RESEARCH ARTICLE

Association study of MCP-1 promoter

polymorphisms with the susceptibility and
progression of sepsis
Junbing He1☯, Yuhua Chen2☯, Yao Lin3☯, Wenying Zhang1, Yujie Cai4, Feng Chen1,
Qinghui Liao2, Zihan Yin1, Yan Wang4, Shoubao Tao1, Xiaoli Lin3, Pengru Huang4,
Lili Cui4*, Yiming Shao1*
1 The Intensive Care Unit, Guangdong Key Laboratory of Age-Related Cardiac and Cerebral Diseases,
Affiliated Hospital of Guangdong Medical University, Zhanjiang, Guangdong, China, 2 The Department of
Endocrinology and Metabolism, Longgang District People’s Hospital of Shenzhen, Shenzhen, Guangdong,
a1111111111 China, 3 The Department of Stomatology, Jieyang Affiliated Hospital, SunYat-sen University, Jieyang,
a1111111111 Guangdong, China, 4 Institute of Neurology, Guangdong Key Laboratory of Age-Related Cardiac and
a1111111111 Cerebral Diseases, Affiliated Hospital of Guangdong Medical University, Zhanjiang, Guangdong, China
a1111111111
a1111111111 ☯ These authors contributed equally to this work.
* [email protected] (LC); [email protected] (YS)

Abstract
OPEN ACCESS
Previous studies have indicated that the monocyte chemo-attractant protein 1 (MCP-1),
Citation: He J, Chen Y, Lin Y, Zhang W, Cai Y, Chen
F, et al. (2017) Association study of MCP-1 also referred to as C-C motif chemokine ligand 2 (CCL2), plays a significant role in the path-
promoter polymorphisms with the susceptibility ogenesis of sepsis, and this study investigated the clinical relevance of two MCP-1 gene
and progression of sepsis. PLoS ONE 12(5):
polymorphisms on sepsis onset and progression. The Multiplex SNaPshot genotyping
e0176781. https://doi.org/10.1371/journal.
pone.0176781 method was used to detect MCP-1 gene polymorphisms in the Chinese Han population
(403 sepsis patients and 400 controls). MCP-1 mRNA expression levels were measured
Editor: Paul Proost, Katholieke Universiteit Leuven
Rega Institute for Medical Research, BELGIUM using real-time quantitative PCR, and enzyme-linked immunosorbent assays were used to
analyze MCP-1, tumor necrosis factor-alpha (TNF-α), interleukin 6 (IL-6) and interleukin-1
Received: February 8, 2017
beta (IL-1β) plasma concentrations. The rs1024611 polymorphism analysis showed lower
Accepted: April 17, 2017
frequencies of minor homozygous genotype (AA) and allele (A) in sepsis patients compared
Published: May 4, 2017 to the healthy controls (19.4% vs. 31.5%, P = 0.0001 and 45.9% vs. 54.8%, P = 0.0004,
Copyright: © 2017 He et al. This is an open access respectively). And the frequencies of GG genotype and G allele were lower in sepsis
article distributed under the terms of the Creative patients compared to the controls (19.6% vs. 31.3%, P = 0.0002 and 46.0% vs. 54.5%, P =
Commons Attribution License, which permits
0.0007, respectively). The rs1024611 AG/GG and rs2857656 GC/CC genotypes were both
unrestricted use, distribution, and reproduction in
any medium, provided the original author and overrepresented in patients with severe sepsis (both P = 0.0005) and septic shock (P =
source are credited. 0.010 and P = 0.015, respectively) compared to the patients with mild sepsis. Moreover,
Data Availability Statement: All relevant data are among sepsis patients, the rs1024611 AG/GG and rs2857656 GC/CC carriers exhibited
within the paper and its Supporting Information significant increases in expression levels of MCP-1 (P = 0.025), TNF-α (P = 0.034) and IL-6
files. (P = 0.043) compared with the rs1024611 AA or rs2857656 GG carriers. This study provides
Funding: This work was supported by funding valuable clinical evidence that the MCP-1/CCL2 polymorphisms rs1024611 and rs2857656
from the National Nature Science Foundation of are associated with sepsis susceptibility and development. We conclude that MCP-1/CCL2
China (81471326, 81301038 and 81401061), the
plays a significant role in the pathogenesis of sepsis, which has potentially important thera-
special competitive assignment fiscal funds of
Zhanjiang City (2016A01026), the PhD Startup peutic implications.
Fund of Affiliated Hospital of Guangdong Medical
College (BJ201507), and the Health Science and

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 1 / 14

 MCP-1 promoter polymorphisms and sepsis

Technology Funds of Longgang District, Shenzhen

City (20160612104602724). Introduction
Competing interests: The authors have declared Sepsis is a systemic inflammatory disease resulting from a harmful response to microbial infec-
that no competing interests exist. tion [1–3]. Although the pathological mechanism of sepsis remains unclear, numerous lines of
evidence have demonstrated that variations in genes associated with the inflammatory
immune response play vital roles in the pathomechanism and progression of sepsis [4–7].
Progress in genetic sequencing and association studies between different immunological pro-
files and disease outcomes may someday allow for genetic diagnosis and interventional treat-
ment of sepsis, ultimately improving outcomes for critically ill patients [8–10].
Monocyte chemo-attractant protein 1 (MCP-1), also known as CC motif chemokine ligand
2 (CCL2), is an important molecule for monocytes chemotaxis, endothelial activation and reg-
ulation of leukocyte function, mediating a variety of inflammation-promoting biological activ-
ities [11–13]. A growing body of evidence shows that sepsis patients, as well as animal models
of sepsis, exhibit high levels of MCP-1, which are strongly correlated with organ dysfunction
and mortality following sepsis [14–17]. A genomic deletion of MCP-1 in mice contributes to
resistance against major Leishmania infection, whereas excessive MCP-1 expression in trans-
genic mice results in predisposition to infection with Listeria monocytogenes and Mycobacte-
rium tuberculosis [18, 19]. Studies have shown that antibody neutralization or a specific
antagonist of MCP-1 in mouse models of sepsis can decrease the septic response and are bene-
ficial to survival, making MCP-1 a promising potential therapeutic target for sepsis [20–22].
Taken together, these lines of evidence indicate that continuous activation of MCP-1 plays a
role in the pathogenesis and progression of sepsis.
The human MCP-1 gene is located on chromosome 17q11.2-q12 [23]. Studies have shown
that two functional genetic variations within the MCP-1 gene promoter region, rs1024611 A/
G and rs2857656 G/C, influence MCP-1 expression levels and result in genetic predisposition
to various inflammation-related diseases [24–27]. The MCP-1 rs1024611 polymorphism
within the distal regulatory region of the gene can influence the transcriptional activity of
MCP-1 and contributes to susceptibility to systemic lupus erythematosus, rheumatoid arthritis
and inflammatory bowel disease [27–30]. The other polymorphism, MCP-1 rs2857656, is
located within the proximal promoter region of the gene and reportedly contributes to
increased MCP-1 expression levels as well as increased risk of spinal tuberculosis and carotid
atherosclerosis [31, 32]. However, there are currently no reports on the clinical relevance of
these two MCP-1 polymorphisms to sepsis susceptibility and progression.
A growing body of work has demonstrated that many variations in genes associated with
the inflammatory and immune responses contribute to the occurrence and progression of sep-
sis [4–7]. However, to the best of our knowledge, the clinical relevance of MCP-1 genetic poly-
morphisms to sepsis has not been determined, adequately. Given the evidence implicating
MCP-1 in the pathomechanism and progression of sepsis, we conducted this case-control
study to examine whether two MCP-1 promoter polymorphisms (rs1024611 and rs2857656)
are associated with sepsis in the Han Chinese population. In addition, we determined the
expression levels of MCP-1, IL-6, IL-1β and TNF-α in the study subjects to assess potential
associations between these genetic variations and cytokine production.

