Environment, Development and Sustainability

(ISBN: 978-93-95847-87-2)

Published by

Department of Zoology, Vidyasagar College for Women, Kolkata

Editor-in-Chief

Dr. Sutapa Ray

M.A., Ph.D.
Principal
Vidyasagar College for Women, Kolkata

Editors

Mr. Debkanta Ghosh Dr. Sanjib Saha

M.Sc., B.Ed., M.Sc., M.Ed., Ph.D., Post Doc, SRFIASC, FASC, FIARA

Assistant Professor & Head, Assistant Professor in Zoology &

Department of Zoology, Assistant Coordinator in IGNOU (LSC)

Vidyasagar College for Women, Vidyasagar College for Women, Kolkata

Kolkata Former Project Assistant (CU, UGC, DRDO)

and PI in the research project (WBDSTBT)

March 2024
Copyright Editors

Title: Environment, Development and Sustainability

Editors: Dr. Sutapa Ray, Mr. Debkanta Ghosh, Dr. Sanjib Saha

First Edition: March, 2024

ISBN: 978-93-95847-87-2

All rights reserved. No part of this publication may be reproduced or transmitted, in any

form or by any means, without permission. Any person who does any unauthorized act in

relation to this publication may be liable to criminal prosecution and civil claims for

damages.

Published by:

BHUMI PUBLISHING

Nigave Khalasa, Tal – Karveer, Dist – Kolhapur, Maharashtra, INDIA 416 207

E-mail: [email protected]

Disclaimer: The views expressed in the book are of the authors and not necessarily of the

publisher and editors. Authors themselves are responsible for any kind of plagiarism found

in their chapters and any related issues found with the book.
 PREFACE

We are delighted to publish our book entitled "Environment, Development and

Sustainability". This book is a compilation of esteemed articles by acknowledged

experts in the fields of environmental science, Biology & Social sciences.

“Environment, Development and Sustainability” draws on knowledge and

methods from many fields of the sciences and social sciences. Many environmental

specialists adopt an interdisciplinary approach to integrate these different ways of

knowing to help understand and prevent environmental damage. This book also

adopts an interdisciplinary approach by drawing on a variety of disciplines.

The articles in the book have been contributed by eminent scientists and

academicians. Our special thanks and appreciation go to experts and research workers

whose contributions have enriched this book. We thank our publisher Bhumi

Publishing, India for taking pains in bringing out the book.

Finally, we will always remain a debtor to all our well-wishers for their

blessings, without which this book would not have come into existence.

Editors
Dr. Sutapa Ray

Mr. Debkanta Ghosh

Dr. Sanjib Saha

 TABLE OF CONTENTS

Sr. No. Book Chapter and Author(s) Page No.

1. AN OVERVIEW ON THE WASTEWATER TREATMENT AT EAST 1–7
KOLKATA WETLAND OF WEST BENGAL, ENHANCING THE SEWAGE
FED AQUACULTURE
Mayukhmala Mandal
2. INTEGRATED PADDY-CUM-FISH FARMING AND SUSTAINABLE 8 – 14
FOOD PRODUCTION IN INDIA: AN OVERVIEW
Ranu Naskar and Sambit Kumat Mistri
3. BIOFOULING: A THREAT IN MARINE FISH CULTURE AND REMEDIES 15 – 29
Suchismita Chatterjee Saha
4. AGEING IN WEST BENGAL AND CHALLENGES 30 – 38
Baisakhi Roy
5. BREATHLESS-ASSESSING THE AIR QUALITY - A CASE STUDY OF 39 – 50
KOLKATA
Arunima Bhattacharya
6. A COMPREHENSIVE REVIEW ON IMPORTANCE OF BELLAMYA 51 – 61
BENGALENSIS IN THE CONTEXT OF ECOTOXICOLOGICAL STUDY
Triparna Roy, Dipanwita Sarkar Paria,
Soumendranath Chatterjee and Shubhajit Saha
7. DNA VACCINE: TRIALS AND POSSIBLE THERAPEUTIC APPROACHES 62 – 75
Paromita Mondal, Madhurima Sharma,
Prateeti Chattopadhyay and Sutapa Datta
8. URBAN BIODIVERSITY: LIFE AMIDST CONCRETE JUNGLE 76 – 87
Amit Mahata
9. EXAMINING THE POLITICAL BUDGET CYCLE: A CASE STUDY OF 88 – 94
MEDICAL AND PUBLIC HEALTH EXPENDITURE IN VIDHAN SABHA
ELECTIONS IN INDIA
Ankita Biswas
10. STUDIES ON PATHOGENIC BACTERIAL DIVERSITY IN SUBHAS 95 – 106
SAROBAR, KOLKATA CONCERNING PUBLIC HEALTH
Srijoni Basak, Jyoti Choudhury, Priya Mandal, Koena Sarkar,
Misha Parveen SK, Disha Bhagat and Sanjib Saha
11. ECO-REHABILITATION OF DEMATERIALIZING ORCHIDS THROUGH 107 – 113
IN VITRO SEED CULTURE
Ranju Tamang
12. AN OVERVIEW OF SUSTAINABLE DEVELOPMENT IN INDIAN 114 – 119
PERSPECTIVE
Prosenjt Ghosh
13. AQUAPONICS: AN ADVANCED INTEGRATED FARMING 120 – 126
Anasuya Majumdar
14. ANTHROPOCENE AQUATIC BODIES: THREATS AND CONSERVATION 127 – 135
Shampa Bag
15. RECOMMENDATIONS OF BALANCED NUTRITION USING LOCAL 136 – 146
FOOD SOURCING FOR SANTHAL TRIBAL COMMUNITIES
Abhaya Dutta
16. SENSITIZATION OF SCHOOL STUDENTS FOR SCHOOL GARDEN AND 147 – 151
SUSTAINABLE -UTILIZATION
Sima Biswas
17. ASIAN SOYBEAN RUST: AN UPCOMING THREAT TO SOYBEAN 152 – 167
CULTIVATION
Disha Dasgupta, Anuron Banerjee, Arijita Majumder,
Anamika Paul, Nilanjan Chakraborty
18. INSECT BIODIVERSITY: PINPOINTING THEIR BENEFICIAL ROLE 168 – 176
Chaitali Banerjee
19. THE ROLE OF ECOTOURISM IN BIODIVERSITY CONSERVATION 177 – 184
EFFORTS IN TRIPURA, INDIA
Dipak Das and Samik Acharjee
20. IMPACT OF FOOD SAFETY AND FOOD CONTAMINATION ON 185 – 198
COMMUNITY HEALTH
Madhurima Sharma, Prateeti Chattopadhyay,
Paromita Mondal and Sutapa Datta
21. DIRECTING HUMAN FOOD HABITS TOWARD GLOBAL 199 – 206
SUSTAINABILITY
Biswajit Saha
22. A REVIEW ON ARSENIC: A DUAL PLAYER CYTOTOXIC AND 207 – 214
CYTOPROTECTIVE
Priyanka Chakraborty
23. SUSTAINABLE DEVELOPMENT OF RIVER FRONT GHATS OF 215 – 224
VARANASI, UTTAR PRADESH
Shouvonik Bala
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

AN OVERVIEW ON THE WASTEWATER TREATMENT AT EAST KOLKATA

WETLAND OF WEST BENGAL, ENHANCING THE SEWAGE FED
AQUACULTURE
Mayukhmala Mandal
Department of Zoology, Charuchandra College, Kolkata- 700 029
Affiliated with University of Calcutta
Corresponding author E-mail: [email protected]

Abstract:
Conservation of natural resources to attain an environmentally sustainable condition has
become prime important in present days. Unutilized wastes from diverse origins should be
returned to the ecosystem to perform various welfare activities. Otherwise, they may affect the
biodiversity of the area and even become hazardous to biotic life. Public health engineers have
provided various waste treatment technologies to minimize such effect of wastes. The only large
scale formal system of wastewater fed aquaculture is located in the East Kolkata wetland (EKW)
in peri-urban Kolkata, West Bengal. The 12500ha EKW was designated a Ramsar site in 2002,
primarily as an example of the wise use of a wetland and greatly contributes towards purification
of city. EKW was previously known as the Waste Recycling Region (WRR). Wastewater feed
aquaculture was thought to have great potential for the future because it produces low-cost fish at
the same time it provides a low cost method to treat waste water that is often otherwise directly
discharge into surface waters. The present review intended to categorize different aspects that
have contributed to its operational view with respect to the general decline in the use of waste
water in aquaculture.
Keywords: Wetland, Sewage, Wastewater, Treatment Plant, Aquaculture.
Introduction:
Wetland ecosystem is a complex ecological process where different developmental
management occurs, at the same time it protects the environment and the farmers who adapt
different recovery activities. It is very important for fisheries and agriculture too where the
sewage from city is widely used. The East Kolkata wetland is the one of the best example of
largest wetland ecosystem in the world for sewage fed fisheries [1]. In this ecosystem, the local
farmers developed various resource recovery systems using waste water from the metropolitan
city [2]. This was accomplished by constructing and maintaining a waste water treatment plant.
The East Kolkata wetland has been recognized as a Ramsar Site in November, 2002 [3]. This
wetland comprises of intertidal marshes that include salt marshes and salt meadows with
significant waste water treatment areas.

1
Bhumi Publishing, India

The Basic Information:

The main outfall for drainage of Kolkata is the swarm water channel which falls into the
Kulti River. Other than this outfall, some areas of the Kolkata city are drained by the Baghjola
khal, Tolly’s nullah, Belighata-circular—Kestopur canal and Hoogly. East Kolkata Wetland
receives sewage only from the basin under the storm channel. The entire area is drained by four
major pumping stations namely Dhapa lock pumping station, Ballygunge pumping station,
Topsia pumping station and Chowbaga pumping station.
Study Site:

Map of East Calcutta Wetlands (ECW) (Google Map), Kolkata [Inset showing the location
of ECW in the map of India]
Geographical Area of East Kolkata Wetlands:
Kolkata is located at 22°20´N 88°20´E in the Ganges delta at an elevation ranging
between 1.5m (5ft) to 9m (30ft). It spread linearly in a north-south direction along the banks of
Hooghly River. Much of the city was originally a vast wetland, reclaimed over the decades to
accommodate the city’s growing population. Under the Ramsar Convention the remaining part of
the East Kolkata wetlands has been designated as a “wetland of international importance” [3].
The total area of East Kolkata Wetland is 12,741.30 hectare, out of this the total water
body is about 5,852.14 hectare and comprising of 364 sewage fed fisheries, several other bodies,
Agricultural area, Garbage disposal site, urban and rural settlements area. Before 1930 the main
water source was the tidal Bidyadhari River. With the silting up of this river, the entire area

2
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
became a vast derelict swamp and for thriving the traditional fisheries in these wetland areas
there was a desperate need for an alternate source of water. The role of city’s sewage in this
matter was quickly appreciated and utilized. The entry of the increasing volumes of sewage from
Kolkata leads to considerable downfall of salinity, which was ideal for the fresh water fish
culture. Presently, 3,898.70 hectare out of 5,862.14 hectare water areas are used for sewage fed
fish framing. This total yield from this sewage fed fisheries is about 30,000 ton per year [4].
Climate:
Kolkata has a tropical wet-and dry climate having 26.8°C (80.2°F) annual mean
temperature and monthly mean temperatures range from 19°C (66.2°F) to 30°C (86.0°F).
Rainfall is due to the Bay of Bengal branch of South-West monsoon occuring between June and
September and supplies the city with most of its annual rainfall of 1,582 mm (62 in). The highest
rainfall occurs during August and is about 306mm (12in). The city receives 2,528 hours of
sunshine per annum, with the maximum sunlight occurring in March. Pollution is a major
concern in Kolkata, and the Suspended particulate Matter (SPM) level is high when compared to
other major cities of India, leading to regular smog and haze. Sever air pollution in the city leads
to rise in pollution-related respiratory ailments such as lung cancer.
The Role of East Kolkata Wetlands as a Waste Recycling Region
Methods of Operation of Sewage fed Fisheries in General:
These fisheries are needed to make dry in every alternate 2 to 3 years during winter
months. After de-watering of the fisheries the bottom is ploughed and treated with lime. After
one month the sewage is allowed into the fishery for 4 to 7 days depending on the area of the
fisheries to fill upto the depth of 18-24 inches. The color of the water at this time remains deep
black. After 3 to 4 days, the colour turns deep green due to algal bloom. After another 10 to 12
days the algal bloom is removed by netting. The water color of the fishery now becomes
transparent. Then gradually it turns into light green. Fishery is now ready for pisciculture.
Fingerlings are introduced into the fishery. The time required from de-watering of the fishery to
introduction of the fingerlings is generally 25-30 days. During the culture period sewage is
allowed into the fishery for 2-4 hours per day depending on the area and quality of water.
Supplementary feeding or pond fertilization is not required during the culture period. Only lime
is added occasionally according to the need [5].
Treatment of Sewage Fed fisheries:
The organic matter decomposed under aerobic or anaerobic condition. There is a
continuons supply of free dissolved oxygen and it is very necessary to reduce the organic content
of dilute liquid wastes. In case of solid waste, it must be liquefied and where the waste are highly
concentrated such as solids from domestic waste water, settled organic solids and from abattor's
where anaerobic digestion is very fruitful.

3
Bhumi Publishing, India

Aerobic Process:
In case of aerobic digestion of organic matter, carbon act as the source of energy for the
organism respired as carbon dioxide. The organisms are mostly bacteria, fungi and protozoa.
They react with phosphorus with the reminder carbon and nitrogen to form a new cell. In case of
domestic waste waters, the weight of cell produced is equal to 40% of 60% of chemical oxygen
demand (COD) and Biochemical oxygen demand (BOD) removed.
During treatment process, the quantity of oxygen required for stabilizing the organic
material in the waste depends on BOD which is very satisfactory. This BOD is the oxygen that
stabilizes the waste material, produced by the process of photosynthesis, in the pond. This
oxygen transferred across the air-water interface and obtained from oxygen containing
compound such as nitrates, phosphates and sulphates. For designing a successful treatment plant
it is very important factor to know the rate at which the oxygen is used.
From the complex organic waste compounds, aerobic microorganisms synthesize new
cellular material. For this reason, some of the organic material is consumed for making
protoplasm and some waste material is degraded into low energy compounds. During the aerobic
digestion process oxygen is required continuously. It acts as the final hydrogen acceptor during
the process of oxidation of organic matter and if oxygen is not present, the reaction ceases.
During this hydrogen transfer process energy liberation occurs [6].
Anaerobic Process:
The process of anaerobic fermentation is a two steps process. Firstly, the facultative
heterotrophs that produces acids degrades the organic matter into fatty acids, aldehydes, alcohols
etc. Secondly, methane (CH4), ammonia (NH3), carbondioxide (Co2) and hydrogen (H₂) are
produced by the action of methane bacteria, converting the intermediate product [6].
The anaerobic activity mainly takes place in the bottom layer or sediments. The ponds are
designed where aerobic digestion takes place but in case of deep pond there is a layer of liquid
present near the bottom, where anaerobic organisms present and anaerobic digestion take place
Biological Reactions:
Biological reactions in waste stabilization ponds include the oxidation of organic material
by anaerobic bacteria, nitrification of protein and nitrogenous material by aerobic bacteria,
reduction of organic material by anaerobic bacteria in bottom deposits, and oxygenation of
surface liquids by algae.
Oxygen Demand:
Expressing the oxygen demand of wastewater for the oxidation of its reduced matter
content involves the biochemical oxygen demand (BOD) and chemical oxygen demand (COD).
While these values measure different aspects, they serve as useful indicators of the total oxygen

4
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
demand on a treatment plant or waterway. Oxidizable nitrogenous material is typically measured
using the BOD test, while the COD expresses the overall demand.
Physical and Chemical Parameters at East Kolkata Wetlands:
Parameters Sewage Fishery (Bheri) water
Range Average Range Average
Total solid (ppm) 840-1150 895 330-870 440
Total dissolve solid (ppm) 470-810 675 10-680 445
Total suspended solid (ppm) 80-230 211 30-210 123
Total acidity as CaCo3 37.12-321.8 127 - 18.8
Turbidity (NTU) 55-80 67.4 15-56 38.2
Total alkalinity, CaCo3 (ppm) - 437.65 - 268.25
BOD (ppm) 85-230 95 35-50 45
COD (ppm) 270-516 359 55-140 95
Total inorganic Nitrogen (ppm) 364-1092 553 154-490 320
Total organic Nitrogen (ppm) 16.24-56.0 32.14 5.6-25.2 13.14
Totalhardness (ppm) 320-624 511.81 320-624 425
Total Phosphorus (ppm) - 15.04 - 3.61
Dissolve Phosphorus (ppm) - 5.64 - 1.90
The Basic Hydrological Input of East Kolkata Wetland:
The main outfall for drainage of the city of Kolkata is the Storm Water Channel which
falls into river Kulti. Other than this outfall, some areas of the Kolkata City are drained by the
BaghjolaKhal, Tolly’sNullah, Belighata-Circular-Kestopur Canal and river Hoogly. East Kolkata
Wetland Receives sewage only from the basin under the Strom Water Channel. The entire area is
drained by four major pumping stations.
Kolkata City Sewage in East Kolkata Wetland:
City sewage is slightly buffered due to the presence of both organic and inorganic salts;
the pH remains near to neutral. The sudden increase at the Chowbhaga collection point of the
SWF channel water is basically due to mixing of well-alkaliner waste water of the tannery waste
cannel. The sewage water again assumes a near neutral pH at Bantala, few kilometers away from
Chowbhaga, due to the dissolved and suspended calcium hydroxide acquired from the tannery
waste being removed as soluble salt precipitated as insoluble calcium compounds. In fishery
water the average pH is 7.5. Total suspended solids are reduced to half of the sewage in the
fishery water. Biochemical Oxygen Demand (BOD) decreases gradually in the swage canal with
distance as from pumping station to Kulti River. In the fisheries the BOD remains within range
from 35 to 50 ppm. Chemical Oxygen Demand (COD) values in the sewage vary from 270 to
516 ppm. COD is drastically reduced in the fishery and remains within the ranges from 55 to 140
5
Bhumi Publishing, India

ppm. Reduction of total acidity of sewage (as CaCO3) takes place in the fishery from the average
of 127 ppm to the average 18.8 ppm. The values of total inorganic nitrogen and phosphorous are
also much lower in fishery water. In receiving water, the level of chromium is average 5.8 ppm.
In fishery chromium is reduced to the level of 0.08 ppm. The presence of copper in the sewage is
very lower. Reduction of lead and zinc in the fishery water is insignificant. Results of MPN
shows the decay ranging from 99.9% to 99.99% in fishery. The same trend is also observed in
the fecal coliform, coliform and salmonella count [7].
Importance of East Kolkata Wetland
Social & Cultural Values:
The East Kolkata Wetlands provide three basic securities in its fish ponds fields and
garbage farms, which are critical for any third world countries. These involve food, sanitation
and livelihood. The East Kolkata wetland is the vital component of the friendly water regime that
provides ecological security to the mega city of Kolkata [7].
Threats:
Land use changes over a period of time have led to conversion of some of the largest fish
farms from pisciculture to paddy cultivation. Large numbers of industries make unauthorized
connection of their waste water effluent without treatment to the recently laid sewers emptying
into the city outfall channels flowing eastwards.
Conservation Measures:
This has caused substantial amount of metal deposition in the canal sludge and rendered
the waste water incapable of ensuring the edible quality of the fish and vegetable grown in the
wetland.
The conservation area boundary for the East Kolkata wetlands and waste-recycling
region was mapped in 1985 by the State Planning Board, Government of West Bengal. This
wetland area is protected by order of the Kolkata High Court in 1992, which prohibits change in
land use. High Court has directed the State Government to take recourse to statutory cover, if
required to prevent any private alienation of land. Recently, the director of land Records, Govt.
of West Bengal has issued a fresh order prohibiting any conversion of land use within the
conservation area boundary and declaring all such conversions that have taken place since 1992,
as void. Filling up of water bodies in this area is not permissible under west Bengal Town and
Country (Planning and development) Act, 1979 as well as under the West Bengal Inland
Fisheries Act, 1984 (with amendment in 1993).
Recycle:
(a) Wetlands absorb and treat in the most efficient, economical and natural way the huge
volume of sewage and wastewater and urban solid and air wastes generated by the Kolkata
city-at no cost to the city but with much gain.

6
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
(b) It fulfills substantially the requirement of fish, vegetables and food-grains in the city.
(c) It also absorbs the pollution from and purifies the air that citizens breathe.
(d) It absorbs and passes down to downstream creeks and the sea the flood waters that the
monsoon downpours bring down on the city.
(e) Wetlands also provide a habitat for a variety of flora and fauna and living organism endemic
to wetlands.
(f) They provide the food chain and Waste-to-wealth recycling so unique and essential to this
city.
(g) They maintain the micro climatic of the region.
(h) They maintain the delicate ecological balance in a fragile environment and ecosystem [8].
Conclusion:
Wetlands maintain the micro climatic of a particular region and provide the food chain
and Waste-to-wealth recycling. They are a habitat for a variety of endemic flora and fauna.
Wetlands absorb and treat the huge volume of sewage in an economical and natural way.
Further, wastewater feed aquaculture has great potential for the future as it produces low-cost
fish at the same time it provides a low cost method to treat waste water that is often otherwise
directly discharge into surface waters. Considering all this in mind it can be stated that
conservation of natural resources to attain an environmentally sustainable condition can be
achieved by maintaining a wetland fed by the waste water of a city.
References:
1. Banerji, Suranjana (2014). State-owned Sewage-fed Fisheries of the East Kolkata
Wetlands: An Overview IOSR Journal of Humanities and Social Science (IOSR-JHSS)
Volume 19, Issue 4, Ver. I (Apr. 2014), pp,11-17
2. Kundu, N., Pal, M. and Saha, S. (2008). East Kolkata wetlands: a resource recovery system
through productive activities. Pro. Taal 2007: the 12th World Lake Conf.: 868-881 (ED.
Sengupta, M. and Dalwani, R., 2008).
3. East Kolkata Wetlands Newsletter November 2010, Vol.1
4. Ghosh, D. (1988). In “Wastewater-Fed Aquaculture in the Wetlands of Calcutta-An
Overview, (India-East Kolkata-Making the Most of It: Wastewater, Fishponds and
Agriculture)
5. Ghosh, D. (2005). Ecology and Traditional Wetland Practice: Lessons from Wastewater
utilization in the East Calcutta Wetlands. Kolkata: Worldview.
6. GloynaEarnes F and Eckenfelder W Wesley, (1968). Advances in water quality
improvement. Austin University of Texas Press.
7. Wise use of Wetland: East Kolkata wetland, A case study – Dr. TapanSaha, IESWM.
8. Mitra, B., S.K. Das and D. Banerjee (2001). Wetland Ecosystem A Field Guide.

7
Bhumi Publishing, India

INTEGRATED PADDY-CUM-FISH FARMING AND SUSTAINABLE FOOD

PRODUCTION IN INDIA: AN OVERVIEW
Ranu Naskar*1 and Sambit Kumat Mistri2
1Department of Zoology,
Jogamaya Devi College, Kolkata-700 026.
2ECE Department,
Ambedkar DSEU Shakarpur Campus-1, Delhi-110 092.

Abstract:
Integrated paddy-cum-fish culture is a type of dual system of farming paddy with fish
culture utilizing same resources in common plot, where paddy is the main enterprise and fishes
are cultured for additional income. In India, it has been largely practiced in traditional way in
North-eastern region. The basic principle of efficient integrated farming is based on the fact that
there is efficient utilization of the synergistic effects of inter-related farm activities including the
full utilization of farm wastes, and their conservation. The motive of integrated fish farming is to
benefit the rural poor people and farmers of India. Indian farmers have evolved the techniques of
rice-fish integrated farming, mostly in rain-fed lowlands over the years. Further, the ever-
increasing population of India and its food demand has resulted in the increased use of modern
technology in integrated paddy-cum-fish culture. Now days, sustainable practices are done
through integrated rice-fish farming system, that optimizes wise use of resources maintaining
sustainable environmental conditions, and socio-economic stability to farmers. It also contributes
to household income, food security and nutrition to rural integrated farming system practiced in
India.
Keywords: Paddy-Cum-Fish Culture, Food Production, Aquaculture
Introduction:
Achieving food security and adequate nutrition for all by mitigating hunger, and
promoting sustainable agriculture is one of the proposed sustainable development goals to be
attained by 2030. But pandemic period had seriously challenged food security and livelihoods of
millions of people in India. Also there has been a significant rise in malnutrition status among
women and children. In present scenario food and nutrition security for people below poverty
line and eradication of hunger is a big challenge in India. Hence, a sustainable agricultural
approach towards integrated paddy-cum-fish cultivation would be one of the ideal practices in
rural areas. It would provide food security and livelihoods for numerous communities across
India and worldwide.

8
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
In India, total inland fish production has reached to 174 lakh tonnes in 2022-23 providing
livelihood opportunities to millions of people (The Economic Times, 2023). Still, the practice of
fish culture in combination with agriculture or livestock by utilizing full resources is usually seen
in traditional ways in various parts of India. This is integrated fish farming, which is based on the
concept that ‘there is no waste, and waste is only a misplaced resource which becomes a valuable
material for another product’ (FAO, 1977). Integrated fish farming refers to the growing of
crops, preferably paddy as well as rearing of fish in coordination in the same plot of land. In
India, states like West Bengal, Bihar, Odisha and Utter Pradesh, paddy-cum-fish co-culture is
well practiced in rain-flooded lowland areas. Besides, integrated rice-fish farming has been
traditionally practiced in many north-east states and southern India, especially parts of Kerala.
To promote rice-fish technology in rice-growing belts of India, the Indian Council of
Agricultural Research (ICAR)-National Rice Research Institute, Cuttack, Odisha, has developed
some adoptable modern rice based integrated farming system by integrating various enterprises
to provide sustainability in production, economic stability, and environmental security for
farmers (Nayak et al., 2020).
Selection Criteria and Preparation of Paddy Field:
The plot selected for paddy-cum-fish culture is usually prepared in the month of January-
February with their raised embankment all around (40-50 cm), and should be comparatively flat.
(i) The width of bund should be 1.5 m at the bottom and 1.0 m at the top to prevent leakage
and escape of cultivated fingerlings and fish during floods, and to retain water up to
desired depth.
(ii) Prevention of both escape of fish and predatory fishes are avoided through provisions of
weirs and screens, like bamboo slats and piece of fish net material may be used.
(iii) The paddy field may be provided with inlet and outlet. Soil of the field should be fertile
and rich in organic matter with high water holding capacity. The plot must be holding
water for several months and up to the depth of 30 cm.
(iv) Fishes are cultured unaffected by pesticides or chemicals used to protect paddy.
(v) Stoking of fish seed in paddy field would be done after 10-15 days paddy transplantation.
Selection Criteria for Targated Fish Species:
(i) The fish must be capable of tolerating very shallow water level with low DO level and high
turbidity.
(ii) Fish should be able to withstand higher temperature and variable temperature fluctuations.
(iii) Fish species having faster growth rate to marketable size in short period.
(iv) Examples of fish highly suitable for rice-fish farming are- Common carp (Cyprinus
carpio), Murrel (Ophiocephalus striatus), Spotted snakehead Ophiocephalus punctatus),

9
Bhumi Publishing, India

(Rohu (Labeo rohita), Catla (Catla catla), Silver carp (Ctenopharyn godonidella), Tilapia
(Oreochromis sp.), Mrigal (Cirrhinus mrigala) (Saikia et al., 2015; Poonam et al., 2019).
Different Models of Integrated Paddy-Cum-Fish Farming:
Based upon the slope of the land three types of layouts have been proposed for
construction of rice-fish-culture plot (Figures 1-4).
1. Perimeter Trench Model:
This type of plot is constructed in the zone of moderate elevation, where trenches are dug
out in the periphery of the paddy field and rice cultivation area remains in the idle of the plot. In
1 ha plot, the central part selected for paddy cultivation is about 0.67 ha, and perimeter trenches
occupies about 0.2 ha with perimeter dykes of another 0.12 ha.
2. Central Pond Model:
Here, fish culture occurs at the centre of the plot and paddy growing region surrounds the
pond. In 1 ha plot area, part of the field for paddy cultivation is about 0.65 ha, while fish pond
area would be 0.35 ha with peripheral dyke space of 0.002 ha. The dimensions of perimeter dyke
are- 20 cm width and 30 cm height.
3. Lateral Trench Model:
In this case, a trench is dug at one end of a moderately sloping paddy field of dimensions
top width 18 m, base 15 m and depth 1.5 m, or pond are dug at opposite ends of the paddy field.
The total water area should be one-third of land area.
Types of Major Paddy-Cum-Fish Culture Systems:
1. Simultaneous Culture or Co-current Method:
In this method, paddy and fish are grown together in the same field at same time. Here,
fish are raised in a trench or refuge pond lying in the periphery or in the centre of paddy field.
This type of integrated farming is practiced on the rain-fed plain and medium lowlands of area
0.1 hr economically. Usually, four rice plots of 250 m2 (25x10 m) are formed in each plot, and a
canal like ditch is created in each plot which has connection with main water supply through
inlet outlet system. The trench serves as capture channel when water level lowers, and also as
refuge when fishes are not foraging. Fish stock density are supposed to be 1 cm Fry @ 5000/ha
and 8-10 cm fingerling @ 2000/ha. Fishes are harvested about one week prior the rice harvest.
After 10-20 weeks of culture, paddy fields are slowly drained off.
2. Alternate Culture or Rotational Method:
In alternate farming method rotational cultivation of paddy and fish is practiced in deeply
flooded lowlands, and fish are raised in the paddy field during paddy off-season. Here, culture is
done alternately when paddy field is converted into a fish pond after paddy harvest. Fish species
like murrels, catfishes, and any carp species are suitable for culture. After rice harvesting the

10
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
field is prepared for fish culture. This system of culture is high yielding than simultaneous
system.

Figure 1 Figure 2

Figure 3 Figure 4
Figures 1-4: Photographs showing Integrated paddy-cum-fish farming in West Bengal

Traditional Methods Practiced in India:

Integrated-paddy-cum-fish farming has been traditionally practiced in many parts of
eastern India, of which most popular ones are Zabo cultivation in Nagaland, Bheri system in
Sundarbans of West Bengal, Apatani farming in Arunachal Pradesh, and also in some parts of
Kerala as Pokkali system. In these systems millions of hectares of seasonal rain-fed flooded
plains are effectively utilized for integrated farming. Trapping fish in such rice farming fields has
been a traditional practice by most small scale farmers (Sathoria and Roy, 2022).
1. Pokkali System in Kerala:
In southern India traditional farming system known as Pokkali is practised in Kerala,
where the cultivation of salt-tolerant traditional varieties of rice are grown in coastal saline
region and alternated with fish-prawn farming on a rotational basis. The soil is rich in organic
matter ad becomes saline during summer months due to ingression of salt water. Rice is

11
Bhumi Publishing, India

cultivated when fields are flooded with heavy monsoon rains, washing off the salinity. Generally,
manuring operations are not needed in Pokkali farming systems as paddy obtains its nutrients
from the waste material excreted by prawns. Fish and prawn are cultivated immediately after the
harvest of rice, where water enters the field through high tide (Nayak et al., 2020).
2. Zabo Cultivation in Nagaland:
In Zabo cultivation, indigenously practiced by the Chakhesang tribe of Kikruma village
in Nagaland, is a combined system of forest, horticulture, agricultural practice, fishery, and
animal husbandry with well founded soil and water conservation. In this agricultural practice,
hill has three tier divisions involving conservation of forests on the hill top. The middle section
of hill is for residential purposes, and ponds are dug for rainwater harvesting, bringing them to
lower part through channels. The collected rain water is utilized for irrigation purposes and
animal drinking. The lower hill area is utilized for paddy and fish cultivation. The livestock is
maintained near ponds, and animal husbandry activities are performed there, so that animal
wastes are brought to the paddy fields located beneath providing nutrients for rice cultivation.
The farmers gain additional earnings of rearing fish of about 50-60 kg per hectare from paddy
fields (Nayak et al., 2020).
3. Apatani System in Arunachal Pradesh:
The Apatani system is a form of ‘water farming’ practiced traditionally in the Apatani
plateau located in lower Subansiri district of Arunachal Pradesh. In this system valleys are
terraced into plots separated by 0.5 meters high earthen dams supported by bamboo frames.
Generally, water for irrigation is trapped from small streams and channelized to the field plots
with the help of traditional bamboo and pinewood pipes. Various strains of carps are
simultaneously cultivated with local rice varieties. When rice seedlings are transplanted in the
month of April-May, about 15-20 mm size fry are introduced in the rice fields. Fishes are reared
after 3-4 months providing an additional earning in one season, besides rice monoculture. This
has helped farmers in alleviating poverty in this region. Further there is no use of chemical
fertilizers, since nitrogen is fixed in the soil by Azolla and Lemna. (Saikia and Das, 2008).
4. Bheri Fishery in Sundarbans:
Bheri fishery is a modified extensive method practiced since late 1960s in Sundarbans,
West Bengal, where fish and prawns are cultivated along with local varieties of rice. The system
involves impounding of adjacent canal having natural brackish water for fish and prawn, along
with the traditional wet season rice farming. Approximately, 100-200 kg/ha fish and prawn are
harvested along with 100 kg/ha of rice (Nayak et al., 2020).
Significance of Integrated Farming:
(i) The integrated paddy-cum-fish culture system enhances food diversity and productivity.

12
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
(ii) The combined culture system increases the economic yield per unit area by enhancing rice
production.
(iii) Fish culture in paddy fields enhances soil fertility with increased nutrient recycling.
(iv) Fish while foraging in paddy fields feed on pest and larvae, thereby reducing the attack of
paddy stem borers.
(v) Controls growth of aquatic weeds and algae which usually compete with paddy plants for
light and nutrients.
(vi) Efficient utilization of rainfed lowlands, serving as nutritional source for farmer’s family,
especially animal protein, vitamins, micronutrients and fatty acids.
Conclusion:
Integrated farming has proved to be an efficient means of both economic and
environmental management. The cultivating fish in paddy field utilizing same water resource is
one of the most viable solutions for sustainable production. Fish farming integrated with rice
cultivation is principally dependent on sufficient availability of water for survival and growth of
fish without affecting paddy crop. Through this type of combined culture, food diversity and
productivity can be raised as compared to rice monoculture. Thus, the above rice-fish co-
cultivation system provides opportunities for rural livelihoods, strengthen socio-economic status,
and stability by efficiently utilizing water resources. The dual farming system serves as
additional income for local farmers, thereby reduction in labour.
References:
1. Poonam, A., Saha, S., Nayak, P. K., Sinhababu, D. P., Sahu, P. K., Satapathy, B. S.,
Shahid, M., Kumar, G., Jambhulkar, N. N., Nedunchezhiyan, M., Giri, S. C., Kumar, S.,
Kujur, S., Nayak, A. K., & Pathak, H. (2019). Rice-Fish Integrated Farming Systems for
Eastern India (NRRI Research Bulletin No. 17). ICAR-National Rice Research Institute,
Cuttack, Odisha, India.
2. Saikia, A. K., Abujam, S. K., Das, D. N., & Prasad, B. S. (2015). Economics of paddy cum
fish culture: A case study in Sivsagar, Assam. International Journal of Fisheries and
Aquatic Studies, 2, 198-203.
3. Food and Agriculture Organization. (1977). China: Recycling of organic wastes in
agriculture (FAO Soils Bulletin No. 40).
4. Nayak, P. K., Nayak, A. K., Kumar, A., Kumar, U., Panda, B. B., Satapathy, B. S.,
Poonam, A., Mohapatra, S. D., Tripathi, R., Shahid, M., Chatterjee, D., Panneerselvam, P.,
Mohanty, S., Sunil, K. D., & Pathak, H. (2020). Rice Based Integrated Farming Systems in
Eastern India: A Viable Technology for Productivity and Ecological Security (NRRI
Research Bulletin No. 24). ICAR-National Rice Research Institute, Cuttack, Odisha, India.

