AML All Merged PDF Class 1 To 8
AML All Merged PDF Class 1 To 8
• Topics covered
• Textbooks and reference books
• Evaluation components: Midsem 30%, Assignment: 30%, Comprehensive 40%
• Teaching Assistant: Dr. Madhusudhan B, Omshree Baskaran
Introduction
• The science (and art) of programming computers so they can learn from data
• Engineering-oriented definition
• Algorithms that improve their performance P at some task T with experience E
• Solution
• Write a detection algorithm for frequently appearing
patterns in spams
• Test and update the detection rules until it is good
enough.
• Challenge
• Detection algorithm likely to be a long list of complex
rules
• hard to maintain.
Machine Learning Approach
Automatically learns phrases that are good predictors of spam by detecting unusually
frequent patterns of words in spams compared to “ham”s
• The program is much shorter, easier to maintain, and most likely more accurate.
More ML Usage Scenarios
Tasks that are best solved by using a learning algorithm
• Recognizing Patterns in images, text
• Facial identities or facial expressions
• Handwritten or spoken words
• Medical images
• Types of Applications
• Application Domains
• State of the Art Applications
Two Classes of Application
• Internet
• Computational biology
• Finance
• E-commerce
• Space exploration
• Robotics
• Information extraction
• Social networks
• Software engineering
• System management
• Creative Arts
Example: Classification
Assign object/event to one of a given finite set of categories
• Medical Diagnosis
• Credit card applications or transactions
• Fraud detection in e-commerce
• Worm detection in network packets
• Spam filtering in email
• Recommended articles in a newspaper
• Recommended books, movies, music, or jokes
• Financial investments
• DNA sequences
• Spoken words
• Handwritten letters
• Astronomical images
Example: Planning, Control, Problem Solving
Performing actions in an environment in order to achieve a goal
• Playing checkers, chess, or backgammon
• Driving a car or a jeep
• Flying a plane, helicopter, or rocket
• Controlling a character in a video game
• Controlling a mobile robot
Breakthrough in Automatic Speech Recognition
Path
Planning
Laser Terrain
Mapping
Sebastian
Stanle
y
Contemporary ML Based Solutions
9
8
7
(1,000,000 sq km)
6
5
4
3
2
1
0
1970 1980 1990 2000 2010 2020
Year Number
Supervised Learning: Classification
y=1 (malignant)
y=0 (benign)
1 (malignant)
0 (benign)
Tumor Size Learnt classifer
If x>T, malignant else benign
Predict benign Predict malignant
x=T
Increasing Feature Dimension
• x can be multi-dimensional
– Each dimension corresponds to an attribute
- Clump Thickness
- Uniformity of Cell Size
Age
- Uniformity of Cell Shape
…
Tumor Size
Example: Supervised Learning Techniques
• Linear Regression
• Logistic Regression
• Naïve Bayes Classifiers
• Support Vector Machines (SVMs)
• Decision Trees and Random Forests
• Neural networks
Unsupervised Learning
• Clustering
• k-Means
• Hierarchical Cluster Analysis
• Expectation Maximization
• Visualization and dimensionality reduction
• Principal Component Analysis (PCA)
• Kernel PCA
• Locally-Linear Embedding (LLE)
• t-distributed Stochastic Neighbor Embedding (t-SNE)
• Association rule learning
• Apriori
• Eclat
Data Visualization
Visualize 2/3D representation of complex unlabelled training data
• Preserve as much structure as possible
• e.g., trying to keep separate clusters in the input space from overlapping in the visualization
• Understand how the data is organized
• Identify unsuspected patterns.
frog
cat
bird
dog
truck
automobile
deer
horse
ship airplane
Applications: Unsupervised Learning
Genomics application: Group individuals by genetic similarity
Genes
Individuals
Applications: Unsupervised Learning
Organize computing clusters Social network analysis
• Examples:
– Game playing, e.g., AlphaGo
– Robot in a maze
– Balance a pole on your hand
Types of Learning
Based on how training data is used
• Batch learning
• Uses all available data at a time during training
• Mini Batch learning
• Uses a subset of available at a time during training
• Online (incremental) learning
• Uses single training data instance at a time during training
Types of Learning
Based on how training data is used
• Instance Based Learning
• compare new data points to known data points
• Model Based learning
• detect patterns in the training data and build a predictive model
• Training Data
• Insufficient
• Non representative
• Poor Quality
• Irrelevant attributes
• Model Selection
• Overfitting
• Underfitting
• Testing and Validation
• Hyperparameters
Insufficient Training Data
Consider trade-off Between Algorithm development & training data capture
Non-representative Training Data
Training Data be representative of the new cases we want to generalize
• Small sample size leads to sampling noise
• Missing data over emphasizes the role of wealth on happiness
• If sampling process is flawed, even large sample size can lead to sampling bias
Data Quality
Cleaning often needed for improving data quality
• Some instances have missing features
• e.g., 5% of customers did not specify their age
• Ignore the instances all together or the feature,
• fill in the missing values
• Train multiple ML models
• Some instances can be erroneous, noisy or outliers
• Human or machine generated
• Identify, discard or fix manually, as appropriate
Irrelevant Features
Feature engineering needed for coming up with a good set of features
• Feature selection
• more useful features to train on among existing features.
• Feature extraction
• combine existing features to produce a more useful one.