Materials and methods

Study population
In the present study, 403 sepsis patients (age range 23–86 years, mean 59.2; 286 men and 117
women) were enrolled within 24 hours of admission to the intensive care unit (ICU) at the
Affiliated Hospital of Guangdong Medical University (Zhanjiang, China) from December

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 2 / 14

 MCP-1 promoter polymorphisms and sepsis

2012 to December 2015. The diagnosis of sepsis was defined following the International Sepsis
Definitions Conference [33, 34]. Those patients were excluded from this study if they were
combined with preexisting cancer, ACI, HIV, blood or autoimmune diseases. The peripheral
blood samples were collected within 12 hours when the diagnosis of sepsis, severe sepsis, or
septic shock was established. The sepsis, severe sepsis or septic shock is the initial situation of
the disease in the patients. The following clinical parameters were recorded for each patient:
age, sex, dysfunctional organs, source of infection, blood microbiological cultures, and Acute
Physiology and Chronic Health Evaluation (APACHE) II score [35]. As a control group, 400
healthy subjects (age range 20–83 years, mean 57.5; 271 men and 129 women) without a his-
tory of sepsis, cancer, autoimmune diseases and other inflammation-related diseases were
enrolled from the Health Examination Center in this hospital at the same period time. All the
studied subjects were from the Chinese Han population and were at least of eighteen years old.
Written informed consent was obtained from the participants prior to their enrollment in the
study. Each sepsis patient’s capacity to consent was confirmed by a family member when nec-
essary. The STROBE Statement of this study was included in the supplementary information
(S1 File). This study was approved by the Ethical Committee of the Affiliated Hospital of
Guangdong Medical University (No. PJ2012134).

DNA extraction and genotyping

Genomic DNA extraction was performed by using the TIANamp Blood DNA Kit (Tiangen
Biotech Co., Ltd., Beijing, China) and stored at -80˚C until use. Two MCP-1 polymorphisms
rs1024611 (-2518 A>G) and rs2857656 (-362 G>C) were genotyped using the SNaPshot Mul-
tiplexKit (Applied Biosystems Co., Ltd., Foster City, CA, USA), and the primers used for
amplification of PCR and extension of SNaPshot were designed with GenBank database and
were as follows: rs1024611F, 5' CTCTCACGCCAGCACTGACCTC3'; rs1024611R, 5' CCAA
TTAGCCCATGGTCACAGA 3'; rs2857656F, 5' TAAGCTGGCAGCGAGCCTGAC3'; rs2857
656R, 5' GCCATTAAGCCCAGACTGACCA 3'. The SNaPshot PCR reaction consisted of SNaP-
shot Multiplex Kitreagent (5μL), templates (4μL) and primer mix (4μl). The PCR reaction pro-
tocol was as follows: 96˚C for 60s; 28 cycles of 96˚C for 10s, 55˚C for 5s, and 60˚C for 30s; 4˚C
for 120s. The products were purified by 1-h incubation with 1U of shrimp alkaline phospha-
tase (Takara: Otsu, shiga, Japan) at 37˚C and 75˚C for 15 minutes. Then the purified products
(0.5μL) were mixed with Lizl20 Size Standard (0.5μL) and HiDi formamide (9μL) and were
incubated at 95˚C for 5 minutes, and were analyzed using ABIPrism 3730XL genetic sequence
analyzer (Applied Biosystems, Foster City, CA, USA) and GeneMapper 4.1 (Applied Biosys-
tems, Carlsbad, CA, USA). Finally, 10% of the samples were randomly selected as the valida-
tion group for re-genotyping. All the samples were successfully genotyped for the two MCP-1
polymorphisms. Power analyses exhibited 98.2% power for rs1024611 and 98.2% power for
rs2857656 to test a genotype relative risk at an odds ratio of 1.5 at a significance level of 0.05 in
this study.

RNA extraction and quantitative real-time PCR

We randomly selected 80 sepsis patients and 80 controls from the enrolled subjects for the
peripheral blood mononuclear cells (PBMCs) isolation by using density gradient centrifuga-
tion method with LymphoprepTM (Axis-Shield PoCAS, Oslo, Norway). The 80 sepsis samples
included 12 mild sepsis, 38 severe sepsis and 30 septic shock samples. Among the 160 selected
subjects, 21 cases and 23 controls carried the rs1024611 AA and rs28576565 GG genotypes,
and 59 cases and 57 controls carried the rs1024611 GA/GG and rs28576565 GC/CC genotypes.
The genomic RNA extraction from PBMCs was performed by using the RNAprep Pure Blood

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 3 / 14

 MCP-1 promoter polymorphisms and sepsis

Kit (Sangon Biotech, Shanghai, China) and then converted to cDNA by using the First Strand
cDNA Synthesis Kit (Thermo) following the protocol of the manufacturer. Next, the MCP-1
mRNA expression was detected by quantitative real-time PCR. The Primers were designed
with Primer Premier 5.0 software by Shanghai Sangon Biological Engineering as follows:
MCP-1: 5' CTCGCCTCCAGCATGAAAGT 3' and 5' GGTGACTGGGGCATTGATTG 3';
GAPDH: 5' TCCTACCCCCAATGTATCCG 3' and 5' CCTTTAGTGGGCCCTCGG 3'. The
quantitative real-time PCR was performed using a LightCycler480 sequence detector system
(Roche Applied Science, Laval, Quebec, Canada) in the following reaction conditions: 95˚
C/300s, and 40 cycles of 95˚C/10s, 60˚C/20s and 70˚C/30s. The 2-ΔΔCT method was used to
calculate the mRNA expression of MCP-1.