13
Bhumi Publishing, India

5. Sathoria, P., & Roy, B. (2022). Sustainable food production through integrated rice-fish
farming in India: A brief review. Renewable Agriculture and Food Systems, 37, 527-535.
6. Saikia, S. K., & Das, D. N. (2008). Rice-fish culture and its potential in rural development:
A lesson from Apatani farmers, Arunachal Pradesh, India. Journal of Agriculture & Rural
Development, 6, 125-131.
7. The Economic Times. (2023). Inland fish production jumps over 2-fold in 9 years to 131
lakh tonnes: Rupala. Retrieved from
https://economictimes.indiatimes.com/news/economy/agriculture/inland-fish-production-
jumps-over-2-fold-in-9yrs-to-131-lakh-tonnes-
rupala/articleshow/105258208.cms?from=mdr
8. Integrated Fish Farming System. (n.d.). Retrieved February 19, 2024, from
https://adpcollege.ac.in/online/attendence/classnotes/files/1626934875.pdf
9. Integrated Paddy-Cum-Fish Culture. (n.d.). Retrieved February 19, 2024, from
https://dof.gov.in/sites/default/files/2020-07/Integrated_Paddy.pdf

14
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

BIOFOULING: A THREAT IN MARINE FISH CULTURE AND REMEDIES

Suchismita Chatterjee Saha
Department of Zoology,
Nabadwip Vidyasagar College,
Nabadwip, Nadia, West Bengal, India
Corresponding author E-mail: [email protected]

Abstract:
Biofouling, the colonization of submerged surfaces by organisms, poses significant
challenges across various industries and ecosystems. Despite considerable efforts to mitigate its
impacts, biofouling remains a pervasive and costly problem with far-reaching economic and
environmental consequences. Biofouling poses significant challenges to shellfish and other fish
culture industries, impacting both economic productivity and environmental sustainability.
Key findings indicate that biofouling adversely affects shellfish culture by fouling nets,
cages, and infrastructure, leading to reduced water flow, increased maintenance costs, and
decreased shellfish growth and survival rates. In fish farming, biofouling can clog intake pipes,
obstructing water flow and oxygen exchange, and promote disease transmission among farmed
fish populations.
The complexity of biofouling dynamics necessitates integrated management approaches
that combine physical, chemical, and biological control methods. While traditional antifouling
strategies, such as toxic biocides and mechanical cleaning, have been employed, their
environmental impacts raise concerns about ecosystem health and sustainability. Therefore, there
is a growing need for sustainable and environmentally friendly alternatives, such as bio-based
coatings, biomimetic surfaces, and biotechnological innovations.
Furthermore, regulatory frameworks and international cooperation are crucial for
addressing biofouling challenges in shellfish and fish culture industries. By fostering
collaboration between industry stakeholders, researchers, and policymakers, it is possible to
develop effective biofouling management strategies that promote both economic prosperity and
environmental stewardship in aquaculture. The main aim of this article is to review regarding
biofouling, organisms involved, its type, adverse effects on shell fish and other fish culture, its
remedies.
Keywords: Biofouling, Organisms Involved, Adverse Effects, Remedies, Future Aspects
Introduction:
Aquaculture is now a days is a very important industry globally as it supplies protein to
low income and food deficient countries. More than half of the fish is consumed by humans
exceeding 55.7 million tons and value nearly about US$ 105 billion (FAO, 2010). This

15
Bhumi Publishing, India

production provides either high production or high biomass. Marine shellfish are oyesters
(Crassostrea sp, Ostrea sp.), mussels (Mytilus sp, Perna sp.), scallops (Placopecten sp, Chlamys
sp), salmonids (Salmo-salar, Oncorhyncus sp), mullets (Mugil sp), tunas (Thunnus sp),
seabreams (Sparus sp, Pagrus sp) and sea brases (Dicentrarchus labrax, Lates sp., Lateolabrax
japonicus). All of these species are cultured by submerged components with cages, nets, floats
and ropes. Surface of these equipment facing a great problem of biofouling. The presence of
such large and varied surfaces provides for broad diversity of epibiotic organism to settle and
grow. These marine algae and animals collectively termed biofouling and cause severe problem
to culture practices and have significant economic impacts. Problems that are associated with
biofouling are reduction of water flow through the net and reduced oxygen supply, reduced
waste removal and fishes are prone to diseases (Chyne, 2010). Increased weight of cage due to
biofouling, seriously affect cage structure and stability (Hodson et al., 2000). High mortality of
cultured fish is also observed (Huang, 2003, Phillipi et al., 2001, Tan et al., 2002, Swift et al.,
2006). Controlling of biofouling causes huge costs with 5-10% of production costs attributed to
biofouling (Lane and Willemilen, 2004). Globally the costs are US$ 1.5 to 3 billion yr-1.
Aquaculture industry uses technologies to combat this problem. The main aim of this to review
about biofouling, types of biofouling, organisms responsible for this, problems regarding
biofouling and its remedies.
Definition of Biofouling
According to Characklis, 1990; “Biofouling refers to the undesirable accumulation of a
biotic deposit on a surface”. According to Epstein, 1981, “Biofouling is the deposition of
macroscopic organisms such as barnacles or mussels (“macrofouling”) and to microorganisms
(“microbial biofouling”).
In biofouling, foulant, that is the microorganisms, can grow at the expense of
biodegradable substances from the water phase, turning them into metabolic products and
biomass. Microorganisms can multiply and produce extracellular polymeric substances (EPS),
which by keeping them together glued them to the surface and cause biofouling.
Conditions Required for Biofouling
Variations of biofouling organisms are temporal and spatial. The conditions which are
necessary for biofouling are seasonality of marine invertebrate populations, arrival of new
species, periods of intense growth, times of dormancy and regression etc. All these are temporal
changes. The spatial changes include planktonic events, larval choices during attachment and
settlement and metamorphosis and mortality (Holloway and Keough 2002 a, 2002b), availability
of light and water flow, depth and orientation of infrastructure (Cronin et al., 1999, Howes et al.,
2007, Guenther et al., 2010), fouling communities are less diverse in deeper waters (Cronin et
al., 1999, Guenther et al., 2010).

16
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Common Fouling Organisms
Some common fouling organisms in marine fish culture are summarized in Table 1
(Fitridge et al., 2012).
Table 1: Common Fouling Organisms
Fouling Organism The adverse impacts References
Chordata: Ascidiacea Cage deformation and Milne (1975b), Tan et al.,
• Ascidiella aspersa structural fatigue, increased (2002), Braithwaite et al.,
• Botrylloides sp. desease susceptibility (2007)
• Botryllus schlosseri
• Styela plicata
Algae
• Antithamnion sp Net occlusion Milne(1975a), Milne(1975b),
• Ectocarpus spp Restriction of water Morning and Morning
• Enteromorpha spp exchange, poor water quality, (1975), Cronin et al., (1999,
• Filamentous diatoms Limited oxygen availability,
• Gracilaria sp. reduced waste metabolite

• Ulvia spp. removal, cage deformation

and structural fatigue
Mollusca: Bivalvia Milne(1975a), Milne(1975b),
• Crassostrea Sp. Net occlusion, Morning and Morning
• Electroma georgenia Cage deformation and (1975), Lee et al., (1985),
• Modiolus sp structural fatigue Cronin et al., (1999),
• Mytilus edulis Braithwaite et al., (2007),
• Perna viridis Greene and Grizzle (2007)

• Pinctada sp.
Cnidaria: Hydrozoa Net occlusion, Cage Hodson et al., (2000),
• Ectopleura larynx deformation and structural Guenther et al., (2009),
• Obelia dichotoma fatigue Madin et al., (2009),
• Plumularia sp. Guenther et al., (2010), Carl
• Tubularia sp. et al., (2011), Guenther et al.,
(2011).

Types of Biofouling Organisms

There are different types of biofouling organisms are there. According to Cook 2001,
biofouling organisms are either intertidal or sublittoral.

17
Bhumi Publishing, India

They may be categorized as microfouling or macrofouling organisms. Microfouling

organisms include algal spores, diatoms and marine bacteria that form organic film, while
macrofouling organisms include multicellular organisms (Fergusson wood, 1950). The common
macrofouling organisms are tubeworms, barnacles, bryozoan, algae, hydroids, mussels, oyster
etc (Madin et al., 2009).
Characteristics of Biofouling Organisms
Biofouling organisms show important characteristics. They are free-swimming larva and
sedentary adult form which can firmly adhere to substratum and ability to utilize dissolved
nutrients and particulate material from water column. Example of such biofouling organisms are
barnacles. Non-sessile organisms that are able to colonize are echinoders, isopods, amphipods,
errant polychaetes, crabs, shrimps and pycnogonids (Claereboult et al., 1994, Maidan et al.,
2009)
Effects of Biofouling in Aquaculture
Variation biofouling organisms are either spatial or temporal. Impacts of biofouling in
most of the cases in aquaculture is very dangerous but in some cases is beneficial. The beneficial
effects of biofouling are enhancement of shell fish growth (Dalby and Young, 1993), production
of primary production of phytoplankton and cause food availability to shellfish (Lodeiros et al.,
2002, Le Blanc et al., 2003), provide protection against predation (Wahl et al., 1997, Manning
and Linquist 2003), facilitate the settlement of commercial farmed shell fish (Hickman and
Sause1984, Fitridge 2011), reduce disease risk (Paclibare et al., 1994).
Biofouling is mainly deleterious and cost effective in finfiah and shell fish culture.
Adverse Effects on Shellfish
Biofouling cause severe adverse effects on surface of shell and equipment. Physical
damage is caused on shell surface by boring into shell by endoliths or epibiotic calcareous
organisms; mechanical damage is caused by colonization of shell at the hinge and lips causing
feeding ability and susceptibility by predators; growth of shell fishes are affected by competition
of food resources; other environmental problems are reduced water flow, decreased oxygen
capacity, waste buildup, reduced food availability. Biodeposition and spreading of non-
indigenous organisms have most harmful effects on nearby natural ecosystem; weight of the
fishing cages and equipment by deposition of biomass of biofouling organisms increases
production costs along with extra maintenance requirements and loss of stock and eqipments.
(i) Physical Damage
Physical shell damage is caused by burrowing nature of endolithic organism or
epibiotic calcareous tube dwelling polychaetes which are attached to shell surface.
Polychaete worm Polydora and Boccardia penetrate and excavate shell, causing
cavities, burrows, blisters and tunnels deep within the nacreous layer (Lieonart et al.,
2003, Silina 2006, Simon et al., 2006). As consequences of several bad effects are

18
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
observed which are hinge instability, disruption of shell formation, fragility,
brittleness and loss of thickness (MaO Che et al., 1996). As a result, shell become
substantially weakened and vulnerable to predators and parasites (Kaehler and
McQuaid, 1999, Stefaniak et al., 2005, Buschbaum et al., 2007, Thieltges and
Buschbaum, 2007). Shell fish shows reduced growth and reproductive output
(Kaehler and McQuid, 1999, Stefaniak et al., 2005), causing a reduction in yield and
quality of Shellfish which ultimately cause substantial economic losses for growers
(Campbell and Kelly, 2002).
(ii) Mechanical Interference
Mechanical interference is arisen due to opening and closing of shellfish valves by
hydroids (eg Ectopleura crocea), macroalgae and barnacles, leading to ineffective
feeding (de Sa et al., 2007), abnormality in respiration (Miyauti, 1968), cause
mortality (Dharmaraj et al., 1983).
(iii) Biological Competition
There is a competition involved between fouling species and shellfish for food, space.
As a result, growth is reduced (Adams et al., 2011, Southgate and Beer, 2000,
Watson et al., 2009)
(iv) Environmental Modification
Environmental problem due to biofouling is associated with reduce waterflow and
changing of waste products in oyster culture, reduction of water currents and exchange,
leading to rapid food depletion (Yukihira et al., 1998).
(v) Increased Weight and Drag
Significant increase in weight in infrastructure in shellfish and fish culture leading to
management issue. As a result of which operational costs are also increased.
Adverse Effects on Fish
Biofouling Causes Serious Impacts on Fish Culture by
(1) Restriction of water exchange due to the growth of fouling organisms causing
net occlusion.
(2) Disease risk due to fouling communities acting as reservoirs for pathogenic
microorganisms and increasing vulnerability to disease; (3) cage deformation
and structural fatigue due to the extra weight imposed by fouling.
Control of Biofouling
Biofouling causes huge economic loss in aquaculture industry. So many effeots have
been adopted to combat this problem. Aquaculture industry had use antifouling agent to solve
this problem. Antifouling paints has been used on the surfaces of fishing crafts and gears to
reduce the problem. These antifouling paints are used to control biofouling are commonly used
on surfaces in marine transport, oil and gas industries (Yebra et al., 2004, deNys and Guenther

19
Bhumi Publishing, India

2009; Dürr and Watson 2010). In this technology, on outer surface of marine transport heavy
metals and organic biocides produce a thin, toxic layer that prevent biofouling. But the drawback
is that, many of the chemicals and heavy metals involved are recognized as dangerous in the
environment with detrimental effects on survival and growth of Shellfish (Paul and Davies 1986;
Short and Thrower 1986, Bruno and Ellis 1988). Alternative methods must be found to mitigate
this problem as biofouling control remedies one of the most difficult challenges and costly in
aquaculture industry. For Shellfish culture, the control of biofouling is divided into five broad
categories.
Control Measures for Shellfish culture
1. Avoidance of Natural Recruitment
Avoidance techniques must be adopted to prevent larval and settlement of problematic
biofouling organism (Wills et al., 2011, Dunham and Marshall 2012).
2. Physical Removal
As chemical antifoulants cause adverse effects on Shellfish, so physical removal is the
best way. Mechanical equipment is very common method. Oysters cleaned regularly
thereby increase their growth (Taylor et al., 1997). Washing reduces some solitary
tunicates by up to 80% (Mallet and Carver 2006). But some problems are there by
colonial organisms which undergo fragmentation (Hopkins et al., 2011). Manual cleaning
involves by knives, brushes and water pressure. Immersing fouled shellfish in freshwater
is simple, cheap and environment friend technique (Denny 2008). Heat technique is
another technique in many marine industries (Perepelizin and Boltovkoy, 2011). Spray
and immersion technique is also popular by using acidic and alkaline chemicals.
3. Biological Control
Main principle in biological control is based upon predation of pest species by other
marine organisms. In Oyster culture, the introduction of periwinkles (Enright et al.,
1983), crab (Ross et al., 2004) and sea urchin (Lodeiros and Garcia 2004, Epelbaum et
al., 2009) is another method.
4. Coatings
Development of coatings technology to solve biofouling in shipping and on other marine
infrastructure has very important. Coating involves of live pearl oysters with a
biodegradable, wax – based, impervious, non – toxic materials (deNys and Ison 2004).
5. Control and Protection for Equipment
Culture equipment in ropes, floats, panels, nets and trays have used heavy metals
including copper due to their negative impacts on developing vertebrates and
invertebrates (Oliva et al., 2007) and their ability to concentrate in shellfish tissues
(Changsheng et al., 1990). But this technique has some problem as low surface energy
coating some time releases fouling communities under physical cleaning.

20
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Control Measures for Fish Culture
Commercially marine fish farm operations usually employ a multifacted approach to
control net fouling. This includes:
(i) Net changing and cleaning to remove fouling organisms and maintain water
exchange.
(ii) Chemical antifoulants such as copper.
(iii) Biological control using herbivorous fish or invertebrates to graze biofouling from
the net surface.
New Strategies to Control and Mitigate Biofouling in Aquaculture
Introduction of new antifouling solutions for aquaculture in marine transport industry
plays important role to mitigate problem of biofouling. The new antifouling technologies should
have implemented in aquaculture industry. They should be
(i) Effective against a broad range of fouling taxa.
(ii) Be environment friendly
(iii) Have no residual effect on cultured species.
(iv) Have no negative effects on cultured species
(v) Be able to withstand on shore handling and cleaning
(vi) Be commercially viable.
Prediction of occurrence of biofouling episodes is one of the most effective measures. As
a result of such prediction infrastructure can be moved away from fouling settlement peaks.
Farmers can place their collecting ropes outside normal collecting times which cause low fouling
settlement. More research is required for controlling of such problems. Application of food grade
oil to farm buoys, ropes and floats reduce fouling by algae and tunicates by more than 90%
(Bakker et al., 2011). Management of husbandry and cleaning strategies prevent removal of
fouling agents. Hard fouling such as barnacles, tubeworms and bivalves are particularly difficult
and costly to remove. For controlling of foulant in fishing nets and other fish farm is largely
restricted to a limited range of products which release copper or zinc. New products should have
low surface energy coatings, texturing and surface bound compounds, fouling release
technologies rely on hydrodynamics forces to remove fouling organisms with poor adhesion.
New approaches should focus on pharmaceuticals (Pinori et al., 2011), bioactive (Dahlstorm and
El wing 2006) and commercially available enzymes (Pettitt et al., 2004) as antifoulants. Biocide
– free, low surface energy siloxane elastomass and fluropolymers may provide a non-toxic
alternative to control biofouling (Lewis 2009, Magin et al., 2010).
Conclusion:
Biofouling, the colonization of submerged surfaces by organisms, continues to pose
formidable challenges across diverse industries and ecosystems. While significant strides have
been made in understanding and mitigating its impacts, the future of biofouling management

21
Bhumi Publishing, India

demands a multifaceted approach that integrates scientific innovation, regulatory action, and
global cooperation.

Emerging Technologies in Biofouling Management:

The future of biofouling management lies in the realm of emerging technologies that
offer novel approaches to prevention and control. Nanostructured surfaces, engineered to mimic
natural antifouling properties, hold immense promise for inhibiting microbial attachment and
biofilm formation. These advanced materials can significantly reduce the need for toxic biocides
while enhancing the efficiency and longevity of antifouling coatings. Additionally,
biotechnological innovations, such as enzyme-based treatments and bio-inspired peptides, offer
environmentally friendly alternatives for disrupting biofilm formation and deterring fouling
organisms.
Furthermore, the convergence of artificial intelligence and robotics presents exciting
opportunities for autonomous monitoring and maintenance of fouling-prone surfaces.
Autonomous underwater vehicles equipped with sensors and imaging systems can detect
biofouling at its earliest stages, enabling timely intervention and optimization of antifouling
strategies. Similarly, robotic systems capable of on-site cleaning and inspection can minimize the
reliance on labor-intensive manual processes, reducing operational costs and environmental
impact.
Challenges and Considerations:
Despite the promise of emerging technologies, several challenges must be addressed to
realize their full potential in biofouling management. One significant obstacle is the development
of environmentally sustainable and economically viable antifouling solutions. While traditional
biocidal coatings have proven effective, their ecological impacts raise concerns about marine
toxicity and ecosystem disruption. Thus, there is a pressing need for research into bio-based
alternatives that offer robust fouling prevention without compromising environmental integrity.
Furthermore, the complexity of biofouling dynamics requires a holistic understanding of
the underlying mechanisms and interactions between fouling organisms and substrates. This
necessitates interdisciplinary collaboration between scientists, engineers, and policymakers to
integrate biological, chemical, and physical approaches into effective antifouling strategies.
Additionally, the global nature of maritime trade and shipping underscores the importance of
international cooperation in establishing standardized regulations and best practices for
biofouling management.
Regulatory Frameworks and International Collaboration:
Regulatory frameworks play a crucial role in shaping the future of biofouling
management by setting standards for antifouling coatings, monitoring protocols, and
environmental protection measures. International agreements, such as the International Maritime

22
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Organization's (IMO) International Convention on the Control of Harmful Anti-fouling Systems
on Ships (AFS Convention), provide a framework for regulating the use of biocidal coatings and
promoting the adoption of environmentally friendly alternatives.
Moreover, regional initiatives and partnerships facilitate knowledge exchange and
capacity building among stakeholders, fostering innovation and best practices in biofouling
management. Collaborative research consortia, industry alliances, and academic networks serve
as platforms for sharing expertise, resources, and data to address common challenges and
accelerate the development of sustainable solutions.
Future Prospects and Conclusion:
In envisioning the future of biofouling management, a proactive and collaborative
approach is essential to harnessing the potential of emerging technologies and addressing
persistent challenges. By investing in research and innovation, fostering interdisciplinary
collaboration, and strengthening regulatory frameworks, we can pave the way for sustainable and
effective biofouling solutions.
Moreover, public awareness and engagement are critical in driving demand for
environmentally friendly antifouling products and practices. Educating stakeholders about the
ecological and economic benefits of biofouling prevention can incentivize industry-wide
adoption of sustainable technologies and promote responsible stewardship of marine resources.
In conclusion, the future of biofouling management holds immense promise for
innovation, sustainability, and global cooperation. By embracing emerging technologies,
overcoming persistent challenges, and forging partnerships across sectors and borders, we can
navigate towards a cleaner, more resilient, and biodiverse marine environment for future
generations.
References:
1. Adams, C. M., Shumway, S. E., Whitlach, R. B., & Getchis, T. (2011). Biofouling in
marine molluscan shellfish aquaculture: A survey assessing the business and economic
implications of mitigation. Journal of the World Aquaculture Society, 42, 242-252.
2. Bakker, J. A., Paetzold, C., Quijon, P. A., & Davidson, J. (2011). The use of food grade oil
in the prevention of vase tunicate fouling on mussel aquaculture gear. Management of
Biological Invasions, 2, 15-25.
3. Braithwaite, R. A., Carrascosa, M. C. C., & McEvoy, L. A. (2007). Biofouling of salmon
cage netting and the efficacy of a typical copper-based antifoulant. Aquaculture, 262, 219-
226.
4. Bruno, D. W., & Ellis, A. E. (1988). Histopathological effects in Atlantic salmon, Salmo
salar L., attributed to the use of tributyltin antifoulant. Aquaculture, 72, 15-20.

23
Bhumi Publishing, India

5. Buschbaum, C., Buschbaum, G., Scherey, T., & Thieltges, D. W. (2007). Shell-boring
polychaetes affect gastropod shell strength and crab predation. Marine Ecology Progress
Series, 329, 123-130.
6. Campbell, D. A., & Kelly, M. S. (2002). Settlement of Pomatoceros triqueter (L.) in two
Scottish lochs, and factors determining its abundance on mussels grown in suspended
culture. Journal of Shellfish Research, 21, 519-527.
7. Carl, C., Guenther, J., & Sunde, L. M. (2011). Larval release and attachment modes of the
hydroid Ectopleura larynx on aquaculture nets in Norway. Aquaculture Research, 42,
1056–1060.
8. Changsheng, Z., Bingyin, S., Yunbi, H., & Xianggui, X. (1990). Effects of JS-876, a
copper-tin compounded anti-fouling agent, on growth of the scallop Pecten maximus.
Journal of Oceanography of Huanghai & Bohai Seas, 8, 40-46. (Chinese with English
abstract).
9. Characklis, W. G. (1990). Microbial biofouling. In Characklis, W. R., & Marshall, K. C.
(Eds.), Biofilms (pp. 523–584). Wiley.
10. Cheyne, I. (2010). Regulation of marine antifouling in international and EC law. In S. Durr
& J. C. Thomason (Eds.), Biofouling (pp. 306–318). Wiley-Blackwell.
11. Claereboudt, M. R., Bureau, D., Cote, J., & Himmelman, J. H. (1994). Fouling
development and its effect on the growth of juvenile giant scallops (Placopecten
magellanicus) in suspended culture. Aquaculture, 121, 327–342.
12. Cook, E. (2001). A review of biofouling on artificial substrates. In A review of the
environmental impacts of marine cage aquaculture, processes of biofiltration relevant to
impact mitigation, the biological properties of marine invertebrates relevant to biofiltration
and biofouling on artificial structures. BIOFAQs, Q5RS– 2000-30305, Technical Annex
Annual Report, (December 2001), 87–96.
13. Cronin, E. R., Cheshire, A. C., Clarke, S. M., & Melville, A. J. (1999). An investigation
into the composition, biomass and oxygen budget of the fouling community on tuna
aquaculture farm. Biofouling, 13, 279-299.
14. Dahlstrom, M., & Elwing, H. (2006). Adrenoceptor and pharmacocoactive compounds as
putative antifoulants. In N. Fusetani & A. S. Clare (Eds.), Antifouling Compounds (Vol.
42, pp. 171-202). Progress in Molecular and Subcellular Biology.
15. Dharmaraj, S., & Chellam, A. (1983). Settlement and growth of barnacle and associated
fouling organisms in pearl culture farm in the Gulf of Mannar. In Proc Symp on Coastal
Aquaculture, Cochin, India, 1980. Part 2: Molluscan Culture (pp. 608-613). Marine
Biological Association of India. Available from http://eprints.cmfri.org.in/2306/.

24
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
16. Dalby, J. E., & Young, C. M. (1993). Variable effects of ascidian competitors on oysters in
a Florida epifaunal community. Journal of Experimental Marine Biology and Ecology,
167, 47-57.
17. Denny, C. M. (2008). Development of a method to reduce the spread of the ascidian
Didemnum vexillum with aquaculture transfers. ICES Journal of Marine Science, 65, 805-
810.
18. de Nys, R., & Ison, O. (2004). Evaluation of antifouling products developed for the
Australian pearl industry (Project No 2000/254). Final Report to the Fisheries Research
and Development Corporation. James Cook University.
19. de Nys, R., & Guenther, J. (2009). The impact and control of biofouling in marine finfish
aquaculture. In C. Hellio & D. Yebra (Eds.), Advances in marine antifouling coatings and
technologies (pp. 177-221). Woodhead Publishing Ltd.
20. de Sa, F. S., Nalesso, R. C., & Paresque, K. (2007). Fouling organisms on Perna perna
mussels: Is it worth removing them? Brazilian Journal of Oceanography, 55, 155-161.
21. Dunham, A., & Marshall, R. D. (2012). Using stocking density modifications and novel
growth medium to control shell deformities and biofouling in suspended culture of
bivalves. Aquaculture, 324, 234-241.
22. Dürr, S., & Watson, D. I. (2010). Biofouling and antifouling in aquaculture. In S. Dürr & J.
C. Thomason (Eds.), Biofouling (pp. 267-287). Wiley-Blackwell.
23. Enright, C., Krailo, D., Staples, L., Smith, M., Vaughan, C., Ward, D., Borgese, E. (1983).
Biological control of fouling algae in oyster aquaculture. Journal of Shellfish Research, 3,
41-44.
24. Epelbaum, A., Pearce, C. M., Barker, D. J., Paulson, A., & Therriault, T. W. (2009).
Susceptibility of non-indigenous ascidian species in British Columbia (Canada) to
invertebrate predation. Marine Biology, 156, 1311-1320.
25. Epstein, N. (1981). Fouling: Technical aspects. In E. F. C. Somerscales & J. G. Knudsen
(Eds.), Fouling of heat transfer equipment (pp. 31–53). Hemisphere.
26. Food and Agriculture Organization. (2010). The State of World Fisheries and Aquaculture.
Accessed February 2012.
27. Ferguson Wood, E. J. (1950). The role of bacteria in the early stages of fouling. Australian
Journal of Marine and Freshwater Research, 1, 81-91.
28. Fitridge, I. (2011). The ecology of hydroids (Hydrozoa: Cnidaria) in Port Phillip Bay,
Australia, and their impacts as fouling species in longline mussel culture (PhD thesis).
Department of Zoology, The University of Melbourne, Australia.
29. Fitridge, I., Dempster, T., Guenther, J., & de Nys, R. (2012). The impact and control of
biofouling in marine aquaculture: A review. Biofouling, 28(7), 649-669.

25
Bhumi Publishing, India

30. Greene, J. K., & Grizzle, R. E. (2007). Successional development of fouling communities
on ocean aquaculture fish cages in the western Gulf of Marine, USA. Aquaculture, 262,
289-301.
31. Guenther, J., Carl, C., & Sunde, L. M. (2009). The effects of colour and copper on the
settlement of the hydroid Ectopleura larynx on aquaculture nets in Norway. Aquaculture,
292, 252-255.
32. Guenther, J., Misimi, E., & Sunde, L. M. (2010). The development of biofouling,
particularly the hydroid Ectopleura larynx, on commercial salmon cage nets in Mid-
Norway. Aquaculture, 300, 120-127.
33. Guenther, J., Fitridge, I., & Misimi, E. (2011). Potential antifouling strategies for marine
finfish aquaculture: The effects of physical and chemical treatments on the settlement and
survival of the hydroid Ectopleura larynx. Biofouling, 27, 1033-1042.
34. Hickman, N. J., & Sause, B. L. (1984). Culture of the blue mussel (Mytilus edulis
planulatus) in Port Phillip Bay, Victoria Australia. III: Larval settlement. Report No. 75.
Victoria (Australia): Marine Science Laboratories (Fisheries Victoria). 25 pp.
35. Hodson, S. L., Burke, C. M., & Bissett, A. P. (2000). Biofouling of fish-cage netting: The
efficacy of a silicone coating and the effect of netting colour. Aquaculture, 184(34), 277-
290.
36. Holloway, M. G., & Keough, M. J. (2002a). An introduced polychaete affects recruitment
and larval abundance of sessile invertebrate. Ecological Applications, 12, 1803-1823.
37. Holloway, M. G., & Keough, M. J. (2002b). Effects of an introduced polychaete, Sabella
spallanzanii, on the development of epifaunal assemblages. Marine Progress Series, 236,
137-154.
38. Hopkins, G. A., Forrest, B. M., Piola, R. F., & Gardner, J. P. A. (2011). Factors affecting
survivorship of defouled communities and the effect of fragmentation on establishment
success. Journal of Experimental Marine Biology and Ecology, 396, 233-243.
39. Howes, S., Herbinger, C. M., Darnell, P., & Vercaemer, B. (2007). Spatial and temporal
patterns of recruitment of the tunicate Ciona intestinalis on a mussel farm in Nova Scotia
Canada. Journal of Experimental Marine Biology and Ecology, 342, 85-92.
40. Huang, Z. G. (2003). Marine biofouling in Hong Kong: A review. Acta Oceanologica
Sinica - English Edition, 22(3), 467-482.
41. Kaehler, S., & McQuaid, C. D. (1999). Lethal and sub-lethal effects of phototrophic
endoliths attacking the shell of intertidal mussel Perna perna. Marine Biology, 135, 497-
503.
42. Lane, A., & Willemsen, P. R. (2004). Collaborative effort looks into biofouling. Fish
Farming International, September 2004, 34-35.

26
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
43. Le Blanc, A. R., Landry, T., & Miron, G. (2003). Fouling organisms of the mussel Mytilus
edulis: Their effect on nutrient uptake and release. Journal of Shellfish Research, 22, 633-
638.
44. Lee, H. B., Lim, L. C., & Cheong, L. (1985). Observations on the use of antifouling paint
in netcage fish farming in Singapore. Singapore Journal of Primary Industries, 13, 1-12.
45. Lewis, J. A. (2009). Non-silicone biocide-free antifouling solutions. In C. Hellio & D.
Yebra (Eds.), Advances in marine antifouling coatings and technologies (pp. 709-724).
Woodhead Publishing Ltd.
46. Lodeiros, C., Prieto, A., Narvaez, N., & Guerra, A. (2002). Growth and survival of the
pearl oyster Pinctada imbricata (Rodling 1758) in suspended and bottom culture in the
Golfo de Cariaco, Venezuela. Aquaculture International, 10, 327-338.
47. Lodeiros, C., & Garcia, N. (2004). The use of sea urchins to control fouling during
suspended culture of bivalves. Aquaculture, 231, 293-298.
48. Lieonart, M., Handlinger, J., & Powell, M. (2003). Spionid mud-worm infestation of
farmed abalone (Haliotis spp). Aquaculture, 221, 85-96.
49. Madin, J., Chong, V. C., & Barsi, B. (2009). Development and short-term dynamics of
microfouling assemblages on fish-cage nettings in a tropical estuary. Estuarine, Coastal
and Shelf Science, 83, 19-29.
50. Magin, C. M., Cooper, S. P., & Brennan, A. B. (2010). Non-toxic antifouling strategies.
Materials Today, 13, 36-44.
51. Mallet, A. L., & Carver, C. E. (2006). Incorporating the New Zealand Tunicate Treatment
Technology into a tunicate management strategy for Indian Point Marine Farms. Report
prepared for Aquaculture Association of Nova Scotia. Dartmouth (Nova Scotia): Mallet
Research Services. 21 pp.
52. Manning, L. M., & Lindquist, N. (2003). Helpful habitat or pernicious passenger:
Interactions between an infaunal bivalve, an epifaunal hydroid and three potential
predators. Oecologia, 134, 415-422.
53. Mao Che, L., Le Campion-Alsumard, T., Boury-Esnault, N., Payri, C., Golubic, S., &
Bezac, C. (1996). Biodegradation of shells of the black pearl oyster, Pinctada
margaritifera var. cumingii, by microbes and sponges of French Polynesia. Marine
Biology, 126, 509-519.
54. Milne, P. H. (1975a). Fouling of marine cages-Part one. Fish Farming International, 2, 15-
19.
55. Milne, P. H. (1975b). Fouling of marine cages-Part Two. Fish Farming International, 2, 18-
21.

27
Bhumi Publishing, India

56. Miyauti, T. (1968). Studies on the effect of shell cleaning in pearl culture - III. The
influence of fouling organisms upon the oxygen consumption in the Japanese pearl oysters.
Nihon Seitai Gakkai Shi (Jap J Ecol.), 18, 40 (in Japanese with English abstract).
57. Moring, J. R., & Moring, K. A. (1975). Succession of net biofouling material and its role in
the diet of pen-cultured Chinook salmon. Progress in Fish-Culture, 37, 27-30.
58. Oliva, M., Carmen Garrido, M. D., Perez, E., & Gonzalez De Canales, M. L. (2007).
Evaluation of acute copper toxicity during early life stages of gilthead, Sparus aurata.
Journal of Environmental Science and Health, Part A, 42, 525-533.
59. Paclibare, J. O., Evelyn, T. P. T., Albright, L. J., & Prosperi-Porta, L. (1994). Clearing of
the kidney disease bacterium Renibacterium salmoninarum from seawater by the blue
mussel Mytilus edulis, and the status of the mussel as a reservoir of the bacterium. Diseases
of Aquatic Organisms, 18, 129-133.
60. Paul, J. D., & Davies, I. M. (1986). Effects of copper and tin-based antifoulant on the
growth of cultivated scallops (Pecten maximus) and oyster (Crassostrea gigas).
Aquaculture, 54, 191-203.
61. Perepelizin, P. V., & Boltovskoy, D. (2011). Thermal tolerance of Limnoperna fortunei to
gradual temperature increase and its applications for biofouling control in industrial and
power plants. Biofouling, 27, 667-674.
62. Pettitt, M. E., Henry, S. L., Callow, M. E., Callow, J. A., & Clare, A. S. (2004). Activity of
commercial enzymes on settlement and adhesion of cypris larvae of the barnacle Balanus
amphitrite, spores of the green alga Ulva linza, and the diatom Navicula perimuta.
Biofouling, 20, 299-311.
63. Phillipi, A. L., Connar, N. J. O., Lewis, A. F., & Kim, Y. K. (2001). Surface flocking as a
possible anti-biofoulant. Aquaculture, 395(3-4), 225-238.
64. Pinori, E., Berglin, M., Brive, L. M., Hulander, M., Dahlstrom, M., & Elwing, H. (2011).
Multi-seasonal barnacle (Balanus improvisus) protection achieved by trace amounts of a
macrocyclic lactone (ivermectin) included in rosin-based coatings. Biofouling, 27, 941-
953.
65. Ross, K. A., Thorpe, J. P., & Brand, A. R. (2004). Biological control of fouling in
suspended scallop cultivation. Aquaculture, 229, 99-116.
66. Short, J. W., & Thrower, F. P. (1986). Accumulation of butyltin in mussels of Chinook
salmon reared in sea pens treated with tri-n-butyltin. Marine Pollution Bulletin, 17, 542-
545.
67. Silina, A. V. (2006). Tumor-like formations on the shells of Japanese scallops
Patinopecten yessoensis. Marine Biology, 148, 833-840.
68. Simon, C. A., Ludford, A., & Wynne, S. (2006). Spionid polychaetes infesting cultured
abalone Haliotis midae in South Africa. African Journal of Marine Science, 28, 167-171.