• Create new features by gathering new data
Model Selection
Overfitting or Underfitting
• Overfitting leads to high performance in training set but performs poorly on new data
• e.g., a high-degree polynomial life satisfaction model that strongly overfits the training data
• Small training set or sampling noise can lead to model following the noise than the underlying pattern
in the dataset
• Solution: Regularization Large slope
Smaller slope
High-order
polynomial
• Underfitting when the model is too simple to learn the underlying structure in the data
• Select a more powerful model, with more parameters
• Feed better features to the learning algorithm
• Reduce regularization
Testing and Validation
Performance of ML algorithms is statistical / predictive
• Good ML algorithms need to work well on test data
• But test data is often not accessible to the provider of the algorithm
• Common assumption is training data is representative of test data
• Randomly chosen subset of the training data is held out as validation set
• aka dev set
• Once ML model is trained, its performance is evaluated on validation data
• Expectation is ML model working well on validation set will work well on unknown test data
• Typically 20-30% of the data is randomly held out as validation data
Cross Validation
K-fold validation is often performed
• To reduce the bias of validation set selection process
• Often K is chosen as 10
• aka 10 fold cross validation
• 10 fold cross validation involves
• randomly selecting the validation set 10 times
• model generation with 10 resulting training set
• Evaluate the performance of each on that validation set
• averaging the performance over the validation sets
Choice of Hyperparameters
Modern ML models often use a lot of model parameters
• Known as hyperparameters
• Model performance depends on choice of parameters
• Each parameter can assume a number of values
• Real numbers or categories
• Exponential number of hyperparameter combinations possible
• Best model correspond to best cross validation performance over the set of hyperparameter
combinations
• Expensive to perform
• Some empirical frameworks available for hyperparameter optimization
End to End Machine Learning
• The model to predict the median housing price in any district, given all the other metrics.
• Goodness of the model is determined by how close the model output is w.r.t. actual price for
unseen district data
Framing the Problem
Understand the Business Objective and Context
• Goal is to predict a real valued price based on multiple variables like population, income etc.
c
• regression
v
• Output is based on input data at rest, not rapidly changing data rapidly.
• h is the model, X is the training dataset, m is number of instances, x(i) is i-th instance, y(i) is the
actual price for the i-th instance.
Mean Absolute Error (MAE)
• MAE is preferred for a large number of outliers. aka L1 norm or Manhattan distance/norm.
General Form
Data Types and Representation
Objects
• Same attribute can be mapped to different attribute values 5 No Divorced 95K Yes
• Example: height can be measured in feet or meters
6 No Married 60K No
• Different attributes can be mapped to the same set of values
• Example: Attribute values for ID and age are integers
7 Yes Divorced 220K No
8 No Single 85K Yes
• But properties of attribute can be different than the properties of
the values used to represent the attribute 9 No Married 75K No
10 No Single 90K Yes
10
Discrete and Continuous Attributes
• Discrete Attribute
• Has only a finite or countably infinite set of values
• Examples: zip codes, counts, or the set of words in a collection of documents
• Often represented as integer variables.
• Note: binary attributes are a special case of discrete attributes
• Continuous Attribute
• Has real numbers as attribute values
• Examples: temperature, height, or weight.
• Practically, real values can only be measured and represented using a finite number of digits.
• Continuous attributes are typically represented as floating-point variables.
Types and properties of Attributes
Types
• Nominal
• ID numbers, eye color, zip codes
• Ordinal
• rankings (e.g., taste of potato chips on a scale from 1-10), grades, height {tall, medium, short}
• Interval
• calendar dates, temperatures in Celsius or Fahrenheit.
• Ratio
• temperature in Kelvin, length, counts, elapsed time (e.g., time to run a race)
Properties
• Distinctness: =
• Order: < >
• Differences are + -
meaningful :
• Ratios are * /
meaningful :
Difference Between Ratio and Interval
female} test
• The types of operations you choose should be “meaningful” for the type of data you have
• Distinctness, order, meaningful intervals, and meaningful ratios are only four (among many possible) properties of data
• The data type you see – often numbers or strings – may not capture all the properties or may suggest properties that are not present
• Record
• Data Matrix
• Document Data
• Transaction Data
• Graph
• World Wide Web
• Molecular Structures
• Ordered
• Spatial Data
• Temporal Data
• Sequential Data
• Genetic Sequence Data
Record Data
• Data that consists of a collection of records, each of which consists of a fixed set of attributes
• If data objects have the same fixed set of numeric attributes, then the data objects can be
thought of as points in a multi-dimensional space, where each dimension represents a distinct
attribute
• Such a data set can be represented by an m by n matrix, where there are m rows, one for each
object, and n columns, one for each attribute
timeout
season
coach
game
score
play
team
win
ball
lost
Document 1 3 0 5 0 2 6 0 2 0 2
Document 2 0 7 0 2 1 0 0 3 0 0
Document 3 0 1 0 0 1 2 2 0 3 0
Transaction Data
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Graph Data
2
5 1
2
5
Items/Events
An element of
the sequence
Ordered Data
Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Ordered Data
SpatioTemporal Data
Average Monthly Temperature of land and ocean
Data Preprocessing
Two sine waves Observed signal (sum of the two sine waves) Observed signal with noise
1 3 3
0.8
2 2
0.6
0.4
1 1
0.2
magnitude
magnitude
magnitude
0 0 0
-0.2
-1 -1
-0.4
-0.6
-2 -2
-0.8
-1 -3 -3
0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5
time (seconds) time (seconds) time (seconds)
Outliers
• Outliers are data objects with characteristics that are considerably different than most of the
other data objects in the data set
• Case 1: Outliers are noise that interferes
with data analysis
• Data set may include data objects that are duplicates, or almost duplicates of one another
• Major issue when merging data from heterogeneous sources
• Examples:
• Same person with multiple email addresses
• Data cleaning
• Process of dealing with duplicate data issues
Data Preprocessing
• Aggregation
• Sampling
• Discretization and Binarization
• Attribute Transformation
• Dimensionality Reduction
• Feature subset selection
• Feature creation
Aggregation
Combining two or more attributes (or objects) into a single attribute (or object)
• Purpose
• Data reduction
• Change of scale
• More “stable” data
• Many classification algorithms work best if both the independent and dependent variables have
only a few values
• Example: Iris Plant data set.