Cytokine measurement
The peripheral blood samples were obtained from the selected 80 sepsis cases and 80 controls
in a sodium heparin vacutainer tube. The plasma was collected from the peripheral blood sam-
ples by centrifugation at low speed and stored at −80˚C until used. The plasma concentrations
of MCP-1, IL-1β, IL-6 and TNF-α were measured by using each specific enzyme linked immu-
nosorbent assay (ELISA) kits (TianGen Biotech, Beijing, China), according to the protocol of
the manufacturer. The absorbance of samples and standards were detected at 450 nm by using
a microplate reader. The minimum detectable concentrations of MCP-1, IL-1β, IL-6 and TNF-
α were 0.1 ng/ml, 1 pg/ml, 1 pg/ml and 1 pg/ml, respectively.

Statistical analyses
The measurement data were shown as the mean ± standard error of the mean (SEM) and com-
pared using Student’s t-test. Genotype/allele distribution of each polymorphism was analyzed
using Chi-squared test or Fisher’s exact test, and the false discovery rate-adjusted P-value was
calculated by using the Bonferroni correction in multiple-time statistics. The Hardy-Weinberg
equilibrium (HWE) was used to assess the deviation of the allele or genotype frequency. A link-
age disequilibrium (LD) map was construct to determine the extent of linkage disequilibrium
between genetic variations using the Haploview (version 4.2) software (Jeffrey C Barrett and
Mark J Daly, Cambridge, MA, USA). All statistical analyses were performed in the SPSS version
19.0 (IBM,NY, USA), and a P value < 0.05 was considered to be statistically significant.

Results
Clinical characteristics
The clinical parameters of the 403 consecutive patients with sepsis who were admitted to the inten-
sive care unit (ICU) and matched the inclusive criteria from December 2012 to December 2015, as
well as the 400 healthy subjects, that were included in this study are presented in Table 1. No sig-
nificant differences were observed between the sepsis and healthy subject groups with respect to
gender (P = 0.323) or age (P = 0.110). The 403 sepsis patients were divided into three subgroups
based on the severity of their sepsis as follows: 74 patients with mild sepsis, 191 patients with severe
sepsis and 138 patients with septic shock. Respiratory tract infection (63.0%), abdominal infection
(23.3%) and primary bloodstream infection (11.9%) were the main sources of infection. The main
pathogens identified in this study were Acinetobacter baumannii (23.1%), Escherichia coli (10.9%),
Pseudomonas aeruginosa (9.7%) and Staphylococcus aureus (8.2%). Gram-negative infections,
Gram-positive infections and mixed infections accounted for approximately 33.5%, 9.9% and
11.7%, respectively. The 28-day ICU mortality rate was 25.3% in this study.

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 4 / 14

 MCP-1 promoter polymorphisms and sepsis

Table 1. Clinical characteristics of sepsis patients and healthy controls.

Variable Sepsis (n = 403) N(%) Control (n = 400) N(%) P value
Demographics
Age, years, mean ± SD 59.2 ± 17.1 57.5 ± 13.7 0.110
Male/female, number 286/117 271/129 0.323
Sepsis status, n(%)
Mild sepsis 74(18.4) N.A
Severe sepsis 191(47.4) N.A
Septic shock 138(34.2) N.A
Source of infection, n(%)
Respiratory tract infection 254(63.0) N.A
Primary bloodstream infection 48(11.9) N.A
Abdominal infection 94(23.3) N.A
Urinary tract infection 22(5.5) N.A
Catheter-associated infection 14(3.5) N.A
Brain 29(7.2) N.A
Others 35(8.7) N.A
Infection types, n(%)
Gram-positive 40(9.9) N.A
Gram-negative 135(33.5) N.A
Mixed Gram-negative and -positive 47(11.7) N.A
Fungus 87(21.6) N.A
Polymicrobial 64(15.9) N.A
Negative blood culture 31(7.7) N.A
Pathogenic bacteria, n(%)
Acinetobacter baumannii 93(23.1) N.A
Monilia albican 27(6.7) N.A
Yeast sample sporphyte 26(6.5) N.A
Aspergillus 17(4.2) N.A
Klebsiella pneumoniae 26(6.5) N.A
Pseudomonas aeruginosa 39(9.7) N.A
Staphylococcus aureus 33(8.2) N.A
Escherichia coli 44(10.9) N.A
Others 76(18.9) N.A
APACHE II score 23.8±7.1 N.A
28-day mortality, n(%) 102(25.3) N.A

N.A: not applicable; APACHE II: Acute Physiology and Chronic Health Evaluation II; Continuous data are expressed as the mean ± SD

https://doi.org/10.1371/journal.pone.0176781.t001

Effects of MCP-1 gene polymorphisms on sepsis risk

The genotype/allele frequency distributions of the two MCP-1 promoter polymorphisms
(rs1024611 A>G and rs2857656 G>C) in the sepsis and control groups are listed in Table 2.
No deviations from Hardy-Weinberg equilibrium were observed for the two MCP-1 genetic
variations in the sepsis and control groups (all P>0.05, S1 Table). Significant differences
between the sepsis and healthy subject groups were found for the genotype distributions of
rs1024611 (P = 0.0004) and rs2857656 (P = 0.0007). The frequencies of the rs1024611 AG/GG
and rs2857656 GC/CC genotypes in the sepsis group were statistically higher compared with
the control group (P = 0.0001 for rs1024611: AA versus AG+GG; P = 0.0002 for rs2857656:
GG versus GC+CC). The frequencies of the rs1024611 G allele and the rs2857656 C allele were