28
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
69. Southgate, P. C., & Beer, A. C. (2000). Growth of black lip pearl oyster (Pinctada
margaritifera) juveniles using different nursery culture techniques. Aquaculture
International, 87: 97-104.
70. Stefaniak, L. M., McAtee, J., & Shulman, M. J. (2005). The cost of being bored: Effects of
a clionid sponge on the gastropod Littorina littorea. Journal of Experimental Marine
Ecology, 327, 103-114.
71. Swift, M. R., Fredriksson, D. W., Unrein, A., Fullerton, B., Patursson, O., & Baldwin, K.
(2006). Drag force acting on biofouled net panels. Aquacultural Engineering, 35, 292-299.
72. Tan, K. F., Nowak, B. F., & Hodson, S. L. (2002). Biofouling as a reservoir of
Neoparamoeba pemaquidensis (Page, 1970), the causative agent of amoebic gill disease in
Atlantic salmon. Aquaculture, 1-4, 49-58.
73. Taylor, J. J., Southgate, P. C., & Rose, R. A. (1997). Fouling animals and their effect on
the growth of silverlip pearl oysters, Pinctada maxima (Jameson) in suspended culture.
Aquaculture, 153, 31-40.
74. Thieltges, D. W., & Buschbaum, C. (2007). Vicious circle in the intertidal: Facilitation
between barnacles epibionts, a shell boring polychaete and trematode parasites in the
perwinkle Littorina littorea. Journal of Experimental Marine Biology and Ecology, 340,
90-95.
75. Wahl, M., Hay, M. E., & Enderlein, P. (1997). Effects of epibiosis on consumer – prey
interactions. Hydrobiologia, 355, 49-59.
76. Watson, D. I., Shumway, S. E., & Whitlach, R. B. (2009). Biofouling and the shellfish
industry. In S. E. Shumway & G. E. Rodrick (Eds.), Shellfish safety and quality (pp. 317-
336). Cambridge, UK: Woodhead Publishing.
77. Willis, J. E., Stewart-Clark, S., Greenwood, S. J., Davidson, J., & Quijon, P. A. (2011). A
PCR-based assay to facilitate early detection of Diplosoma listerianum in Atlantic Canada.
Aquatic Invasions, 6, 7-16.
78. Yebra, D. M., Kiil, S., & Dam-Johansen, K. (2004). Antifouling technology - past, present
and future steps towards efficient and environmentally friendly antifouling coatings.
Progress in Organic Coatings, 50, 75-104.
79. Yukihira, H., Klumpp, D. W., & Lucas, J. S. (1998). Effects of body size on suspension
feeding and energy budgets of the pearl oysters Pinctada margaritifera and P. maxima.
Marine Ecology Progress Series, 170, 119-130.

29
Bhumi Publishing, India

AGEING IN WEST BENGAL AND CHALLENGES

Baisakhi Roy
Department of Geography,
Vidyasagar College for Women, Kolkata
Corresponding author E-mail: [email protected]

Abstract:
The elderly population in West Bengal is growing fast and at an alarming rate in
comparison with the all India average. Proper safety, security and social protection of ageing
population majority of whom being woman is of utmost criteria of consideration in West Bengal
gerontological research. The state faces the urgent need to study her ageing processes so that its
influence and impact on elderly population as well as society could be judged.
Introduction: The concept of Ageing
Ageing is a continuous, irreversible, universal process, which starts from conception till
the death of an individual. However, the age at which one’s productive contribution declines and
one tends to be economically dependent can probably be treated as the onset of the aged stage of
life. Old age is the last phase of human life cycle, which is again universally true. As such it is
difficult to provide a clear definition. Different writers have viewed ageing in different contexts
as the outcome of biological, demographic, sociological, psychological or other processes.
Objective of the Study: To find out the fast growing ageing population in the state, problems
faced by them, way out and ultimate implication on the society.
Methodology: The methodology followed in this article relates to the data collection from
sources like research journals, magazines, books and internet.
Discussions and Findings:
Categorization and Dimensions of Ageing
The WHO defines those aged 60 -74 years as elderly. In 1980 the UN recommended 60
years as the age of transition for the elderly segment of the population, and has been categorized
as follows:
1. Young Old- between the ages of 60-75 years.
2. Old-Old- between the ages of 75-85 years.
3. Very Old- 85 years and above
Gerontologists say that age and ageing have at least four dimensions. The dimension
most of us think of is chronological age, defined as the number of years since someone was born.
A second dimension is biological ageing, which refers to the physical changes that “slow us
down” as we get into our middle and older years. For example, our arteries might clog up, or
problems with our lungs might make it more difficult for us to breathe. A third dimension,

30
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
psychological ageing, refers to the psychological changes, including those involving mental
functioning and personality, that occur as we age. The fourth dimension of ageing is social.
Social ageing refers to changes in a person’s roles and relationships, both within their networks
of relatives and friends and in formal organizations such as the workplace and houses of worship.
World Population Data Sheet- 2002 considers aged population as population in the age group of
65+ as old.
Indian Population on Age Perspective
In the Indian context, the age of 60 years has been adopted by the census of India for the
purpose of classifying a person as old, which coincides with the age of retirement in government
sector. The terms Young-Old for 60 to 69, Old-Old for 70 to 79 and Oldest Old for 80 to 89 have
been used.

Figure 1: The number of older Indians is growing rapidly as a proportion of the country’s
population Source: (United Nations 2015); dashed lines represent projections under a
medium-fertility scenario

Figure 2: State wise Population Aged 60 years and above according to Census 2001 and
2011

31
Bhumi Publishing, India

West Bengal Population on Age Perspective:

The ageing population in West Bengal has got relatively less priority in gerontological
research in India despite the fact that she acquires fourth position among all states and Union
Territories (UT) in India in respect of absolute numbers of aged people (Census, 2001).
However, the elderly population in the state of West Bengal is growing in a faster rate than all
India average. It could be projected that, in near future, West Bengal would emerge as an
important state in India in respect of population ageing.

Figure 3: Percent of Elderly for Districts of West Bengal Along with West Bengal and India
in 2011 (Source: Census of India)
Table 1: Percent Distribution of Population by Age Groups in West Bengal
Age groups (years)
Source
0 – 14 15 – 59 60 - Total
Census 2001 33.3 59.6 7.1 100
Census 2011 27.2 64.3 8.5 100
Age and Sex in West Bengal

The sex ratio across the elderly age groups, as shown in above Figure: 4 , clearly
indicates a steadily increasing female dominance with age – the sex ratio increases from 1,053
(60-69 years) to 1,376 in the 80+ age group.
Rising feminization of ageing was prominent in West Bengal, similar to the seven state
report, with the sex ratio being 1135 females per 1000 males in the 60+ age group. Nearly two-
thirds of the elderly (63%) are in the 60-69 age group confirming ageing as a recent phenomenon
requiring immediate attention. Almost three-quarters of the elderly females are widows and the
lifetime migration among the elderly women is very high (82%) as against men (36%).

32
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Surprisingly, remarriage rate is marginally higher in rural locales (4%) than the urban locales
(1%). Nearly half the elderly population (48%) surveyed in the state has no formal education.

Figure 4: Sex ratio (females per 1,000 males), West Bengal 2011
(Source: Census of India, 2011)

Amenities Presently Available:

Health Care for the Elderly (HCE) Public health expenditure in West Bengal is
reasonably low. The elderly here largely suffer from communicable diseases and impairment of
special sensory functions like vision and hearing. Track records of the estimates of health burden
of the BPL elderly are not in order. Geriatrics is not yet a popular specialty. As a result, there
was no dedicated infrastructure for elderly health care particularly for the groups under the BPL
category till the National Programme for the Health Care for the Elderly (NPHCE) commenced
in 2013. This section discusses the currently operational government-initiated health care
schemes and community response initiatives for the elderly.
Programmes
i) National Programme for Health Care of the Elderly (NPHCE) The NPHCE scheme is
financed in the ratio 80:20 by the central and state governments respectively. The purpose of this
scheme is to provide acceptable, affordable and quality long-term comprehensive dedicated
health care services to the ageing population of the country. For West Bengal 2013 is the maiden
year. NPHCE is open to all the elderly, irrespective of economic class. In order to address human
resource issues under the NPHCE, it has been proposed to develop 12 additional regional
geriatric centres in select medical colleges of the country in addition to 8 regional geriatric
centres being developed during the 11th Plan. One of the regional centres and medical colleges
proposed is Kolkata Medical College (KMC).

33
Bhumi Publishing, India

ii) Briddhashree Yojana (BY) of Government of West Bengal The Government of West
Bengal has announced Briddhashree Yojana for the health care of 17 lakh (approximately) BPL
elderly beneficiaries on record receiving old age pension. This scheme would be operational
during the fiscal year 2013. (Ananda Bazar Patrika, 19 October 2013).
iii) Varistha Yojana for Senior Citizens (VYSC) This programme has been launched by
National Insurance and other major insurance companies and caters to multiple health needs of
senior citizens in the age group 60–80 years. The policy covers hospitalization and domiciliary
hospitalization expenses as well as expenses for treatment of critical illnesses. However,
beneficiaries of this scheme in West Bengal constitute only 2 per cent in APL category (The
Economic Times, 10 July 2004).
iv) Mobile Medicare Unit (MMU) The scheme framed by the Ministry of Social Justice and
Empowerment (MOSJE) limits grants-in-aid for projects for older people living in slums, rural
and inaccessible areas where proper health facilities are not available. Currently there are seven
MMUs in the state. The total number of beneficiaries is 2,800 (Annual Report, GoWB, 2011).
Contemporary West Bengal is focused more on ageing and elderly care than child care.
The Kolkata Police and an NGO “Bengal” started a program called ‘Pronam’. It is a
unique attempt to provide physiological and physical support to the elderly through a helpline
number. Pronam also provides emergency ambulance facilities and financial support in a
restricted way. The same programme has been replicated in the Salt Lake City under the name of
‘Saanjhbaati’ to provide assistance to NRIs living alone in that part of the city (Hindustan
Times, 10 September, 2012).
Another notable initiative in West Bengal is of the Indian Medical Association (IMA),
Behala. This is a doctors association that provides various medical services to the elderly
population residing in Behala. Services provided include- hospitalization at subsidized rates;
home visits by professional doctors; ambulance facilities and medical insurance for some of the
fatal diseases (UNFPA, 2014).
Challenges Before the Elderly People: We have come across some facilities are available or
some attempts have been taken to ease the life of the elderly people, but in reality those
programmes need a considerable time and sincere effort to overcome the following challenges
faced by the elderly people.
(i) Challenges in Urban Area
(ii) Challenges in Rural Area
The challenges faced by the aged people both in urban and rural area can be identified
under the following major heads.

34
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Urban Area:
i. Monetary – The urban population has a wide range of income groups and thus the average
expenditure reflects the actual capacity of consumption.
ii. Social Association – Nuclear family and isolated existence.
iii. Medication – High cost of life saving drugs.
iv. Transportation – Facilities are available but not up to the mark.
v. Lack of oldage care amenities and infrastructure
Table 2: Average Monthly Per Capita Expenditure on Broad Groups of Items in West
Bengal (N.S.S 68th Round, July 2011 to June 2012)
Average monthly per capita expenditure (in Rs.) Urban
State Food Fuel and Clothing Educatio Total Durable Others Total
total light and n Medical goods consumer
footwear expenditu
re

West 989.16 201.39 170.98 193.59 211.35 151.16 572.26 2489.89

Bengal

Rural Area:
i. Monetary - The rural population has a narrow range of income groups and its average
expenditure reflects the actual capacity of consumption.
ii. Medication – High cost of life saving drugs.
iii. Transportation – Negligible facilities are available.
iv. Lack of oldage care amenities and infrastructure
Table 3: Average Monthly Per Capita Expenditure on Broad Groups of Items in West
Bengal (N.S.S 68th Round, July 2011 to June 2012)
Average monthly per capita expenditure (in Rs.) Rural
State Food Fuel and Clothing Educatio Total Durable Others Total
total light and n Medical goods consumer
footwear expenditu
re

West 639.92 117.67 84.40 48.57 93.49 33.49 152.57 1170.11

Bengal

35
Bhumi Publishing, India

Comparative analysis of the challenges faced by the elderly people in rural and urban
sectors of West Bengal
The foregoing assessment portrays that the population of two sectors (rural and urban) of
West Bengal have some common problems faced by the elderly people. Basically the elderly
people of urban sector though having the similar problems with the rural population but they
stand in different footing. As we see, socio-economic status of urban population is far better than
the rural population though it may not be sufficient and thus monetary problem is generally faced
by the elderly people of middle class, lower middle class and of the slum area. On the contrary
this monetary problem is mainly faced by the majority of the rural elderly people except some
exceptions.
To provide emergency service to the elderly people there is no special provision even in
the urban area and it is obvious no need to opine about the rural area. Since the elderly people is
passing through a vulnerable stage, they need some special amenities and infrastructure such as
equipments for their easy movment, safe corridor for their public interaction and artificial life
saving aid to lessening their pain and trouble including health and sanitary facilities. At present
only the rich population of the urban area and some exceptional rural people can manage to avail
those facilities, which needs institutional or governmental interventions for mass utility. It is now
revealed from various studies that the life expectancy of any population rises by using life saving
drugs and it is also applicable to the elderly people who uses regularly life support drugs. Due to
monetary problem and high cost of these life saving and life support drugs a part of the urban
elderly population and a major portion of the rural elderly population cannot avail those drugs.
It is one of the major socio-psycho problem caused mainly by socio-economic
independence reaching to the nuclear family from joint family. This rampant problem is mainly
faced by the urban elderly population due to social and family structure. It is a natural
phenomenon as the age goes up the elderly people loses their peers which reduces their
communication to exchange their views. On the other hand, the younger generation is on the age
of rat race and lacking in to spend valuable times with their elderly people which resulted the
elderly people to face extreme isolation and indirectly forced them to dip into depression. On the
contrary though the rural family structure is mostly nuclear still the rural elderly people have
some social association which prevents them to face the problems as faced by the urban elderly
people.
Some Innovative Approaches which may help in better way the elderly people if
implemented in the state:
i) Dance movement therapy: It is now-a-days used as a successful media to increase the health
status of any age group by eliciting positive changes in certain aspects of physical fitness and
healthy wellbeing (Chatterjee, 2013a). It has a great potential to improve antioxidant status and

36
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
prevent free radical injury (Chatterjee, 2013b). Western ballroom dance forms had been used in
gerontology research to enhance balance and functional autonomy (Borges et al., 2012). Salsa
dance had also been used to increase balance and strength among older adults (Granacher et al.,
2012). But such attempts with Indian dance forms are in a very nascent stage. Though the Indian
classical, folk and innovative dance forms has a great treasure in therapeutic aspects (Chatterjee
2013c), but the subject still necessitates in-depth practical application. Further the folk and tribal
dance forms of West Bengal have a great influence on physical health, mental health and social
health (Chatterjee 2013d).
ii) Age-friendly cities and communities: An age-friendly city or community is a good place to
grow old. Age-friendly cities and communities foster healthy and active ageing and, thus, enable
well-being throughout life. They help people to remain independent for as long as possible, and
provide care and protection when they are needed, respecting older people’s autonomy and
dignity.
The WHO Global Network of Age-friendly Cities and Communities was established in
2010 to support municipalities that wished to transform these ambitions into reality, involving
older people in the process and maximizing their opportunities at the local level. The network
seeks to do this by:
Inspiring change and showing what can be done and how it can be done;
Connecting cities and communities worldwide to facilitate the exchange of information and
experience;
Supporting cities and communities to find solutions by providing innovative and evidence-
based technical guidance. The network builds on previous work by WHO, and by 2015 included
more than 250 cities and communities in 28 countries.
iii) Safe Streets for seniors programme has developed measures to improve the safety of older
pedestrians in particular areas of the city where older people had been involved in accidents that
resulted in severe injuries or fatality. Initiatives in other cities, have focused on enhancing
mobility by making transportation affordable for and accessible to older people, including in
rural areas. For example, in Winnipeg, Canada, Handi-transit provides transportation for older
people who are not well served by public transport or who can no longer drive. To address the
challenges of social isolation and loneliness, many communities have developed telephone
hotlines as well as befriending schemes in which volunteers visit older people. Another way of
tackling social isolation and loneliness is through schemes that offer activities of interest to older
people. An example is the Men’s Sheds in Australia and Ireland that target men at risk of social
isolation, offering activities of interest to them, such as wood turning, repairing vintage vehicles,
compiling heritage memorabilia and classes on information technology.

37
Bhumi Publishing, India

Conclusion:
Statistics embodies the trend of increasing elderly people in the state of West Bengal.
Some discrete approaches have been taken to ease the life of the elderly people within the state
under the existing infrastructure. But no common programme has yet been taken for all the
people who have crossed the age limit of sixty years. It may rise a viable question to the existing
and future young generation how would they treat their yesterday's nation builders who are now
elderly people and what will happen when their turn will come.
References:
1. Bureau of Applied Economics & Statistics Department of Statistics & Programme
Implementation Government of West Bengal. (2015). State Statistical Handbook 2015
(Appendix-VI, p. 237, 238).
2. Hooyman, N. R., & Kiyak, H. A. (2011). Social gerontology: A multidisciplinary
perspective (9th ed.). Upper Saddle River, NJ: Pearson.
3. http://mospi.nic.in/sites/default/files/publication_reports/ElderlyinIndia_2016.pdf
4. http://shodhganga.inflibnet.ac.in/bitstream/10603/57408/9/09_chapter%203.pdf
5. https://www.hsph.harvard.edu/pgda/wp-content/uploads/sites/1288/2012/11/Population-
Aging-in-India_PGDA-Working-Papers.pdf
6. Mishra, N. (2014, August). Ageing in India: Concerns and Challenges. Bold, 24(4), 5-11.
7. Nayak, A., & Bagchi, K. K. (2017). Trends and Pattern of Population Ageing in India and
West Bengal: A Comparative Study. PRAGATI: Journal of Indian Economy, 4(2), 96-119.
doi: 10.17492/pragati.v4i02.11466
8. Roy, S. (2013). The Emerging Scenario of Population Ageing in West Bengal: Past Trends
and Future Direction. Indian Journal of Gerontology, 27(4), 588-597.
9. Shettar, S. C. (2013). Problems of Aged in Changing Indian Scenario. Web Exclubsives,
Social issues Yojna Archives. http://yojana.gov.in/problems-of-aged.asp
10. UNFPA. (2014). The Status of elderly in W.B, 2011 (p. 4-6, p. 50-53).
11. WHO. (2015). World Report on Ageing and Health (Chpt. 6, p. 161).
12. WHO. (2019). Ageing in India (p. 1-17).

38
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

BREATHLESS-ASSESSING THE AIR QUALITY - A CASE STUDY OF KOLKATA

Arunima Bhattacharya
Department of Geography,
Vidyasagar College for Women, Kolkata

Abstract:
India has been on the road to massive urbanization for the last two decades. Urbanization
has led to several problems the city is facing at present. Urbanization has always posed
sustainability threats to the surrounding and Kolkata is no exception. There are several AQI
stations in Kolkata for monitoring the air quality on a regular basis. However, the study
encompasses three major stations- Fort William, Victoria, and Jadavpur. An increasing trend is
observed from 2022 onwards with a significant dip between 2020-2021. The average monthly
AQI of Kolkata for the year 2023 has been depicted which shows an unhealthy air quality for the
winter months of January, November and December, a poor air quality for the months of
February, March, April, October, moderate air quality in June and August and a good air quality
only for the months of July and September. All the stations have shown a clear predominance of
particulate matter emissions which are most detrimental for the society and ecology. A Z Score
index has also been prepared. This standardized measure allows for a clear comparison across
different times of the year, highlighting months with potential air quality issues or
improvements. The natural and anthropogenic causes of air pollution are manifold. The paper
highlights the issues of air polluting materials and also the detrimental effects of the menace. The
city is breathing the air that exceeds the WHO’s guideline of permissibility of maximum limit of
pollutants. Funding projects that promote clean air can have enormous benefits for human health,
economic development, climate change and mitigation.
Keywords: Pollution, Urbanization, Air Quality, Particulate Matter, Mitigation, Sustainability.
Introduction:
India has been on the road to massive urbanization for the last two decades. The
metropolitan and cosmopolitan population are increasing on an alarming rate. Urbanization has
led to several problems the city is facing at present [1]. Urbanization has always posed
sustainability threats to the surrounding and Kolkata is no exception. The National Air Quality
Index Standard (NAQI) in India was launched by The Minister for Environment, Forests &
Climate Change, Shri Prakash Javadekar, on 17 September 2014. The issue of urban air pollution
poses a serious threst to the environment and the lives of citizens and thus the Government has
initiated this mission to introduce the culture of cleanliness in the country. Governmental
organizations measure and notify the public about air pollution levels using an Air Quality Index
(AQI). A significant portion of the populace will suffer from serious adverse health effects when

39
Bhumi Publishing, India

the AQI rises. An air monitor and the air pollutant concentration during a predetermined
averaging period are needed for the AQI measurement [2]. The results are grouped into ranges,
and each range is assigned a descriptor, a colour code and a standardized public health advisory.
The major determinants of AQI levels are PM 2.5, PM 10, CO, CO2, Ozone and several others.
Though the year of worldwide lockdown has brought about some remarkable changes in the AQI
for 2020-2021, yet India holds twenty- two most polluted cities of the world. For the world to
sustain the focus of the scientists, researchers should be on this major issue which threatens the
very existence of mankind as a whole.
Study Area:
The area of study taken for the purpose of this study is Kolkata which is a prominent
metropolitan city of India. With an area of 206.1 sq km, it consists of nearly 1.53 crores of
people (2023). It is the third most populous city of India and the cultural capital of the country as
well. There are several AQI stations in Kolkata for monitoring the air quality on a regular basis.
However, the study encompasses three major stations- Fort William, Victoria, and Jadavpur. The
study area for this project comprises three AQI stations located in three different locations. These
stations are spread across different areas of the city and are subject to various sources of air
pollution, including vehicular emissions, industrial pollution, and construction activities. The
AQI levels in these areas can vary depending on a range of factors such as weather conditions,
traffic volume, and industrial activities. Studying the AQI levels in these areas can help provide a
better understanding of the air pollution situation in Kolkata and may inform policy decisions
aimed at reducing pollution levels and improving public health.

Source: Internet
Literature Review:
S. Praveen and J Josephraj presented the condition and quality of the air by measuring
Air Quality Index (AQI) for the development of environmental impact assessment for building

40
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
construction projects in Coimbatore city in their research work ‘Air Quality Index (AQI) for
Development of Environmental Impact Assessment (EIA) Reports of Urban Infrastructural
Projects in Coimbatore City’ published in Nature Environment and Pollution Technology: An
International Quarterly Scientific Journal on March, 2018.He showed that the emissions from
foundry clusters and automobiles are the major sources of pollution which determine the ambient
air pollution condition of the zone. It is observed that the AQI is lower during the monsoon,
followed by winter and higher in summer. The results also revealed that the pollution level is low
for residential zones and moderate for commercial zone and is high for industrial zone. In
addition to critically analysing the 2009–2017 air pollution data analysis, Nidhi Sharma et al.,
(2018) suggested a critical observation of the 2016–1017 Delhi, India, air pollution trend that
was released by Elsevier Ltd. They have forecasted future trends for a number of contaminants,
including carbon monoxide (CO), suspended particulate matter (PM), nitrogen dioxide (NO2),
sulphur dioxide (SO2), and benzene. Utilizing time series regression forecasting in data
analytics, they have projected the future values of the pollutants previously indicated based on
historical records. The Delhi monitoring stations in Anand Vihar and Shadipur are being
examined, per the study's findings. The results clearly demonstrate the rising pollution in Delhi,
with a sharp rise in PM10 concentration levels and noticeable increases in NO2 and PM 2.5. The
Air Quality Monitoring Committee (AQMC) in Kolkata prepared a comprehensive Air Quality
Action Plan in response to an order passed by the Hon’ble National Green Tribunal on
08.10.2018. The plan aims to address the issue of air pollution in Kolkata by proposing measures
such as reducing emissions from vehicles, promoting public transportation, promoting clean
energy sources, and reducing industrial emissions. The plan also includes measures to increase
public awareness and encourage public participation in efforts to improve air quality. Overall,
the plan is a comprehensive and proactive approach to improving air quality in Kolkata.
Objectives of the Study:
The objectives of the study are:
• To analyse the overall quality of air
• To analyse the quality of air at selected stations
• The comparative seasonal and spatial analysis
• Determining the major pollutants
• Measures to combat the detrimental air quality index
Materials and Methods:
The study relates to mixed method being both qualitative and quantitative. This consisted
of collection of real time secondary data on air quality of the three stations of Kolkata- Jadavpur,
Fort William, Victoria for the year 2023. Secondary data was collected from West Bengal
Pollution Control Board, books, websites and journals relating to the area under study. The data

41
Bhumi Publishing, India

gathered, has been analysed with the help of representative maps and various cartographic
techniques. The collected data is processed and analysed with the help of multiple methods such
as tabulation and preparation of various types of charts as well.
Air Quality Trends in Kolkata:
The fundamental right of the citizens should be clean air which is mutilated in the
metropolitan cities like Kolkata, mostly for anthropogenic reasons. The overall air quality has
been deteriorating in Kolkata for the last few years with only an exception of 2020-2021 during
the overall lockdown of the country [3]. But an increasing trend is again observed from 2022
onwards. The central government together with the state pollution control agencies implemented
the National Air Monitoring Program (NAMP) covering 240 cities of the country with more than
342 monitoring stations. Accordingly, an AQI scheme has been prepared to quantify the effects
of air pollution. AQI of 0-50 indicates good air quality, 51-100 indicates moderate air quality,
101-200 indicates poor air quality, 201-300 indicates unhealthy air quality, 301-400 indicates
severe air quality and 401-500 indicates hazardous air quality. Kolkata is suffering from poor to
severe air quality throughout 2022-2023 which causes respiratory diseases and problems in
healthy masses also. The major pollutants are found to be PM2.5, PM10, Carbon Monoxide,
Carbon di oxide, Ozone, Sulphur di oxide [4].
Table 1: The Average Monthly AQI of Kolkata, 2023
Months Average AQI
January 229.86
February 129.63
March 115.67
April 112.42
May 71.21
June 59.77
July 37.28
August 69.80
September 42.53
October 111.16
November 230.55
December 223.37
Source: West Bengal Pollution Control Board

42
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

Average Monthly AQI

250
200

Average AQI
150
100
50
0

Months

Figure 1: The Average Monthly AQI of Kolkata-2023

Source: West Bengal Pollution Control Board
The average monthly AQI of Kolkata for the year 2023 has been depicted by the line
graph which shows an unhealthy air quality for the winter months of January, November and
December, a poor air quality for the months of February, March, April, October, moderate air
quality in June and August and a good air quality only for the months of July and September.
The trend line also denotes the same indicating an increasing trend on two sides of the curve and
a downward trend for the mid part only. The raw data also depicts that, three days in January
scored more than 300 AQI level- 8th January being the highest (308), six days in November
scored more than 300 AQI level- 11th and 13th November being the highest (346), two days in
December has scored more than 300 AQI level- 15th December being the highest (318). Thus,
severe air quality has been a major threat faced by the residents of this metropolis during the
winter months.
Table 2: Pollutant Emissions of Jadavpur Monitoring Station,2023
Pollutants PM 2.5 PM 10 Ozone NO2

Emissions 125.41 104.67 81.58 50.58

Source: West Bengal Pollution Control Board

PM stands for particulate matters which are otherwise known as particle pollution. They
are an admixture of solid and liquid particles quite detrimental to human health. PM 2.5 and PM
10 are inhalable fine particles with diameters less than 2.5 and 10 micrometers respectively
[5].They include dirt, soot, ashes etc. these particles are emitted from industries and automobiles
and consisted of hundreds of various chemicals and are the result of complex reactions of
Sulphur di oxide and Nitrogen di oxides. There has been a detrimental emission of PM2.5 and
PM10 in Jadavpur monitoring station as the national standard of emission is specified to be 40
mg/m3.

43
Bhumi Publishing, India

Emission of Pollutants
140 125.41
120 104.67
100 81.58
Emission in mg/m3 80
50.58
60
40
20
0
PM 2.5 PM 10 Ozone NO2
Major Pollutants

Figure 2: Pollutant Emissions of Jadavpur Monitoring Station, 2023

Source: West Bengal Pollution Control Board
Table 3: Pollutant Emissions of Fort William Monitoring Station, 2023
Pollutants PM 2.5 PM 10 Ozone NO2

Emissions 106.67 87.67 64.5 57.25

Source: West Bengal Pollution Control Board

Emission of Pollutants

NO2 57.25
Major Pollutants

Ozone 64.5

PM 10 87.67

PM 2.5 106.67

0 20 40 60 80 100 120
Emission in mg/m3

Figure 3: Pollutant Emissions of Fort William Monitoring Station, 2023

Source: West Bengal Pollution Control Board
The emission levels of Fort William Monitoring station are lower in range than that of the
previous station yet the emission rates of PM 2.5 and PM10 is on the higher side.
Table 4: Pollutant Emissions of Victoria Monitoring Station, 2023
Pollutants PM 2.5 PM 10 Ozone NO2

Emissions 114.67 109.08 93.00 59.42

Source: West Bengal Pollution Control Board

44
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

Emission of Pollutants
PM 2.5
120 114.67
100
80
60
40
20
NO2 59.42 0 PM 10
109.08

93
Ozone

Figure 4: Pollutant Emissions of Victoria Monitoring Station, 2023

Source: West Bengal Pollution Control Board
The condition of air pollutant emission is moderate in Victoria station, though here also
an excessive emission of particulate matters is noted. While the toxic soup over Kolkata consists
of several pollutants like Sulphur di oxide, carbon monoxide, nitrogen di oxide, the most
predominant ones are PM 2.5, PM10 and Ozone which are the most disastrous as well. The main
pollutant has been PM 2.5 over all the three major stations of Kolkata.
Table 5: The Comparative Analysis of AQI of Kolkata- 2022 and 2023
Months Average AQI, 2023 Average AQI, 2022
January 229.86 241.3
February 129.63 153.88
March 115.67 131.83
April 112.42 54.37
May 71.21 63.58
June 59.77 51.8
July 37.28 35.08
August 69.80 36.2
September 42.53 53.48
October 111.16 63.97
November 230.55 208.17
December 223.37 264.58

45
Bhumi Publishing, India

Comparative AQI -2022 and 2023

300

250

200
Average AQI

Average
150 AQI(2023)

Average
100 AQI(2022)

50

Months

Figure 5: Comparative Analysis of AQI of Kolkata-2022 and 2023

Source: West Bengal Pollution Control Board
Table 6: Calculation of Z Score on AQI of Kolkata, 2023
Months AQI, 2023 Z Score
January 229.86 1.539495
February 129.63 0.142102
March 115.67 -0.05253
April 112.42 -0.09784
May 71.21 -0.67238
June 59.77 -0.83188
July 37.28 -1.14543
August 69.80 -0.69204
September 42.53 -1.07223
October 111.16 -0.1154
November 230.55 1.549115
December 223.37 1.449012
Source: Calculated by the Author
The Z-score calculation provided here shows how each month's Air Quality Index (AQI)
in 2023 compares to the mean AQI over the year, standardized against the variability in AQI
across all months. January and November have significantly higher AQI values compared to the
annual mean, indicating worse air quality. Their Z-scores are more than 1.5, which suggests that
the AQI is more than one and a half standard deviations above the mean. Similarly, December
also shows a higher AQI, with a Z-score close to 1.5, indicating poor air quality that's

46
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
significantly above the mean. February's AQI is slightly above the annual mean, but the Z-score
is close to 0, indicating that its AQI is near the average AQI for the year. March, April and
October have AQI values slightly below the annual mean. Their Z-scores are near zero but
negative, indicating air quality slightly better than average. May and August months show better
air quality with their AQI values being lower than the mean. The negative Z-scores suggest these
values are less than one standard deviation below the mean. June, July, September, have
significantly better air quality, with Z-scores indicating that the AQI is more than one standard
deviation below the mean. July, in particular, has the lowest AQI, with a Z-score indicating it's
significantly below the mean, suggesting much cleaner air compared to the rest of the year. In
summary, Z-scores help in understanding how each month's air quality compares to the yearly
average. Positive Z-scores indicate worse air quality than the yearly average, while negative Z-
scores indicate better air quality. The farther a Z-score is from zero, the more significant the
deviation from the average AQI [6]. This standardized measure allows for a clear comparison
across different times of the year, highlighting months with potential air quality issues or
improvements.
Discussion:
The overall AQI figures of Kolkata also denotes a very unhealthy situation from October
to April which sometimes turn to severe as well. In summer, the air in the lower atmosphere is
lighter and warmer and rises up more easily. It carries pollutants away from the ground and
rainfall helps the pollutants to settle in the ground below [7,8]. Thus, the overall AQI decreases
during summer and monsoon months. During winter, the planetary boundary air is cooler and
denser. The cooler air is trapped inside the warmer layer which forms a kind of atmospheric lid.
This phenomenon is called winter inversion [9]. Since the vertical mixing
of the air occurs only in this layer, the emitted pollutants do not have enough space to spread
into the atmosphere. In these three major stations of Kolkata, vehicular and industrial emissions
coupled with biomass burning in the surrounding areas causes more pollution. The amount of
particulate matter shoots up. Thus, the overall AQI sparks up during the post monsoon and
winter months. The seasonal variation of air quality is more prominent than the spatial variation.
Overall, the three stations have shown a tendency of increasing particulate matter emissions,
though the quantities may vary. Most of the particulate matter concentration in the air is
attributed to the roadside eateries and combustion of fuels by the households [10].
The natural and anthropogenic causes of air pollution are manifold. A cosmopolitan city
like Kolkata which is still growing must wrap under its arm a huge influx of population including
the migratory ones. The industrial effluents, increasing vehicular emissions, individual houses
and massive cutting down of trees for expansion of roads have all contributed much to the
problem. But the problems the citizens are facing is becoming a matter of concern especially for

47
Bhumi Publishing, India

the children and the elder ones [11]. Irritation of eyes, skin, bronchitis are the short-term effects.
But long exposure to air pollution can lead to chronic respiratory and cardiovascular problems
like lung cancer, heart problems and emphysema. Long exposure to severe AQI can lead to ill
development of respiratory organs in children. Exposure to pollutants like particulate matter,
nitrogen di oxide and volatile organic compounds can lead to increased respiratory infections.
Acid rain, smog in winter are the other negative effects which muffles the daily intake of oxygen
by the citizens. The combined effects of indoor and outdoor pollution is the cause of huge
premature deaths and birth defects in new born all over the world [12]. In Kolkata, air pollution
significantly impacts human health, with a long-term study revealing that 70% of residents suffer
from respiratory diseases such as lung cancer, dyspnea, and asthma due to air pollution. Kolkata
has been identified as having one of the highest numbers of lung cancer cases among Indian
cities, contributing to its nickname as the "lung cancer capital of India."(Times of India,
December, 2023). Despite low rates of car ownership compared to other large cities, air pollution
remains high, suggesting the need for measures to reduce emissions and improve vehicle
efficiency standards. Air pollution significantly impacts mortality rates by contributing to
respiratory and cardiovascular diseases. Long-term exposure to polluted air can lead to chronic
conditions such as asthma, lung cancer, and heart disease, which increase the risk of premature
death. Fine particulate matter (PM2.5) and toxic pollutants in the air can penetrate deep into the
lungs and bloodstream, causing inflammation and exacerbating existing health conditions [13].
Studies have shown that reducing air pollution levels can lead to a decrease in mortality rates by
improving overall air quality and public health. According to ENT Specialist, Dr Dwaipayan
Mukherjee, the National President of Otolaryngologists of India, patients suffering from
bronchial and hearing issues had gone up manifold in recent times due to the rise in particulate
matter and dust particles in the air and winters are really bad as the city is enveloped in smog
(Times of India, February, 18, 2024).
To combat air pollution in Kolkata, several measures have been implemented, including
promoting carpooling to reduce vehicle traffic, enforcing pollution checks on all vehicles,
organizing cleaning drives, and controlling construction activities. These efforts aim to mitigate
the harmful effects of air pollution on the city's residents and environment [14]. A fleet of twenty
electric buses have already started plying in Kolkata to make it environmentally sustainable. The
Pollution Control Board plays a crucial role in combating air pollution through regulatory and
advisory functions. It enforces environmental laws and regulations, monitors air quality and
pollution sources, and sets emission standards for industries and vehicles. Additionally, it
promotes cleaner technologies and practices, conducts environmental impact assessments, and
raises public awareness about air pollution and its health impacts (15). Through these activities,

48
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
the board aims to reduce pollution levels, protect public health, and ensure sustainable
development.
Conclusion:
The city is breathing the air that exceeds the WHO’s guideline of permissibility of
maximum limit of pollutants. The presence of particulate matters like PM 2.5 and PM 10
exceeds 22.5 times the WHO’s guidelines. The results are being already faced by the citizens and
will be far more detrimental in recent future. Our transition to cleaner fuels and industrial
processes is the best way towards reducing air pollution (16). The electronic vehicles can go a
long way in helping the situation. Rational choices on fuels, living styles and renewable energy
resources will help us conserve the resources and make a sustainable living. Air pollution
and childbirth are global public health issues. Clean air acts as a catalyst to achieve the
sustainable development goals set by the United Nations for 2030. Funding projects that
promote clean air can have enormous benefits for human health, economic development, climate
change and mitigation which in turn would contribute to sustain the natural ecosystem and the
society.
References:
1. Jacobson, M. Z. (2012). Air Pollution and Global Warming: History, Science and
Solutions. Cambridge University Press, pp. 21-53.
2. Lal, S. (2017). Air Pollution. Educreation Publishing, pp. 147-169.
3. Rao, H. V. N., & Rao, M. (2017). Air Pollution. Mc Graw Hill Education, pp. 39-45.
4. Smedley, T. (2019). Clearing the Air: The Beginning and End of Air Pollution.
Bloomsbury Sigma, pp. 68-76.
5. Yerramilli, A. (2020). Air Pollution- Prevention and Control Technologies. BS
Publications, pp. 32-66.
6. Roger, G. D. (2006). Principles of Air Quality Management. Routledge Press, pp. 124-136.
7. Vibhaw, N. (2020). Environment, Energy and Climate Change. Lexis Nexis Publications,
pp. 54-98.
8. Doabia, T. S. (2023). Environmental and Pollution Laws in India. Lexis Nexis
Publications, pp. 155-198.
9. Kumar, A. (2012). Air Pollution and Environment. DPS Publishing House, pp. 118-156.
10. Aghaei, M. (2021). Long Term Exposure to Air Pollution and Risk of Preterm Birth and
Low Birth Weight in Tehran, Iran. Journal of Air Pollution and Health, eISSN No-2476-
3071, 6(4), pp. 233-242.
11. Gupta, D., & Duan, X. (2023). Role of Meteorological Parameters in Covid 19 Pandemic
Waves in Delhi, India. Open Journal of Air Pollution, 12(2).