• http://www.ics.uci.edu/~mlearn/MLRepository.html
• Three flower types (classes):
• Setosa
• Versicolour
• Virginica
• Four (non-class) attributes
• Sepal width and length
• Petal width and length
Supervised Discretization Example …
How can we tell what the best discretization is?
• Supervised discretization: Use class labels to find breaks
50
40
30
Counts
20
10
0
0 2 4 6 8
Petal Length
• When dimensionality increases, data becomes increasingly sparse in the space that it occupies
• Definitions of density and distance between points, which are critical for clustering and outlier
detection, become less meaningful
Dimensionality Reduction
Purpose
• Avoid curse of dimensionality x2
• Reduce amount of time and memory required by ML algorithms
• Allow data to be more easily visualized
• May help to eliminate irrelevant features or reduce noise e
• Popular Techniques
• Principal Components Analysis (PCA)
• Singular Value Decomposition
• Find a projection that captures the largest amount of variation in data
x1
Dimensionality Reduction: PCA
Increasing # of components improve quality of reconstruction
Feature Subset Selection
Another way to reduce dimensionality of data
• Redundant features
• Duplicate much or all of the information contained in one or more other attributes
• Example: purchase price of a product and the amount of sales tax paid
• Irrelevant features
• Contain no information that is useful for the ML task at hand
• Example: students' ID is often irrelevant to the task of predicting students' GPA
• Many techniques developed, especially for classification
Feature Creation
Create new attributes that can capture the important information in a data set
• More efficiently than the original attributes
• Three general methodologies
• Feature extraction
• Example: extracting edges from images
• Feature construction
• Example: dividing mass by volume to get density
• Mapping data to new space
• Example: Fourier and wavelet analysis
Data Analysis
• The mean is the most common measure of the location of a set of points.
• However, the mean is very sensitive to outliers.
• Thus, the median or a trimmed mean is also commonly used.
• Because of outliers, other measures are often used. Average Absolute Distance is given by
Similarity and Dissimilarity Measures
• Similarity measure
• Numerical measure of how alike two data objects are.
• Is higher when objects are more alike.
• Often falls in the range [0,1]
• Dissimilarity measure
• Numerical measure of how different two data objects are
• Lower when objects are more alike
• Minimum dissimilarity is often 0
• Upper limit varies
• Proximity refers to a similarity or dissimilarity
Similarity/Dissimilarity for Simple Attributes
The following table shows the similarity and dissimilarity between two objects, x and
y, with respect to a single, simple attribute.
Euclidean Distance
• Euclidean Distance
where n is the number of dimensions (attributes) and xk and yk are, respectively, the kth attributes
(components) or data objects x and y.
3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
Minkowski Distance
• r = 2. Euclidean distance
• Do not confuse r with n, i.e., all these distances are defined for all numbers of dimensions.
Minkowski Distance
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Distance Matrix
Correlation measures the linear relationship between objects
Visually Evaluating Correlation
Scatter plots
showing the
similarity from –1 to
1.
Drawback of Correlation
Y
4
3
• mean(x) = 0, mean(y) = 4 2
1
• std(x) = 2.16, std(y) = 3.74
0
-4 -2 0 2 4
X
• Domain of application
• Similarity measures tend to be specific to the type of attribute and data
• Record data, images, graphs, sequences, 3D-protein structure, etc. tend to have different measures
• However, one can talk about various properties that you would like a proximity measure to have
• Symmetry is a common one
• Tolerance to noise and outliers is another
• Ability to find more types of patterns?
• Many others possible
• The measure must be applicable to the data and produce results that agree with domain
knowledge
Visualization
Conversion of data into a visual or tabular format
• Visualization of data is one of the most powerful and
appealing techniques for data exploration.
• Humans have a well developed ability to analyze large
amounts of information that is presented visually
• Can detect general patterns and trends
• Can detect outliers and unusual patterns
• Data objects, their attributes, and the relationships
among data objects are translated into graphical
elements such as points, lines, shapes, and colors.
• Example:
• Objects are often represented as points
• Their attribute values can be represented as the
position of the points or the characteristics of the
points, e.g., color, size, and shape
Sea Surface Temperature (SST) for July 1982
Visualization Techniques: Histograms
• Histogram
• Usually shows the distribution of values of a single variable
• Divide the values into bins and show a bar plot of the number of objects in each
bin.