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 5 / 14

 MCP-1 promoter polymorphisms and sepsis

Table 2. Frequencies of the MCP-1 genotypes and alleles in the sepsis patients and controls.
MCP-1 Sepsis n = 403 Control n = 400 P P* OR (95% CI)
rs1024611
AA 78(19.4) 126(31.5) 0.0004 0.0005 -
AG 214(53.1) 186(46.5) - - -
GG 111(27.5) 88(22.0) - - -
AA/AG 292(72.5) 312(78.0) 0.069 0.069 0.742(0.538, 1.024)
AG/GG 325(80.6) 274(68.5) 0.0001 0.0004 1.916(1.384, 2.652)
A 370(45.9) 438(54.8) - - 1.000 (reference)
G 436(54.1) 362(45.2) 0.0004 0.0005 1.426(1.171, 1.735)
rs2857656
GG 79(19.6) 125(31.3) 0.0007 0.0009 -
GC 213(52.9) 186(46.5) - - -
CC 111(27.5) 89(22.2) - - -
GG/GC 292(72.5) 311(77.8) 0.083 0.083 0.753(0.546, 1.038)
GC/CC 324(80.4) 275(68.8) 0.0002 0.0008 1.864(1.348, 2.579)
G 371(46.0) 436(54.5) - - 1.000 (reference)
C 435(54.0) 364(45.5) 0.0007 0.0009 1.404(1.154, 1.709)

OR: odds ratio; 95% CI: 95% confidence interval

* False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method.

https://doi.org/10.1371/journal.pone.0176781.t002

overrepresented in the sepsis patients compared with the controls (P = 0.0004 for rs1024611
and P = 0.0007 for rs2857656). A haplotype block was established to determine the extent of
linkage disequilibrium between polymorphisms using the Haploview software program
(rs1024611-rs2857656, D’ value = 0.995, r2 = 0.988, Fig 1). The data indicated there is a nearly
complete linkage disequilibrium (LD) between the rs1024611 and rs2857656 polymorphisms.

Distributions of MCP-1 allele and genotype frequencies in the sepsis

subgroups
We further divided the 403 cases into three subgroups based on the severity of sepsis to evalu-
ate potential associations between MCP-1 genetic variations and sepsis progression. As pre-
sented in Table 3, the genotype distributions of the two polymorphisms in the subgroup of
mild sepsis were significantly different from those in the severe sepsis (P = 0.0005 for
rs1024611 and rs2857656) and septic shock (P = 0.010 for rs1024611, and P = 0.015 for
rs2857656) subgroups. The frequencies of both the rs1024611 G and rs2857656 C alleles were
observed to be overrepresented in the severe sepsis/septic shock subgroups compared with the
mild sepsis subgroup, suggesting a role for rs1024611 A>G and rs2857656 G>C in the pro-
gression of mild sepsis to severe sepsis/septic shock.

Effects of MCP-1 gene polymorphisms on the expression of MCP-1

In total, 80 sepsis cases and 80 healthy subjects were randomly selected to investigate MCP-1
mRNA expression in peripheral blood mononuclear cells. Consistent with several previous
studies [16, 17], expression levels of the MCP-1 mRNA in the sepsis group were significantly
higher than in the control group (P = 0.002, Fig 2A). Among the three sepsis subgroups, MCP-
1 mRNA expression levels in the severe sepsis/septic shock subgroups were statistically higher
compared with the mild sepsis subgroup (P<0.05, Fig 2B). We further assessed the influence
of MCP-1 genetic variations on MCP-1 mRNA expression in the sepsis and control groups.

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 6 / 14

 MCP-1 promoter polymorphisms and sepsis

Fig 1. The linkage disequilibrium (LD) block (rs1024611 and rs2857565) and their locations in the promoter
region of the MCP-1 gene. According to the GRCh38.p7 primary assembly, the human MCP-1 gene is located in Homo
sapiens chromosome 17 (34,255,277–34,257,203). The blue bar represents the 5’-flanking region of the MCP-1 gene,
and the three dark green bars individually represent its exon1, exon2 and exon3, respectively. In the visual, rs1024611
and rs2857656 are located in the upstream of the transcriptional start site (-2508 bp and -289 bp), respectively. The
haplotype block (rs1024611-rs2857656, D’ value = 0.995, r2 = 0.988) is generated using Haploview 4.2.
https://doi.org/10.1371/journal.pone.0176781.g001

Significantly higher expression levels of the MCP-1 mRNA were found in sepsis patients and
healthy controls carrying the rs1024611 AG/GG genotypes or rs2857656 GC/CC genotypes
(Fig 2C and 2D). In addition, we determined the plasma concentrations of the MCP-1 protein
in sepsis and control groups, and our results were consistent with the MCP-1 mRNA expres-
sion levels, whereas MCP-1 plasma concentrations were normal in healthy controls with these
genotypes (Fig 3).

Effects of MCP-1 gene polymorphisms on the plasma concentrations of

related pro-inflammatory cytokines
We determined the plasma concentrations of TNF-α, IL-6 and IL-1β to determine whether
MCP-1 gene polymorphisms had any effect on the production of these related cytokines in the
sepsis and control groups. The sepsis patients exhibited significantly higher plasma concentra-
tions of TNF-α, IL-6 and IL-1β compared with the healthy controls (Fig 4A, 4B and 4C).
Among the three sepsis subgroups, the plasma concentrations of TNF-α, IL-6 and IL-1β in the

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 7 / 14

 MCP-1 promoter polymorphisms and sepsis

Table 3. Genotype and allele frequencies distribution in the different sepsis status.
MCP-1 Mild sepsis n = 74 (%) Severe sepsis n = 191 (%) Septic shock n = 138 (%) P1 P2 P1* P2*
rs1024611
AA 25(33.8) 28(14.7) 25(18.1) 0.0005 0.010 0.001 0.020
AG/GG 49(66.2) 163(85.3) 113(81.9)
A 83(56.1) 163(42.7) 124(44.9) 0.0055 0.029 0.0055 0.029
G 65(43.9) 219(57.3) 152(55.1)
rs2857656
GG 25(33.8) 28(14.7) 26(18.8) 0.0005 0.015 0.001 0.030
GC/CC 49(66.2) 163(85.3) 112(81.2)
G 83(56.1) 163(42.7) 125(45.3) 0.0055 0.034 0.0055 0.034
C 65(43.9) 219(57.3) 151(54.7)

P1: mild sepsis group versus severe sepsis; P2: mild sepsis group versus septic shock.
*False discovery rate-adjusted P-value for multiple hypotheses testing using the Benjamin-Hochberg method.

https://doi.org/10.1371/journal.pone.0176781.t003

severe sepsis/septic shock subgroups were significantly higher compared with the mild sepsis
subgroup (Fig 4D, 4E and 4F). Furthermore, the MCP-1 rs1024611 AG/GG and rs2857656
GC/CC genotype carriers exhibited significantly higher concentrations of TNF-α and IL-6
compared with the rs1024611 AA and rs2857656 GG genotype carriers among the sepsis
patients (Fig 4G, 4H, 4J and 4K). However, no significant differences in the IL-1β concentra-
tions were observed among the different genotypes in sepsis cases or healthy controls (Fig 4I
and 4L).