49
Bhumi Publishing, India

12. Sethi, R. (2013). Air Pollution- Sources, Prevention, Health Effects. Nova Science
Publisher, pp. 147-169.
13. Budakoti, S. (2023). Assessment of Causal Relationship between Air Quality of Delhi and
Neighbouring Cities using Granger Causality Network. Journal of Air Pollution and
Health, eISSN No-2476-3071, 8(4), pp. 453-470.
14. Ramesh, M. (2019). The Climate Solution- India’s Climate Change Crisis and What We
Can Do About It. Hachette India, pp. 258-280.
15. Manisalidis, I., Starvopoulou, E., & Starvopoulou, A. (2020). Environmental Health and
Impacts of Air Pollution- A Review. Frontiers, 8.
16. Gurjar, B. R., Molina, L. T., & Ojha, C. S. P. (2010). Air Pollution, Health and
Environmental Impacts. CRC Press, pp. 158-202.
17. https://app.cpcbccr.com/AQI_India_Iframe
18. https://www.epa.gov/pm-pollution/particulate-matter
19. https://india.mongabay.com/2019/12/can-kolkata-clean-its-air-by-2030
20. https://scied.ucar.edu/learning-zone/air-quality/effects-air-pollution
21. https://www.weforum.org/agenda/2019/11/kolkata-india-air-pollution-electric-buses
22. https://www.iqair.com/in-en/newsroom/cost-of-air-pollution

50
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

A COMPREHENSIVE REVIEW ON IMPORTANCE OF BELLAMYA

BENGALENSIS IN THE CONTEXT OF ECOTOXICOLOGICAL STUDY
Triparna Roy1, Dipanwita Sarkar Paria2,
Soumendranath Chatterjee1 and Shubhajit Saha*1
1Department of Zoology, The University of Burdwan, West Bengal 713104, India
2Department of Zoology, Chandernagore College, Chandernagore, Hooghly-712136
*Corresponding author E-mail: [email protected]

Abstract:
Bellamya bengalensis (Lamarck, 1822) in one of the most important fresh water, edible,
widely distributed snails found in India. This species is present throughout Asia and Africa, and
of great medicinal as well as socioeconomic values. Moreover, it is a cheap source of protein
which is even higher than some common fish and red meat groups. Besides human, it is also a
beneficial food source of many aquatic fishes and birds; hence, Bellamya bengalensis is one the
significant part of aquatic ecosystem. Studies revealed that it has been used in the treatment of
different human diseases like chronic gastric disorder, arthritis, joint pain, rheumatism,
cardiovascular disease, night blindness, asthma, rickets, diarrhea etc. Although it possesses high
protein content, it is being neglected than other proteinaceous resources in terms of food choice.
Various bacteria present in the gut and flesh of Bellamya bengalensis act positively in the growth
and survival of the snails. As snails are mostly found in the polluted water bodies, toxic elements
present in polluted water affects the host-bacteria equilibrium, and hence changes in the
metabolism and physiology of snails may have been observed. Acute and chronic toxicity studies
with different toxic elements like formic acid, copper sulphate, fluoride, mercury etc. from
industrial effluent showed behavioral and respiratory alterations along with decreased oxygen
consumption rate in Bellamya bengalensis. This review provides an overview of ecological
importance and its application on Bellamya bengalensis. Further studies will be done on
physiological alterations upon application of toxic elements.
Keywords: Freshwater Snails, Ecological Importance, Host-Bacteria Equilibrium.
Introduction:
Bellamya bengalensis is a freshwater edible snail which is abundant and widely
distributed in temporary as well as permanent water bodies throughout India. It is mainly used as
food and medicine within the ethnic races of the North-Eastern parts of India (Bar, 2020). Along
with other snails, this snail plays an important role in maintaining the economy as well as the
tradition of West Bengal by serving as food (Khalua et al., 2014). It is a cheap source of protein
which is even higher than some common fish and red meat groups. Village people and ethnic

51
Bhumi Publishing, India

people use this as a good source of protein because of its lower market value, availability,
monetary point of interest, and ethno-medicinal value. Studies revealed that it has been used in
the treatment of different human diseases like chronic gastric disorder, arthritis, joint pain,
rheumatism, cardiovascular disease, night blindness, asthma, rickets, diarrhea, etc. It breeds
throughout the year (Srivastava et al., 2010) reaching its peak during April to July and lays the
eggs on the lower surface of the aquatic plants. Recent studies have focused on the ethnomedical
importance of Bellamya bengalensis in terms of its protein and amino acid composition
(Chakraborty et al., 2015). It has been reported that various bacteria are present in flesh, gut, and
mucus of Bellamya bengalensis. Nowadays, many aquatic ecosystems are being polluted due to
extensive increase in industrialization, uncontrolled use of pesticides which increases the
discharge of chemicals from farms as well as factories and runoff into adjacent surface water
(Gobi et al., 2018). Toxicity studies with different toxic elements like formic acid, copper
sulphate, fluoride, mercury etc. from industrial effluents showed physiological and behavioral
changes in Bellamya bengalensis which are exemplified in different studies mentioned in
journals. This review is based on socio-economic and ecological impact of Bellamya bengalensis
and changes related to its behavior and physiology in context of toxicity of different toxicants.
Ecological Importance of Bellamya bengalensis
B. bengalensis is one of the important components of freshwater ecosystems. This feeds
on microorganisms and plankton by using biofiltration mechanism (Bar, 2020). This snail plays
as a good bioindicator for a large number of aquatic species. Their population density has a
positive correlation with the temperature, TDS, electric conductivity, salinity, whereas negative
correlation with pH, hardness, etc. Thermal stress impacts on physiological parameters and
growth patterns of B. bengalensis (Baag et al., 2020). Hence, it plays an important role for
freshwater ecosystems. This specimen can be used for laboratory studies for the standardization
of freshwater sediment toxicity test protocol.
1. Nutritional values of Bellamya bengalensis
It is a cheap source of protein which is even higher than some common fish and red meat
groups (Table 1). It has high demand to less economic background people because of its lower
market value. Not only protein it contains a considerable amount of carbohydrate and fat also
(Khalua et al., 2014). This snail contains a large number of amino acids (Table 2). These amino
acids play a vital role in controlling human physiological stress (Baby et al., 2010; Chakraborty
et al., 2015). There is a great seasonal variation in the nutrient content of the snail. The
carbohydrate, protein, and fat contents are maximum during pre-monsoon (March-June) and
minimum during post-monsoon season.
2. Medicinal values of Bellamya bengalensis

52
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
From the immemorial time beings, ethnic people are very conscious about the ethno-
medicinal values of B. bengalensis. They strongly believe about the functions B. bengalensis,
which can cure several diseases such as controlling conjunctivitis, night blindness, diarrhea,
stomach upset, and chronic gastric disorders, arthritis, joint pain, rheumatism, cardiac diseases,
controlling blood pressure, asthma, rickets, calcium metabolism, nervousness, giddiness etc.
Depending on the intended use, various parts of the animal body, its derivatives, or the entire
animal itself may be utilized. Particularly noteworthy is the reliance of individuals living below
the poverty line in the northeastern regions of our country (Chhattisgarh, Jharkhand, Bihar, West
Bengal, Sikkim, Tripura, Manipur, Mizoram, etc.) on B. bengalensis as their primary source of
income and sustenance. Both in vivo and in vitro studies have lent support to traditional beliefs
regarding the snail's immune-boosting, anti-carcinogenic, anti-inflammatory, and cardio-tonic
properties. Anti-inflammatory, analgesic, and antipyretic activity: - It is used for the treatment of
arthritis, joint pain. Rheumatism etc. Studies revealed that Swiss mice show significant anti-
inflammatory, analgesic, and antipyretic activity of the lymph secretion of B. bengalensis (Ray et
al., 2017) in a dose-dependent manner. Peripheral and central analgesic activity are found within
its body fluid. The analgesic activity is due to inhibitory actions on protease or prostaglandin
biosynthetic activity (Adhikari et al., 2017; Ray et al., 2017). Hence, prostaglandin synthesis
inhibitors or non-steroidal anti-inflammatory drugs (NSAIDs) are commonly used in the
treatment of inflammations, arthritis, and pain but serious adverse events have alerted against
repeated use of NSAIDs. Hence, it can be a better alternative to develop safer anti-inflammatory
drugs.
Apoptotic and Anti-Cancer Property: The first line defense against cancer cell cycle
regulation and apoptosis. The in-vitro studies revealed that the secretion extract of Bellamya
bengalensis plays an important role in cell cycle regulation and apoptosis (Besra et al., 2013;
Besra et al., 2015). Its anti-hepatocellular carcinoma activity on human hepatic cell line is
reported (Besra et al., 2015). Cell cycle analysis reported that treatment with the extraction of
Bellamya bengalensis arrested the human hepatic carcinoma cell and leukemic cell populations
in early phase of cell cycle (Besra et al., 2013). This apoptotic property has a great significance
to develop anti-cancer drug development. The extract of Bellamya bengalensis shows
hepatoprotective activity in rat against carbon tetrachloride-induced hepatotoxicity.
Anti-Oxidative Property: In vitro study suggests a significant free radical scavenging activity
of BBE (Bellamya bengalensis Extract) on arsenic exposed human liver cells, lung epithelial
cells, and brain tissues (Ali et al., 2017). According to Ali (Ali & Maiti, 2017), BBE
demonstrated dose-dependent antioxidant effects in rat models of arsenic-induced intestine
injury. Supplementation with BBE significantly mitigated arsenic-induced oxidative, necrotic,
and apoptotic damage to liver tissue. This protective effect is crucial for averting the harmful

53
Bhumi Publishing, India

consequences of arsenic-induced oxidative stress, which poses a significant risk of cancer

development in humans. Studies have provided compelling evidence of BBE's medicinal
efficacy in counteracting oxidative stress induced by arsenic.
Anti-Microbial Property: A novel antimicrobial peptide of 1676 Da was purified from
Bellamya bengalensis. The effect of this peptide on Staphylococcus epidermidis resistant to
ampicillin and chloramphenicol reveals that it increases the staphylococcal membrane
permeability in a dose-dependent manner (Gauri et al., 2011). Hence, the peptide can be a
promising candidate for anti-Staphylococcal drug development.
Table 1: Protein content analysis of Bellamya bengalensis by Kjeldahl procedure (AOAC,
1991) (Baby et al., 2010; Chakraborty et al., 2015)
Type Protein Content (% dry weight)
Molluscs
Bellamya bengalensis 48.65±0.85%
Pila globosa 8.27%
Melania tuberculata 12.36%
Lamellidens marginalis 6.46%
Anisus convexiusculus 12.92%
Helix sp. 8.64%
Fish
Carp 42-43%
Pomfret 19%
Salmon 30%
Mackerel 30%
Meats
Chicken 30%
Mutton 21%
Pork 22%
Beef 28%

54
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Table 2: Isolation of Protein and Amino acid content in B. bengalensis and a parallel
comparison (accordingto WHO, 2007) onthedaily requirement of protein and amino acid
for child and adult human (Length - 3.84±0.26cm; Weight - 3.76±0.15gm)
Name of Amino Acid Quantity (gm/100 gm of Protein)
Aspartic acid 6.59±0.72
Glutamic acid 7.93±0.61
Serine 7.62±0.45
Histidine 6.19±0.50
Glycine 1.85±0.36
Threonine 18.89±0.88
Arginine 5.61±0.59
Alanine 8.64±0.23
Tyrosine 1.90±0.60
Valine 3.66±0.12
Methionine 0.61±0.39
Cysteine 0.84±0.82
Isoleucine 2.70±0.33
Leucine 7.51±0.26
Phenylalanine 2.10±0.36
Lysine 16.13±0.51

Toxicity Studies in B. bengalensis

1. Toxicity of Copper Sulphate to Bellamya bengalensis
According to Kamble et al. (2014) four groups of studies viz., control group and exposure
of toxicants after 24 hours, 48 hours,72 hours and 96 hours are monitored. The control group of
snails is fully immersed in water. Initially, they retract their bodies into their shells, with closed
opercula. Within 6 to 8 hours of the experiment, they exhibit protective behaviours, quickly
protruding their bodies outside the shell, engaging in regular movements including radular
movements for feeding, and displaying swift tentacular movements. The snails freely move their
foot, securely attaching to the trough, secreting ample mucus. They congregate on the floor and
walls of the trough, exhibiting normal courtship behaviour, with whitish or colourless embryos
visible.
After 24 hours of exposure to copper sulphate, snails' body parts expand, releasing
excreta into the trough. Tentacular movements change to a side-to-side motion, and foot
stretching occurs. Mucus secretion increases under stressful conditions, with snails remaining

55
Bhumi Publishing, India

grouped or paired. As mucus secretion intensifies, they become static and gradually decrease
their response to external stimuli.
No grouping or pairing of snails is observed during 48h period. Excessive excretory
product secretion occurs, accompanied by slowed tentacular movements and reduced response to
stimuli. The foot size decreases, with increased mucus secretion from the foot. Snails show
minimal response to pin touch or vibrations, retracting their bodies under the shell to counteract
toxic effects.
After 72 hours of exposure, snails lose their protective behaviour, closing their shell
openings with opercula and remaining stationary. Tentacular movements cease, foot movements
stop, yet extensive mucus secretion persists. They exhibit diminished response to mechanical
stimuli.
After 96 hours of copper sulphate exposure, snails remain motionless under chemical
stress, tightly closing their shell openings with opercula. Tentacular and foot movements cease
entirely, while mucus secretion increases significantly. Thick, gelatinous white mucus is
observed in the trough, and courtship behaviour ceases, with snails remaining solitary.
According to Kamble (2014) these behavioural changes were observed at a
predetermined mean LC50 of 0.56 ppm of pod extract of A. sinuata at 24, 48, 72, and 96 hours of
exposure.
2. Effect of Acacia sinuate on Bellamya bengalensis
Within 24 hours of exposure to Acacia sinuata pod extract, the movement of the snails
gradually decreases. Tentacular movements occur irregularly within the trough, and snails begin
secreting mucus from their feet to mitigate toxicity. Initially, quick responses to stimuli such as
pin touches are observed. After 48 hours of intoxication, snails retract their body parts inside the
shell, with excess excreta present in the trough. Tentacular movements become irregular, and
while a few snails may be paired, courtship behavior is absent.
At both 72 and 96 hours of exposure, tentacular and foot movements diminish, and snails
show no response to external stimuli. Mucus secretion increases significantly, resulting in the
presence of thick, white, gelatinous mucus in the trough. Courtship behavior ceases, and snails
remain solitary. They become immobile, losing their normal movement within the
trough.According to Kamble (Kamble & Kamble, 2014), these behavioral changes were
observed at a predetermined mean LC50 of 2.32 ppm of pod extract of A. sinuata at 24, 48, 72,
and 96 hours of exposure.
3. Fluoride Toxicity on Bellamya bengalensis
Different studies are performed on the basis of predetermined LC50 values of fluoride at
24, 48, 72, and 96 hours of exposure. Behavioral changes in the test organisms exposed to
various concentrations of the toxicant, like crawling movement, tentacle movement, clumping

56
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
tendency, touch reflex, and mucous secretion, can be studied by naked eye observation during
the bioassay following the methods of (Rand & Petrocelli, 1985). By scoring in the range of –3
to +3, indicating normal, none, strongly decreased, mildly decreased, mildly increased,
moderately increased, and strongly increased respectively (Dhara & Guhathakurta, 2021) can be
studied. The snails in the control group are active throughout the test period and show their
normal tentacle movements, crawling movements, response to touching, and remain attached
over each other’s shell surface as their normal clumping tendency. They show normal crawling
movement initially but it gradually decreases with increasing concentration of fluoride and time
of exposure than the control study. Similarly, tentacle movements of the snails inversely vary
with increasing concentrations of the toxicant and exposure time and finally cease at higher
doses (450 mg/L) at 96 h. The clumping tendency of the treated B. bengalensis is found to
increase with increasing concentration of fluoride and exposure times but reduces at 96 h and
they are gradually separated from each other and remain individual during this period. With the
passage of time, touch reflex as well as reflex from any mechanical stimulus is also reduced in
the treated snails and no response is recorded at higher doses at 72 and 96 h. The snails exposed
to the toxicant are found to withdraw their body into the shell. Excessive mucous secretion is
observed in the treated snails at higher concentrations of fluoride at 72 and 96 h of exposure. It
gradually increases with time and concentration of toxicants. Oxygen consumption rate is more
or less similar at 24 hours of exposure. After increasing the period of time, it decreases. At the
end of 48 hours, oxygen consumption rate drastically decreases. Oxygen consumption rate is
mostly low at the 96 hours of exposure. The oxygen consumption rate in the control group of test
organism is almost similar throughout the experiment. But the rate in the snails is found to be
increased gradually during 24 and 48 hours of exposure. For the chronic toxicity studies, the
sublethal concentrations of a toxicant are determined on the basis of its 10% (Treatment 1) and
20% (Treatment 2) of 96 h LC50 value to B. bengalensis (i.e., Control-0.00 mg/L; T1–27.324
mg/L; T2–54.648 mg/L) (Dhara & Guhathakurta, 2021). These studies can be done for a longer
duration than acute toxicity (30 days).
4. Toxicity of Mercury on Bellamya bengalensis
Analytical grade Mercuric Chloride, HgCl2 (purity 98%; procured from E. Merck (India)
Ltd., Mumbai) may be utilized as a toxicant. Various vital parameters, including behavioral
changes, alterations in hemocyte count, rate of oxygen consumption, and analysis of protein
content in different organs, are studied at various times and concentrations of toxicant exposure.
The exposure duration follows the same procedure as before, but the rate of exposure needs to be
predetermined. Several studies have observed behavioral changes based on foot movement,
tentacle movement, mucus secretion, courtship behavior, response to touch, distress syndrome,
and withdrawal into the shell.

57
Bhumi Publishing, India

Discussion:
Literature surveys indicate that the behavioral patterns of molluscan animals change due
to exposure to toxic compounds, including pesticides, metals, phenolic compounds, and oils in
the surrounding medium. Control groups of snails show normal behavior with standard mucus
secretion. However, intoxication by metals and molluscicides leads to an increased quantity of
mucus. The exposure and duration of toxicants impact changes in clumping tendency, crawling
movement, tentacle movement, touch response, and mucus secretion in fluoride-treated Bellamya
bengalensis. These behavioral changes are likely a reflection of early stages of physiological
stress due to the effects of toxicant exposures such as copper sulphate, Acacia sinuata, fluoride,
and mercury. Mucus secretion occurs as a result of the underlying deployment of mucoprotein. It
is one of the primary physiological reactions of gastropods aimed at preventing tissue damage,
fluid loss, and the incidence of pathogen and parasite infections (Triebskorn et al., 1996). Mucus
secretion is found to be higher due to mercury intoxication compared to cadmium and zinc (Devi
et al., 1996). Mucus dilutes toxins and helps epithelial cells protect themselves from toxins (El-
Gendy et al., 2019). Severe toxicity may damage tissue even though mucus secretion is highly
increased. Studies have revealed that behavioral changes due to the toxicity of copper sulphate
and A. sinuata within 24hrs, 48hrs, 72hrs, and 96hrs are more or less similar. However,
behavioral alterations due to copper sulphate intoxication are more acute and occur earlier than
intoxication with A. sinuata, demonstrating that copper sulphate has more toxicity than the pod
extract of A. sinuatain the freshwater snail Bellamya bengalensis. Locomotion is crucial for
ecological behavior, particularly migration, food search, reproduction, and predator avoidance;
therefore, altered locomotion capacity may affect organism fitness and lead to ecological
disadvantages (Baatrup & Bayley, 1993). Snails sense their environment by withdrawing their
tentacles when encountering an obstacle; reduced tentacle movement is observed with increased
toxic concentration, leading to degenerative changes in snails. Oxygen consumption rate
increases as the toxicity rate rises, possibly as a compensation mechanism for snails to overcome
toxic shock. As more energy is needed, oxygen demand also increases. A significant reduction in
haemocyte count has been observed due to exposure to mercury and fluoride. Haemocytes serve
various functions such as blood haemostasis, wound healing (Ottavianiet al., 2000), shell
formation and repair mechanisms (Mount et al., 2004), metal transportation, metabolism, and
even the stress response through the release of vertebrate-like endocrine molecules (Ottavianiet
al., 2000). Toxic heavy metals are known to affect haematological parameters in aquatic
organisms, especially in molluscs, interrupting normal bodily functions (Ray et al., 2013;
Leomanni et al., 2016). They can decrease cell viability and cause cell death by accumulating in
granular haemocytes. Since haemocytes of molluscs are involved in various physiological
functions and innate immunity (Serpentini et al., 2000; Ray et al., 2013), the adverse effects of

58
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
mercury on haemocytes may increase the susceptibility of organisms and reduce their survival
capability. A lower number of haemocytes in the haemolymph occurs due to the toxic effects of
fluoride, mercury, etc., which can be considered potential biomarkers.
Conclusion:
Bellamya bengalensis has a significant and proven role in monitoring all the ecological
and environmental factors of freshwater. Among all the freshwater edible mollusks, Bellamya
bengalensis has the highest protein content (% dry weight) and it also has a significant medicinal
value. Different studies provide support for its use as an anti-inflammatory, anti-cancer, anti-
oxidative, and anti-microbial agent. In the present era of global warming and industrial pollution,
it can play an important role as a bioindicator species of water quality and in water biofiltration.
Therefore, it can be concluded that Bellamya bengalensis is a freshwater snail with easy
availability, cheap market price, and immense potential for new drug development.
References:
1. Adhikari, A., Bhattacharya, S., Chanda, A., & Sur, T. K. (2017). Assessment on
antinociceptive actions of soluble fractions derived from edible mollusc (Bellamya
bengalensis Lam.). International Journal of Basic & Clinical Pharmacology. 6(12), 2916.
2. Ali, S. S., & Maiti, S. (2017). Therapeutic Potentials of Edible Freshwater-Snail Bellamya
bengalensis Extract against Arsenic-induced Rat Tissue Damage are Conferred by
Antioxidative Mechanism and Attenuation of Pro-Inflammatory Response. Journal of
Pharmacology and Experimental Therapeutics, 362(3), 487-496.
3. Baag, S., Mahapatra, S., & Mandal, S. (2020). Unravelling the effects of elevated
temperature on the physiological energetics of Bellamya bengalensis. Journal of Thermal
Biology. 88, 102494.
4. Baatrup, E., & Bayley, M. (1993). Effects of the pyrethroid insecticide cypermethrin on the
locomotor activity of the wolf spider Pardosa amentata: quantitative analysis employing
computer-automated video tracking. Ecotoxicology and environmental safety. 26(2), 138-
152.
5. Baby, R., Hasan, I., Kabir, K., & Naser, M. J. J. o. S. R. (2010). Nutrient analysis of some
commercially important molluscs of Bangladesh. Journal of Scientific Research, 2(2), 390-
396.
6. Bar, A. (2020). Bellamya bengalensis: A review on its Ecological importance, Nutritional
values & Ethnomedicinal importance. European Journal of Pharmaceutical and Medical
Research. 7(10), 315-319.
7. Besra, A. R., Pal, K., Basu, S., & Besra, S. E. (2015). Anti tumor activities of secretion
extract of Bellamya bengalensis in human hepatocellular carcinoma cell lines is mediated
by caspase-dependent apoptosis and cell cycle arrest. World Journal of Pharmaceutical

59
Bhumi Publishing, India

Research. 4(10), 2326-2344.

8. Besra, S. E., Ray, M., Dey, S., Roy, S., & Deb, N. (2013). Apoptogenic activity of
secretion extract of Bellamya bengalensis f. annandalei via mitochondrial mediated caspase
cascade on human leukemic cell lines. International Journal of Pharmaceutical Science
Review and Research. 20, 146-152.
9. Boyd, W. A., Brewer, S. K., & Williams, P. L. (2002). Invertebrates living in polluted
environments. Behavioural ecotoxicology. 293.
10. Chakraborty, D., Mukherjee, M., & Maity, J. (2015a). Estimation of proximate fatty acid
composition in Ethno-medicinally important Viviparous gastropod, Bellamya bengalensis
(Lamarck, 1822). International Journal of Advanced Scientific and Technical Research,
5(1), 84-92.
11. Chakraborty, D., Mukherjee, M., & Maity, J. (2015b). Ethno-medicinal importance of
viviparous gastropod, Bellamya bengalensis (Lamarck, 1822) in terms of estimation of its
proximate protein and amino acid composition. measurement, 3, 0.26.
12. Devi, M., Thomas, D. A., Barber, J. T., & Fingerman, M. (1996). Accumulation and
physiological and biochemical effects of cadmium in a simple aquatic food chain.
Ecotoxicology and environmental safety. 33(1), 38-43.
13. Dhara, K., & Guhathakurta, H. (2021). Toicity of neem (Azadirachta Indica a, juss) Leaf
extracts on fresh water snail, Bellamya bengalensis (Lamarck, 1882). BIOINFOLET-A
Quarterly Journal of Life Sciences. 18(1a), 35-39.
14. El-Gendy, K. S., Radwan, M. A., Gad, A. F., Khamis, A. E., & Eshra, E.-S. H. (2019).
Physiological traits of land snails Theba pisana as simple endpoints to assess the exposure
to some pollutants. Environmental Science and Pollution Research. 26, 6922-6930.
15. Gauri, S. S., Mandal, S. M., Pati, B. R., & Dey, S. (2011). Purification and structural
characterization of a novel antibacterial peptide from Bellamya bengalensis: activity
against ampicillin and chloramphenicol resistant Staphylococcus epidermidis. Peptides.
32(4), 691-696.
16. Gobi, N., Vaseeharan, B., Rekha, R., Vijayakumar, S., & Faggio, C. (2018).
Bioaccumulation, cytotoxicity and oxidative stress of the acute exposure selenium in
Oreochromis mossambicus. Ecotoxicology and environmental safety. 162, 147-159.
17. Kamble, S., & Kamble, N. (2014). Behavioural changes in freshwater snail Bellamya
bengalensis due to acute toxicity of copper sulphate and Acacia sinuata. Int J Sci Environ
Technol, 3, 1090-1104.
18. Khalua, R. K., Tripathy, S., Paul, B., & Bairy, D. (2014). Seasonal variation of
carbohydrate, protein and lipid of common freshwater edible gastropod (Bellamya
bengalensis) of Medinipur district, West Bengal. Research Journal of Biology. 2, 49-52.

60
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
19. Leomanni, A., Schettino, T., Calisi, A., & Lionetto, M. G. (2016). Mercury induced
haemocyte alterations in the terrestrial snail Cantareus apertus as novel biomarker.
Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. 183, 20-
27.
20. McIntyre, A. D., & Mills, C. F. (2012). Ecological Toxicology Research: Effects of Heavy
Metal and Organohalogen Compounds: Springer Science & Business Media.
21. Ottaviani, E., Franchini, A., Malagoli, D., & Genedani, S. (2000). Immunomodulation by
recombinant human interleukin-8 and its signal transduction pathways in invertebrate
hemocytes. Cellular and Molecular Life Sciences CMLS. 57, 506-513.
22. Rand, G. M., & Petrocelli, S. R. (1985). Fundamentals of aquatic toxicology: methods and
applications. Retrieved from
23. Ray, M., Bhunia, A. S., Bhunia, N. S., & Ray, S. (2013). Density shift, morphological
damage, lysosomal fragility and apoptosis of hemocytes of Indian molluscs exposed to
pyrethroid pesticides. Fish & shellfish immunolog. 35(2), 499-512.
24. Ray, M., Deb, N., Datta, R. and Besra, S.E., 2017. Analgesic, anti-pyretic and anti-
inflammatory activity of the lymph extracted from Bellamya bengalensis f. Annandalei in
rodent models. World Journal of Pharmaceutical Research. 6: 772-783.
25. Serpentini, A., Ghayor, C., Poncet, J., Hebert, V., Galéra, P., Pujol, J. P., Lebel, J. M.
(2000). Collagen study and regulation of the de novo synthesis by IGF‐I in hemocytes from
the gastropod mollusc, Haliotis tuberculata. Journal of Experimental Zoology. 287(4),
275-284.
26. Srivastava, P., Kumar, P., Singh, V., & Singh, D. (2010). Effect of Piper nigrum and
Cinnamomum tamala on biochemical changes in the nervous tissue of fresh water snail
Lymnaea acuminata. Bioscan, 247-256.
27. Triebskorn, R., Henderson, I., Martin, A., & Köhler, H.-R. (1996). Slugs as target or non-
target organisms for environmental contamination: a study on metal accumulation in slug
tissues. Environmental Pollution, 91(3), 331-339.

61
Bhumi Publishing, India

DNA VACCINE: TRIALS AND POSSIBLE THERAPEUTIC APPROACHES

Paromita Mondal, Madhurima Sharma, Prateeti Chattopadhyay and Sutapa Datta*
PG Department of Zoology,
Bethune College, Kolkata- 700006, West Bengal, India
*Corresponding author E-mail: [email protected]

Abstract:
Two decades ago, successful DNA vaccination was attempted by transfection of antigen
to antigen-presenting cells (APC) and producing adaptive immune responses in different
animals. Transferring the target gene into the target animal by plasmid is the main strategy of
this process. After thousands of trials, it's demonstrated that though it's well effective to the small
animals the output in larger animals is not so fruitful. So making it more useful to the larger
animals as well as to the human population the techniques are getting more modified by
following electroporation, using live virus vectors to make it more efficient, or molecular
adjuvants to get better results. Scientists are summing up the DNA vaccination trials to get the
fruitfulness against Cancer, HIV, HPV, and many other autoimmune disorders. In this review,
the total journey of DNA vaccination is summarised with the current research information about
the development and usefulness of DNA vaccines.
Keywords: DNA Vaccine, Antigen-Presenting Cell, Adaptive Immune Response,
Electroporation, Autoimmune Disorder
Introduction:
Vaccination is a process of triggering and stimulating the host’s immune response by
introducing the infectious agent which doesn't cause any disease but makes sure that the immune
system can neutralize the pathogen before causing disease. Different types of vaccines are used
like live-attenuated, killed pathogens, virus-like particles, viral subunit, viral-vector, mRNA and
DNA vaccines for infectious disease and cancer (Jain et al., 2020, Baba et al.,1999). In the early
era of vaccination, the killed virus-induced vaccines were used to be applied which didn't have
any specific killer T cell responses. Thus, non lived vaccines generally do not confer long term
protection. The killed virus-induced vaccines were useful only for some particular diseases. In
contrast, the living but weakened organisms (live attenuated) can induce a better TH (cellular)
and antibody (humoral) responses and imparts a prolonged immunity (Bernadette et al., 2011).
Nucleic acid-based vaccine platforms are more promising that the older protein-based vaccine
platforms. They are thermostable, simple, stored easily, reproducible, versatile, purified easily,
cost effective, and low risk in application (Gary and Weiner 2020, Leitner et al., 1999, Tang et
al., 1992). DNA Vaccine is produced by using several DNA sequences (vehicles) such as
plasmids, minicircle DNA or linear DNA (Stenler et al., 2014) which induce both cellular and

62
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
humoral immune responses by producing appropriate DNA copies after reaching the target.
Polynucleotide vaccine, genetic vaccine, nucleic acid vaccine are the type of DNA vaccine.
Among those the nucleic acid vaccine has been chosen by WHO which later divided into DNA
and RNA vaccine (Wolff et al., 1990). In early 1990, it's reported that plasmid DNA can respond
to both viral and nonviral antigen after delivering it to an animal's body which is able to produce
both a humoral and cellular immune response (Baba et al.,1999, Bernadette et al., 2011, Gary
and Weiner 2020). Two decades ago, in the first trial of DNA vaccine the role of recombinant
plasmid DNA was demonstrated by showing the expression of foreign proteins encoded by
plasmid (Tang et al., 1992). After the first trial, in 1992 in the second trial the immune response
against the expressed foreign proteins has been reported by introducing a plasmid to a mice skin
directly through a gene gun. Later on, in 1993, during clinical trials on lethal influenza immune
response was noticed in mice (Ulmer et al., 1993, Fynan et al., 1993). Though the response of
the DNA vaccine wasn't well established, it created a great excitement in the vaccine and
immunology community that is induced for cancer treatment, allergies and several clinical trials
of autoimmune disease, infectious diseases, have started. In the USA, 500 clinical trials were
registered at a time based on viral infection (Wang et al., 1998).
Different Era of DNA Vaccine:
In early 1990, the DNA vaccine trials were done by using mice. The trails became
successful for the smaller animal and created an excitement for further trails. In the starting
generation of the DNA vaccine both immune and humoral responses were relatively low and the
CD8+ activation was neither very frequent. So, the application of this vaccine to the larger
animals was quite challenging due to its low immune responses. In the case of the human body at
least 5-20 mg of DNA should be injected into the body because the major target for DNA is
crossing the nuclear membrane of the target cell and getting transcribed. But plasmids
degradation is relatively common that become a barrier for successful transfection of DNA
(Bender et al., 1998, Fioretti et al., 2014). To enhance the successful transfection of it, a few
steps are taken in the second generation which includes increasing gene expression by optimising
the encoded antigen transfecting through plasmids, designing better vectors, and introducing
molecular adjuvants (Bender et al., 1998).
Structure and Composition of DNA Vaccine:
DNA vaccines generally made of plasmid that get inserted into the host cell and express
the encoded antigen through transcription and induce immune responses. The plasmid is made of
two parts- plasmid backbone and transcriptional unit (Mariana Ingolotti, 2010). In plasmid
designing, the backbone consisting of the origin of replication helps the bacteria to grow in a
culture medium. The resistance gene present in the backbone helps in proper selection of plasmid
DNA from the culture medium and removes the impurities (Maja Velhner, 2002). The

63
Bhumi Publishing, India

transcriptional unit represents a promoter region which shows APC specific activity and
enhances the highest gene expression in the host cell, a transgene part which consists of encoded
gene of interest and polyadenylation sequence. The plasmid DNA along with encoded genes of
interest to be inserted into the host cell. The plasmid reaches the nuclei to the particular cell and
the encoded gene gets transcribed to induce the antigen of interest. This antigen gets recognised
as foreign compound and this enhances the immune response of the body. For enhancing the
plasmid DNA uptake by target cell and gene expression adjuvant can be added (Sidgi Syed
Anwer Abdo Hasson, 2015). In addition, a specific number of unmethylated CpG motifs can be
added to it. This helps in greater immune response for the foreign antigen by producing Th1
cytokines and enhance the costimulatory molecule like CD80, CD86 (Hawkins et al., 1994,
MacGregor et al., 2000, Mariana Ingolotti 2010, Perales et al., 2008, Akira et al 2001; Shimada
et al 1985; Tdokunaga et al., 1984).
Preparation of Vaccine:
The modern vaccines are designed on the basis of successful transfection, proper antigen
design to put the gene or antigen of interest, successful vector designing and cloning with
bacterial DNA and delivery principle. Plasmid DNA is the way by which the target antigen is to
be sent to the subject for the trial. The step includes:
1. Vector Designing: the promoter region of the plasmid carries the gene and also enhances the
in vivo transcription and translation. Vector which is used as a vehicle generally target for the
maximum protein expression by optimizing the codon usage of pathogenic DNA or alteration of
gene sequence to express the antigen of interest. In case of nucleic acid vaccine, the antigen of
interest releases continuously into the cell for maintaining a memory immunogenicity (Benjamin
Yang, 2015).
2. Vaccine Preparation: In case of
preparing the vaccine, the vectors and
copied genes are taken and got cut into
specific regions by restriction enzymes
to make the vector open and the gene
will be trimmed. After alteration these
vectors are then treated by bacteria to
get replicated. The newly replicated
vectors form many copies along with
genes sliced into loops. It becomes
self-replicating while present within
the bacterial host and makes many
copies. The vectors and bacteria need

64
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
to be separated after enough copies are produced. Detergent can be used for this process which
will rupture the cell wall and exceed the DNA is to be separated from the larger loop. The copies
of altered vectors are to be injected by which only one percent will reach to the nuclei.
3. Activation of Immune Response: The pathogenic DNA that is carried in by the vector will
reach to the nuclei and get transcribed to form mRNA which gradually move to the cytosol and
translated into protein. The host body recognizes it as a foreign protein in presence of either
major histocompatibility complex (MHC) class 1 or class 2 and stimulates the immune response
(Williams, 2013).
Delivery Methods: Intramuscular delivery is the initially induced and most common technique
for DNA vaccine (Gang Wang, 2011). But the result of this method is quite disappointing
because it creates very low immune responses. This method includes gene gun delivery by using
nanoparticles. Other than this needle free induction, electroporation is highly demanding for the
process (Prazeres and Monteiro 2014, Rice et al., 2008, Scheiblhofer et al., 2018).
Electroporation (EP) is the skilled method for transferring the sample as it increases the rate of
plasmid DNA intake by the cell, enhances the formation of target protein and boosts up
immunogenic cell activation including production of interferon (Wang et al., 1993).
Mechanism of Action of DNA Vaccine:
After reaching to the target place the vaccine can introduce both cellular and humoral
response to the host immune system through CD4+, CD8+ cells or B. The detector and the
effector cells determine the type of immune response. After entering to the host cell, the antigen
is presented to the CD4+ and CD8+ cell by antigen presenting cell (APC) through a major
histocompatibility complex (MHC) class 1 or class 2 molecule. This a protein molecule presents
on the cell surface which enable the T cell receptor to identify the target antigen.t The
professional APC is required for presenting the antigen because only professional APC like
dendritic cell and Langerhans (LNs) can induce signalling molecule such as CD80 and CD86 for
initiating primary innate response (Banchereau and Steinman, 1998). In case of life vaccines, a
peptide form of antigen is generated by the host cell to prevent the viral infection and attached
with MHC molecules that get identified by CD8+ and induce CTL response. On the other hand,
the nonlive vaccine is presented to the immune cell through MHC class 2 molecule
endogenously and is recognised by CD4+ cell and shows humoral response. The existence of
direct presentation of antigen by DC is also seen and elicits an immune response (Takashima and
Morita, 1990). The plasmid DNA may bound with host cell DNA to enhance the immunization
by producing type 1 interferons (Cevayir, 2013; Wang, 2011).