• The height of each bar indicates the number of objects
• Shape of histogram depends on the number of bins
• Example: Petal Width (10 and 20 bins, respectively)
Two-Dimensional Histograms
90th percentile
75th percentile
50th percentile
25th percentile
10th percentile
Visualization Techniques: Scatter Plots
Attributes values determine the position
• Useful to have arrays of scatter plots can compactly summarize the relationships of several pairs
of attributes
Visualization Techniques: Contour Plots
Continuous attribute is measured on a spatial grid
• Useful when a They partition the
plane into regions of similar values
• The contour lines that form the
boundaries of these regions connect
points with equal values
• Common example: contour maps of
elevation, temperature, rainfall, air
pressure, etc.
Celsius
Surface Sea Temperature
Visualization Techniques: Matrix Plots
Plot data matrix
• Often useful when objects are sorted according to class
• Plots of similarity or distance matrices can also be useful for visualizing the relationships
standard
deviation
Visualization of the Iris Data Matrix
standard
deviation
Visualization of the Iris Correlation Matrix
Other Visualization Techniques
• Star Plots
• Similar approach to parallel coordinates, but axes radiate from a central point
• The line connecting the values of an object is a polygon
• Chernoff Faces
• Approach created by Herman Chernoff
• This approach associates each attribute with a characteristic of a face
• The values of each attribute determine the appearance of the corresponding facial characteristic
• Each object becomes a separate face
• Relies on human’s ability to distinguish faces
Star Plots for Iris Data
Setosa
Versicolour
Virginica
Chernoff Faces for Iris Data
Setosa
Versicolour
Virginica
Software Tools
age latitude
# of households
• rooms_per_household is more correlated with price than total number of bedrooms or rooms.
Data Cleaning
• Some of the instances don’t have total_bedroom values
• Since median applies only to numerical data, create an copy of the data without ocean-proximity
• The imputer stores the median of each attribute the result in its statistics_ instance variable.
• Use this “trained” imputer to replace any missing values by the learned medians
Handling Textual and Categorical Data
Convert the text attributes to numbers
• Scikit-learn provides a transformer
• ML algorithms assume closer values are more similar. But ‘<1H OCEAN’ and ‘NEAR OCEAN’ are far away in
values!
• Solution! Use 1-hot encoding
Test Set Creation
Ensures reproducibility of
• Test set size is 20% of training set results
• Uses uniform sampling of data.
• Not appropriate for heavy tailed distribution
• income very important to predict house prices.
• Important that test set is representative of the various
categories of incomes in the dataset.
• Most income values are around $20–$50K, but some >> $60K.
• Multi-class classification
In this segment
Model Selection and Training
• Select based on training data
• If prediction label/output is available, use regression or classification model
• Regression if real valued output
• Classification if output is discrete (binary/integer)
• else, unsupervised model is used.
• For the house price prediction problem, use regression model since median house prices are
available along with training data (predictors)
• Example: Linear Regression
• Train a classification model for detecting ‘5’. Target output for training data instance
corresponding an image of ‘5’ is +1, else target output is ‘0’
• Perform cross validation like the regression problem and try out multiple classification model for
achieving acceptable performance.
Multiclass Classification
• Multiclass classifiers (aka multinomial classifiers) can distinguish between more than two classes.
• Some algorithms (such as Random Forest classifiers or naive Bayes classifiers) are capable of
handling multiple classes directly.
• Many (such as Support Vector Machine classifiers or Linear classifiers) are strictly binary
• One-versus-all (OvA) or One-versus-rest strategy using multiple binary classifiers.
• e.g., for MNIST classification, train 10 binary classifiers, one for each digit (a 0-detector, a 1-detector, a
2-detector, and so on).
• get the decision score from each classifier for that image and select the class whose classifier outputs
the highest score.
• One-versus-one (OvO) strategy
• train a binary classifier for every pair of digits: one to distinguish 0s and 1s, another to distinguish 0s and
2s, another for 1s and 2s, and so on.
• If there are N classes, you need to train N × (N – 1) / 2 classifiers.
• Run an image through all 45 classifiers and see which class wins the most duels.
• Main advantage of OvO is each classifier only needs to be trained on the part of the training set
for the two classes that it must distinguish
Model Evaluation
PREDICTED CLASS
a: TP (true positive)
Class=Yes Class=No b: FN (false negative)
c: FP (false positive)
ACTUAL Class=Yes a b d: TN (true negative)
CLASS
Class=No c d
Metrics for Performance Evaluation…
PREDICTED CLASS
Class=Yes Class=No
ACTUAL Class=Yes a b
(TP) (FN)
CLASS
Class=No c d
(FP) (TN)
ad TP TN
Accuracy
a b c d TP TN FP FN
Limitation of Accuracy
a
Precision (p)
ac
a
Recall (r)
ab
2rp 2a
F - measure (F)
r p 2a b c
wa w d
Weighted Accuracy 1 4
• Holdout
• Reserve 2/3 for training and 1/3 for testing
• Random subsampling
• Repeated holdout
• Cross validation
• Partition data into k disjoint subsets
• k-fold: train on k-1 partitions, test on the remaining one
• Leave-one-out: k=n
• Stratified sampling
• Bootstrap
• Sampling with replacement
ROC (Receiver Operating Characteristic)
At threshold t:
TP=0.5, FN=0.5, FP=0.12, TN=0.88
ROC Curve
(TP,FP):
• (0,0): declare everything
to be negative class
• (1,1): declare everything
to be positive class
• (1,0): ideal
• Diagonal line:
• Random guessing
• Below diagonal line:
• prediction is opposite of the true class
Using ROC for Model Comparison
ROC Curve:
Class + - + - - - + - + +
P 0.25 0.43 0.53 0.76 0.85 0.85 0.85 0.87 0.93 0.95 1.00
Threshold
TP 5 4 4 3 3 3 3 2 2 1 0
>=
FP 5 5 4 4 3 2 1 1 0 0 0
TN 0 0 1 1 2 3 4 4 5 5 5
FN 0 1 1 2 2 2 2 3 3 4 5
TPR 1 0.8 0.8 0.6 0.6 0.6 0.6 0.4 0.4 0.2 0
• Gradient Descent
• e.g., Learning rate, how long to run
• Mini-batch
• Batch size
• Regularization constant
• Many Others
• will be discussed in upcoming sessions
Hyperparameter Optimization
• Just fiddle with the parameters until you get the results you want
• Downsides:
• As the number of parameters increases, the cost of grid search increases
exponentially!
