Kugaji, Manohar S. et al. 2019a. “Effect of Resveratrol on Biofilm Formation and Virulence Factor Gene
Expression of Porphyromonas Gingivalis in Periodontal Disease.” APMIS 127(4): 187–95.
9. ———. 2019b. “Effect of Resveratrol on Biofilm Formation and Virulence Factor Gene Expression of
Porphyromonas Gingivalis in Periodontal Disease.” APMIS 127(4): 187–95.
10. Kumar, Shashank, Prem Prakash Kushwaha, and Sanjay Gupta. 2019. “Emerging Targets in Cancer Drug
Resistance.” Cancer Drug Resistance 2: 161–77.
11. Lheureux, Stephanie, Marsela Braunstein, and Amit M. Oza. 2019. “Epithelial Ovarian Cancer: Evolution
of Management in the Era of Precision Medicine.” CA: A Cancer Journal for Clinicians.
12. Linjawi, Sabah A.A., Wagdy K.B. Khalil, Mahrosa M. Hassanane, and Ekram S. Ahmed. 2015.
“Evaluation of the Protective Effect of Nigella Sativa Extract and Its Primary Active Component
Thymoquinone against DMBA-Induced Breast Cancer in Female Rats.” Archives of Medical Science
11(1): 220–29.
13. Liu, Xiaoli et al. 2017. “The Effect of Thymoquinone on Apoptosis of SK-OV-3 Ovarian Cancer Cell by
Regulation of Bcl-2 and Bax.” International Journal of Gynecological Cancer 27(8): 1596–1601.
14. Momenimovahed, Zohre, AzitaTiznobaik, Safoura Taheri, and Hamid Salehiniya. 2019. “Ovarian Cancer
in the World : Epidemiology and Risk Factors.” International Journal of Women’s Health 11: 287–99.
15. Mostofa, A. G.M., Md Kamal Hossain, Debasish Basak, and Muhammad Shahdaat Bin Sayeed. 2017.
“Thymoquinone as a Potential Adjuvant Therapy for Cancer Treatment: Evidence from Preclinical
Studies.” Frontiers in Pharmacology 8(JUN).
16. Rio, Donald C., Manuel Ares, Gregory J. Hannon, and Timothy W. Nilsen. 2010. “Purification of RNA
Using TRIzol (TRI Reagent).” Cold Spring Harbor Protocols 5(6)
17. Stewart, Christine, Christine Ralyea, and Suzy Lockwood. 2019. “Ovarian Cancer: An Integrated
Review.” Seminars in Oncology Nursing 35(2): 151–56. https://doi.org/10.1016/j.soncn.2019.02.001.
18. Wang, Bingliang et al. 2015. “Artesunate Sensitizes Ovarian Cancer Cells to Cisplatin by Downregulating
RAD51.” Cancer Biology and Therapy 16(10): 1548–56.
19. Woźniak, Marta, RafałKrajewski, Sebastian Makuch, and Siddarth Agrawal. 2021. “Phytochemicals in
Gynecological Cancer Prevention.” International Journal of Molecular Sciences 22(3): 1–20.
20. Zhao, Yulei et al. 2018a. “PI3K Positively Regulates YAP and TAZ in Mammary Tumorigenesis through
Multiple Signaling Pathways.” Molecular Cancer Research 16(6): 1046–58.
21. ———. 2018b. “PI3K Positively Regulates YAP and TAZ in Mammary Tumorigenesis through Multiple
Signaling Pathways.” Molecular Cancer Research 16(6): 1046–58.

A Journal for New Zealand Herpetology 4025