Discussion
To our knowledge, this study was the first to explore the clinical relevance of two specific
MCP-1 gene promoter polymorphisms, rs1024611 (-2518 A>G) and rs2857656 (-362 G>C),
for sepsis susceptibility in the Chinese population. Our results showed that the AG/GG geno-
types at rs1024611 and GC/CC genotypes at rs2857656 were associated with susceptibility to
sepsis. Furthermore, we identified additional stratifications indicating that the rs1024611 G
allele and rs2857656 C allele were both overrepresented among the severe sepsis/septic shock
subgroups compared with the mild sepsis subgroup, suggesting a possible role for rs1024611
A>G and rs2857656 G>C in promoting sepsis progression.
Accumulating evidence indicates that MCP-1 plays an important role in the pathogenic
mechanisms leading to sepsis [14–17]. MCP-1 is a member of the CC chemokine family, and

Fig 2. Real-time PCR analysis of the monocyte chemo-attractant protein 1 (MCP-1) mRNA expression
levels in sepsis cases (n = 80) and healthy controls (n = 80). Expression levels of MCP-1 in sepsis
patients and healthy controls (A). Expression levels of MCP-1 in mild sepsis, severe sepsis and septic shock
subgroups (B). The distribution of MCP-1 mRNA expression levels in groups of sepsis patients with different
rs1024611 genotypes (C) and different rs2857656 genotypes (D). The horizontal line stands for the median
expression level with each group. * P <0.05; ** P <0.01; *** P <0.001.
https://doi.org/10.1371/journal.pone.0176781.g002

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 8 / 14

 MCP-1 promoter polymorphisms and sepsis

Fig 3. The plasma concentration of MCP-1 in sepsis patients (n = 80) and healthy controls (n = 80). The plasma concentration of MCP-1 in sepsis
patients and healthy controls (A), and the plasma concentration of MCP-1 in mild sepsis, severe sepsis and septic shock subgroups (B). The distribution of
the plasma concentration of MCP-1 in groups of sepsis patients with different rs1024611 genotypes (C) and different rs2857656 genotypes (D). The
horizontal line stands for the median concentration with each group. * P <0.05; ** P <0.01; *** P <0.001.
https://doi.org/10.1371/journal.pone.0176781.g003

Fig 4. The plasma concentrations of pro-inflammatory cytokines polymorphisms in sepsis patients (n = 80) and healthy controls (n = 80). The
plasma concentration of TNF-α (A), IL-6 (B) and IL-1β (C) in sepsis cases (n = 80) and controls (n = 80), and the plasma concentration of TNF-α (D), IL-6 (E)
and IL-1β (F) in mild sepsis, severe sepsis and septic shock subgroups. The distribution of the plasma concentration of TNF-α (G), IL-6 (H) and IL-1β (I) in
groups of sepsis patients with different rs1024611 genotypes. The distribution of the plasma concentration of TNF-α (J), IL-6 (K) and IL-1β (L) in groups
of sepsis patients with different rs2857656 genotypes. The horizontal line stands for the median concentration with each group. * P <0.05; ** P <0.01;
*** P <0.001.
https://doi.org/10.1371/journal.pone.0176781.g004

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 9 / 14

 MCP-1 promoter polymorphisms and sepsis

it is an important molecule for monocytes recruitment under acute inflammatory conditions

and endothelial activation by regulating inflammation progression through the production of
pro-inflammatory cytokines [36, 37]. Several studies have shown that the expression levels of
MCP-1 are markedly increased in various murine models of sepsis, which reflect the organ
dysfunction and mortality seen in sepsis patients [15, 38]. Consistent with previous studies
[16, 17], our results showed that MCP-1 expression levels in the sepsis group were significantly
higher than in the control group, and expression levels also increased with severity of sepsis.
These results confirm an important role for MCP-1 in the pathomechanisms and progression
of sepsis as a pro-inflammatory mediator, and they also suggest that MCP-1 could be used as
an indicator of sepsis severity.
Recently, several studies indicated that MCP-1 genetic variations within the regulatory
regions of the gene could predispose patients to certain inflammation-related diseases by alter-
ing MCP-1 expression levels or certain linkage correlations under conditions of infection or
systemic inflammatory response [25–27]. MCP-1 transcription is under the control of two dis-
tinct regions in the 5’-flanking region of the MCP-1 gene [39]. The -2518 A/G (rs1024611)
promoter polymorphism influences the distal regulatory region, which is located upstream of
the transcription start site (1.9–2.7 kb) [40], and is considered a good candidate for genetic
predisposition to various inflammatory diseases, such as Crohn’s disease [41], spontaneous
bacterial peritonitis [24] and systemic lupus erythematosus [28]. Another proximal regulatory
region located upstream of the transcriptional start site (>150 bases) appears to contain poten-
tial transcription factor binding sites [42]. The MCP-1 rs2857656 polymorphism located in
this proximal promoter region was reported to increase the risk of carotid atherosclerosis by
enhancing transcriptional activity of the MCP-1 gene [43]. Consequently, we conducted this
study to assess the roles of these two MCP-1 promoter polymorphisms in the susceptibility to
and development of sepsis. Our data show that the sepsis patients carrying the rs1024611 AG/
GG or rs2857656 GC/CC genotypes presented with higher MCP-1 expression levels compared
with the carriers of the rs1024611 AA or rs2857656 GG genotypes. These results suggest that
these two SNPs are functional polymorphisms that upregulate the expression levels of MCP-1
through enhanced transcription, ultimately promoting MCP-1-mediated inflammatory pro-
gression and resulting in a predisposition towards sepsis. In addition, the frequencies of the
rs1024611 G allele and rs2857656 C allele were both overrepresented among the severe sepsis/
septic shock subgroups compared with the mild sepsis subgroup, further supporting the idea
that rs12692386 (-2518 A>G) and rs2857656 (-362 G>C) are statistically significant prognos-
tic factors that acts as genetic indicators of the sepsis risk and development. It is worth nothing
that, as well as the closely inflammation-related disease, the recent GWAS study related the
inflammatory bowel disease (IBD) identified rs3091315 and rs3091316 in the region as the sus-
ceptibility SNPs [44, 45], which there is strong linkage disequilibrium among rs1024611 and
rs2857656, rs3091315 and rs3091316 (r2>0.9) in each continental population, supporting our
report on the association between these two SNPs and sepsis risk. Future studies will investi-
gate the molecular mechanisms affected by these two functional polymorphisms using pro-
moter prediction techniques and a cellular sepsis model for experimental verification of these
findings.
MCP-1 plays pivotal roles in modulating monocyte chemotaxis and endothelial activation
as well as regulation of inflammatory progression and the production of pro-inflammatory
cytokines [17, 46, 47]. Accumulating evidence demonstrates that the inhibition or specific
antagonism of MCP-1 results in decreased release of TNF-α, IL-1β and IL-6 by macrophages
and confers survival benefits on mice following sepsis [20, 21, 48, 49]. Moreover, a recent
study suggested that the modulation of monocyte recruitment and endothelial activation dur-
ing LPS-induced endotoxemia are mediated by MCP-1 [50], and another study by Katherine