• Need some way to choose the grid properly
• Something this can be as hard as the original hyperparameter
optimization
Making Grid Search Fast
• This is just grid search, but with randomly chosen points instead of points on a grid.
• RandomSearchCV
• Problem: with random search, not necessarily going to get anywhere near the optimal parameters in
a finite sample.
Cross-Validation
• Partition part of the available data to create an validation dataset that we don’t use for training.
• Automation and monitoring at all steps of ML system construction, including integration, testing,
releasing, deployment and infrastructure management.
• Data scientists can implement and train an ML model with predictive performance on an offline
validation (holdout) dataset, given relevant training data for their use case.
• However, the real challenge is building an integrated ML system and to continuously operate it in
production.
Ecosystem of ML System Components
A small fraction of a real-world ML system is composed of the ML code
DevOps Vs. MLOps
• DevOps for developing and operating large-scale software systems provides benefits such as
• shortening the development cycles
• increasing deployment velocity, and
• dependable releases.
• Two key concepts
• Continuous Integration (CI)
• Continuous Delivery (CD)
• An ML system is a software system, so similar practices apply to reliably build and operate at
scale.
• However, ML systems differ from other software systems
• Team skills: focus on exploratory data analysis, model development, and experimentation.
• Development: ML is experimental in nature.
• The challenge is tracking what worked and what did not, maintaining reproducibility, and maximizing code
reusability.
• Testing: Additional testing needed for data validation, trained model quality evaluation, and model
validation.
DevOps Vs. MLOps
• Data validation: Required prior to model training to decide whether to retrain the model or stop
the execution of the pipeline based on following
• Data values skews: significant changes in the statistical properties of data, triggering retraining
• Data schema skews: downstream pipeline steps, including data processing and model training, receives
data that doesn't comply with the expected schema.
• stop the pipeline to release a fix or an update to the pipeline to handle these changes in the schema.
• Schema skews include receiving unexpected features or with unexpected values, not receiving all the expected
features
• Model validation: Required after retraining the model with the new data. Evaluate and validate
the model before promoting to production. This offline model validation step consists of
• Producing evaluation metric using the trained model on test data to assess the model quality.
• Comparing the evaluation metrics of production model, baseline model, or other business-requirement
models.
• Ensuring the consistency of model performance on various data segments
• Test model for deployment, including infrastructure compatibility and API consistency
• Undergo online model validation—in a canary deployment or an A/B testing setup
Frameworks
Cloud Vendors are providing MLOps framework
• https://
cloud.google.com/solutions/machine-learning/mlops-continuous-delivery-and-automation-pipelin
es-in-machine-learning
• Kubeflow and Cloud Build
• Achieves continuous
delivery of model prediction
service.
•
• Automated data and model
validation steps to the
pipeline
1) Development and experimentation: iteratively try new ML algorithms and modeling. The
output is the source code of the ML pipeline steps that are then pushed to a source
repository.
2) Pipeline continuous integration: build source code and run various tests. The outputs of
this stage are pipeline components (packages, executables, and artifacts).
3) Pipeline continuous delivery: deploy artifacts produced by the CI stage to the target
environment.
4) Automated training: automatically executed in production based on a schedule or trigger.
The output is a trained model pushed to the model registry.
5) Model continuous delivery: serve the trained model as a prediction service for the
predictions.
6) Monitoring: collect statistics on the model performance based on live data. The output is a
trigger to execute the pipeline or to execute a new experiment cycle.
Stages of the CI/CD automated ML pipeline
Continuous Integration
• Pipeline and its components are built, tested, and packaged when
• new code is committed or
• pushed to the source code repository.
• Besides building packages, container images, and executables, CI process can include
• Unit testing feature engineering logic.
• Unit testing the different methods implemented in your model.
• For example, you have a function that accepts a categorical data column and you encode the function as a one-
hot feature.
• Testing for training convergence
• Testing for NaN values due to dividing by zero or manipulating small or large values.
• Testing that each component in the pipeline produces the expected artifacts.
• Testing integration between pipeline components.