65
Bhumi Publishing, India

Clinical Trials of DNA Vaccine for Several Disease:

Clinical trials are performed to assess the efficiency and its therapeutic approaches in
treating diseases in humans. The first clinical trials of DNA-based vaccines for cancer initiate
immunisation against B cell receptors (Hawkins et al.,1994) expressed by a human B cell
lymphoma. A specific idiotypic DNA vaccine preparation for each patient is laborious and costly
thus DNA vaccines are developed against the widespread tumour antigens like HE2-2/ her for
breast cancer (Rice et al., 2008), E7 for cervical cancer (Disis et al., 2004), gp100 for melanoma
(Trimble et al., 2009), mammaglobin-A (Mam-A) (Valilou, 2019). Preclinical trials of DNA
vaccines in prostate cancer patients target prostatic acid phosphatase (PAP) and exhibit PAP-
specific CD8+ T cell immune responses. The advantages of cellular responses through DNA

66
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
vaccine is getting utilized for some critical diseases. The fact of DNA vaccines that are safe for
humans with a high tolerance and producing CTL responses encourages the trials.
HIV:
The first human HIV trial was done at the end of the 90's era (MacGregor et al., 1998).
From the first trial it was reported that people with 100 and 300 mg doses increase their antibody
against gp120 and induce CTL response. Overall, the patient with the highest dose (300mg)
shows antigen specific immune response by inducing antigen specific lymphocytes along with
IFN and b-chemokine. In HIV-1gp 160 vaccine trials were done with an infected patient with
less than 500 lymphocytes/ml but didn’t have a significant response (Weber et al.,2001). After
all the trials forming proper immune specific vaccine formation become quite difficult so
recombinant vaccine composed of DNA based and viral based vaccine along with regulatory
genes (Calarota et al., 2001) was designed. This vaccine shows some antibodies response and T
cell response and enhances HIV-1 specific CTL immune response. The first trial of recombinant
vaccine was RV144, which shows the rapid upregulation of cellular response, antigen specific
CD8+, T cell response along with humoral response (MacGregor et al., 2000). The first level of
HIV vaccine used to provide insufficient responses but RV144 with gp120 protein boost showed
almost 31% efficiency to prevent the disease (Weber et al., 2001, Calarota et al., 2001,
Lundholm et al., 1999, Pitisuttithum et al., 2006, Buchbinder et al., 2008, Rerks-Ngarm et al.,
2009, Catanzaro et al., 2006). For the new generation of the vaccine different molecular
adjuvants are getting used in the vaccine to give better immune results and decrease the viral
load into the vaccine.
sample patients Doses Duration Observation and Conclusion

HIV-1 Fifteen Three 10 weeks No significant changes in CD4 and CD8

env and HIV dose trial. intervals lymphocytes.
rev gene infected (30,100, per dose CTL responses is noticed to some patient
patient 300 mg) trials with higher do

HPV:
Human Papilloma Virus is the main reason for worldwide spread of cervical cancer as
well as causing anal dysplasia (WHO,2010). Initially, two preventive vaccines, Gardsil and
Cervix, were made but couldn’t be fruitful due to higher economic value and major distribution
problems from the US. These vaccines also couldn’t form proper cellular responses against HPV.
For clinical trials of HPV16 and HPV17 vaccines the E6 and E7 protein is targeted as antigen
because these proteins have a major role in disease formation and HPV associated cancer (Lin et
al., 2010). Currently the fusion vaccine associated with HPV 16 and HPV18 consist of multiple

67
Bhumi Publishing, India

antigens undergoing phase 1 clinical trial (Klencke, 2002). The other microencapsulated vaccine
ZYC101 is also undergoing clinical phase 1 and phase 2 trials including HPV 16 and HPV 18
derived epitopes that can induce CTL responses (Rerks-Ngarm et al., 2009, Catanzaro et al.,
2006).
Vaccine component Doses Duration Result
sample
ZYC10 HPV 16 and 50- 400 mg 3 weeks Vaccine is well tolerated but failed to
1 HPV 17. of ZYC101by of enhance proper T cell response.
Consisting of E6 four injection intervals The patient with 200 and 400 mg
and E7 per trial. doses shows an increasing immune
oncoproteins response.

Cancer:
The DNA vaccine shows CTL immune response, workers use this phenomenon and
induce clinical trials for different cancer using tumour specific antigen (TSAs) and tumour
associated antigen, TAA (Mincheff et al., 2000, Conry et al., 2002, Timmerman et al., 2002,
Rosenberg et al., 2003). The results are as following:
Disease Component of Doses Duration Result
vaccine
Prostate Prostate specific 100-800 mg Weekly No immediate immune
cancer membrane antigen intervals response. The patient with
PSMA/CD86 regular observation shows
50% immunization lately
(Mincheff, 2000)
Metastatic Carcinoemal 0.1, nil HBsAg induced immune
colorectal bryonic antigen 0.3,1.0mg- response is noticed in case
carcinoma (CEA)with single dose -3 of repetitive dosage.
HBsAg patient CEA specific antibody is
0.3, 1.0 mg- 3 weeks of not seen in any patient
repetitive intervals (Conry et al., 2002)
dose-3 patient
2 mg – 3 weeks
repetitive intervals
dose-2 patient

68
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

IgG2a and k 200, 600 1800 Monthly for Shows either humoral or T
B cell mouse mg to each 3 months cell induced immune
lymphoma immunoglobulin patient response.
(MsIg)
1800 mg dose nil Same as previous and half
delivered by cases shows both T Cell and
bio injector humoral response.
(Timmerman et al., 2002)
200, 400 and Pump Treatment was well
Metastatic gp 100 melanoma 800 mg intake for tolerated but Patient
melanoma melanocyte 96 hours developed the cancer even
every 14 after the vaccine dose, no
days of four sign of immunization.
cycle (Rosenberg et al., 2003;
Tagawa et al., 2003)
The cancer cell loses MHC 1 molecule that works as a defence mechanism against CTL
immune response.
Influenza:
Influenza is one of the most common diseases. The current vaccines show only 30% of
efficiency because influenza shows various strains which show mismatched results with the
antigen (Jones et al., 2009). The vaccines’ first trials were done into mice for H5N1 and H1N1
lethal stains (Minor, 2010). H5N1 DNA vaccines with H5 antigen were treated to the mouse
through a PMED device. Among them 47% showed antibody responses and almost 75% mice
showed T cell mediated immunity against targeted antigen (Laddy et al., 2011, Smith et al.,
2010, Evans et al., 2009). The first trial of the vaccine shows great success so the ultimate
success of the vaccine is not so far away.
Safety Profiles:
Recent studies demonstrated that the rate of DNA integration into host chromosome in
vivo is three times lower than the rate of spontaneous mutagenesis. Thus the activation of
oncogenes or inactivation of tumour suppressor genes upon DNA integration is low. There is no
reported study of induction of antibiotic resistance upon administration of DNA vaccines. (David
B Weiner and Plotkin's, 2018) Highly safe for being non-live and non-replicating. There is no
antibody generation against the DNA (autoimmunity) even after multiple immunization.
Challenges:
Higher amounts of DNA within the range of 5-20 mg need to be injected in an average
sized human to increase the immunogenicity. Optimization of transfection can be achieved by
hybrid viral/ eukaryotic promoter on antigen codons.

69
Bhumi Publishing, India

Advantages:
• Naked DNA vaccines can induce both humoral and cell-mediated immune responses.
• Naked DNA is much stable than conventional vaccine platforms.
• The production of purification of large quantities of a desired DNA sequence are much
easier a cost effective than proteins, peptides or viral/ microbial vectors (Mak and Mary
2006).
• The DNA sequence for a particular antigen can be easily modified to optimise the
immunogenicity, immunosuppressivity or intracellular localization (Mak and Mary 2006).
• DNA vaccines containing single antigen from multiple pathogens or multiple antigens
from single pathogen are easy to manufacture (Mak and Mary 2006).
• DNA vaccines can generate endogenous antigens that induce CD8+ T cell responses (Mak
and Mary 2006).
• Targeted protein is properly folded.
• Easy storage on a large scale.
Discussion:
DNA vaccine is the new hope for medical science and safer than live viral vaccines with
almost negative side effects. It can be also designed by multiple genes of interest to target several
problems through a single plasmid. workers have seen it only shows immune responses against
the antigen of interest so risk of another unexpected reaction is lesser in this case. This vaccine
induces different immune responsive cells and presents the antigen through both class 1 and class
2 MHC. The unmethylated CpG present in the plasmid backbone act as PAMP molecule and
enhance the immune cell through the interaction with TLR9 (Akira et al 2001). Even DNA
vaccines are economically supportive and the production of its copies is easier and can be stored
for a long time and logistically easy to port. Equally this vaccine has multiple drawbacks which
includes its effectiveness on larger animals. The main problem lies in the delivery approaches of
the plasmid. The intramuscular injection was quite effective to the smaller animal only. Later on
gene gun delivery, electroporation reflect a better result for the larger animal still a lot of
improvement is needed to get 100% success in human treatment (Conry et al., 2002). Current
trials show that it provides a very low immunogenic effect and the cells can be highly antigen
tolerant, atypical growth of parasitic protein can be seen.
Conclusion:
Conventional vaccines prevent the spread of numerous highly infectious diseases. For
conventional vaccine manufacturing researchers had to handle live pathogens, that increases the
risk of contamination. The time taken for vaccine designing and cost of making are high also.
These challenges had led to the development of alternative vaccine like DNA-based vaccine. A
DNA vaccine is composed of a bacterial plasmid containing the target antigen (expressed in the
70
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
host) along with the mammalian promoter. The promoter enables it to transfect mammalian
cells. DNA vaccine is more stable, cost efficient & easier to handle. DNA vaccine induce an
adaptive immune response. Since early 1992, scientists are finding promising techniques to make
the DNA vaccine useful in every possible way. Thousands of trials have summed up to a
conclusion that it can provide immunogenicity. The autoimmune disease, influenza, malaria,
HIV, HPV shows a positive response during the trials. Cancer trials are showing more or less
immunogenic activation. As it is highly effective to the smaller animal and some of the vaccines
are used for veterinary treatment. Workers are focusing on the efficient DNA uptake, proper
antigen designing, using molecular adjuvants, plasmid delivery by immunomodulatory
molecules to boost up the immune system. FDA, WHO and many European countries have
already set up guidelines and protocols to achieve 100% success in future. There is more
research needed for the development of an ideal DNA vaccine that will not degrade
extracellularly and will enter the nucleus of target cells successfully.
Acknowledgement:
The authors acknowledge their departments and Institute. This review received no
external funding.
References:
1. Baba, T. W., Liska, V., Khimani, A. H., Ray, N. B., Dailey, P. J., Penninck, D., Bronson,
R., Greene, M. F., McClure, H. M., Martin, L. N., & Ruprecht, R. M. (1999). Live
attenuated, multiply deleted simian immunodeficiency virus causes AIDS in infant and
adult macaques. Nature Medicine, 5, 194–203.
2. Bernadette Ferraro, Matthew P. Morrow, Natalie A. Hutnick, Thomas H. Shin, Colleen E.
Lucke, & David B. Weiner. (2011). Clinical Applications of DNA Vaccines: Current
Progress. Clinical Infectious Diseases, 53(3), 296–302. https://doi.org/10.1093/cid/cir334
3. Fynan, E. F., Webster, R. G., Fuller, D. H., Haynes, J. R., Santoro, J. C., & Robinson, H.
L. (1993). DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun
inoculations. Proceedings of the National Academy of Sciences of the United States of
America, 90, 1147.
4. Gary, E. N., & Weiner, D. B. (2020). DNA vaccines: prime time is now. Current Opinion
in Immunology, 65, 21–27.
5. Jain, S., Batra, H., Yadav, P., & Chand, S. (2020). COVID-19 vaccines currently under
preclinical and clinical studies, and associated antiviral immune response. Vaccines, 8(4),
649.
6. Leitner, W. W., Ying, H., & Restifo, N. P. (1999). DNA and RNA-based vaccines:
principles, progress and prospects. Vaccine, 18(9-10), 765-77.
https://doi.org/10.1016/s0264-410x(99)00271-6

71
Bhumi Publishing, India

7. Stenler, S., Blomberg, P., & Smith, C. E. (2014). Safety and efficacy of DNA vaccines:
plasmids vs. minicircles. Human Vaccines & Immunotherapeutics, 10(5), 1306–1308.
8. Tang, D. C., DeVit, M., & Johnston, S. A. (1992). Genetic immunization is a simple
method for eliciting an immune response. Nature, 356, 152–154.
9. Ulmer, J. B., Donnelly, J. J., & Parker, S. E. (1993). Heterologous protection against
influenza by injection of DNA encoding a viral protein. Science, 259, 1745–1749.
10. Wolff, J. A., Malone, R. W., Williams, P., Chong, W., Acsadi, G., Jani, A., & Felgner, P.
L. (1990). Direct gene transfer into mouse muscle in vivo. Science, 247, 1465–1468.
11. Akira, S., Takeda, K., & Kaisho, T. (2001). Toll‐like receptors: Critical proteins linking
innate and acquired immunity. Nature Immunology, 2, 675–680.
12. Banchereau, J., & Steinman, R. M. (1998). Dendritic cells and the control of immunity.
Nature, 392, 245–252.
13. Bender, B. S., Ulmer, J. B., DeWitt, C. M., Cottey, R., Taylor, S. F., Ward, A. M.,
Friedman, A., Liu, M. A., & Donnelly, J. J. et al., (1998). Immunogenicity and efficacy of
DNA vaccines encoding influenza A proteins in aged mice. Vaccine, 16, 1748–1755.
14. Calarota, S. A., Kjerrstrom, A., Islam, K. B., & Wahren, B. (2001). Gene combination
raises broad human immunodeficiency virus-specific cytotoxicity. Human Gene Therapy,
12, 1623–1637.
15. Cevayir Coban, S. K. (2008). Molecular and cellular mechanisms of DNA. Human
Vaccines, 4, 453-457.
16. Disis, M. L., Schiffman, K., Guthrie, K., Salazar, L. G., Knutson, K. L., Goodell, V., dela
Rosa, C., & Cheever, M. A. (2004). Effect of dose on immune response in patients
vaccinated with an her-2/neu intracellular domain protein--based vaccine. Journal of
Clinical Oncology, 22(10), 1916–1925.
17. Fioretti, D., Iurescia, S., & Rinaldi, M. (2014). Recent Patents on Anti-Cancer Drug
Discovery. Recent Patents on Anti-Cancer Drug Discovery, 9(1), 66–82.
18. Hawkins, R. E., Zhu, D., Ovecka, M., Winter, G., Hamblin, T. J., Long, A., & Stevenson, F.
K. (1994). Idiotypic vaccination against human B-cell lymphoma. Blood, 83(11), 3279–
3288.
19. MacGregor, R. R., Boyer, J. D., Ciccarelli, R. B., Ginsberg, R. S., & Weiner, D. B. (2000).
Safety and immune responses to a DNA-based human immunodeficiency virus (HIV) type
I env/rev vaccine in HIV-infected recipients: Follow-up data. Journal of Infectious
Diseases, 181, 406.
20. Mariana Ingolotti, O. K. (2010). DNA vaccines for targeting bacterial infections. Expert
Review of Vaccines, 9(6), 747–763.

72
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
21. Perales, M. A., Yuan, J., Powel, S., Gallardo, H. F., Rasalan, T. S., Gonzalez, C., Manukian,
G., Wang, J., Zhang, Y., Chapman, P. B., Krown, S. E., Livingston, P. O., Ejadi, S.,
Panageas, K. S., Engelhorn, M. E., Terzulli, S. L., Houghton, A. N., & Wolchok, J. D.
(2008). Phase I/II study of GM-CSF DNA as an adjuvant for a multipeptide cancer vaccine
in patients with advanced melanoma. Molecular Therapy, 16(12), 2022–2029.
22. Prazeres, D. M. F., & Monteiro, G. A. (2014). Plasmid Biopharmaceuticals. Microbiology
Spectrum, 2(3).
23. Rice, J., Ottensmeier, C. H., & Stevenson, F. K. (2008). DNA vaccines: precision tools for
activating effective immunity against cancer. Nature Reviews Cancer, 8(2), 108–120.
24. Scheiblhofer, S., Thalhamer, J., & Weiss, R. (2018). DNA and mRNA vaccination against
allergies. Pediatric Allergy and Immunology.
25. Tang, D. C., DeVit, M., & Johnston, S. A. (1992). Genetic immunization is a simple
method for eliciting an immune response. Nature, 356, 152–154.
26. Trimble, C. L., Peng, S., Kos, F., Gravitt, P., Viscidi, R., Sugar, E., Pardoll, D., & Wu, T. C.
(2009). A phase I trial of a human papillomavirus DNA vaccine for HPV16+ cervical
intraepithelial neoplasia 2/3. Clinical Cancer Research, 15(1), 361–367.
27. Valilou, S.F. and Keshavarz-Fathi M. (2019). Vaccines for Cancer Immunotherapy:
Genetic Vaccine for Cancer., 129–143. https://doi.org/10.1016/B978-0-12-814039-
0.00010-2.
28. Wang, B., Agadjanyan, M. G., & Srikantan, V. (1993). Molecular cloning, expression, and
biological characterization of an HTLV-II envelope glycoprotein. HIV AIDS Research and
Human Retroviruses, 9(9), 849–860.
29. Weber, R., Bossart, W., Cone, R., Luethy, R., & Moelling, K. (2001). Phase I clinical trial
with HIV-1 gp160 plasmid vaccine in HIV-1-infected asymptomatic subjects. European
Journal of Clinical Microbiology & Infectious Diseases, 20, 800–803.
30. Williams, J. A. (2013). Vector Design for Improved DNA Vaccine Efficacy, Safety and
Production. Vaccines, 1(3), 225-249.
31. Buchbinder, S. P., Mehrotra, D. V., Duerr, A., et al., (2008). Efficacy assessment of a cell-
mediated immunity HIV-1 vaccine (the Step Study): A double-blind, randomized, placebo-
controlled, test-of-concept trial. The Lancet, 372, 1881–1893.
32. Catanzaro, A. T., Koup, R. A., Roederer, M., et al., (2006). Phase 1 safety and
immunogenicity evaluation of a multi-clade HIV-1 candidate vaccine delivered by a
replication-defective recombinant adenovirus vector. Journal of Infectious Diseases, 194,
1638–1649.
33. Conry, R. M., Curiel, D. T., Strong, T. V., Moore, S. E., Allen, K. O., Barlow, D. L., Shaw,
D. R., et al., (2002). Safety and immunogenicity of a DNA vaccine encoding

73
Bhumi Publishing, India

carcinoembryonic antigen and hepatitis B surface antigen in colorectal carcinoma patients.

Clinical Cancer Research, 8, 2782–2787.
34. Klencke, B., Matijevic, M., Urban, R. G., Lathey, J. L., Hedley, M. L., Berry, M.,
Thatcher, J., Weinberg, V., Wilson, J., Darragh, T., Jay, N., Da Costa, M., & Palefsky, J.
M. (2002). Encapsulated plasmid DNA treatment for human papillomavirus 16‐associated
anal dysplasia: A phase I study of ZYC101. Clinical Cancer Research, 8, 1028–1037.
35. Lin, K., Russinovich, E., Ma, B., Hung, C. F., & Wu, T. C. (2010). Therapeutic HPV DNA
vaccines. Immunologic Research, 47, 86–112.
36. Mincheff, M., Tchakarov, S., Zoubak, S., Loukinov, D., Botev, C., Altankova, I.,
Georgiev, G., Petrov, S., & Meryman, H. T. et al., (2000). Naked DNA and adenoviral
immunizations for immunotherapy of prostate cancer: A phase I/II clinical trial. European
Urology, 38, 208–217.
37. Pitisuttithum, P., Gilbert, P., Gurwith, M., et al., (2006). Randomized, double-blind,
placebo-controlled efficacy trial of a bivalent recombinant glycoprotein 120 HIV-1 vaccine
among injection drug users in Bangkok, Thailand. Journal of Infectious Diseases, 194,
1661–1671.
38. Rerks-Ngarm, S., Pitisuttithum, P., Nitaya Phan, S., et al., (2009). Vaccination with
ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand. New England Journal of
Medicine, 361, 2209–2210.
39. Rosenberg, S. A., Yang, J. C., Sherry, R. M., Hwu, P., Topalian, S. L., Schwartzentruber,
D. J., Restifo, N. P., Haworth, L. R., Seipp, C. A., Freezer, L. J., Morton, K. E.,
Mavroukakis, S. A., & White, D. E. (2003). Inability to immunize patients with metastatic
melanoma using plasmid DNA encoding the gp100 melanoma‐melanocyte antigen. Human
Gene Therapy, 14, 709–714.
40. Timmerman, J. M., Singh, G., Hermanson, G., Hobart, P., Czerwinski, D. K., Taidi, B.,
Rajapaksa, R., Caspar, C. B., Van Beckhoven, A., & Levy, R. (2002). Immunogenicity of a
plasmid DNA vaccine encoding chimeric idiotype in patients with B‐cell lymphoma.
Cancer Research, 62, 5845–5852.
41. World Health Organization. (2008). Cervical cancer incidence and mortality worldwide in
2008. GLOBOCAN. Retrieved from http://globocan.iarc.fr/factsheets/cancers/cervix.asp.
Accessed 10 May 2010.
42. Evans, K., McElwaine-Johnn, H., & Sharpe, M. (2009). DNA vaccination protects against
an influenza challenge in a double-blind randomized placebo-controlled phase 1b clinical
trial. Vaccine.
43. Laddy DJ, Yan J, Kutzler M, Kobasa D, Kobinger GP, Khan AS, Greenhouse J, Sardesai
NY, Draghia-Akli R, Weiner DB. Heterosubtypic protection against pathogenic human and

74
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
avian influenza viruses via in vivo electroporation of synthetic consensus DNA antigens.
PLoS One. 2008 Jun 25;3(6):e2517. https://doi.org/10.1371/journal.pone.0002517.
44. Jones S, Evans K, McElwaine-Johnn H, Sharpe M, Oxford J, Lambkin-Williams R, Mant
T, Nolan A, Zambon M, Ellis J, Beadle J, Loudon PT. (2009). DNA vaccination protects
against an influenza challenge in a double-blind randomised placebo-controlled phase 1b
clinical trial. Vaccine. 21;27(18):2506-12. https://doi.org/10.1016/j.vaccine.2009.02.061.
45. Minor, P. (2010). Vaccines against seasonal and pandemic influenza and the implications
of changes in substrates for virus production. Clinical Infectious Diseases, 50, 560–565.
46. Smith, L. R., Wloch, M. K., & Ye, M. (2010). Phase 1 clinical trials of the safety and
immunogenicity of adjuvanted plasmid DNA vaccines encoding influenza A virus H5
hemagglutinin. Vaccine, 28, 2565–2572.
47. Weiner DB, Gary JN, (2018). Plotkin's. Development of Gene-Based Vectors for
Immunization Vaccines, 7th Edn, https://doi.org/10.1016/B978-0-323-35761-6.00067-5.

75
Bhumi Publishing, India

URBAN BIODIVERSITY: LIFE AMIDST CONCRETE JUNGLE

Amit Mahata
Department of Zoology,
Vidyasagar College for Women, Kolkata
Corresponding author E-mail: [email protected]

Abstract:
Urbanization led to alteration in the land use pattern, that result into development of a
unique ecosystem. Such altered ecosystem often supports wide range of biodiversity that
provides valuable ecosystem services. The effect of anthropogenic activities on the species
richness and abundance is not always detrimental. Different groups of species show different
level of response to the changed environmental situation. As, such they can be categorized into
urban- exploiters, adapters and avoiders according to their ability to utilize the urban resources
efficiently. Urbanization often led to the replacement of native species with non-native species
due to introduction of several exotic floral and faunal species. Homogenisation of species
assemblages in urban areas appears to be driven by invasions or introductions of generalist,
urban-adapted species leading to local extinctions of specialist species. The biodiversity in the
urban landscapes can be conserved by appropriate ecological planning along with their efficient
implementation. Identifying the existing blue green spaces on a priority basis and zone-based
approach involving the locals is the most efficient in managing the urban biodiversity. Ecological
planning not only highlight the linkages between urbanization and biodiversity, but also helps
integrate this understanding into urban planning, strategy, and investment. All the available
resources should be taken into account while establishing a sustainable city. Cutting-edge
science, inclusive, expansive visioning, comprehensive and strategic planning are to be
considered because sustainable development works with and not against nature.
Keywords: Urbanization, Biodiversity, Richness, Abundance, Homogenisation, Sustainable
Development.
Introduction:
Urbanisation leads to a near-permanent alteration of land use pattern, which eliminates
the locally dominant natural ecosystem that poses a serious threat to global biodiversity. Habitat
degradation and fragmentation increasingly challenges wildlife persistence and movement in
human-dominated landscapes, due to urbanization and the erosion of blue (i.e., aquatic) - green
(i.e., terrestrial) spaces to accommodate growing human population. As a result, key biological
processes such as breeding, dispersal, migration and resource utilization are disrupted (Fletcher
et al., 2018), that led to ultimate reduction in gene flow between populations with profound
implications for genetic diversity and adaptive processes.

76
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
The positive effects of the urban biodiversity on ecosystem services, including human
well-being very often remain concealed under the negative impact of urbanisation on
ecosystems, biodiversity hotspots or protected area. This stigmatisation of the urban landscape
can distract from the high levels of biodiversity that may flourish inside cities.
Biodiversity conservation and human well-being are tightly interlinked. Ecosystem
services linked to biodiversity, in turn, are crucial for ensuring long-term human well-being
(Seppelt et al., 2013).
Current Scenario of Urban Biodiversity
Across the planet, about three-quarters of the land surface has been transformed by
human interventions, two-thirds of the oceans are under severe threat, and over 85 percent of
wetlands have been destroyed. The average abundance of nonhuman species in their native home
regions has declined by more than 20 percent, and approximately 1 million species face
imminent extinction (IPBES 2019b).
Some Case Studies:
The effects of various anthropogenic activities on species diversity and distribution are
virtually impossible to ignore in urban systems but still there are evidences of strong, positive
population effect sizes between biodiversity and human population density (an indicator of
urbanization). However the degree of impact varies across different taxonomic groups. In a
number of studies human population density is found to be positively correlated with the number
of threatened species, geographically restricted species (endemic to a localised region) and
introduced species. While the correlation with threatened species infers that increasing
urbanisation adversely affects species persistence, such spatial correlations are weak causal
explanations. Lower species diversity with increasing urbanisation has been found for birds
(Cam et al., 2000; Sandstrom et al., 2006), bats (De Cornulier & Clergeau 2001), terrestrial
mammals (Tait et al., 2005) and amphibians (Gagne´ & Fahrig 2007), but the occasional study
does not fit this trend.
It is evident that species richness tends to increase for plants, birds and introduced
species, this may be due to the fact that increase in the number of exotic species in human
domesticated form adds to the indigenous species.
Comparisons of species richness between urban areas and those dominated by agriculture
or native vegetation at the outskirts of the cities find the richness to be lower in urban areas,
while total species abundance is higher with a handful of opportunist species contributing the
majority of individuals.

77
Bhumi Publishing, India

Figure 1: Population effect sizes (combining correlation coefficients across studies) between
human population density and the species richness of birds, mammals and plants, and
threatened, restricted and introduced species

Exotic species  Sedentary species ?

Habitat generalists  Short-distance migrants ?
Habitat specialists  Widely distributed species 
Ground-nesters  Narrowly distributed species 
Cavity-nesters ? Omnivores 
Shrub-nesters ? Insectivores ?
Tree-nesters ? Granivores ?
Figure 2: General trends in the bird’s diversity observed with increasing urbanization
(: increase, : decrease, ?: Questionable)

Some species thrive very well in urban habitats. For example, birds with bigger brains
(Maklakov et al., 2011) and broader environmental tolerances (Bonier et al., 2007) are more
likely to make cities their homes. In many cases, urban development leads to the replacement of
native species with non-native species that are well adapted to urban environments globally
technically referred to as ‘alien invasion’. This shift leads to biotic homogenization, threatens to
reduce the biological uniqueness of local ecosystems (Blair 2001). For plants, birds, and
butterflies along urban gradients, the number of non-native species increases toward centres of
urbanization while the number of native species decreases.

78
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

Figure 3: Aerial view of Urban landscape dominated by concrete structure

Figure 4: Aerial view of the outskirt of city areas, a transitional zone with interspersed
green landscapes

Figure 5: Roosting bats in Urban environment. (Kolkata, West Bengal)

79
Bhumi Publishing, India

Figure 6: Urban adapted birds during breeding season (Kolkata, West Bengal)

Figure 7: Urban blue spaces support high diversity of species (Kolkata, West Bengal)

Figure 8: Urban landscape attracts large population of migrants (Howrah, West Bengal)
80
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Biodiversity Shift:
Homogenisation of species assemblages in urban areas appears to be driven by invasions
or introductions of generalist, urban-adapted species leading to local extinctions of specialist
species. The process of homogenisation raises substantial challenges for protecting diverse
species assemblages within human settlements. Species richness is found to be highest at
intermediate levels of disturbance. For an urban settlement the outskirts comprising of the
suburban belts are supposed to have highest diversity due to the phenomenon of ‘edge effect’.
Many studies have observed this relationship for a variety of taxonomic groups including birds
(Chace & Walsh 2006), bats (Duchamp et al., 2004) and lizards. This response may be the result
of increased resources at moderate levels of urbanisation with diversified niche structures. More
blue-green infrastructures in the form of gardens, parks, reserves, agriculture, aquatic bodies and
other land uses characterising these areas and providing habitat for more groups of species
(Young et al., 2007).
Species display different tolerances to urban disturbance and have been grouped as
‘exploiters’, ‘adapters’ or ‘avoiders’ of urbanisation (Croci et al., 2008). The exploiters are fittest
members to successfully thrive and flourish the urban landscapes followed by the adapters. The
avoiders are the worst affected, they diminish and gradually replaced within due course of time.
Species classified as adapted to moderate levels of disturbance will tend to be dominant at the
rural–urban interface where landscapes are the most heterogenous (Caula et al., 2008). This is a
distinct group of species able to use resources typical in this landscape, but the assemblage is
very different from the species that occurred in the area prior to development (McKinney 2006).
Another recurring pattern along rural–urban gradients is the greater abundance of species
observed in bats and birds at the urban centre, with a few urban exploiters contributing the
majority of individuals. Other taxonomic groups show a different pattern even when a few
species are dominant. For example, abundance has been observed to decrease at the urban centre
for amphibians (Pillsbury & Miller 2008), lizards (Germaine & Wakeling 2001), butterflies
(Blair 1999) and ground beetles (Gaublomme et al., 2008).
The difference in responses of certain taxa may be related to their ability to disperse
through the landscape, their habitat preferences and the location of habitat along the rural–urban
gradient. White et al., (2005) found that parks and streetscapes with native vegetation supported
more bird species than recently developed streetscapes or those with exotic vegetation.
Urban landscapes not only can this promote species conservation, but vegetation offers
human residents a range of additional benefits including microclimate regulation (Harlan et al.,
2006), control of air and water pollution, carbon storage, recreational opportunities (Miller 2006)
cultural and health benefits (Fuller et al., 2007). An increasing number of studies demonstrate a
relationship between the socioeconomic profile of neighbourhood residents or householder

81
Bhumi Publishing, India

behaviour and vegetation cover and plant species diversity (Grove et al., 2006). These studies
often show that income or some other measure of social ‘status’ (e.g. education) is positively
correlated with species richness or vegetation cover.
The amount and spatial distribution of area dedicated to urban green and blue spaces
forms the backbone of any city’s plan for conserving urban biodiversity and ecosystem services.
There are two metrics that can best measure the baseline of urban nature. First, cities can
evaluate the percentage of their landscape that is currently dedicated to green and/or blue space.
Second, planners can assess what proportion of this space is permanently protected through
legislation or zoning. To maintain healthy levels of biodiversity within a city, it is not enough
simply to have areas of dedicated green and blue space; species must be able to move between
these areas in order to maintain healthy populations—that is, there must be connectivity. A
general framework for decision-making is essential to guide urban ecological planning.
Conceptual framework to guide urban ecological planning:
1. Foundation of set up:
➢ The initial step includes preparing an expert team, a strategic, inclusive vision, and a
work plan with clear objectives of the ecological planning process at hand.
➢ A clearly articulated goal for proposed nature-based solutions with metrics and indicators
with which to assess success should be framed.
➢ Participation and realistic expectations of local residents and stakeholders should be
taken into consideration. Compilations or assessments of relevant data and other
resources to taken into account.
2. Analyse and compare:
➢ This step includes the mapping of current biodiversity, ecosystem types, ecosystem
services and to articulate possible alternatives and evaluate likely outcomes against stated
goals
➢ The data about original species diversity, ecosystem types and services should be
gathered from the existing literature (if available).
➢ Alternative future maps of the area of interest should be constructed.
➢ Maps and summary tables reflecting agreed-upon metrics of urban nature, urban
biodiversity, and urban ecosystem services is to be compared across alternatives.
3. Synthesize and inform: Summarize results, inform decisions, and iterate
➢ Construction of interactive maps of urban nature and biodiversity including the key
biodiversity areas, simple diagrams showing projected changes in urban nature.
➢ local workshops to communicate the city’s vision for the future to be conducted
involving the locals. An interpretation guidebook for nature education to be prepared.