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 10 / 14

 MCP-1 promoter polymorphisms and sepsis

et al. showed that antibody neutralization of MCP-1 in a mouse model of sepsis leads to greatly
decreased transcription of IL-1α, IL-1β, and IL-6 in the diaphragm [51]. We found that plasma
concentrations of TNF-α, IL-1β and IL-6 in the sepsis group were significantly higher than in
the healthy control group, and the levels of these cytokines also increased with sepsis severity.
Importantly, the plasma concentrations of TNF-α and IL-6 were significantly increased in sep-
sis patients with rs1024611 AG/GG or rs2857656 GC/CC genotypes, accompanied by an upre-
gulation of MCP-1. These results are consistent with previous studies involving models of
sepsis where the blockage of MCP-1 inhibited the expression of pro-inflammatory cytokines
and conferred a survival benefit to mice following sepsis [20–22]. We inferred that rs1024611
A>G and rs2857656 G>C upregulate MCP-1 expression levels by enhancing transcriptional
activity of the MCP-1 gene, thereby causing excessive macrophage activation, increased pro-
duction of pro-inflammatory cytokines and ultimately a predisposition to and development of
sepsis.
Several important limitations should be acknowledged in this study. First, the limited num-
ber of patients in the study could have affected estimations of our preliminary conclusions.
Second, only a few MCP-1 genetic variations implicated in the susceptibility and progression
of sepsis were studied, and it is possible that other MCP-1 polymorphisms associated with sep-
sis remain to be identified. Third, the subjects enrolled in this study were only from the Han
Chinese ethnic group. Thus, further biological studies with a larger sample size of sepsis
patients from different ethnicities will be necessary to verify the association of MCP-1 poly-
morphisms with sepsis. Moreover, not only MCP-1 (CCL2) but also other chemokine genes,
such as CCL7 and CCL11, are located near to the positions of the rs1024611 and rs2857656
polymorphisms, so it is also possible that these polymorphisms may affects the other activity of
neighboring genes.
In conclusion, this study was the first to demonstrate an association between two MCP-1
genetic variations (rs1024611 G and rs2857656 C allele/the AG haplotype) that are associated
with predisposition to and protection against sepsis, respectively. Moreover, the high-risk
rs1024611 AG/GG and rs2857656 GC/CC genotypes affected the transcriptional activity and
expression of MCP-1, accompanied by the upregulation of pro-inflammation cytokines. These
findings suggest that these two MCP-1 promoter polymorphisms are clinically significant and
further validate the importance of MCP-1 as a therapeutic target in the pathogenesis and pro-
gression of sepsis.

Supporting information
S1 File. STROBE Statement-checklist of items that should be included in reports of obser-
vational studies.
(PDF)
S1 Table. The Hardy-Weinberg equilibrium of the two MCP-1 promoter polymorphisms.
(PDF)

Author Contributions
Conceptualization: JH YS LC.
Data curation: Y. Cai YW.
Formal analysis: JH Y. Chen YL Y. Cai YW.
Funding acquisition: YS LC Y. Chen.

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 11 / 14

 MCP-1 promoter polymorphisms and sepsis

Investigation: JH YL WZ FC ZY ST XL.
Methodology: JH YL Y. Chen.
Project administration: YS LC.
Resources: QL ST YW PH.
Software: Y. Cai YW.
Supervision: YS LC.
Validation: YS LC.
Visualization: YS LC JH.
Writing – original draft: JH Y. Chen YL.
Writing – review & editing: YS LC JH.

References
1. Hotchkiss RS, Sherwood ER. Immunology. Getting sepsis therapy right. Science. 2015; 347:1201–
1202. https://doi.org/10.1126/science.aaa8334 PMID: 25766219
2. Szakmany T, Lundin RM, Sharif B, Ellis G, Morgan P, Kopczynska M, et al. Sepsis Prevalence and Out-
come on the General Wards and Emergency Departments in Wales: Results of a Multi-Centre, Obser-
vational, Point Prevalence Study. PLoS One. 2016; 11:e0167230. https://doi.org/10.1371/journal.pone.
0167230 PMID: 27907062
3. Suffredini AF, Munford RS. Novel therapies for septic shock over the past 4 decades. JAMA. 2011;
306:194–199. https://doi.org/10.1001/jama.2011.909 PMID: 21750297
4. Shao Y, Shao X, He J, Cai Y, Zhao J, Chen F, et al. The promoter polymorphisms of receptor for
advanced glycation end products were associated with the susceptibility and progression of sepsis. Clin
Genet. 2017; 91:564–575. https://doi.org/10.1111/cge.12800 PMID: 27172264
5. Cui L, Gao Y, Xie Y, Wang Y, Cai Y, Shao X, et al. An ADAM10 promoter polymorphism is a functional
variant in severe sepsis patients and confers susceptibility to the development of sepsis. Crit Care.
2015; 19:73. https://doi.org/10.1186/s13054-015-0796-x PMID: 25888255
6. Kimura T, Watanabe E, Sakamoto T, Takasu O, Ikeda T, Ikeda K, et al. Autophagy-related IRGM poly-
morphism is associated with mortality of patients with severe sepsis. PLoS One. 2014; 9:e91522.
https://doi.org/10.1371/journal.pone.0091522 PMID: 24626347
7. Shao Y, He J, Chen F, Cai Y, Zhao J, Lin Y, et al. Association Study Between Promoter Polymorphisms
of ADAM17 and Progression of Sepsis. Cell Physiol Biochem. 2016; 39:1247–1261. https://doi.org/10.
1159/000447830 PMID: 27607600
8. Namath A, Patterson AJ. Genetic polymorphisms in sepsis. Crit Care Nurs Clin North Am. 2011;
23:181–202. https://doi.org/10.1016/j.ccell.2010.12.011 PMID: 21316575
9. Shimada T, Oda S, Sadahiro T, Nakamura M, Hirayama Y, Watanabe E, et al. Outcome prediction in
sepsis combined use of genetic polymorphisms—A study in Japanese population. Cytokine. 2011;
54:79–84. https://doi.org/10.1016/j.cyto.2010.12.001 PMID: 21282064
10. Sipahi T, Pocan H, Akar N. Effect of various genetic polymorphisms on the incidence and outcome of
severe sepsis. Clin Appl Thromb Hemost. 2006; 12:47–54. PMID: 16444434
11. Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an
overview. J Interferon Cytokine Res. 2009; 29:313–326. https://doi.org/10.1089/jir.2008.0027 PMID:
19441883
12. Gerszten RE, Garcia-Zepeda EA, Lim YC, Yoshida M, Ding HA, Gimbrone MA Jr., et al. MCP-1 and IL-
8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature. 1999;
398:718–723. https://doi.org/10.1038/19546 PMID: 10227295
13. Ziraldo C, Vodovotz Y, Namas RA, Almahmoud K, Tapias V, Mi Q, et al. Central role for MCP-1/CCL2
in injury-induced inflammation revealed by in vitro, in silico, and clinical studies. PLoS One. 2013; 8:
e79804. https://doi.org/10.1371/journal.pone.0079804 PMID: 24312451
14. Bossink AW, Paemen L, Jansen PM, Hack CE, Thijs LG, Van Damme J. Plasma levels of the chemo-
kines monocyte chemotactic proteins-1 and -2 are elevated in human sepsis. Blood. 1995; 86:3841–
3847. PMID: 7579352