Continuous Delivery
Linear Regression
1
Example – Polynomial Curve
Fitting
Line M=3
M=5
Parabola
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Regularization
M=5, with different levels of
regularization
15
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
What is Regression
• Prediction of numerical variables. E.g., predicting value of real estate,
demand forecast in retail, weather forecast etc
• Dependent variable (Y) – the one whose value is to be predicted
• Y is presumed to be functionally related to one (say X) or more
independent variables or predictors
• Regression – finding a relationship/association between Y and X such
that Y = f(X)
• Approaches
• Ordinary Least Squares function fitting given {<x1,y1>…<xn,yn>}
• Gradient Descent
• Bayesian: Choose some parameterized form for P(Y|X; θ) (θ is the vector of
parameters). Derive learning algorithm as MCLE or MAP estimate for θ
16
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Linear Regression
Algorithm -
+ Inc slope
•Choose a random line Dec slope
Inc intercept
Inc intercept
•Epoch = 1000 + +
•Learning rate = 0.01
•Loop (repeat) Inc slope
-
Dec intercept - + Dec slope
• Pick a random point - Dec intercept
17
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Linear Regression
- Dec intercept
18
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Linear Regression - OLS
Sum of Square Error
y = mx + b
y = mx + b → 4.80x + 9.15
y = 4.80x + 9.15
19
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Linear Regression
Size Price
2104 460
1416 232
1534 315
852 178
20
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
• For a fixed value of ɵ, h(x) is a function of x
• J(ɵ) is a function of the parameters ɵ
• For different values of ɵ, we get different J(ɵ)
• For different hypotheses, we get different costs
30
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Gradient Descent
•Hypothesis:
48
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Regularization
60
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Regularization
Regularization is a technique
used for tuning the function by
adding an additional penalty
term in the error function
For M=9:
69
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Summary
78
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Additional References
• Andrew Ng’s videos on Linear Regression (Coursera)
• Luis Serrano video on Linear Regression:
https://www.youtube.com/watch?v=wYPUhge9w5c
• https://medium.com/quick-code/maximum-likelihood-estimation-for-
regression-65f9c99f815d
• https://towardsdatascience.com/linear-regression-simplified-
ordinary-least-square-vs-gradient-descent-48145de2cf76
• Lab capsules on Linear Regression
• https://towardsdatascience.com/introduction-to-bayesian-linear-
regression-e66e60791ea7
• http://bjlkeng.github.io/posts/a-probabilistic-view-of-regression/
• https://towardsdatascience.com/my-journey-into-machine-learning-
class-3-c8139736f550
• https://towardsdatascience.com/understanding-the-mathematics-
behind-gradient-descent-dde5dc9be06e
79
BITS Pilani, Deemed to be University under Section 3 of UGC Act, 1956
Classification Models I
Introduction
• What is Classification?
• Linear Classifier
• Generative and Discriminatory Classifier
Classification
Definition
• Given a collection of records (training set )
• Each record is by characterized by a tuple (x,y), where x is the attribute (feature) set and y is the
class label
• x aka attribute, predictor, independent variable, input
• Y aka class, response, dependent variable, output
• Task
• Learn a model or function that maps each attribute set x into one of the predefined class labels y
Training Set
Apply
Tid Attrib1 Attrib2 Attrib3 Class Model
11 No Small 55K ?
12 Yes Medium 80K ?
13 Yes Large 110K ? Deduction
14 No Small 95K ?
15 No Large 67K ?
10
Test Set
Types of Classifiers
Linear Classifier
• Classes are separated by a linear decision surface (e.g., straight line
in 2-dimensional feature/attribute space)
• If for a given record, linear combination of features x i is >= 0, i.e.,
y=1
it belongs to one class (say, y = 1), else it belongs to the other class (say, x2
y=0 or -1)
• wi s are learned during the training (induction) phase of the classifier. Decision
• Learnt wi s are applied to a test record during the deduction / inferencing y=0 Boundary
phase.
x1
Discriminative
x1
Classification Model I
Naïve Bayes Classifier
8
Bayes Classifier
A generative framework for solving classification problems
• Conditional Probability:
P( X , Y )
P (Y | X )
P( X )
P( X , Y )
P( X | Y )
P(Y )
• Bayes theorem:
P( X | Y ) P(Y )
P(Y | X )
P( X )
Bayes Theorem - Example
Bayesian Learning - Example
ID Headache Fever Vomiting Meningitis
• P(h, -f, v | m) = 2/3 x 2/2 x 2/2 = 0.6666 7 True False True False
8 True False True True
• Hence P(m | h, -f, v) = 0.6666 x 0.3 / 0.6 = 0.33
9 False True False False
10 True False True True
• Another example query instance: h=true, f=true, v=false 1 True True False False
2 False True False False
3 True False True False
• P(m | h, f, -v) = P(h, f, -v | m) x P(m) / P(h, f, -v) 4 True False True False
• = P(h | m) x P(f | h, m) x P(-v | f, h, m) x P(m) / P(h, f, -v) 5 False True False True
• P(-m | h, f, -v) = P(h | -m) x P(f | h, -m) x P(-v | f, h, -m) x P(-m) / P(h, f, -v) 10 True False True True
P ( X 1 X 2 X d | Y ) P (Y )
P (Y | X 1 X 2 X n )
P( X 1 X 2 X d )
• Now we can estimate P(Xi| Yj) for all Xi and Yj combinations from the training data
• Discretization
• Partition the range into bins
• Replace continuous value with bin value
• Attribute changed from continuous to ordinal
• Probability density estimation
• Assume attribute follows a normal distribution
• Use data to estimate parameters of distribution
(e.g., mean and standard deviation)
• Once probability distribution is known, use it to estimate the conditional probability
P(Xi|Y)
a l a l s
Estimate Probabilities from Data o ric o ric u o u
g g it n s
at
e
at
e
on las
c c c c
Normal Distribution Tid Refund Marital Taxable
Status Income Evade
• One for each (Xi,Yi) pair
( X i ij ) 2 1 Yes Single 125K No
1 2 ij2
P( X i | Y j ) e 2 No Married 100K No
1
( 120110 ) 2
27
Baseline: Bag of Words Approach
aardvark 0
about 2
all 2
Africa 1
apple 0
anxious 0
...