82
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
➢ An updated version of the desired future and a process for how to derive plans to reach
that future
The rise of popular citizen science platforms such as iNaturalist or the Global
Biodiversity Information Facility (GBIF) can fill a key void of the biodiversity data. The most
popular citizen science platform for reporting species occurrences record the latitude, longitude,
time of sample, and identity of all species in their database (GBIF 2017). From this, city
managers can conduct annual surveys of how many vertebrate and invertebrate species are found
within their city each year. This data can serve as the baseline of the local biodiversity profile.
Implementation.
1. Improve existing blue and green spaces for local biodiversity (Beninde, Veith, and
Hochkirch 2015). The available green spaces and the aquatic bodies should be identified
and steps is be taken for improvement of the environmental health of the said habitats.
2. Identify habitats that used to exist in the city and restore them (Blaustein 2013). There are
several patches of native habitats that may be existing till dates and are vulnerable to
extinction. Every possible effort should be done to restore such patches of natural
ecosystem, because they are the representative of the original biodiversity of the region.
3. Enrich and/or reintroduce native plant and animal species (Burghardt, Tallamy, and Shriver
2009). Introduction of the native plants and animals are to be encouraged especially in the
private domain. This will ensure enriching and restoration of the local and original
biodiversity.
4. Plant native plants in parks, roadsides, and gardens. Planting more native plants in public
areas such as parks, roadsides, gardens etc. for beautification purposes instead of alien
exotic plants. It helps in niche diversification and resource partitioning thereby restoring
local biodiversity.
5. Participation of the locals. (Soga et al., 2017). Awareness amongst the locals regarding the
importance and benefits of the biodiversity is to be developed. The peoples should be
encouraged for urban gardening in the form of rooftop or vertical gardening for food
security, food for pollinators and mental health and other benefits. Vertical gardening in
multi-storeyed buildings under both the private or public domain should be encouraged.
6. The fragmented ecosystems should be connected by expanding green spaces near one
another, particularly by adding corridors of vegetation or other forms of connectivity
(Beninde, Veith, and Hochkirch 2015). This will ensure free movements of the animal
species which will help in maintaining a steady state population with good numbers.
7. Expand tree canopy using native species (Shackleton et al., 2015). Tree canopies supports
a wide range of biodiversity. However, the native species should be of preferred instead of
exotic species as such communities supports and sustain more biodiversity.

83
Bhumi Publishing, India

8. Build tunnels or overpasses to enable movement of animals throughout the city,

particularly across roads or other linear features (Riley et al., 2014; Teixeira et al., 2013).
Tunnels and overpasses ensure free movement of the animals amongst the metapopulation
that can ensure exchange of genetic materials thereby preventing the genetic drift.
9. Add parks and other green spaces to the city (Beninde, Veith, and Hochkirch 2015). New
areas are to be identified for the establishment of green spaces, parks etc. to increase the
green patches for sustenance of the local biodiversity.
10. Use nature-based solutions, when possible, for stormwater and flood management
(Ishimatsu et al., 2017). This process will help in ground water recharge and will reduce
the depletion of the ground water resource.
11. Use transdisciplinary collaborations between urban planners, engineers, and ecologists to
design stormwater and flood management plans (World Bank 2019).
Identification of the key drivers of spatial congruence and the development of intra- and
inter-regional management strategies that ensure species persistence through appropriate
settlement planning should be the focus of future research. More field-based works are needed to
assess the ecological, social and environmental (e.g. energy use) relationship between
concentrated, high-density living in increasingly large cities versus more dispersed, smaller
regional centres
Better planning of urban growth, identification of priority areas, zone-based management
of protected areas near cities, integration of habitat for biodiversity within cities, and use of
nature-based solutions to urban problems can all help reverse the negative impacts of cities on
biodiversity (The Nature Conservancy 2018). Aligning ecological findings with administrative
boundaries, or existing policy is very much needed to increase the utility of prioritization
exercises.
Ecological planning not only highlight the linkages between urbanization and biodiversity,
but also helps integrate this understanding into urban planning, strategy, and investment. Now a
days, we have the knowledge, data, tools, and approaches to direct investment in nature to solve
many different types of urban problems. Using these approaches at present will help cities of the
future become more sustainable, liveable, resilient, and equitable.
Leadership to address the escalating risks and costs of destabilizing Earth’s life-support
systems and climate must come from cities. All the available resources should be taken into
account while establishing a sustainable city. Cutting-edge science, inclusive, expansive
visioning, comprehensive and strategic planning are to be considered because sustainable
development works with and not against nature.

84
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
References:
1. Beninde, J., Veith, M., & Hochkirch, A. (2015). Biodiversity in cities needs space: A meta-
analysis of factors determining intra-urban biodiversity variation. Ecology Letters, 18(6),
581–592. https://doi.org/10.1111/ele.12427
2. Blair, R. B. (1999). Birds and butterflies along an urban gradient: Surrogate taxa for
assessing biodiversity? Ecological Applications, 9, 164–170.
3. Blair, R. B. (2001). Birds and butterflies along urban gradients in two ecoregions of the
U.S. In J. L. Lockwood & M. L. McKinney (Eds.), Biotic homogenization (pp. 33–56).
Norwell, MA: Kluwer.
4. Blaustein, R. (2013). Urban biodiversity gains new converts: Cities around the world are
conserving species and restoring habitat. BioScience, 63(2), 72–77.
https://doi.org/10.1525/bio.2013.63.2.3
5. Bonier, F., Martin, P. R., & Wingfield, J. C. (2007). Urban birds have broader
environmental tolerance. Biology Letters, 3(6), 670–673.
6. Burghardt, K. T., Tallamy, D. W., & Shriver, W. G. (2009). Impact of native plants on bird
and butterfly biodiversity in suburban landscapes. Conservation Biology, 23(1), 219–224.
https://doi.org/10.1111/j.1523-1739.2008.01076.x
7. Cam, E., Nichols, J. D., Sauer, J. R., Hines, J. E., & Flather, C. H. (2000). Relative species
richness and community completeness: Birds and urbanization in the Mid-Atlantic states.
Ecological Applications, 10, 1196–1210.
8. Caula, S., Marty, P., & Martin, J. (2008). Seasonal variation in species composition of an
urban bird community in Mediterranean France. Landscape and Urban Planning, 87, 1–9.
9. Chace, J. F., & Walsh, J. J. (2006). Urban effects on native avifauna: A review. Landscape
and Urban Planning, 74, 46–69.
10. Croci, S., Butet, A., & Clergeau, P. (2008). Does urbanization filter birds on the basis of
their biological traits? The Condor, 110, 223–240.
11. De Cornulier, T., & Clergeau, P. (2001). Bat diversity in French urban areas. Mammalia,
65, 540–543.
12. Duchamp, J. E., Sparks, D. W., & Whitaker, J. O. (2004). Foraging-habitat selection by
bats at an urban–rural interface: Comparison between a successful and a less successful
species. Canadian Journal of Zoology-Revue Canadienne De Zoologie, 82, 1157–1164.
13. Fletcher, R. J., Didham, R. K., Banks-Leite, C., Barlow, J., Ewers, R. M., Rosindell, J., ...
Haddad, N. M. (2018). Is habitat fragmentation good for biodiversity? Biological
Conservation, 226, 9–15.

85
Bhumi Publishing, India

14. Fuller, R. A., Warren, P. H., Armsworth, P. R., Barbosa, O., & Gaston, K. J. (2008).
Garden bird feeding predicts the structure of urban avian assemblages. Diversity and
Distributions, 14, 131–137.
15. Gagne, S. A., & Fahrig, L. (2007). Effect of landscape context on anuran communities in
breeding ponds in the National Capital Region, Canada. Landscape Ecology, 22, 205–215.
16. Gaublomme, E., Hendrickx, F., Dhuyvetter, H., & Desender, K. (2008). The effects of
forest patch size and matrix type on changes in carabid beetle assemblages in an urbanized
landscape. Biological Conservation, 141, 2585–2596.
17. GBIF (Global Biodiversity Information Facility). (2016). Final report of the Task Group on
GBIF data fitness for use in distribution modelling.
http://dx.doi.org/10.13140/RG.2.2.27191.93608
18. Germaine, S. S., & Wakeling, B. F. (2001). Lizard species distributions and habitat
occupation along an urban gradient in Tucson, Arizona, USA. Biological Conservation, 97,
229–237.
19. Grove, J. M., Troy, A. R., O’Neil-Dunne, J. P. M., et al. (2006). Characterization of
households and its implications for the vegetation of urban ecosystems. Ecosystems, 9,
578–597.
20. Harlan, S. L., Brazel, A. J., Prashad, L., Stefanov, W. L., & Larsen, L. (2006).
Neighbourhood microclimates and vulnerability to heat stress. Social Science and
Medicine, 63, 2847–2863.
21. IPBES (Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem
Services). (2019). Summary for policymakers of the global assessment report on
biodiversity and ecosystem services of the Intergovernmental Science-Policy Platform on
Biodiversity and Ecosystem Services. In S. Diaz, J. Settele, E. S. Brondízio, H. T. Ngo, M.
Guèze, J. Agard, A. Arneth, et al. (Eds.), IPBES secretariat.
22. McKinney, M. L. (2001). Effects of human population, area, and time on non–native plant
and fish diversity in the United States. Biological Conservation, 100, 243–252.
23. Miller, J. R. (2006). Restoration, reconciliation, and reconnecting with nature. Biological
Conservation, 127, 356–361.
24. Pillsbury, F. C., & Miller, J. R. (2008). Habitat and landscape characteristics underlying
anuran community structure along an urban–rural gradient. Ecological Applications, 18,
1107–1118.
25. Riley, S. P., Brown, J. L., Sikich, J. A., Schoonmaker, C. M., & Boydston, E. E. (2014).
Wildlife friendly roads: The impacts of roads on wildlife in urban areas and potential
remedies. In Urban Wildlife Conservation (pp. 323–360). Springer.

86
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
26. Sandstrom, U. G., Angelstam, P., & Mikusin´ski, G. (2006). Ecological diversity of birds
in relation to the structure of urban green space. Landscape and Urban Planning, 77, 39–
53.
27. Seppelt, R., Lautenbach, S., & Volk, M. (2013). Identifying trade-offs between ecosystem
services, land use, and biodiversity: A plea for combining scenario analysis and
optimization on different spatial scales. Current Opinion in Environmental Sustainability,
5, 458–463.
28. Shackleton, S., Chinyimba, A., Hebinck, P., Shackleton, C., & Kaoma, H. (2015). Multiple
benefits and values of trees in urban landscapes in two towns in northern South Africa.
Landscape and Urban Planning, 136, 76–86.
29. Soga, M., & Gaston, K. J. (2016). Extinction of experience: The loss of human–nature
interactions. Frontiers in Ecology and the Environment, 14(2), 94–101.
30. Tait, C. J., Daniels, C. B., & Hill, R. S. (2005). Changes in species assemblages within the
Adelaide metropolitan area, Australia, 1836–2002. Ecological Applications, 15, 346–359.
31. Teixeira, F. Z., Printes, R. C., Fagundes, J. C. G., Alonso, A. C., & Kindel, A. (2013).
Canopy bridges as road overpasses for wildlife in urban fragmented landscapes. Biota
Neotropica, 13(1), 117–123.
32. The Nature Conservancy. (2018). Nature in the Urban Century. Arlington, VA: The Nature
Conservancy.
https://www.nature.org/content/dam/tnc/nature/en/documents/TNC_NatureintheUrbanCent
ury_FullReport.pdf
33. White, J. G., Antos, M. J., Fitzsimons, J. A., & Palmer, G. C. (2005). Non-uniform bird
assemblages in urban environments: The influence of streetscape vegetation. Landscape
and Urban Planning, 71, 123–135.
34. World Bank. (2019). Chongqing 2035: Spatial and economic transformation for a global
city. Overview. Washington, DC: World Bank.
35. Young, K. M., Daniels, C. B., & Johnston, G. (2007). Species of street tree is important for
southern hemisphere bird trophic guilds. Austral Ecology, 32, 541–550.

87
Bhumi Publishing, India

EXAMINING THE POLITICAL BUDGET CYCLE: A CASE STUDY OF MEDICAL

AND PUBLIC HEALTH EXPENDITURE IN VIDHAN SABHA ELECTIONS IN
INDIA
Ankita Biswas
Department of Economics,
Vidyasagar College for Women, Kolkata

Abstract:
This study investigates the dynamic relationship between state government elections and
Revenue expenditure on Medical and Public Health. The regression results reveal a significant
positive coefficient for the Election Year variable, indicating an increased allocation of resources
to the specified sectors during election years. This aligns with the strategic approach of
governments to enhance public welfare perception among voters. However, the subsequent years
exhibit a consistent decrease in expenditure, suggesting a post-election fiscal restraint strategy.
The statistical significance of the coefficients reinforces the reliability of these observed patterns.
The implications of the political budget cycle underscore the need for policymakers to
understand and adapt to these dynamics for effective resource management. This study
contributes to the discourse on the impact of electoral cycles on public spending, emphasizing
the importance of context-aware policy formulation.
Keywords: Political Budget Cycle, State Government Expenditure, Vidhan Sabha Elections,
Revenue Expenditure, Medical and Public Health
Introduction:
A political budget cycle refers to the theory that politicians manipulate government fiscal
policies, spending and budgets according to the electoral cycle. Incumbent politicians have an
incentive to stimulate the economy and increase spending right before elections to improve their
re-election chances. For example, increasing spending on public services, welfare benefits, or
infrastructure projects just as voters head to the polls. After elections, they then may impose
austerity measures or spending cuts to control deficits and debt accumulation. Politicians may
loosen fiscal policy and allow deficits to rise when they first take office, then tighten closer to the
next election. Evidence of political budget cycles has been found in many countries when
studying patterns of government spending, revenues, deficits across electoral cycles. However,
the existence and size of cycles depends on factors like information available to voters, strength
of institutions that constrain politicians, type of electoral system etc. Budget cycles can create
macroeconomic instability and suboptimal fiscal policy from a long-term economic perspective,
if spending is driven too much by short-term political incentives.

88
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
So, in summary, incumbent politicians often engage in opportunistic increases or
decreases in government spending and budgets timed around elections to improve their chances
of re-election, even if these budget cycles are not optimal economic policy in the longer run.
Literature Survey and Objective:
A sizable body of theoretical and empirical literature provides evidence for opportunistic
political budget cycles, where incumbent politicians manipulate fiscal policies, including
taxation, spending, and deficits, to bolster economic conditions before elections and thus
improve re-election odds (Rogoff, 1990). Theoretical models demonstrate how such cycles
emerge rationally in democratic systems due to information asymmetry between voters and
governments about actual competence and effort levels (Alesina et al., 2000). Voters evaluate
politician performance at election time based on recent economic trends (Powell, 2000), but
cannot perfectly determine the degree of skill or diligence contributing to outcomes.
Consequently, the impending election incentivizes incumbent politicians to engineer temporary
economic booms by utilizing expansionary fiscal policies (Tufte, 1978).
Support for these opportunistic models has been found across various empirical contexts.
Seminal research by Tufte (1978) revealed pre-electoral economic interventions under different
U.S. administrations aimed at accelerating growth before presidential elections. Additionally,
global evidence of more pronounced deficit cycles in established rather than nascent
democracies, as spending increases or taxes decline ahead of ballots (Brender et al., 2005). The
prevalence of such cycles depends partly on institutional attributes like the delineation of
responsibilities across government branches and tiers (Alesina et al., 1997). Local analysis
applying a novel methodology uncovered increased spending prior to municipal elections in
Portugal (Aidt et al., 2011). Moreover, we saw Colombian incumbent politicians strategically
shift public spending toward more noticeable consumption preceding elections (Drazen et al.,
2010). Thus, existing analysis presents extensive proof that political budget cycles manifest due
to the incentives for opportunism inherent in imminent elections.
The existence of political budget cycles - where incumbent politicians manipulate fiscal
policy for electoral advantage - is a well-documented phenomenon in the literature. Much of the
scholarly focus has focused on studying cycles in aggregate spending, revenues fiscal deficits at
the national level. However, an open question exists as to whether targeted spending in areas like
healthcare is subject to similar election-driven fluctuations.
The objective of our study is to investigate the presence of political budget cycles in the
allocation of resources to medical and public health expenditure across Indian state governments.
Given the high salience of public health and healthcare performance for electoral outcomes,
politicians may have an incentive to channel greater funding to these areas in the lead up to state-
level elections. On the other hand, fiscal balancing motives or debt constraints may dampen

89
Bhumi Publishing, India

opportunism. Understanding the dynamics of healthcare spending around the election cycle has
important welfare implications in terms of both efficiency and equity of service delivery.
Data Collection and Methodology
We compile a new state-level panel dataset on medical and public health expenditures as
well as state assembly elections over the period 1996 to 2020 across 31 states. This allows us to
carry out an empirical test for political budget cycles after controlling for potential economic and
demographic drivers of health spending. Given the documented importance of fiscal institutions
in moderating budget cycles, we pay particular attention to analysing the differential impact of
election timing across states with varying fiscal rules and constraints.
The results will help assess both the reality of election-motivated manipulation as well as
the potential mechanisms states have at their disposal to encourage fiscal discipline - even in a
politicized arena like public health resourcing. More broadly, the analysis will expand
understanding of how budget cycles manifest across different areas of state expenditure and shed
light on the nature of tactical redistribution of government funds in developing countries.
The data of state-government expenditure on expenditure on Medical and Public Health
is collected from “State Finances: A Study of Budgets”, which is an annual publication by The
Reserve Bank of India (RBI). It provides information, analysis and an assessment of the finances
of state governments on the basis of primary state level data. We have particularly taken the data
from Appendix II: Revenue Expenditure of Individual States. The data of state-government’s
expenditure on Medical and Public Health is available from year 1996 to 2020. No data is
available for year 2017. All the data are in Rs. Lakh except from 2010 to 2016 are given in Rs.
Million, which we have converted to Rs. Lakh.
Our hypothesis is that the political budget cycle is generated by incumbent in state
assembly to increase their own re-election prospect. In other words, we want to test the existence
of a cycle in terms of per capita expenditure on medical and public expenditure
Ln (HE)s,t = α + βEs,t + γXs,t + δs + ωt + εs,t
We perform a panel regression across 31 states of India over 24 years, where ln(HE )s,t is
the natural log of per capita real State government’s revised planned revenue expenditure on
Medical and Public Health of state s at time t, Est is a set of variables representing the state
government electoral cycle, Xs,t is the set of state level covariates (several age groups 5to 19, 20
to 34, 35 to 59 and 60 up, per-capita net state domestic product, birth rate, death rate, total
fertility rate) which vary by state and time, δs are state effects, and φt are year effects.
If the election was held after 30th June of the n-th year then we have considered n-th year
as the election year and if the election was held before 30th June of the n-th year, we have
considered (n-1)-th year as the election year. This election year variable is our focal regressor.
Usually, a state releases its state budget within first three months of a financial year. If the

90
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
election is held within 30th of June there is no or little time for the incumbent to use the revenue
expenditure as a policy variable. The incumbent in power must have increased the state
government spending or expenditure of the previous year to lure the voters desires to re-elect
himself or his party in this year. So, in such scenario, we have considered the immediate year
before or the previous year as the election year. On the other hand, when the election is held after
the month of June, the incumbent in power gets much time to lure the voters, so he must have
used the state government expenditure as a policy variable by increasing the expenses, in order to
be re-elected.
In India a Vidhan sabha is held every five years, so, the period of election cycle is five
years. However, we have also analysed that the gap between two elections was less than 5 years
for an early election, and the gap between two election was more than 5 years for a delayed
election. In case if the election cycle was more than five years, then we have considered all the
years after the 5th year as the last year of election.
The main coefficient of interest is β which would capture political budget cycle effects of
increased health spending in election years and potential post electoral reversals.
Table 1: Effect of state government elections on Revenue expenditure on Medical and
Public Health, 1996–2020
Model [1] [2]
Coef. Coef.
Independent Variable Sig. Sig.
(Robust Std. Err.) (Robust Std. Err.)
Election year .1364758 (.0657136) **
One year after election -.0687187 (.0822461)
Two years after election -.2081504 (.0909275) **
Three years after election -.148749 (.079059) *
Four year after election -.116314 (.0568052) **
N 443 442
F-test 30.49 *** 36.66 ***
R-sq 0.2865 0.2858
Significance levels: *** p<0.01, ** p<0.05, * p<0.1; Robust std. errors are clustered by states

Results:
This table presents results from two fixed effects regression models examining the impact of
state election timing on public health expenditures by state government in India. Several key
findings emerge:

91
Bhumi Publishing, India

Model 1 shows that Vidhan Sabha election years are associated with a statistically
significant (at 5% level) increase in public health spending, compared to non-election years. This
provides evidence of a political budget cycle, where health expenditures rise leading up to
elections.
Model 2 suggests this Vidhan Sabha election year boost tends to be reversed in the years
immediately following elections. Coefficients of non-election years are negative indicating a fall
in the post-election years by the state governments. More notably, the state government spending
significantly decreases in the second and third year after an election, respectively. Both are
significant at 5% level or higher.
The positive coefficient for the Election Year suggests an increase in Revenue
expenditure on Medical and Public Health during election years. The negative coefficients for
the subsequent years indicate a decrease in expenditure in the years following the election, with
varying significance levels. Thus, we can say that there is a political budget cycle in Medical and
Public health by state government in Vidhan sabha election. This pattern is consistent with
political budget cycle theories of fiscal manipulation. Incumbents expand health expenditures to
signal competence and curry favour with myopic voters ahead of elections. But spending is cut
back once the election passes and immediate pressure eases.
Overall, the results suggest Indian state health budgets systematically reallocate resources
over the state government election cycle, with citizens likely facing spending reductions in post-
election periods compared to election lead ups. Institutions encouraging fiscal restraints outside
election years may be beneficial.
Conclusion:
The results of the regression analysis provide insights into the political budget cycle
observed in the context of state government expenditure during Vidhan Sabha elections. The
positive coefficient for the Election Year variable indicates a statistically significant increase in
Revenue expenditure on Medical and Public Health during election years. This aligns with the
notion of governments strategically boosting spending in key sectors, such as healthcare, to
appeal to voters and demonstrate a commitment to public welfare in the lead-up to elections.
However, the subsequent years show a consistent pattern of decreased expenditure, as indicated
by the negative coefficients for one, two, three, and four years after election. This post-election
reduction in spending may reflect fiscal restraint measures implemented by the government to
manage budgets and address concerns about financial sustainability. The statistical significance
levels associated with the coefficients enhance the reliability of these observed effects.
A surge in government expenditure for Medical and Public Health can catalyse
multifaceted positive transformations in the healthcare sector. Firstly, increased funding
empowers the government to fortify healthcare infrastructure, augment facilities, and expand

92
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
services, fostering an environment conducive to improved medical care. This financial boost
enables the implementation of preventive healthcare measures, immunization programs, and
disease control initiatives, thereby contributing to better health outcomes, reduced mortality
rates, and an overall enhancement of public health. Furthermore, expanded access to healthcare
becomes a reality as additional resources facilitate the establishment of medical facilities in
underserved and rural areas, ensuring that a broader segment of the population can avail
themselves of essential health services. The financial injection also facilitates the development
and sustenance of a skilled healthcare workforce through training and hiring initiatives.
Simultaneously, increased government expenditure may propel medical research and
development, fostering innovation in healthcare technologies, treatments, and pharmaceuticals.
Public health programs, including awareness campaigns and disease prevention efforts, can be
strengthened, reinforcing the nation's capacity to tackle health challenges comprehensively.
Economically, the positive impact on productivity, stemming from an improved health profile,
contributes to long-term economic benefits. Additionally, augmented healthcare spending offers
an opportunity to address disparities in healthcare access and outcomes among diverse
demographic groups, fostering a more equitable distribution of health resources. While increased
expenditure holds significant potential for positive change, its effectiveness hinges on prudent
resource allocation, efficient policy implementation, and effective governance of the healthcare
system. Sustainable fiscal responsibility remains paramount for the enduring success of
endeavours aimed at enhancing healthcare outcomes.
Elevating government expenditure for Medical and Public Health emerges as a
strategically advantageous move in the political arena, particularly for winning elections. This
approach carries inherent benefits that resonate with voters and contribute to a positive electoral
outcome. By channelling additional funds into healthcare, political candidates and parties
demonstrate a commitment to public welfare, a crucial factor in appealing to the electorate.
Improved healthcare services, enhanced facilities, and increased accessibility to medical care
present tangible and visible benefits that can sway voters' sentiments in favour of the governing
party or candidate.
The perceived responsiveness of the government to pressing societal needs becomes a
key factor influencing voter decisions. The strategic decision to boost healthcare spending
creates an image of a government attuned to the concerns of its citizens, fostering trust and
confidence. Popularity and trust in political leaders are further bolstered as citizens witness direct
improvements in their health outcomes and access to medical facilities.
Increased healthcare expenditure becomes a central theme in political messaging,
providing a compelling narrative for campaigns. By highlighting advancements in public health
services, governments can shape positive perceptions and differentiate themselves from

93
Bhumi Publishing, India

competitors. This strategy is particularly effective in appealing to swing voters, as health-related

policies have broad appeal across diverse demographics.
During times of health crises, such as pandemics, governments allocating additional
resources to address pressing challenges can be perceived as proactive and decisive. Crisis
management through increased healthcare spending not only addresses immediate concerns but
also positions the government as capable and responsive, potentially translating into electoral
support.
Ultimately, the impact of heightened healthcare expenditure on electoral success is
contingent on effective communication of policies, transparent governance, and the broader
political context. Genuine and thoughtful resource allocation is essential to avoid the perception
of opportunistic behaviour solely for electoral gain. Nevertheless, the positive changes in
healthcare services contribute significantly to shaping public perception and can be a compelling
factor in securing electoral victory.
ReferenceS:
1. Drazen, A., & Eslava, M. (2010). Electoral Manipulation via Expenditure Composition:
Theory and Evidence. Quarterly Journal of Economics, 125(4), 1437–1468.
2. Alesina, A., Roubini, N., & Cohen, G. D. (1997). Political Cycles and the Macroeconomy.
MIT Press.
3. Powell, G. B. (2000). Elections as Instruments of Democracy: Majoritarian and
Proportional Visions. Yale University Press.
4. Tufte, E. R. (1978). Political Control of the Economy. Princeton University Press.
5. Alesina, A., & Tabellini, G. (2000). Political Economics: Explaining Economic Policy.
MIT Press.
6. Brender, A., & Drazen, A. (2005). Political Budget Cycles in New versus Established
Democracies. Journal of Political Economy, 113(1), 1–45.
7. Aidt, T. S., Veiga, F. J., & Veiga, L. G. (2011). Election Results and Opportunistic
Policies: A New Test of the Rational Political Business Cycle Model. European Journal of
Political Economy, 27(1), 181–190.
8. Klomp, J. & Haan, J. (2013). Political Regime and Human Capital: A Cross-Country
Analysis. Social Indicators Research: An International and Interdisciplinary Journal for
Quality-of-Life Measurement, Springer, 111(1), 45-73.
9. Rogoff, K. (1990). Equilibrium Political Budget Cycles. American Economic Review, 21-
36.

94
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

STUDIES ON PATHOGENIC BACTERIAL DIVERSITY IN SUBHAS SAROBAR,

KOLKATA CONCERNING PUBLIC HEALTH
Srijoni Basak, Jyoti Choudhury, Priya Mandal, Koena Sarkar,
Misha Parveen SK, Disha Bhagat and Sanjib Saha*
Department of Zoology,
Vidyasagar College for Women,
39 Sankar Ghosh Lane, Kolkata – 700006, West Bengal, India
*Corresponding author E-mail: [email protected]

Abstract:
Subhas Sarobar is a medium-sized artificial lake situated in the northeastern region of
Kolkata, West Bengal which is controlled by the Calcutta Improvement Trust. This body of
water is home to a variety of organisms, including bacteria, benthos, nekton, phytoplankton, and
zooplankton, all of which contribute to a healthy and interdependent ecosystem. Seasonal
variations in temperature, precipitation, and humidity have an impact on the physicochemical
characteristics of the water, which could lead to a shift in the faunal population. Additionally,
residential effluents are used on this aquatic system. Therefore, in addition to seasonal variations,
home spills, washing clothes and utensils, taking baths, and disposing of plastic garbage next to
the lake water all affect the physico-chemical characteristics of the water. The lake water quality
ultimately declines as a result of all these human activities. The combination of high nutrient
content and low DO creates an ideal habitat for the growth of bacteria in the lake system,
including pathogenic bacteria that might potentially harm public health as well as other aquatic
creatures. Pathogenic bacteria species found in water are dangerous and can cause several
illnesses to human beings. It is possible to successfully stop the spread of disease(s) if the traits
and specifics of pathogenic bacteria are understood.
Keywords: Bacterial Diversity, Water Pollution, Subhas Sarobar.
Introduction:
In aquatic ecosystems, lakes are the most productive. They support life and also aid in
environmental regulation and the management of the water cycle (Figure 1). Urban freshwater
lakes also have an important recreational and aesthetic role. The vegetation and faunal
composition of lakes generally exhibit a wide range of diversity and is very dynamic, responding
to perturbations in the natural ecological balance. East Calcutta's lung is Subhas Sarobar,
administered by the Calcutta Improvement Trust, which enjoys substantial environmental
support. The environment surrounding the lake is used for athletic, recreational, and cultural
activities in addition to being an essential part of the oxygen balance. Furthermore, by removing

95
Bhumi Publishing, India

contaminants from the surrounding environment, this ecosystem is functioning as a natural sink.
The impact of human activity on the Subhas Sarobar has intensified significantly in recent times.
Daily, more than 3,000 individuals use it for bathing and washing clothes and utensils.
Additionally, trash made of plastic is being disposed of next to the lake. The natural elements,
particularly the lake water quality, have deteriorated because of all these human activities.
Consequently, the area's terrestrial and aquatic ecosystems are at risk of not developing
sustainably due to environmental degradation. One of the biggest threats to the aquatic
environment worldwide is thought to be microorganism-mediated water pollution (Percival and
Willium, 2014). A water body's bacterial burden is heightened by the effluent from hospitals,
industries, livestock farms, and fecal matter disposal sites. Coliform bacterial groups have long
been used as a common indicator organism for water pollution by microorganisms, which has
historically influenced public perceptions of public health security (Rayan and Ray, 2004).
Subhas Sarobar is exposed to a variety of pollutants, which alters the parameters governing water
quality and increases the diversity of microorganisms (Khan and Sen, 2002)
Status of Water Body:
The Lake ecosystem possesses a diverse array of flora and fauna which make it a
dynamic aquatic ecosystem (Figure 1).
Geographical Status:

Figure 1: Geographical location of Subhas Sarobar

East Calcutta's lung, Subhas Sarobar, is a manmade lake managed by the Calcutta
Improvement Trust and benefits greatly from the surrounding environment (Figure 1). Its latitude
is between 220 34′ and 220 34′ 30′′ N and its longitude is between 880 24′ and 880 24′ 30′′.
About 6.04 ha of the 39.6 ha total area of the Subhas Sarobar is covered by water. Two islands—
one little and the other large—make up a fantastic home for a variety of living things. The
total area is 39.6 ha including the lake and the surrounding vegetation of which 16.29 ha. of the

96
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
area stands for the water body, according to CMC 1986. The total volume of the water body is
an average of 634 m3 due to seasonal changes across the year and the mean depth is 4.8m
(Samal et al., 2004).
Physicochemical Status:
Temperature (Hanna, Romania), pH (Hanna, Romania), Dissolve oxygen (Lutron,
Taiwan), Salinity (Erma, Japan), Ammonia (Himedia kit), Nitrite (Himedia kit), Nitrate
(Himedia kit), Hardness ((Himedia kit), Vibrio sp. (Himedia kit), were measured and recorded
for determining the health condition of cultured pond water on the spot instantly and collection
of water in bottle for determination of bacterial population and species. Throughout the study
period, five sampling locations were designated for the monthly collection of water samples to
determine the water quality. One-liter polythene cans were carefully waded into the water to get
surface water samples. The analysis was completed through the standard methods (APHA,1992;
Saha, 2000) (Table 1).
Table 1: Physicochemical Factors (Adapted from Khan et al., 2002)
Physicochemical Factors
Water temperature (0C) 30.20C
pH 8.24
Turbidity 16.42
Conductivity 417.37
Dissolved Oxygen (ppm) 5.7
Total alkalinity(mg/lit) 216.47
Chloride (mg/l) 42.82
Phosphate (mg/l) 0.04
Nitrite (mg/l) 0.12
Nitrate (mg/l) 0.29
Ammonium (mg/l) 0.20

Temperature: It is the primary factor influencing the great diversity of species found in the lake
ecosystem. Every aquatic organism, including macrophytes, zooplankton, and phytoplankton,
has a preferred temperature range within which they can develop to their maximum population.
The cause of the increased chemical reactions in the water body that result in the release of
additional nutrients from the sediments is typically high temperatures.
Light: It provides the energy needed for green plants to carry out photosynthesis. Several
variables, including the size of the water body, the existence of an algae bloom, climatic
conditions, and dissolved particles, affect light penetration in the lake.

97
Bhumi Publishing, India

pH: pH is the measure of acidity or alkalinity in the lake water. It is an important indicator of
water if any chemical change occurs in water.
Turbidity: High turbidity levels can inhibit the growth of submerged aquatic plants.
Zooplankton Status:
A wide range of zooplankton inhabited in the water body among which the Cladocerans
are the most dominant followed by rotifers and copepods. Some of the zooplanktons are listed
below (Saha et al., 2001) (Table 2).
Table 2: List of few Zooplanktons (Adapted from Khan et al., 2002)
Group Name of Zooplankton
Copepoda 1. Cyclops sp.
2. Mesocyclops sp.
3. Heliodiaptomus sp.
Rotifer 1. Brachionus sp.
2. Testudinella sp.
3. Lacane sp.
Cladocera 1. Sida sp.
2. Moina sp.
3. Allona sp.
4. Pseudosida sp.