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 12 / 14

 MCP-1 promoter polymorphisms and sepsis

15. Bozza FA, Salluh JI, Japiassu AM, Soares M, Assis EF, Gomes RN, et al. Cytokine profiles as markers
of disease severity in sepsis: a multiplex analysis. Crit Care. 2007; 11:R49. https://doi.org/10.1186/
cc5783 PMID: 17448250
16. Matsukawa A, Hogaboam CM, Lukacs NW, Lincoln PM, Strieter RM, Kunkel SL. Endogenous MCP-1
influences systemic cytokine balance in a murine model of acute septic peritonitis. Exp Mol Pathol.
2000; 68:77–84. https://doi.org/10.1006/exmp.1999.2296 PMID: 10716911
17. Tsuda Y, Takahashi H, Kobayashi M, Hanafusa T, Herndon DN, Suzuki F. CCL2, a product of mice
early after systemic inflammatory response syndrome (SIRS), induces alternatively activated macro-
phages capable of impairing antibacterial resistance of SIRS mice. J Leukoc Biol. 2004; 76:368–373.
https://doi.org/10.1189/jlb.1203645 PMID: 15123772
18. Gu L, Tseng S, Horner RM, Tam C, Loda M, Rollins BJ. Control of TH2 polarization by the chemokine
monocyte chemoattractant protein-1. Nature. 2000; 404:407–411. https://doi.org/10.1038/35006097
PMID: 10746730
19. Lu B, Rutledge BJ, Gu L, Fiorillo J, Lukacs NW, Kunkel SL, et al. Abnormalities in monocyte recruitment
and cytokine expression in monocyte chemoattractant protein 1-deficient mice. J Exp Med. 1998;
187:601–608. PMID: 9463410
20. Ramnath RD, Ng SW, Guglielmotti A, Bhatia M. Role of MCP-1 in endotoxemia and sepsis. Int
Immunopharmacol.
21. Speyer CL, Gao H, Rancilio NJ, Neff TA, Huffnagle GB, Sarma JV, et al. Novel chemokine responsive-
ness and mobilization of neutrophils during sepsis. Am J Pathol. 2004; 165:2187–2196. https://doi.org/
10.1016/S0002-9440(10)63268-3 PMID: 15579460
22. Taub DD. Chemokine-leukocyte interactions. The voodoo that they do so well. Cytokine Growth Factor
Rev. 1996; 7:355–376. PMID: 9023058
23. Da LS, Zhang Y, Zhang S, Qian YC, Zhang Q, Jiang F, et al. Association between MCP-1 -2518A/G
polymorphism and cancer risk: evidence from 19 case-control studies. PLoS One. 2013; 8:e82855.
https://doi.org/10.1371/journal.pone.0082855 PMID: 24367564
24. Salama MK, Sabry D, Al-Ghussein MA, Ahmed R, AbdAllah S, Taha FM, et al. Molecular detection of
monocyte chemotactic protein-1 polymorphism in spontaneous bacterial peritonitis patients. World J
Gastroenterol. 2014; 20:11793–11799. https://doi.org/10.3748/wjg.v20.i33.11793 PMID: 25206284
25. Thye T, Nejentsev S, Intemann CD, Browne EN, Chinbuah MA, Gyapong J, et al. MCP-1 promoter vari-
ant -362C associated with protection from pulmonary tuberculosis in Ghana, West Africa. Hum Mol
Genet. 2009; 18:381–388. https://doi.org/10.1093/hmg/ddn352 PMID: 18940815
26. Walczak A, Przybylowska K, Sygut A, Dziki L, Chojnacki C, Chojnacki J, et al. The -2518 A/G MCP-1
polymorphism as a risk factor of inflammatory bowel disease. Pol Przegl Chir. 2012; 84:238–241.
https://doi.org/10.2478/v10035-012-0039-7 PMID: 22763298
27. Rovin BH, Lu L, Saxena R. A novel polymorphism in the MCP-1 gene regulatory region that influences
MCP-1 expression. Biochem Biophys Res Commun. 1999; 259:344–348. https://doi.org/10.1006/bbrc.
1999.0796 PMID: 10362511
28. Aguilar F, Gonzalez-Escribano MF, Sanchez-Roman J, Nunez-Roldan A. MCP-1 promoter polymor-
phism in Spanish patients with systemic lupus erythematosus. Tissue Antigens. 2001; 58:335–338.
PMID: 11844145
29. Li YW, Yang CQ, Xiao YL, Li J, Xie CX, Zhang SH, et al. The -A2518G polymorphism in the MCP-1
gene and inflammatory bowel disease risk: A meta-analysis. J Dig Dis. 2015; 16:177–185. https://doi.
org/10.1111/1751-2980.12232 PMID: 25620350
30. Ozyurek AR, Gurses D, Ulger Z, Levent E, Bakiler AR, Berdeli A. Allelic frequency of the MCP-1 pro-
moter -2518 polymorphism in the Turkish population and in Turkish patients with juvenile rheumatoid
arthritis. Clin Rheumatol. 2007; 26:546–550. https://doi.org/10.1007/s10067-006-0347-6 PMID:
16835702
31. Guo C, Zhang H, Gao Q, He D, Tang M, Liu S, et al. Monocyte chemoattractant protein-1 in spinal tuber-
culosis: -362G/C genetic variant and protein levels in Chinese patients. Diagn Microbiol Infect Dis.
2014; 78:49–52. https://doi.org/10.1016/j.diagmicrobio.2013.07.024 PMID: 24183600
32. Nyquist P, Zhang J, De Graba TJ. The -928 G/C and -362 G/C single-nucleotide polymorphisms in the
promoter of MCP-1: Increased transcriptional activity and novel binding sites. Cerebrovasc Dis. 2010;
29:242–247. https://doi.org/10.1159/000267849 PMID: 20029197
33. Dellinger RP, Levy MM, Rhodes A, Annane D, Gerlach H, Opal SM, et al. Surviving Sepsis Campaign:
international guidelines for management of severe sepsis and septic shock, 2012. Intensive Care Med.
2013; 39:165–228. https://doi.org/10.1007/s00134-012-2769-8 PMID: 23361625