gas
...
1
oil
…
1
Zaire
0
Text Classification: A Simple Example
Text Tag • Which tag does the sentence A very close game
belong to? i.e. P(sports| A very close game)
“A great game” Sports
• Feature Engineering: Bag of words i.e., use
“The election was over” Not sports word frequencies without considering order
“Very clean match” Sports • Using Bayes Theorem:
“A clean but forgettable game” Sports P(sports| A very close game)
“It was a close election” Not sports = P(A very close game| sports)
P(sports)
-------------------------------------------------------------
P(A very close game)
• We assume that every word in a sentence is independent of the other ones
• “close” doesn’t appear in sentences of sports tag, So P(close | sports) = 0, which makes
product 0
Laplace smoothing
• Laplace smoothing: we add 1 or in general constant k to every count so it’s never zero.
• To balance this, we add the number of possible words to the divisor, so the division will never be
greater than 1
• In our case, the 14 possible words are
{a,great,very,over,it,but,game,election,clean,close,the,was,forgettable,match }
30
Apply Laplace Smoothing
31
Experiment with NewsGroups
• Given 1000 training documents from each group learn to classify new documents according to
which newsgroup it came from
• (a1): rainy
• (a2): 2 wins in the last 3 matches
• (a3): humidity = normal
• (a4): win toss = true
Solution
3
Logistic regression
• Logistic Regression could help us predict, for example, whether the student passed or
failed. Logistic regression predictions are discrete (only specific values or categories are
allowed). We can also view probability scores underlying the model’s classifications.
• In comparison, Linear Regression could help us predict the student’s test score on a scale
of 0 - 100. Linear regression predictions are continuous (numbers in a range).
• Idea
1
h 𝜃 ( 𝑥 )= −𝜃 𝑥
⊤ 𝑔(𝑧)
1+𝑒
𝑧
Logistic regression
𝑔(𝑧)
𝑧=𝜃 ⊤ 𝑥
Suppose predict “y = 1” if
predict “y = 0” if
Decision boundary
At decision boundary output of logistic regressor is 0.5
• e.g.,
Decision boundary
Age
Tumor Size
• Predict “” if
Learning Model Parameters
• Training set:
• m examples
• n features
Logistic regression:
“non-convex” “convex”
0 h𝜃 (𝑥 ) 1
if 𝑦=0
• J(θ) is convex
• Apply gradient descent on J(θ) w.r.t. θ to find optimal parameters 0 h𝜃 (𝑥 ) 1
Gradient descent
Goal:
Repeat {
𝜕𝜃𝑗 𝑚 𝑖=1
Multi-class classification
𝑥2 𝑥2
𝑥1 𝑥1
One-vs-all (one-vs-rest)
𝑥2
( 1)
h𝜃 ( 𝑥)
𝑥1
𝑥2
(2) 𝑥2
h ( 𝑥)
𝜃
𝑥1 𝑥1
Class 1:
Class 2: (3)
h𝜃 ( 𝑥 ) 𝑥2
Class 3:
( 𝑖)
h ( 𝑥 )=𝑃 ( 𝑦 =𝑖|𝑥 ; 𝜃 ) (𝑖=1 , 2 ,3)
𝜃 𝑥1 Slide credit: Andrew Ng
One-vs-all
• Train a logistic regression classifier for each class to predict the probability that
• Credit Card Fraud : Predicting if a given credit card transaction is fraud or not
• Health : Predicting if a given mass of tissue is benign or malignant
• Marketing : Predicting if a given user will buy an insurance product or not
• Banking : Predicting if a customer will default on a loan.
Classification Models I
Support Vector Machines
• Introduction
• Support Vectors
• Linear Support Vector Machine
• Maximizing Margin
• Handling non linearly separable data
• Non-linear Classification
• Kernel Functions
18
Support Vector Machines
Find a linear hyperplane (decision boundary) that will separate the data
Support Vector Machines
One Possible Solution
B1
Support Vector Machines
Another possible solution
B2
Support Vector Machines
Other possible solutions
B2
Support Vector Machines
B2
Support Vector Machines
Find hyperplane maximizes the margin
• => B1 is better than B2
B1
B2
b21
b22
margin
b11
b12
Support Vector Machines
B1
w x b 0
w x b 1 w x b 1
b11
b12
1 if w x b 1 2
f ( x) Margin
1 if w x b 1 || w ||
Linear SVM
Linear Model
1 if w x b 1
f ( x)
1 if w x b 1
• Learning the model
is equivalent to determining the values of w and b
• How to find w and b from training data?