Bacterial Diversity of The Lake:

The detrimental effects of human activities have increased dramatically in the last few
years. The high concentration of nutrients that Subhas Sarabor receives from the surrounding
environment as a result of human activity makes it a eutrophic lake. These nutrients contribute to
the growth of the lake's phytoplankton and algae populations and decrease the amount of oxygen
available for other aquatic organisms. This condition of the water body can give rise to several
pathogenic bacteria that can cause serious waterborne diseases in humans (Dutta et al., 2018;
Saha et al., 2023) (Table 3).
• Salmonella
There are multiple species in the genus, and each species contains a variety of antigenic
kinds. There are about 1800 recognized serotypes. Typhoid fever is caused by Salmonella typhi.
The symptoms include weakness, headache, and a fever that keeps getting worse. After a while,
the abdomen develops rose-colored patches and diarrhea happens. From the intestine, the
organism travels to the blood and other organs. In severe circumstances, there may be a deadly
intestinal perforation and hemorrhage. It is mostly water-borne, and severe infection requires
high concentrations of the bacterium. The antigens boost immunity in the person who has been

98
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
exposed, but because of their wide range, control is challenging. During the first week of the
illness, blood culture is a helpful diagnostic technique (Cabral, 2010).
• Shigella
Shigella species contamination is a common cause of diarrhoea. They are limited to the
gastrointestinal system. The type species is S. dysenteriae. S. flexneri, S. boydi, and S. sonnei are
the others. They are facultative anaerobes that are gram-negative, non-lactose fermenting, and
non-gas-forming. Based on S. dysenteriae lipopolysaccharides and '0' antigens, over 40 serotypes
are recognized. They induce mucous membrane necrosis, which leads to superficial ulceration.
Abdominal pain, fever, and watery diarrhea are the symptoms. In healthy adults, symptoms go
away in two to three days, but in children and the elderly, electrolyte infusion is required to
prevent dehydration. The bacteria produces both an exotoxin and an endotoxin. Antibiotics
(ampicillin, tetracycline, and chloramphenicol) are administered to maintain control. Shigella
spp. are transmitted through contamination of food and water by faecal matter (Cabral, 2010).
• Vibrio
Vibrios are facultative anaerobes; gram-negative bacteria present in saline and fresh
water. Abdominal pain, frequent diarrhea, and abrupt nausea and vomiting are the hallmarks of
the illness of Vibrios. The stools have a distinctive appearance similar to rice water (rice stools).
The intestinal system is the only place the bacteria can grow. It causes a hypersecretion of
chlorides and water. Dehydration and electrolyte loss consequently happen, leading to death.
Owing to the disease's quick transmission, numerous nations have seen widespread outbreaks
(Saha and Dash, 2021). Prevention by good hygiene, the use of clean water and food, and good
sanitation practices is the best management strategy. As a preventative precaution, cholera toxoid
vaccinations are administered anytime the illness manifests. Patients who are afflicted receive
replacement electrolytes and water (Cabral, 2010).
• Escherichia
Although Escherichia coli is frequently found in the intestinal tract, it can also
infrequently turn harmful, particularly in the urinary tract. Because coliform bacteria are
common intestinal inhabitants, they are tested for bacterial contamination in water. O and K
antigens are formed by pathogenic strains. They make people sick, especially kids (Cabral,
2010).
• Yersinia
As a food-borne infectious agent pathogen, Y. enterocolitica can cause a wide range of
gastrointestinal disorders in people, from moderate diarrhea to inflammation of the mesenteric
glands. In children and people with underlying medical conditions, it can also cause appendicitis
and septicemia, with potentially serious symptoms. Yersiniosis ranks third among the many
foodborne infections, following salmonellosis and campylobacteriosis. Pestis is the culprit of the

99
Bhumi Publishing, India

plague. The rod is Gram-negative and exhibits bipolar staining, which is stain limited to the
poles. The optimal temperature for this facultative anaerobe is 28°C. The membrane made of
lipopolysaccharides is poisonous (endotoxin). A surface protein inhibits the function of
macrophages. The bacteria live in rodent reservoirs, and fleas carry it by sucking on their blood.
Pneumonic plague arises when the bacterium finds a center in the lungs; septicaemic plague is
characterized by hypotension, vomiting, and diarrhea. Bubonic plague is characterized by
swollen lymph glands, or "bubos." If the plague is not treated quickly, it can cause cardiac arrest
and death. Tetracyclines and streptomycin work well. Controlling rats is a prophylactic approach
(Cabral, 2010).
• Tetanus
An obligatory anaerobe that is common in nature is Clostridium. Certain species provide
a health risk to both people and animals. It is a spore-forming genus with a distinctive drumstick-
like morphology that is observed in culture. when endospores develop in cells in the terminal
stage. Clostridium botulinum causes food poisoning, Clostridium perfringens causes gas
gangrene, and Clostridium tetani causes tetanus. Contamination of wounds with dirt or other
contaminated materials is the cause of localized C. tetani infection. Being an anaerobe, it grows
in hidden places such as deep wounds; in surgical procedures, it occurs in approximately 50% of
cases. The primary cause of the impact is the bacterium's toxin, tetanospasmin (Cabral, 2010).
Table 3: List of few pathogenic bacteria
Diseases Causative Bacteria
Cholera Vibrio cholerae
Gastroenteritis caused by Vibrios Vibrio parahaemolyticus
Typhoid fever and other serious salmonellosis Salmonella sp.
Bacillary dysentery or shigellosis Shigella sp.
Acute diarrheas and gastroenteritis Escherichia coli
Gastroenteritis Aeromonas sp.

Method for Observation of Water Borne Bacteria:

The microbe must be brought into pure culture, which is devoid of any other organisms,
to start the culture. By cultivating it in confined containers on a sterile media, the pure culture is
obtained and maintained for additional research (Saha and Dash, 2021; Saha et al., 2023).
• Media Preparation: Essential minerals and a carbon source, like dextrose, are included
in a culture medium. By adding complex proteinaceous material like vitamins, amino
acids, and other nutrients, this medium's nutrition is enhanced. For the majority of the

100
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
bacteria, the medium's pH is adjusted to be between 7.2 and 7.4. The components are
added to water in appropriate amounts and then moved to culturing vessels. The liquid
medium is referred to as nutritional broth, and the microbial culture cultured within it is
called broth culture. Before sterilizing, the medium is mixed with gelatin or agar agar to
create a semi-solid gel. Upon cooling a solid surface is created for the formation of
microbial colonies by this type of agar medium.
• Isolation and Inoculation: Millions of microorganisms can be found in samples taken
from natural ecosystems such as soil, water, and sewage. Before being isolated, collected
samples are diluted with nutritional medium or water. Millions of microorganisms can be
found in samples taken from natural ecosystems such as soil, water, and sewage. Before
being isolated, collected samples are diluted with nutritional medium or water.
There are two common techniques to obtain pure cultures:
o Streak plate Method: An inoculation needle is used to streak the diluted sample in the
Petri dish and draw a straight line on the medium's surface. From the distal end of the
first streak, another streak is formed at a right angle to it. The third and fourth streaks are
constructed such they don't come into contact with one another in the middle. Bacterial
cells split and form different, independent colonies when the streaks are drawn.
o Single Cell Isolation: To calculate the density of cells, the sample is inspected under a
counting chamber. Next, the concentration is reduced until a single cell is present in
every two drops of liquid. Agar media is covered with discrete liquid droplets. On agar
slants, discrete colonies are subcultured when they form. These techniques are useful
for culturing most bacteria into pure culture.
• Staining Techniques: One of the most important staining techniques is Gram Staining
which separates gram-positive and gram-negative bacteria. In this method, the gram-
positive bacteria retain the crystal violet color whereas the gram-negative bacteria lose
the violet color.
• Maintenance and Preservation of Culture: After a pure culture has been obtained, it is
preserved for further research.
Glycerol Method: For long-term storage, bacterial glycerol reserves are essential.
Glycerol stabilizes the frozen bacteria, protecting the cell membranes and preserving the
viability of the cells. Bacteria can be preserved in glycerol at -20°C for several months or
at -80°C for many years.
• Stab Method: Stab cultures are made using solid agar in a test tube and which resembles
agar plates. By stabbing a pipette tip or inoculation needle into the center of the agar,
bacteria are introduced. In the perforated region, bacteria proliferate. The most popular
use for stab cultures is the transportation or short-term storage of cultures.

101
Bhumi Publishing, India

Physical Detection of Bacteria (Kit Method):

From the lake, collected water was put into a bacterial identification bottle kit. Incubate
the bottle for 24 to 48 hr. in an incubator at 350C. The presence of the colour of bacterial
colonies helps to recognize water from green to red, pink, blue, and black identity as different
bacteria in lake water (Figure 2, Table 4)

Figure 2: Detection of the bacterial population by colour using the kit (Himedia)
Table 4: Colour detection kit for bacteria
Sl. no. Colour Detection of bacteria
1. Light green Control
2. Deep green E. coli
3. Blackish green Shigella sp.
4. Pinkish red Vibrio sp.
5. Light pink Enterobacter sp.
6. Black Salmonella sp.
Water samples were collected from the lake and at least 0.1 ml of water sample was
taken on prepared microbiological culture media (species-specific) by spread plate method.
Observe bacterial colonies after 24 hr. incubation at room temperature (350C) within a
bacteriological incubator. The presence of colour or bacterial colonies (droplets) on plates
indicates bacterial contamination of water with bacterial sp. The counts of colonies were
considered per ml and were calculated by multiplying the average number of colonies per plate
by the reciprocal of the dilution factor. The calculated results are expressed as colony-forming
units (CFU) per ml of sample. Each colony, separated by color and size, was counted
separately as Colony Forming Unit per 100 µl of blood (CFU/100µl) thrice and averaged. Then,
discrete representatives of each colony type were randomly selected for purification and
characterization (Saha and Dash, 2021).

102
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Molecular Detection:
Table 5: Primer selection of bacteria for freshwater bodies

Name of Sequence Product Annealin Targets sp

Primer Length g
(bp) Temp.
8F 5’-AGAGTTTGATCCTGGCTCAG-3' 1600 500C
1492R 5’-GGTTACCTTGTTACGACTT-3' 1 min Universal
27F 5’- AGAGTTTGATCMTGGCTCAG-3’ 1500 500C primer for
1492R 5’- TACGGYTACCTTGTTACGACTT-3’ 1 min bacteria
700F 5’-CGGTGAAATGCGTAGAGAT-3’ 663 570C Vibrio genus
1325R 5’-TTACTAGCGATTCCGAGTTC-3’ 45 S (16srRNA)
Vc-F GTTCGCGCTGGTGAAGGTTCA 192 570C Vibrio
Vc-R TGGCATACCAGAGTCTTTCTGTG 1 min cholerae
16S rDNA-F 5’-AGAGTTTGATCATGGCTTACGACTT-3’ 1542 550C Enterobacter
16S rDNA-R 5’-GGTTACCTTGTTACGACTT-3’ 30 sec sp.
uidA-F 5’-AAAACGGCAAGAAAAAGCAG-3’ 371 550C E. coli
uidA-R 5’-ACGCGTGGTTAACAGTCTTGCG-3’ 30 sec
Aero-F 5’-TGTCGGSGATGACATGGAYGTG-3’ 720 550C Aeromonas
Aero-R 5’-CCAGTTCCAGTCCCACCACTTCA-3’ 30 sec hydrophila
IpaB-F 5′-GGACTTTTTAAAAGCGGC GG-3′ 314 0
55 C Salmonella
IpaB-R 5′-GCCTCTCCCAGAGCCGTC TGG-3′ 30 sec enterica
IpaH-F 5’-TGGAAAAACTCAGTGCCTCT-3’ 423 550C Shigella sp.
IpaH-R 5’-CCAGTCCGTAAATTCATTCT-3’ 30 sec
Ail-F 5’-CTATTGGTTATGCGCAAAGC-3’ 354 570C Yersinia
Ail-R 5’-TGGAAGTGGGTTGAATTGC-3’ 30 sec enterocolitica
HP-F 5′-TCTGTCTGATTCGCTTTTCTG-3′ 132 540C Helicobacter
HP-R 5′-AAGCTCGCTAAAAACGACC-3′ 5 Sec pylori

DNA extraction:
From the media agar, selected colonies were transferred onto tryptone soy agar and
finally purified into TSB after incubating at 350C for 24 hr. After final purification and growth in
TSB cultured bacterial samples are to be centrifuged and transferred into a pellet in the bottom of
a micro centrifuge tube. The pellet of bacteria was used for genomic DNA isolation by using a
bacterial genomic DNA isolation kit according to the manufacturer's protocol. After 70% ethanol
wash, followed by centrifugation, the DNA pellet was dissolved in TE buffer and subsequently

103
Bhumi Publishing, India

sored at -200C for further use. The quality and quantity of isolated genomic DNA for each
sample are to be evaluated by measuring and calculating the ratio of optical densities at 260 nm
and 280 nm wavelengths respectively, using a NanoDropTM spectrophotometer. The aqueous
phase contained purified DNA and is to be directly used for the subsequent experiments (Saha
and Dash, 2021).
PCR Amplification and Agarose Gel Electrophoresis and Documentation:
The PCR reaction is to be carried out by using 100ng of genomic DNA as a template.
Each reaction mix contained Phusion reaction buffer with 1 X final concentration, 0.2 U of
PhusionTM high fidelity DNA polymerase, 200 µM dNTPs, Forward primer and Reverse primer
with a final concentration of 0.5 µM each, and template DNA. Primers are selected from
available literature (Mookherjee et al., 2015) (Table 5). The amplification was performed in a
thermal cycler (Gene Amp 9700, ABI). After completion of PCR amplification steps, the
amplified products are to be analyzed on 1%agarose gels containing 0.5 µg/ml ethidium bromide
in 1X Tris-acetate- EDTA (TAE) buffer, and after electrophoresis, the gel is to be visualized and
images are to be captured in gel documentation system (Saha et al., 2023).
Factors Responsible for The Lake Pollution:
The neighborhood slum residents' unlimited access to the lake and its natural resources
has been one of the main annoyances within the lake premises. Due to the lack of infrastructure,
the impoverished villages have become increasingly reliant on the lake's water and surrounding
resources for their daily needs. This includes routinely using the lake's limited water supply to
wash clothes and utensils, bathing, fishing in the lake, urinating along its perimeter, washing
various vehicles with the water, and carelessly discarding trash in this water body. Detergents,
which are used to wash clothes and utensils, contain harmful chemicals like nonylphenol is one
of the main pollutants of the lake water. Other contaminants like excreta and microplastics are
also polluting the lake water. These contaminants bioaccumulate, enter the food chain of humans
through the fish, and pose serious threats to human health. Laundry detergents are rich in
phosphate salts which can also cause water pollution. This phosphate salt prevents the
biodegradation of organic substances and causes eutrophication in the water body.
Eutrophication results in algal bloom, increases the BOD value causing the death of aquatic
organisms. All these together also support the growth of harmful waterborne bacteria in the lake
water imposing a serious threat to human health as they utilize the water daily (Khan and Sen,
2002).
Conclusion:
Subhas Sarobar, also known as Beliaghata Lake is a man-made lake located in the eastern
part of Kolkata and maintained by Calcutta Improvement Trust (CIT). This lake contains two
islands that support a diverse array of biological organisms. Due to anthropogenic activities, the

104
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
water body becomes rich in nitrogen and phosphorus which makes it a eutrophic lake. As a
result, there is a huge growth of phytoplankton and algae populations. Not only that, this lake
also supports zooplankton and other aquatic organisms like fish, mollusks, etc. This water body
supports a huge array of living organisms and so, the amount of decomposition at the bottom of
the water body is also high. As a result, the amount of oxygen gets depleted for the survival of
aquatic organisms. This high BOD value of the water body provides a suitable environment for
the growth of pathogenic bacteria. Since this water body is extensively used by local people there
is a threat to their health. These pathogenic bacteria can cause different types of gastrointestinal
diseases in humans. So, there is a need for vast studies to detect all the pathogenic bacteria and
also to control the pollution level of the lake water. To understand the diversity of the bacterial
population differential culture of the pathogens and molecular detection of them is also needed.
Acknowledgment and Funding:
The authors are thankful to the principal of Vidyasagar College for Women, for providing
funding and facilities to continue the research work entitled “Studies of bacterial diversity in
Subhas Sarobar, Kolkata” and “Impact of seasonal water physico-chemical parameters on
bacterial diversity in Subhas Sarobar (Lake)” as a Teacher-Student research grant. Dr Sanjib
Saha is also grateful to the WBDSTBT for funding support of the Project entitled “Diversity and
impact of zoonotic strains of Vibrio sp. in aquacultured Scylla serrata in West Bengal” in the
category of Animal Science and Fishery for Research Development Program [Sanction no.
1406(Sanc.)/STBT-11012(27)/21/2021-ST SEC dated 25/03/2022].
References:
1. APHA. (1995). Standard Methods for the Examination of Water and Wastewater. 19th
Edition, American Public Health Association Inc., New York.
2. Cabral, J.P.S. (2010). Water Microbiology. Bacterial Pathogens and Water. Int. J. Environ.
Res. Public Health, 7, 3657-3703; doi:10.3390/ijerph7103657
3. Dutta, S., Chakraborty, S. and Srivastava, R.C. (2018). Environmental Impact Assessment
& Incidence of Occurrence of Disease among the Public Health in East Kolkata Wetland
Area. International Journal of Bioinformatics and Biological Science, Vol 6, 55-63.
4. Jones, K. E. Nikkita G. Patel, N. G., Levy, M. A., Storeygard, A., Balk, D. Gittleman, J. L.
and Daszak, P. (2008). Global trends in emerging infectious diseases. Nature, 451: 990 –
994.
5. Khan, R. A. and Sen, S. (2002). Studies on physicochemical and biological properties of
two man-made lakes, Kolkata. Rec. zool. Surv. India: 100 (Part 3 - 4) : 1-19.
6. Percival, S. L., & Williams, D. W. (2014). Vibrio. Microbiology of Waterborne Diseases
(Second Edition), pp. 237-248.Elsevier.

105
Bhumi Publishing, India

7. Ryan, K.J. and Ray, C.G. (2004). Sherris Medical Microbiology: An introduction to
infectious diseases. The Mc Graw-Hil Companies, Inc.
8. Saha, S. and Dash, G. (2021). Climatic Stress on Cultured Scylla sp.: Impact on livelihood
and Public Health in West Bengal. International Journal of Researches in Biosciences,
Agriculture & Technology, S17: 331 – 344.
9. Saha, S. and Dash, G. (2021). Zoonotic Vibrio diversity and diseases in mudcrab fishery:
impacts on public health in India. Uttar Pradesh Journal of Zoology, 42(19): 48-58.
10. Saha, S., Pradhan, D. and Dash, G. (2023). Studies on diversity of bacterial diseases and
occupational risks through mudcrab aquaculture in West Bengal. Journal of Pure and
Applied Microbiology. 17(2):722-731. doi: 10.22207/JPAM.17.2.23.
11. Saha, T., Manna, N. K., Majumder, S. S., Bhattacharya, I. N. (2001). Primary
Productivity of the Subhas Sarobar Lake in East Calcutta in Relation to Some
Selected Physico-Chemical Parameters.Pollution Research 20: 47-52.
12. Samal, N. R., Roy, D., Mazumdar, A. & Bose, B. (2004). Influence of thermal
stratification on dissolved oxygen in Subhas Sarobar, Kolkata. Journal of Curriculum
Sciences 7 (1), 259–266.
13. Saha, T. (2000). Monitoring of environmental studies of Subhas Sarobar, Calcutta and
Preparation of management action.

106
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

ECO-REHABILITATION OF DEMATERIALIZING ORCHIDS THROUGH IN

VITRO SEED CULTURE
Ranju Tamang
Department of Botany,
Vidyasagar College for Women, 39, Sankar Ghosh Lane, Kolkata 700006
Corresponding author E-mail: [email protected]

Abstract:
The world’s most wonderous plants belonging to family Orchidaceae are Orchids with
over 25,000 species found in almost all habitation around the globe. Many of these species
contain compounds with potential medicinal value making them important targets for
conservation efforts to preserve biodiversity and potentially valuable genetic resources. These
unique plants have been utilized for centuries in various cultures for their medicinal properties
and they continue to be of great importance today. The substantial use of orchid is ornamental
because of their exquisitely attractive flowers or inflorescences. Subsequently, the rate of
germination is very poor in natural habitat. This study is about conventional preservation through
in-vitro seed culture and micropropagation.
Keywords: Orchids, in-vitro, Micro-propagation, Conservation.
Introduction:
Orchids occupy a special position in the plant kingdom due to its specialization and
modification in their vegetative and floral characters. They are perennial, herbaceous epiphytic
and occasionally terrestrial plants with long lasting flowers in myriad varieties of colors, shapes,
sizes, architecture and fragrance. These group of plants comprise a unique and distinctive portion
of plants. Taxonomically, these plants belong to the most highly evolved family Orchidaceae in
the plant group monocotyledons with 750 genera and 18000 species (Heywood, 1993) or 788
genera and 18500 species (Mabberley, 1998) constituting second largest family of flowering
plants in the world. Raj Bhandari & Bhattarai (2001) documented 53 species having medicinal
value from north eastern region of India.
The most significant use of orchid is ornamental because of their exquisitely attractive
flowers or inflorescences remain fresh for longer period of time in comparison to other flowers.
These qualities have made orchid growing a high profitable industry all over the world. So,
orchids are cultivated in a large scale for cut flowers and potted plants. On the other hand, a large
number of species bear attractive flowers and their capacity for inter specific as well as
intergeneric breeding has generated tremendous possibilities producing hybrids or diverse floral
characters. There are about 70 species of Indian orchids that have been used in breeding

107
Bhumi Publishing, India

programs for producing hybrids in and outside the country for example Dendrobium nobile, an
Indian orchid species extensively used in hybridizing over 77 hybrids registered so far in which
it was parent. Today more than 1.2 lakh hybrids are known all over the world. The wild native
orchids are likely to play a unique role in the development of new cultivars or hybrids and also
existing with one or more attributes. India constitutes invaluable reservoir of these genes or
germplasm of orchids that are needed for the development of new varieties.
Maximum orchids are important floricultural and ornamental plants, some of which have
pharmacological interests. They have been used to cure various ailments. The Chinese Materia
Medica of the Mythical Emperor prepared during Han Dynasty (200 B.C.- A.D. 200) mentions
“Shih-hu” or the Dendrobium, whose dried stems were widely used as tonic, astringent,
analgesic, anti-inflammatory and for curing a number of other diseases. The Indian orchids have
also been used in various indigenous system of medicines since the Vedic period (Handa, 1986;
Kaushik, 1983; Kirttikar and Basu, 1935; Trivedi et al., 1961; Vij et al., 1997). Orchids have
been integral to traditional medicine systems in many cultures, where they are used to treat
ailments such as coughs, fever, inflammation, microbial infection, cardiovascular diseases,
digestive disorders and are often included in formulations for their therapeutic effects.
As the over exploitation of orchids raises, it is essential to promote sustainable harvesting
and cultivation practices to ensure the long-term availability of these valuable resources. In vitro
seed culture & micropropagation plays a vital role in orchid conservation, offering resolution to
the challenges of preserving genetic diversity, propagating rare and endangered species and
supporting sustainable trade.
Literature Review:
The pioneer work of Bernard (1909) is important in the development of in vitro culture
techniques of orchids. Knudson’s work showed for the first time that germination of orchid seeds
could be possible in vitro without fungal association, Knudson (1951). Besides medicinal
importance, orchids are used in the breeding program to develop new varieties and hybrids to
improve their horticultural aspects. Once a hybrid is made, the only problem is the large-scale
propagation because of its slow growing vegetative propagation. The advantage of using seeds
from capsules or pods for micropropagation is that, virus diseases etc. present in the capsule may
be eliminated when they are transferred to culture, Mitchell (1989). The mature seeds, on the
other hand either fail to germinate or germinate very poorly due to loss of growth promoting
factors and accumulation of inhibitory and other dormancy factors (Burgeff 1959, Kano 1965,
Stoutamire 1974, Withner 1959). Asymbiotic germination of selected orchid seeds was obtained
and the effect of different media on germination was studied by Raghuwanshi. Sterile
propagation of Cypripedium reginae from seeds was possible after a chilling treatment. The
occurrence of germination in presence of charcoal which binds toxic polyphenolics was

108
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
suggested by several authors (Waterman and Mole 1994; Miyoshi and Mii 1995). other authors
have suggested different nutrient solution suitable for different stages of growth for various
species (Talukdar, 2001). Plant growth regulators and coconut water promotes germination. It
has been reported that plantlets growth was vigorous and survives well when they were
germinated in combination with 20% coconut water (Michel 2002). The same action of coconut
water enhancing vigorous growth was found in the species of Dendrobium orchid (De et al.,
2006). Other than economic consideration; orchids have some inherent capacities for drought
resistance, nutrient conservations and long self-life of the flowers etc. These characters are very
peculiar and not present in common crops. Therefore, the germplasm of orchids should be
conserved because they may act as important gene donor in future for the improvement of other
crops through genetic manipulation.
Objective & Methodology of the Study:
Although orchids belong to one of the largest families, they are also perhaps most
seriously threatened plants on the globe. Their vulnerability depends upon following reasons:
1. Orchids have specialized life cycle. The vegetative propagation and multiplication of
orchids is very slow process and it takes a long duration. In case of vegetative
propagation through separation of stem and pseudobulbs one may not get more than a
few plants after 4-5 years.
2. The pollination of orchid flower depends on the pollinators.
3. In the seeds of orchid, there is lack of reserve food material i.e., absence of endosperm,
cotyledon etc.
4. The seed germination of orchid is always dependent on the association of mycorrhizal
fungi, in some cases they are species specific. Therefore, only less than 1% of seed
germinate in their natural environment due to non-availability of specific fungi, so slow
vegetative propagation through asexual method and the need of mycorrhizal fungi for
seed germination make their life cycle more vulnerable.
5. Owing to ornamental and therapeutic values which they possess has made them so sought
after the man.
Due to human pressure on land and developmental activities, orchid wealth is depleted
sadly and seriously. The epiphytic species of orchids are faced with the maximum danger due to
cutting of host tree serving as a substrate. The natural process of extinction of orchids is also
accelerated by the global warming as a result due to increasing aridity or decreasing moisture in
the climate by deforestation and global warming cause a serious threat to the survivalists of
epiphytic orchids.
The orchid seeds are unique in several respects, they are extremely small and usually
undifferentiated. They are produced in large numbers ranging from 1300-40000 per capsule.

109
Bhumi Publishing, India

Each seed contains, an undifferentiated embryo composed of 80-100 cells without any functional
endosperms. The entire embryo is covered by a membranous transparent loose air-filled seed
coat or testa. The embryos are situated in the middle of the testa being attached to it by few fine
strands. Testa cells are dead, vary in size and have longitudinal and transverse walls of different
thickness which gives them a net like appearance, this is a marked character and is species
specific. Since there is no cotyledon and no endospermic nutrient reserve for the embryo, the
seed germination and the subsequent germination of the seedlings in orchids are extremely low.
This process is activated in the presence of suitable fungus in nature. The fungus digests the seed
coat while breaking the starch and cellulose into usable sugar for the embryo to ensure
germination. The orchid seeds generally do not germinate in nature and the common practice is
to reproduce asexually by pseudobulbs or cuttings. Thus, huge commercial demand of planting
materials is difficult to achieve. However, successful in vitro germination of Cattleya, Laelia
seeds on a sugar rich medium by Knudson (1921,1922,1925) laid the foundation of asymbiotic
seed germination as an aid to orchid propagation. The culture of green seed pod has opened new
vistas in conservation and commercialization of orchid genetic resources and has been
successfully employed in a large number of commercially important taxa. Significantly, the
orchid ovules are also capable of development in vitro, prior to being fully ripe and their capacity
to germinate drops progressively as the seeds ripen (Arditti, 1967; Withner, 1943). The plantlets
developed through embryo culture or seed culture is generally subjected to micropropagation for
rapid multiplication. This technique is helpful for commercialization of orchids.
Seed culture technique and micropropagation is taken into consideration of this study.
The seed culture technique helps in germination of plants where the normal growth is difficult.
This technique ensures much better germination particularly in the genera where germination is
not possible due to some abnormality within the seeds (Arditti et al., 1982; Linden, 1980;
McIntyre et al., 1972; Pathak, 1989; Pathak et al., 1992; Vij and Pathak, 1988; Vij et al., 1995;
Yam and Weatherhead, 1988). The orchid seeds are minute and exhibit very poor level of
differentiation. The development of the embryo is suppressed as such that the embryo is arrested
at a bulbous stage. In spite of being insubstantial embryo, they can germinate in nature if infected
with a suitable fungus (Bernard, 1904). However, the germination can bypass the fungal
requirement by supplying an appropriate sugar rich nutrient medium in vitro (Knudson, 1925).
Significantly, the orchid ovules are also capable of development in vitro.
Micropropagation Technique:
The technique of orchid micropropagation has been originated since many years, its
origin lies in several lines of research and came from the work of many well-known scientists,
(Arditti and Krikorian, 1996). Method for the in vitro culture of isolated plant cells, leaves and
organs or seeds are not difficult or complex but they do require some equipment and certain

110
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
skills and knowledge. More than one hundred years ago the method of propagating Phalaenopsis
was viewed by simply placing an explant on a medium and cultured until it produced a plantlet
or died. Micropropagation when done from a plantlet developed through any technique of plant
tissue culture, it is called clonal micropropagation. Clonal micropropagation is very popular in
commercial horticultural plants and orchids. The major advantages of micropropagation are i)
propagation can be carried out under disease free conditions throughout the year, ii) sub-
culturing of in vitro plantlets can be done after a defined intervals and each time one plantlet can
give at least 3 to 4 nodal cuttings. This was necessary for meeting the huge demand of planting
materials and also for survival of some wild orchids in vitro and for mass multiplication. After
the survey of the orchids in the present study area twenty plants were selected for seed culture
and also for micropropagation. Hence the objectives of the present study were set forth as:
• Production of plants in large scale through in vitro seed culture.
• Micropropagation of the plants developed through in vitro seed culture.
Conclusion:
Plant tissue culture and micropropagation is such a technique where orchids can be
rapidly multiplied allowing the production of large quantities. This will also enable the future
scientists to preserve the rare, endangered and medicinal species contributing to conservation
efforts. Orchid seed pod culture and micropropagation plays a crucial role in advancing orchid
cultivation, conservation and further research, thus helps eco-rehabilitation.
References:
1. Arditti, J. (1967). Factors affecting the germination of orchid seeds. Botanical Review, 33,
24–29.
2. Arditti, J., Clements, M. A., Fast, G., Hadley, G., Nishimura, G., & Ernst, R. (1982).
Orchid seed germination and seedling culture – A manual. In J. Arditti (Ed.), Orchid
biology, reviews and perspectives (Vol. II, pp. 243–370). Ithaca, NY: Cornell University
Press.
3. Arditti, J., & Krikorian, A. D. (1996). Orchid micropropagation: The path from laboratory
to commercialization and an account of several unappreciated investigators. Botanical
Journal of the Linnean Society, 122, 183–241.
4. Bernard, N. (1904). Recherches expérimentates sur les orchidées. La germination des
orchidées. Revue Générale de Botanique, 16, 405–475.
5. Bernard, N. (1909). L’éevolution dans La Symbiose. Les Orchideséet Leurs champignons
commensaus. Annales des Sciences Naturelles, Paris, 9(1), 196.
6. Burgeff, H. (1959). Mycorrhiza of orchids. In C. L. Withner (Ed.), The orchids: A
scientific survey. Ronald Press.

111
Bhumi Publishing, India

7. De, K. K., Majumdar, S., Sharma, R., & Sharma, B. (2006). Green capsule culture and
rapid micropropagation of Dendrobium chrysanthum Wall., a horticultural and medicinal
Orchid. Folia Horticulturae, 18(1), 81–90.
8. Handa, S. S. (1986). Orchids for drugs and chemicals. In Biology, conservation and culture
of orchids (pp. 89–100). Affiliated East West Press.
9. Heywood, V. H. (Ed.). (1993). Flowering plants of the world. B.T. Batsford Ltd.
10. Kano, K. (1965). Studies on the media for orchid seed germination. Memoirs Faculty Agri.
Kagawa Univ., 20, 1–68.
11. Kaushik, P. (1983). Ecological and anatomical marvels of the Himalayan orchids. Today
and Tomorrow’s Printers and Publishers.
12. Kirttikar, K. R., & Basu, B. D. (1935). Indian medicinal plants (2nd ed.). Bishen Singh
Mahendra Pal Singh.
13. Knudson, L. (1921). Non-symbiotic germination of orchid seeds. Botanical Gazette, 73, 1–
25.
14. Knudson, L. (1922). Further observations on non-symbiotic germination of orchid seed.
Botanical Gazette, 77, 212–219.
15. Knudson, L. (1925). Physiological study of the symbiotic germination of orchid seeds.
Botanical Gazette, 79, 345–379.
16. Knudson, L. (1951). Nutrient solutions for orchids. Botanical Gazette, 112, 528–532.
17. Linden, B. (1980). Aseptic germination of seeds of northern terrestrial orchids. Annales
Botanici Fennici, 17, 174–182.
18. Mabberley, D. J. (1998). The plant (2nd ed.). Cambridge University Press.
19. Michel, E. E. (2002). Asymbiotic propagation of tropical terrestrial orchid species. In J.
Clark, W. M. Elliott, G. Tingley, & J. Biro (Eds.), Proceedings of the 16th World Orchid
Conference. Vancouver Orchid Society.
20. Mitchell, R. B. (1989). Growing hardy orchids from seed at Kew. The Plantsman, 11, 152–
169.
21. McIntyre, D. K., Veitch, G. J., & Wrigley, J. W. (1972). Australian terrestrial orchids from
seed. American Orchid Society Bulletin, 41, 1093–1097.
22. Miyoshi, K., & Mii, M. (1995). Enhancement of seed germination and protocorm
formation in Calanthe discolor (Orchideaceae) by NaOCl and polyphenol treatments. Plant
Tissue Culture Letters, 12, 267–272.
23. Pathak, P. (1989). Asymbiotic germination and clonal propagation of some commercially
important and endangered orchids using tissue culture techniques (Ph.D. Thesis). Panjab
University.

112
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
24. Pathak, P., & Vij, S. P. (1992). Ovule culture in Goodyera biflora (Lindl.) Hk.f.: A study
in vitro. Journal of Orchid Society of India, 6, 49–53.
25. Rajbhandari, K. R., & Bhattarai, S. (2001). Beautiful orchids of Nepal. Kishore Offset
Press.
26. Stoutamire, W. P. (1974). Terrestrial orchid seedlings. In C. L. Withner (Ed.), The orchids
– A scientific survey (pp. 101–128).
27. Talukdar, A. (2001). Multiple shoot induction in Dendrobium aphyllum Roxb. Journal of
Orchid Society of India, 15, 35–38.
28. Trivedi, K. P., Garg, D. S., Agarwal, J. P., & Garg, D. D. (1961). Ridhi-Vridhi, Jeevak and
Rishbhak. Dhanvantari Vanaushadhi Bisheshank, Part I, 529–533.
29. Vij, S. P., & Pathak, P. (1988). Asymbiotic germination of saprophytic orchid Cymbidium
macrorhizon: A study in vitro. Journal of Orchid Society of India, 2, 25.
30. Vij, S. P., Vaidya, N., & Kondo, K. (1995). Chromosomes of Neottia listeroides Lindl.
(Orchidaceae), a reinvestigation. Chromosome Information Service, 58, 27–30.
31. Vij, S. P., Kaur, S., & Dev Manjari. (1997). Orchid breeding: Possibilities and
achievements. Botanica, 47, 168–176.
32. Waterman, P. G., & Mole, S. (1994). Methods in ecology: Analysis of phenolic plant
metabolites. Blackwell Scientific Publications.
33. Withner, C. L. (1943). Ovule culture: A new method for orchid seedlings. American
Orchid Society Bulletin, 11, 261–263.
34. Withner, C. L. (1959). Orchid physiology. In The orchids – A scientific survey (pp. 315–
360). Ronald Press.