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 13 / 14

 MCP-1 promoter polymorphisms and sepsis

34. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, et al. The Third Inter-
national Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016; 315:801–810.
https://doi.org/10.1001/jama.2016.0287 PMID: 26903338
35. Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: a severity of disease classification
system. Crit Care Med. 1985; 13:818–829. PMID: 3928249
36. Fong DS, Aiello LP, Ferris FL, 3rd, Klein R. Diabetic retinopathy. Diabetes Care. 2004; 27:2540–2553.
PMID: 15451934
37. Holtkamp GM, De Vos AF, Peek R, Kijlsta A. Analysis of the secretion pattern of monocyte chemotactic
protein-1 (MCP-1) and transforming growth factor-beta 2 (TGF-beta2) by human retinal pigment epithe-
lial cells. Clin Exp Immunol. 1999; 118:35–40. https://doi.org/10.1046/j.1365-2249.1999.01016.x PMID:
10540157
38. Zhang H, Zhi L, Moochhala S, Moore PK, Bhatia M. Hydrogen sulfide acts as an inflammatory mediator
in cecal ligation and puncture-induced sepsis in mice by upregulating the production of cytokines and
chemokines via NF-kappaB. Am J Physiol Lung Cell Mol Physiol. 2007; 292:L960–971. https://doi.org/
10.1152/ajplung.00388.2006 PMID: 17209138
39. Ueda A, Okuda K, Ohno S, Shirai A, Igarashi T, Matsunaga K, et al. NF-kappa B and Sp1 regulate tran-
scription of the human monocyte chemoattractant protein-1 gene. J Immunol. 1994; 153:2052–2063.
PMID: 8051410
40. Ping D, Jones PL, Boss JM. TNF regulates the in vivo occupancy of both distal and proximal regulatory
regions of the MCP-1/JE gene. Immunity. 1996; 4:455–469. PMID: 8630731
41. Palmieri O, Latiano A, Salvatori E, Valvano MR, Bossa F, Latiano T, et al. The -A2518G polymorphism
of monocyte chemoattractant protein-1 is associated with Crohn’s disease. Am J Gastroenterol. 2010;
105:1586–1594. https://doi.org/10.1038/ajg.2010.4 PMID: 20125127
42. Valente AJ, Xie JF, Abramova MA, Wenzel UO, Abboud HE, Graves DT. A complex element regulates
IFN-gamma-stimulated monocyte chemoattractant protein-1 gene transcription. J Immunol. 1998;
161:3719–3728. PMID: 9759897
43. Nyquist PA, Winkler CA, McKenzie LM, Yanek LR, Becker LC, Becker DM. Single nucleotide polymor-
phisms in monocyte chemoattractant protein-1 and its receptor act synergistically to increase the risk of
carotid atherosclerosis. Cerebrovasc Dis. 2009; 28:124–130. https://doi.org/10.1159/000223437 PMID:
19506371
44. Franke A, McGovern DP, Barrett JC, Wang K, Radford-Smith GL, Ahmad T, et al. Genome-wide meta-
analysis increases to 71 the number of confirmed Crohn’s disease susceptibility loci. Nat Genet. 2010;
42:1118–25. https://doi.org/10.1038/ng.717 PMID: 21102463
45. Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, et al. Host-microbe interactions
have shaped the genetic architecture of inflammatory bowel disease. Nature. 2012; 491:119–24.
https://doi.org/10.1038/nature11582 PMID: 23128233
46. Han YL, Li YL, Jia LX, Cheng JZ, Qi YF, Zhang HJ, et al. Reciprocal interaction between macrophages
and T cells stimulates IFN-gamma and MCP-1 production in Ang II-induced cardiac inflammation and
fibrosis. PLoS One. 2012; 7:e35506. https://doi.org/10.1371/journal.pone.0035506 PMID: 22567105
47. Hanemann AL, Liborio AB, Daher EF, Martins AM, Pinheiro MC, Sousa MS, et al. Monocyte chemotac-
tic protein-1 (MCP-1) in patients with chronic schistosomiasis mansoni: evidences of subclinical renal
inflammation. PLoS One. 2013; 8:e80421. https://doi.org/10.1371/journal.pone.0080421 PMID:
24265821
48. Damas JK, Aukrust P, Ueland T, Odegaard A, Eiken HG, Gullestad L, et al. Monocyte chemoattractant
protein-1 enhances and interleukin-10 suppresses the production of inflammatory cytokines in adult rat
cardiomyocytes. Basic Res Cardiol. 2001; 96:345–352. PMID: 11518190
49. Slimani H, Zhai Y, Yousif NG, Ao L, Zeng Q, Fullerton DA, et al. Enhanced monocyte chemoattractant
protein-1 production in aging mice exaggerates cardiac depression during endotoxemia. Crit Care.
2014; 18:527. https://doi.org/10.1186/s13054-014-0527-8 PMID: 25209241
50. Turler A, Schwarz NT, Turler E, Kalff JC, Bauer AJ. MCP-1 causes leukocyte recruitment and subse-
quently endotoxemic ileus in rat. Am J Physiol Gastrointest Liver Physiol. 2002; 282:G145–155. https://
doi.org/10.1152/ajpgi.00263.2001 PMID: 11751168
51. Labbe K, Danialou G, Gvozdic D, Demoule A, Divangahi M, Boyd JH, et al. Inhibition of monocyte che-
moattractant protein-1 prevents diaphragmatic inflammation and maintains contractile function during
endotoxemia. Crit Care. 2010; 14:R187. https://doi.org/10.1186/cc9295 PMID: 20950459

PLOS ONE | https://doi.org/10.1371/journal.pone.0176781 May 4, 2017 14 / 14