Learning Linear SVM
𝑦 𝑖 (w • x 𝑖 +𝑏) ≥1 , 𝑖=1,2 , ..., 𝑁
• Objective is to maximize:
2
Margin
|| w ||
• Which is equivalent to minimizing:
2
|| w ||
L( w )
2
• Subject to the following constraints:
1 if w x i b 1
yi
1 if w x i b 1
or
L(w, b, λi)= ||w||2 - Σ λi [yi (wTxi + b) -1]
• This is a constrained optimization problem
• Solve it using Lagrange multiplier method
• Lagrange multipliers λi are 0 or +ve
Learning Linear SVM
λi
Example of Linear SVM
Support vectors
x1 x2 y l
0.3858 0.4687 1 65.5261
0.4871 0.611 -1 65.5261
0.9218 0.4103 -1 0
0.7382 0.8936 -1 0
0.1763 0.0579 1 0
0.4057 0.3529 1 0
0.9355 0.8132 -1 0
0.2146 0.0099 1 0
Learning Linear SVM
• How to classify using SVM once w and b are found? Given a test record, xi
1 if w x i b 1
f ( xi )
1 if w x i b 1
Support Vector Machines
What if the problem is not linearly separable?
Support Vector Machines
What if the problem is not linearly separable?
• Introduce slack variables
• Need to minimize
2
|| w || N k
L( w) C i
2 i 1
• subject to
1 if w x i b 1 - i
yi
1 if w x i b 1 i
• If k is 1 or 2, this leads to similar objective function as linear SVM but with different constraints
Nonlinear Support Vector Machines
What if decision boundary is not linear?
Nonlinear Support Vector Machines
Transform data into higher dimensional space
Decision boundary:
w ( x ) b 0
Example of Nonlinear SVM
• Robust to noise
• Overfitting is handled by maximizing the margin of the decision boundary
• In some sense, the best linear model for classification.
• SVM can handle irrelevant and redundant data better than many other techniques
• The user needs to provide the type of kernel function and cost function
• Difficult to handle missing values
• What about categorical variables?
• Needs to be mapped to some metric space
• which leads to the same set of equations (but involve (x) instead of x)
Learning NonLinear SVM
Issues
• What type of mapping function should be used?
• How to do the computation in high dimensional space?
• Most computations involve dot product (xi) (xj)
• Curse of dimensionality?
Learning Nonlinear SVM
• Kernel Trick:
• (xi) (xj) = K(xi, xj)
• K(xi, xj) is a kernel function (expressed in terms of the coordinates in the original space)
• Examples:
Support Vector Machines
Dr. Chetana Gavankar, Ph.D,
BITS Pilani IIT Bombay-Monash University Australia
Pilani Campus
[email protected]
0
denotes +1 b=
+
x How would you
denotes -1 w
classify this data?
w x + b<0
denotes +1
denotes -1 How would you
classify this data?
denotes +1
denotes -1 How would you
classify this data?
denotes +1
denotes -1 Any of these
would be fine..
..but which is
best?
denotes +1
denotes -1
How would you
classify this data?
Misclassified
to +1 class
f(x,w,b) = sign(w x + b)
denotes +1
denotes -1 Define the margin
of a linear
classifier as the
width that the
boundary could be
increased by
before hitting a
datapoint.
w = Σ αi yi xi
Taking partial derivative with respect to b, = 0
- Σ α y = 0
i i
Σ αi yi = 0
Ref:
https://towardsdatascience.com/support-vector-machines-soft-margin-formulation-and-kernel-tri
ck-4c9729dc8efe
BITS Pilani, Pilani Campus
Effect of Margin size v/s
misclassification cost
Generalizes better
space:
0 x
Φ: x → φ(x)
Anita Ramachandran
Question 1
Solution 1
Question 2
Solution 2
Question 3
Solution 3
Question 4
Vijay is a certified Data Scientist and he has applied for two companies -
Google and Microsoft. He feels that he has a 60% chance of receiving
an offer from Google and 50% chance of receiving an offer from
Microsoft. If he receives an offer from Microsoft, he has belief that
there are 80% chances of receiving an offer Google.
• If Vijay receives an offer from Microsoft, what is the probability that
he will not receive an offer from Google?
• What are his chances of getting an offer from Microsoft, considering
he has an offer from Google?
Solution 4
Vijay is a certified Data Scientist and he has applied for two companies -Google and Microsoft. He
feels that he has a 60% chance of receiving an offer from Google and 50% chance of receiving an
offer from Microsoft. If he receives an offer from Microsoft, he has belief that there are 80%
chances of receiving an offer Google.
• If Vijay receives an offer from Microsoft, what is the probability that he will not receive an offer
from Google?
• What are his chances of getting an offer from Microsoft, considering he has an offer from
Google?
Ans
• P(not g| m) = 0.2
• P(M|G)=0.67
Question 5
From an insurance company, people have purchased the travel insurance to be safe and
experiencing the world. The below dataset describes the listing purchase transactions in 2015. List
at least 6 issues with the below available dataset which are required for Data Pre-processing.
BITS Pilani
Pilani Campus
Introduction
sns.histplot(X[col], kde=True)
feature_importances = dt_classifier.feature_importances_
Runs the genetic algorithm using the eaSimple function from the
algorithms module.