113
Bhumi Publishing, India

AN OVERVIEW OF SUSTAINABLE DEVELOPMENT IN INDIAN

PERSPECTIVE
Prosenjt Ghosh
Department of Zoology,
Government General Degree College, Kaliganj, Debagram, Nadia, West Bengal, 741137
Corresponding author E-mail: [email protected]

Abstract:
Sustainable development which deals with the reasonable management of natural, human
and economic resources, aims to assure the essential requirements of humanity in the very long
term, has become a matter of growing interest among researchers. India being 7th largest country
in the world in terms of area covered and most populous country in the world is considered as a
developing country. It possesses diverse kinds of ecosystems as well as several mega diversity
zones and huge comparatively poor rural population. Sustainable development may play a very
crucial role in the development of India. By protecting the human resources, natural resources,
ecosystem and biodiversity, sustainable development, in terms of present generation may prove
to be a very good practice to improve the economic conditions of people and boost up their
quality of life. At the same time, by adopting this practice we can leave economically prosperous
and nature friendly India and world for future generations.
Keywords: Sustainable Development, Economic Development, Biodiversity, Future Generation
Introduction:
Though the concept of sustainable development is continuously being revised, extended,
and modified, according to United Nations it can be defined as “A sustainable development is the
development which achieves the requirements of the present, without compromising the ability
of the future generation to meet their own needs”. Currently United Nation provides clarification
regarding sustainable development as per 2030 agenda. The United Nation also refers three main
components of sustainable development acting as its main pillars. In 2015 by considering the
fundamental and common needs of the living organisms, the United Nation constituted 17 goals
which is also known as the global goals. This will act to finish poverty, protect the planet, and
make sure that by 2030 global population enjoy peace and prosperity. India is focusing largely
on five aspects to attain sustainable development goals. India constitutes 2.4 percent of the
earth's land, while sustaining 16 percent of the global population, which leads to an extremely
unsustainable exploitation of natural resources for several generations. At present, India is facing
rapid and extensive environmental degradation at alarming pace. Country's land and natural
resources are experiencing huge pressure to nurture the massive overpopulation. Poverty and

114
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
exclusion, unemployment, climate change, conflict and humanitarian aid, building peaceful and
inclusive societies, building strong institutions of governance, and supporting the rule of law are
considered as the major challenges to sustainable development which are also global in character
[1, 2].
Purposes and Goals of Sustainable Development (SDGs):
United Nations General Assembly in which India is a member country, in 2015 has set 17
goals for sustainable development in its 2030 agenda. These 17 Goals fall into 169 heads which
encompass all aspects to attain the sustainable development [ 3].
The SDGs and their main focus area summarized below:
Sl. No. Goals Focus Areas
SDG 1 No Poverty Elimination of poverty in all forms is the main purpose of this
goal. It also plans to provide basic requirements to all the people.
SDG 2 Zero Hunger Removal of all dimensions of malnutrition and boost the
agricultural productivity is the focal point of this goal.
SDG 3 Good Health and It aims in decreasing maternal mortality ratio and fortifies the
Well-being prevention and treatment measures for premature mortality.
SDG 4 Quality This goal ensures quality education for all devoid of any
Education discrimination.
SDG 5 Gender Equality This goal ensures equal rights in liberty, education, political
empowerment, to live in nonviolent society for women.
SDG 6 Clean Water and This goal is all about to provide clean water and to extend proper
Sanitation sanitation facilities.
SDG 7 Affordable and This goal is aiming to make clean resources and sources of
Clean Energy energy accessible to all at reasonable rates.
SDG 8 Decent Work Reaching economic growth in sustainable ways is the eventual
and Economic goal of sustainable development. So, everybody should get work
Growth opportunities. In this connection, to end the problem of
unemployment adequate number of industries and MSMEs
should be established.
SDG 9 Industry, This is an approach to endorse sustainable industrialization by
Innovation, and means of environment friendly techniques to enhance
Infrastructure manufacture. Financial assistance should be extended for the
purpose of building small scale industries.
SDG 10 Reduced This goal helps to finish all kinds of inequalities within the
Inequality country and among the countries.

115
Bhumi Publishing, India

SDG 11 Sustainable Natural heritage must be preserved during the establishment of

Cities and cities and communities.
Communities
SDG 12 Responsible Policies should be taken to avoid overuse and to encourage
Consumption reuse, recycle and reduce techniques.
and Production
SDG 13 Climate Action This particular goal is all about intimidation of climate hazards
and requirement to fix it as early as possible. Hence, this goal
focuses on to make people aware about the risk of climatic
changes and take on necessary measures to protect it.
SDG 14 Life below Marine pollution must be reduced to safeguard underwater lives.
Water Special measures should be taken to prevent overfishing and
scientific methods must be adopted to improve the aquatic life.
SDG 15 Life on Land Conservation of wildlife, ecosystem and the whole biodiversity
is the prime essence of sustainable development. This goal
focuses on restoration of terrestrial life, maintaining the quality
of soil, reduction in degradation of land due to deforestation and
increasing the capacity of natural resources to facilitate
sustainable development.
SDG 16 Peace and All types of violence like trafficking, abusing and exploitation of
Justice Strong any age group must be abolished. For this purpose, legal
Institutions framework must be strong enough and justice must be accessible
to all.
SDG 17 Partnerships to This is the main aspect as these goals cannot be achieved by
achieve the Goal only one nation or institution or isolated measures taken
separately by different countries. To fulfill these goals the
collective and inclusive efforts of all countries are required.

Pillars of sustainable development: The sustainable development comprises 3 main pillars.

This are-
Social Development:
It is the capacity of a community to develop measures which not only fulfill the
requirements of its present generations but also help to sustain the ability of upcoming
generations to keep up a healthy community, quality of life, education, equal opportunities, law
and ethics, environmental law, public involvement in social development [3, 4].

116
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Environmental Development:
It deals with the type of development that reduces environmental problems and achieves
the requirements of the current generation without harming or disturbing the ability of the future
generation to attain their own needs [3, 4].
Economic Development:
Sustainable development has several economic aspects. Sustainable development focuses
on creating sustainable enhancement in the quality of life of entire population. Sustainable
development also helps to increase economic growth and fulfill the basic requirements of people
resulting in the improvement in their standard of living. Thus, it helps to increase in economic
development. The quality of life and economic development of future generations largely
depends on the natural resources and quality of the environment including the quality of air,
water and land [3, 4].
Sustainable development in Indian Context:
Environment and environment related issues have long been considered as an essential
part of Indian culture which has been reflected in key Government policies and Constitution of
India. The Article 21 of Indian Constitution refers the Right to Life which mentions right to
clean environment, right to livelihood, right to live with pride and a number of other associated
rights. The National Environment Policy of India is “Only such development is sustainable,
which respects ecological constraints and the imperatives of social justice.” Government of India
considering sustainable development a crucial one made its important presence in The Seventh
Five Year Plan (1985-1990) [2, 3].
Measures of Sustainable Development:
Strategies for sustainable development in India are given below:
(i) Technology
Technologies which will be used should be locally adaptable, resource efficient,
biodegradable and culturally suitable. The technologies should be designed in such way that they
will consume minimal resources and produce least waste [2, 3].
(ii) Reduce, reuse, and recycle approach
This 3-R approach promotes minimum resource use; reuse them as much as possible and
finally recycling the materials in such a way that it can achieve the goals of sustainability [2, 3].
(iii) Promoting environmental education and awareness
Environmental education and awareness will help people to change their thinking pattern
and approach towards the planet earth and the environment. Environment related studies should
be introduced right from the school level to boost this awareness campaign [2, 3].

117
Bhumi Publishing, India

(iv) Resource utilization as per carrying capacity

The concept of carrying capacity, unlike other animals, becomes much more complex in
human beings as they not only need food to live, but also many other things are required to
maintain their quality of life. When the carrying capacity of a system is breached, environmental
degradation begins and doesn’t stop until it reaches a point of no return. In order to attain
sustainability it is essential to utilize the resources depending upon the supporting capacity and
assimilative capacity of a system [2, 3].
(v) Improving quality of life including social, cultural and economic dimensions
Development must focus on both the rich and poor section of the society and all the
beneficial measures must be equally shared between them. The tribal, ethnic people and their
cultural heritage should also be conserved [2, 3].
India’s status:
The Sustainable Development Goals of India Index released by NITI Aayog and the
United Nations in December, 2018 show that the Indian Nation has a score of 58%, which is
slight beyond the halfway mark to achieve the target of 2030 agenda. In a ranking system of 0-
100 for all the Indian states and Union territories, the data show status of different states.
Himachal Pradesh, Kerala and Tamil Nadu achieved top performance with 69%. Assam, Bihar
and Uttar Pradesh are lagging behind with 0-49%. In achieving zero hunger goal Goa, Kerala,
Manipur, Mizoram and Nagaland were emerged as top performers [3].
Steps taken by government: The following steps have been taken by Government of India for
successful achievement of sustainable development goals:
Ratifying Paris agreement, the clean development mechanism projects in India, state
action plans on climate change, coal cess and the national clean energy fund, national adaptation
fund for climate change [3].
Challenges encountered in sustainable development:
Excessive Population, poverty among large section of population, unequal distribution of
resources among poor and rich, shortage of drinking water, excessive consumption of energy
especially those derived from fossil fuel, deforestation etc pose great challenges in sustainable
development [2].
Conclusion:
The vision and concept of sustainable development is not only for the benefit of present
day world but also it encompasses the efforts taken today for benefit and wellbeing of future
world. Future generations on earth may face extreme threats of extinction or their quality of life
may decline severely if efforts to establish successful sustainable development is failed today.
For this reason, all the stakeholders, entire global population and all nations of the world must
work collectively for establishment and finally successful achievement of sustainable

118
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
development. Ultimately, the goal will become true when all the major three aspects of
sustainable development can be achievable throughout the world.
References:
1. Tushar Kumar Gandhi and Shailendra Kumar Sharma. (2012). Study of environmental
imperatives of sustainable development in India. International Journal for Environmental
Rehabilitation and Conservation, III(2), 72–79.
2. Vinati S. Dhankhar. (2016). India and sustainable development. International Journal of
Computing and Corporate Research, 6(2), March-April. 2249054XV6I2032016-89.
3. S. Srimathi. (2019). Sustainable development of India – an overview. JETIR, February
2019, 6(2). ISSN: 2349-5162. www.jetir.org.
4. Rashmi R K and Thippesh K. (2023). Sustainable development in Indian perspective.
Quest Journals. Journal of Research in Humanities and Social Science, 11(7), 195-197.
ISSN (Online): 2321-9467. www.questjournals.org.

119
Bhumi Publishing, India

AQUAPONICS: AN ADVANCED INTEGRATED FARMING

Anasuya Majumdar
Department of Zoology,
Vidyasagar College for Women, Kolkata-06

Abstract:
A nation's robust economy is based on its agricultural industry. The two recent, massive
processes of urbanisation and population increase have made the growing disparity between
supply and demand more problematic. Agricultural land is decreasing while demand of food
products is continuously increasing. To solve this problem researchers are looking for ways to
produce more using less resource. Aquaponics or vertical integrated farming is one such
alternative, though still in its developing stage towards perfection. It is the bio-system that
integrates recirculated aquaculture with hydroponics that creates a symbiosis between fish and
plants. This technology could thus be used in urban areas or regions with scarcity of other
resources like water. With research, training and awareness aquaponics may revolutionize
agriculture by promoting resource efficiency, food security and environmental sustainability.
Keywords: Aquaponics, Integrated Farming, Food Security, Environmental Sustainability
Introduction:
Aquaponics is an agricultural system that combines aquaculture and hydroponics for
production of fish and plants in a more sustainable way. This food production system raises
aquatic animals like fish, crayfish, snails and prawn along with cultivating plants in water
(without use of soil). The development of modern aquaponics is attributed to German scientist
Ludwig C.A. Naegel in 1977 for his publication of ‘Combined production of fish and plants in
recirculating water’.
In aquaponics farming, plants are cultivated in a grow bed and fishes are placed in a fish
tank. The nutrient rich water of fish tank feeds the plant grow bed where billions of bacteria
break toxic ammonia of the waste water into less harmful nitrates that the plants absorb and their
roots filter out water before refilling the fish tank. At this postpandemic era, the aquaponics
system represents an efficient green farming and eco‐friendly alternative to sustainable
agricultural production [1].
The principle of the system consists of - aquatic effluents (resulting from uneaten feed
and excreta that accumulate in water), due to closed-system recirculation in most cases of
aquaculture, becomes toxic to aquatic animals in high concentration but this contains nutrients
essential for plant growth. In recirculatory aquaculture systems large quantities of fish are raised
in small volumes of water by treating the water to remove the toxic waste products and thus
reuse again [2] Nitrifying bacteria convert toxic ammonia and nitrite into less toxic nitrate in

120
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
specialized biofilters, but, disturbances to the biofilter or ammonia production that exceeds the
capacity for the biofilter, toxic waste can accumulate to levels that are deleterious to the fish and
can’t be removed [3]. If by introducing plants, the toxicity is removed and the said nutrients
could be used, the fresh water could be returned to aquaculture. Removal of solid wastes and
conversion of toxic substances like ammonia into nontoxic nitrates are the most important
intermediate steps that helps in the successful coexistence of aquaculture and vegeculture on
each other. An effective aquaponic system thus require solid waste removal, neutralization and
oxygenation of the aquatic medium that is essential for both the animals and the plants. Hence,
the main objective of such farming is to grow plants using aquatic animal waste.

Representation of a simple aquaponics system

System set up
To set up a basic aquaponic system one needs the following typical components:
• Space (land or rooftop)
• Rearing tank for raising fishes or other aquatic animals
• Settling basin for catching uneaten food and settling out fine particulates
• Biofilter, where nitrification bacteria can grow and convert ammonia into nitrates
• Hydroponic subsystem, where plants are grown by absorbing nutrients from the water
and
• Sump or the lowest point in the system where the water flows to and from which it is
pumped back to rearing tanks.
• Plant and animal species, water and electricity
Types
Modern aquaponics can be classified according to different hydroponic form and the fact
whether the water cycle is closed or not. Media-Based Growing Bed (MBGB), Deep Water
Culture (DWC), Nutrient Film Technique (NFT) are the common types. The three have their
own characteristics:
• Media-based growing bed aquaponics system: This system uses a growing medium,
such as bed of gravel or expanded clay pellets, to support the plant roots while providing
a surface for beneficial bacteria to live. This media acts as a biological filter that helps
maintain water quality.

121
Bhumi Publishing, India

• Nutrient film technique (NFT) aquaponics system: In this system, a thin film of
nutrient-rich water continuously flows over the plant roots, providing them with the
necessary nutrients.
• Deep water culture (DWC) aquaponics system: This is also called the raft system and
involves suspending the plant roots directly in a nutrient-rich water solution.
MBGB is space-saving but difficult to maintain and clean. DWC is easier to clean and
has a higher removal rate of nitrate, but it requires extra biofilters, aeration devices, and a larger
volume of water. NFT has higher efficiency for water use but lower yield [4].
Advantages of aquaponics farming over other agricultural systems:
• This is more sustainable, intensive and carbon-neutral, high yielding (nearly six times
more than traditional farming) system
• cultivation could be accomplished all year-round which is one of the biggest benefits
• It can offer multi-channel income source for farmers
• It is water efficient, accounts for 90% less water usage than conventional farming
Similarly, does not require soil or large spaces of land and is a great option for anyone
with limited space
• As practiced in a controlled environment it has fewer chances of pests and diseases
• Almost no artificial fertilizer is needed since fish waste is used as the source of natural
fertilizer for plants
• Efficient and reusable resources decrease the operating cost of aquaponics farming
Disadvantages of aquaponics farming:
Challenges to the domestication of the system, however, include moderately high start‐up
capital, the need for stable electricity to operate the system, nutrient availability, as well as
treatment of diseases in the system.
• Aquaponics farming system is expensive to set up
• It requires daily maintenance
• Proper knowledge of fish, bacteria and plants are required for efficient production
• This farming requires reliable electricity source
Global status of aquaponics farming
Aquaponics is a relatively modern concept and still under trial. It is being tested out in
places where the unfavorable weather does not allow crop growth. However, it is yet to become a
universal solution.
Interestingly, rearing fishes in paddy fields or growing rice and fodder on floating
wooden rafts in various provinces of China during 13th century or earlier was a common practice.
During 1970s to the ‘90s. several farms and institutes in North America developed modern
aquaponics systems. The Urban Farming Company in Switzerland has created a method of

122
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
rooftop based aquaponic systems aiming to offer fresh, sustainable produce to local urban areas.
In 2018 the European Aquaponics Association was established. At the Bangladesh Agricultural
University, M.A. Salam has created plans for low-cost aquaponics system to provide organic
produce to people of Bangladesh. Aquaponic systems are also growing in countries like
Malayasia and India. Various non-profit organizations and research institutes globally are
involved in implementation and improvement of this practice as well.
Scenario in India
In India Aquaponics system is still evolving. It is becoming popular with individuals,
entrepreneurs, educators, missions and governments interested in modern farming. This system is
commonly used in resource limited and urban areas. Vegetables and horticulture plants with low
to medium nutrient requirement are grown along with fishes. India is known to lead in freshwater
fish production using traditional methods; however, Aquaponics system may produce up to five-
six times the quantity of fish in same area per year with good crop of vegetables in addition.
Even if the system requires high initial investment, the recurring cost is less and one would get
reasonable return. Establishment and operation of such units is quite demanding in our country,
in terms of technology, techniques, biology of life forms and water quality parameters.
Beneficiaries of such farming may include women self-help groups (SHGs), fisherman
societies and entrepreneurs. Technical supports are provided by several technology service
provider and department of Fisheries of the state government whereas financial assistance in
form of subsidy from government was provided to the beneficiaries.
To set up the aquaponics systems one needs to select and arrange different components
wisely. Tilapia, ornamental fish, catfish, and leafy vegetables are the most common fish and
plant species for aquaponics cultivation [5]. Hydroponic types, fish and plant density [6], flow
rate, water quality parameter, feeding and planting strategies are important factors affecting
yield. The components can be broadly divided into living and non-living:
Living components
a) Aquatic animals to be reared (fish, shellfish etc.):
Targeted fish species are Monosex Tilapia (Oreochromis
niloticus), Pangasius (Pangasiandon hypophthalmus) or
any species that can tolerate high density stocking.
b) Plants to be cultivated: any kind of plants that are
suitable to grow in that region and require low to medium
nutrient are good targets for cultivation. Leafy vegetables
like mint, basil, lettuce, spinach or fruit plants like tomato,
chilly, brinjal, ladies’ finger, lemon, gourds etc. and also
horticultural plants of various kinds are grown depending on the seasonal and climatic condition
as per requirement.

123
Bhumi Publishing, India

c) Biofiltering bacteria: Beneficial bacteria play important role in the optimal development of
species in aquaponics. They transform fish excrement and food debris into macronutrients and
micronutrients that plants can assimilate. Ammonium nitrogen undergoes conversion to nitrite
through biological nitrification by ammonia oxidizing bacteria such as Nitrosococcus,
Nitrosospira and Nitrosomonas. Then nitrite-oxidizing bacteria such as Nitrobacter, Nitrospira
etc. transform toxic nitrite to relatively harmless nitrate.
Non-living components
a) Water: Water is the main medium for aquaponics and hence the success of such
integrated farming depends on quality of the water used. For this reason, several
parameters of water, like temperature, dissolved oxygen, pH, salinity, alkalinity etc. are
to be monitored and optimal levels are maintained on a regular basis.
b) In addition, other important non-living components are - Fish Pond/tank with proper
technological arrangements, plant grow-beds, moving bed biofilm reactor and filtration
unit, pumps and oxygenation tools, electricity supply and pipelines, sand and gravel, fish
feed, cleaning apparatus, transportation arrangement etc.
Government, non-government organization as well as several companies in India are
helping individuals in setting up this sustainable agriculture practice for domestic as well as
commercial purposes. Researchers are also busy developing newer more efficient systems.
Aquaponics in India is being implemented in the following forms:
• Urban backyard or roof top Gardens: Rooftop gardens and aquaponics vertical farming
systems allow the urban population to grow fresh vegetables and fish in a controlled
environment in a limited space. These contribute to local high-quality food production in
cities.
• Organic farming: Aquaponics system is an attractive option for farmers who aim to
produce organic, chemical free food. The farming could be open or within net house or
polyhouse. The closed ways, though more expensive option, yield more profitable as the
production is less attacked by pests and diseases.
• High value crop production: A wide range of high value crops including leafy greens like
lettuce, herbs, strawberries and exotic vegetables can be grown using this method. These
crops have high demand in urban areas. Farms in different states of India has opted for
this system and are cultivating such exotic plant products in addition to various fish
species. Farmers thus could increase their profitability and diversify their income.
• Farming in adverse environmental conditions: Many regions in India face water scarcity
(drought prone areas) or with water unsuitable for growing different plant products
(coastal areas). Since aquaponics conserve water by recycling it within a closed-loop
system it could be an ideal option of farming in such areas. It has also been suggested [7]

124
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
instead of open fishing in brackish water fisherman and farmers of Sundarbans may opt
for aquaponics system to culture prawn and other aquatic organisms along with mangrove
cultivation. That would help conserve both the animals and mangrove plants that are
known to be threatened by various means. This thus could act as an example of
conservation of water, plant and animal by a single system.

Rooftop garden Backyard garden

Aquaponic farming in India presents a sustainable approach to addressing the challenges
faced by traditional agriculture. However, this system is progressing in a low pace and the
reasons for such stagnant growth rate is the high capital requirement. The increasing urbanization
and population growth demand high global food production but the land under cultivation is
decreasing so is water resource. This problem of increasing gap between demand and supply is
needed to be solved. With further research, training, awareness towards more cost-effective
innovative techniques, aquaponics has the potential to revolutionize Indian agriculture by
promoting resource efficiency, food security and environmental sustainability.
A recent study identified [8] prolific authors, journals, and affiliations in the field of
aquaponics. The USA, Europe, and some Asian countries, especially China and India, seemed to
be the most innovative regions with significant research in this area. The Fisheries Science
Division of the Indian Council of Agricultural Research, New Delhi in collaboration with its 8
Fisheries Research Institutes launched the National Campaign on “System Diversification in
Aquaculture” in February 2021 where speakers stated that the Hi-end novel technologies like
RAS, Biofloc, Aquaponics, FIMTA and Flow-through, etc., are increasingly attracting the
attention of Young Entrepreneurs. [9].
In order to meet human demand for aquatic products, total global aquatic production
increased by 27.5% in 2010–2018, during which aquaculture and capture output increased by
29.8% and 10.4%, respectively (FAO, 2018). During this time of shrinking resources of land and
water, growing population, urbanization and change in life style aquaponics seems to have
immense potential for fish and plant production in urban, suburban as well as rural settings.
Since it is an environmentally-friendly aquaculture and planting system, aquaponics has attracted

125
Bhumi Publishing, India

attention in fisheries, agriculture, and ecology. At present, the aquaponics development is facing
many pressures from management and market. Future needs more in-depth research in the
system construction, management of nutrient and microbial community structure to provide a
theoretical basis [10]. Incorporating aquaponics into the category of green infrastructure can
provide it with research directions, development environment, and policy support.
References:
1. Okomoda et al. (2023). Aquaponics production system: A review of historical perspective,
opportunities, and challenges of its adoption. Food Science & Nutrition, 11(3), 1157–1165.
2. Rakocy, J. E., & Hargreaves, J. A. (1993). Integration of vegetable hydroponics with fish
culture: A review. In J. Wang (Ed.), Techniques for modern aquaculture. American
Society of Agricultural Engineers.
3. Yildiz, H. Y., Robaina, L., Pirhonen, J., Mente, E., Domínguez, D., & Parisi, G. (2017).
Fish welfare in aquaponic systems: Its relation to water quality with an emphasis on feed
and faeces–a review. Water (Switzerland), 9, 9–17. https://doi.org/10.3390/w9010013
4. Goddek, S., Delaide, B., Mankasingh, U., Ragnarsdottir, K. V., Jijakli, M. H., &
Thorarinsdottir, R. (2015). Challenges of sustainable and commercial aquaponics.
Sustainabilty, 7, 4199–4224.
5. Love, D. C., Fry, J. P., Genello, L., Hill, E. S., Frederick, J. A., Li, X., & Semmens, K.
(2014). An international survey of aquaponics practitioners. PLoS ONE, 9, e102662.
6. Surnar, S. R., Sharma, O. P., & Saini, V. P. (2017). Nutrient harvesting through
aquaponics: Growth of labeo rohita and production of plant (spinach). J. Exp. Zool. India,
20, 389–396.
7. Chakravartty, D., Mondal, A., Raychowdhury, P., Bhattacharya, S. B., & Mitra, A. (2017).
Role of aquaponics in the sustenance of coastal India – Aquaponics is a solution for
modern agriculture in ecologically sensitive Indian mangrove Sundarbans: A review.
International Journal of Fisheries and Aquatic Studies, 5(2), 441–448.
8. Basumatary, B., Verma, A. K., & Verma, M. K. (2023). Global research trends on
aquaponics: A systematic review based on computational mapping. Aquaculture
International, 31, 1115–1141.
9. ICAR. (n.d.). https://icar.gov.in/node/12782
10. Hao, Y., Ding, K., Xu, Y., et al. (2020). States, trends, and future of aquaponics research.
Sustainability (Switzerland), 12, 1–14. https://doi.org/10.3390/SU12187783

126
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

ANTHROPOCENE AQUATIC BODIES: THREATS AND CONSERVATION

Shampa Bag
Department of Zoology,
Ananda Mohan College,
102/1, Raja Rammohan Sarani, Kolkata-700009
Corresponding author E-mail: [email protected]

Abstract:
Water is one of the vital needs of all living things. Humans need water in their daily
activities like drinking, bathing, washing, cooking, etc. Presently, anthropogenic activities bring
contamination and subsequent pollution to our varied ecosystems, especially aquatic. Poor
quality of water is unfit for drinking and other activities. Polluted water affects aquatic life as
well as the surrounding environment.
The quality of water of an aquatic body is usually described by its physical, chemical,
and biological properties. Hence it becomes essential to find the suitability of water for the
purpose of its use like drinking, irrigation or industry etc. The availability of good quality water
is an indispensable feature for preventing diseases and improving quality of life.
Assessing the quality of an aquatic body requires knowledge about the different
physicochemical parameters such as colour, temperature, hardness, acidity, pH, odour, chloride,
sulphate, dissolved oxygen, biological oxygen demand, chemical oxygen demand, alkalinity etc.
All these factors interacting among themselves determine the complex community structure.
Maintenance of a good quality water environment requires pollution prevention and water reuse
in combination with the recycling of nutrients in a controlled manner, especially in an urban
context, that can help in biodiversity conservation as well as enhance the socioeconomic status of
the surrounding people.
Keywords: Physicochemical Parameters, Variations, Seasonal, Fresh Water, Pollution.
Introduction:
Water is the most precious resource on the earth, without which life would not have
existed. A water body not only affects the physical and climatic environment in its nearby areas
but also affects the socio-economic conditions of the area1. Variability in physicochemical
parameters determines the distribution of the aquatic organisms in different aquatic habitats
according to their adaptation that allows them to live in a specific habitat2. A stagnant or lentic
water body is more vulnerable to pollution as self-purification processes are very poor in them3.
Any contamination or pollution of an aquatic body affects greatly the flora and fauna and also
human health if the water is used for domestic purposes4,5. In the last few decades, there has been
a vigorous increase in the demand for freshwater due to the fast growth of the human population

127
Bhumi Publishing, India

and the accelerated pace of industrialization on earth. According to WHO, about 80% of all
diseases in human beings are caused due to contaminated water6. Water-borne disease infections
occur due to consumption of polluted water7. Discharge of urban, industrial, and agricultural
wastes with nutrients like phosphorous, nitrogen and potassium accelerate the process of
eutrophication8.
The proper functioning of an aquatic ecosystem depends on the physicochemical
characteristics of its water 9. Variability in physicochemical parameters is responsible for the
diversity and distribution of organisms according to their adaptation, which allows them to
10
survive in a specific habitat . It is essential to assess water quality. Temperature, dissolved
oxygen, pH, free carbon dioxide, Biological Oxygen Demand (BOD), Chemical Oxygen
Demand (COD), phosphate, phosphorus, nitrate-nitrite, and total alkalinity are significant
11
parameters used to study the water quality . Maintaining the quality of aquatic ecosystems
represents one of the most tough challenges facing global society in the twenty first century.
Some physicochemical parameters as indicators of water quality
Commonly analyzed physicochemical parameters for the study of aquatic body involve
the study of following parameters:
Temperature:
The water temperature controls the rate of all chemical reactions and affects fish growth,
reproduction and immunity. Drastic temperature changes can be fatal to fish. The rates of
chemical and biological processes depend on temperature. Temperature affects the oxygen
content, rate of photosynthesis, metabolic rates of water organisms and sensitivity of organisms
to toxic wastes, parasites, and diseases12.
pH:
The pH of is measured as a negative logarithm of H+ ions for many practical practices.
Mainly drinking water pH lies from 4.4 to 8.5. The pH is most important in determining the
corrosive nature of water. The lower the pH value the higher is the corrosive nature of water13.
Turbidity:
The suspension of particles in water interfering with the passage of light is called
turbidity. Turbidity is caused by a wide variety of Suspended particles. As per IS: 10500-2012
the acceptable and permissible limits are 1 and 5 NTU respectively13.
Total Dissolved Solids (TDS):
The difference between total solids and suspended solids is used to determine the
filterable solids with the help of filtrate. The acceptable and permissible limits as per IS: 10500-
2012 are 500 and 2000 mg/l respectively13.

128
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Dissolved Oxygen:
The presence of dissolved oxygen is essential to maintain the higher forms of biological
life and to keep the proper balance of various pollutions thus making the water bodies healthy.
The chemical and biochemical processes undergoing in the water body are largely dependent
upon the presence of oxygen. The permissible value recommended for DO is 5mg/L as per
Indian standard14.
Free Carbon Dioxide:
In water, CO2 may exist in three states- 1. Unbound state simply dissolved in water
known as free CO2; 2. As bicarbonate ions (HCO3-) known as half bound state; 3. As carbonate
ions (CO32-) known as a fixed state. Free CO2 has interdependence with pH and bicarbonate-
carbonate equilibrium.
Biological Oxygen Demand (BOD):
BOD is a measure of the dissolved oxygen consumed by microorganisms during the
oxidation of reduced substances in waters and wastes. BOD directly affects the amount of
dissolved oxygen in aquatic bodies. The greater the BOD, the more rapidly oxygen is depleted in
the water that causes aquatic organisms become suffocate, stressed leading to death. In
chlorinated waters, it is essential to neutralize the chlorine with sodium thiosulphate15.
Electrical Conductivity:
Conductivity is the ability of water to carry an electrical current and depends on the
presence of ions their total concentration, mobility, valence, relative concentration, and the
temperature of the liquid. Solutions of most inorganic acids, bases, and salts are relatively good
conductors16.
Total Hardness:
As per IS: 10500-2012 Desirable limit and Permissible limit for hardness lie between 200
to 600 mg/l. The effect of hardness varies in scale in the different purposes of the use of water.
Sources are dissolved calcium and magnesium from soil and aquifer minerals containing
limestone or dolomite. The hardness value of drinking water is classified in terms of equivalent
CaCO3 concentration as follows: Soft - 0-60mg/l, Medium - 60-120 mg/l, Hard - 120-180 mg/l,
Very hard - >180 mg/l16.
Sulphate:
Natural water contains sulphate ions and most of these are soluble in water. Most of the
sulphate ions are produced by the oxidation process of their ores, they are also present in
industrial wastes. As per IS: 10500-2012 the desirable limit for Sulphate is 200 and 400 mg/l in
the Permissible limit13.

129
Bhumi Publishing, India

Nitrate:
Nitrate is found in raw water and mainly in the form of N2 compound (of its oxidizing
state). The chief sources of nitrate are fertilizer and chemical factories, the matter of animals,
kitchen waste or domestic and industrial discharge. As per IS: 10500-2012 Desirable limit for
nitrate is max.45 and no relaxation is the permissible limit13.
Total Alkalinity:
Alkalinity is the total of components in the water which tend to elevate the pH to the
alkaline side of neutrality. It is measured by titration with standardized acid to a pH value of 4.5
and is expressed commonly as milligrams per liter of calcium carbonate (mg/l as CaCO3).
Commonly occurring materials in water that increase alkalinity are carbonate, phosphates, and
hydroxides16.
Chloride:
All type of natural and raw water contains chlorides. It comes from activities carried out
in the agricultural area, Industrial activities, and from chloride stones. As per IS: 10500-2012
Desirable limit for chloride is 250 and 1000 mg/l in the Permissible limit16.
Phosphate:
Phosphorus is an important plant nutrient and most often controls aquatic plant growth in
freshwater. Normally groundwater contains only a minimum phosphorus level 17.
Chemical Oxygen Demand (COD):
COD is a measure of the oxygen required for complete chemical oxidation of organic
matter with the help of a strong chemical oxidant. High COD results in oxygen depletion due to
large scale microbial decomposition to a level detrimental to aquatic life17.
Adverse effects of Contaminated Aquatic Ecosystems due to human activities:
Human activities like deforestation, filling and construction of canals, dams, roads and
bridges, agricultural and industrial and domestic activities lead to contamination of water
bodies.18
In most developed countries, agriculture is one the major factor in the depletion aquatic
ecosystems. In the European Union, 38% of aquatic bodies are mostly under agricultural
pressure. In the USA, agriculture is the leading source of pollution in water bodies.
Agrochemicals:
Population increase has increased the food demand, which results in the increase in the
use of agrochemicals in the fields. Agrochemicals in the form of fertilizers, pesticides, herbicides
and plant hormones diffuses into the aquatic bodies. This contributed to the more pollution in the
water bodies.

130
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Table 1: Sources and entry route of pollutants into aquatic environment:
Type of pollutants Source Route of entry
Organic pollutants Domestic sewage, like wastes Inflow into the water bodies by run-
from cattle farm and wood off from drains, gutter.
pulp mills etc.
Infectious disease agents Domestic sewage, human and Washing, swimming or working in
animal wastes paddy rice fields and on irrigated
land
Plant nutrients such as Fertilized farm lands, ashes Run-off from fertilized farmlands
nitrate, phosphate and and detergent
others
Pesticides (insecticides Organic and inorganic Run-off from pesticides associated
and herbicides) chemical with farmlands
Eroded sediments Deforestation and accelerated Soil erosion
soil erosion
Industrial effluents Textile factories and other Human discharges
which include DDT, industries,
dyes, mercury, cadmium

Other solid wastes Metals, plastics, artificial Dumping by humans due to

fibers etc mismanagement of waste disposal
Petroleum products Drill cuttings, drilling mud , Petroleum, exploration, exploitation,
accidental discharges of crude refining, transportation, storage,
petroleum, refinery effluents marketing, use and ruptured oil
which include oil and grease, pipelines
phenol, cyanide, sulphide,
suspended solids, chromium,
and biologically oxygen
demanding organic matter

Nutrients:
Fertilizers are used at a higher rate than they are fixed by the soil, and or taken up by the
plants or when they are taken off through surface runoff from the soil surface to water bodies and
leads to water pollution. Excess nitrogenous fertilizers and phosphate fertilizers enter into
groundwater or reach into surface aquatic bodies through surface runoff. This results in the
nutrient enrichment eutrophication of lakes, reservoirs, ponds, and coastal waters, which leads to

131
Bhumi Publishing, India

more growth of aquatic plants—algae blooms that destroy other aquatic plants and animals. The
excessive nutrients may also increase the adverse effects on health.
Pesticides:
Pesticides such as insecticides, herbicides, and fungicides are applied in fields in several
nations and run-off into aquatic ecosystems and pollute the water bodies. They contain
carcinogens and other poisonous substances which may destroy aquatic life. These long
chemicals often enter the food chain causing to bio-accumulation and bio-magnification.
Salts:
Salinization is caused by transporting accumulated salts into receiving water bodies by
drainage water. Highly saline waters change the geochemical cycles of elements such as carbon,
iron, nitrogen, phosphorus, silicon and sulphur and have impacts on ecosystems. Salinization can
affect freshwater organisms by causing alters within species and community composition.
Sewage:
The large volume of waste enter into the aquatic environment is sewage. Sewage contains
industrial wastes, municipal wastes and domestic wastes that include wastes from baths,
kitchens, washing machines and also faecal matter. Fresh water bodies serve as good sinks for
the discharge of wastes. It has resulted in extensive ecological depletion of water quality and
availability. Sewage effluent contains a variety of pathogenic organisms which may cause in the
transmission of waterborne diseases when this water is used for domestic and other purposes and
thus is harmful to human health and the community at large.
Heavy Metals:
Heavy metals get incorporated into the aquatic ecosystem due to natural and human
activities. It may be due to direct discharges or through indirect routes such as atmospheric
precipitation and surface run-off. The main pollutants consist high levels of Lead, Cadmium,
Mercury, Chromium, Copper, Zinc, etc. in the aquatic body. Cadmium, Arsenic, Copper,
Mercury, and Zinc are the potent heavy metals that have severe environmental impact. These
metals enter into the aquatic body due to various agricultural or industrial activity through storm
water and wastewater discharges. These pollutants are ecologically highly significant because
these tend to accumulate in the water body and enter into the food chain.
Eutrophication:
Eutrophication is one of the main causes of destruction of many freshwater and marine
ecosystems in the world. It is characterized by excessive algal growth due to the more
availability of limiting growth factors required for photosynthesis. The impact of cultural
eutrophication is the production of dense blooms of noxious, bad-smelling phytoplankton which
decrease water transparency and decrease water quality. Algal blooms inhibit penetration of

132
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
light, limit the growth and cause death of plants and the chance of prey by predators which need
light to catch prey.
Plastics and microplastics:
The stor ing of plastic debris in aquatic environment is one of the most important but
least studied. Plastics leads to significant benefits of the society but due to its durability,
unsustainable and inappropriate use, plastics accumulate extensively in the natural habitats. And
has practically entered the global marine ecosystem. The main source of this pollution is the
single-use plastics (plastic bags and micro beads). Recently, it has been revealed that
microplastics in the marine environment may lead more threat than macroplastics.
Oil spills:
An oil spill is defined as the discharge of liquid petroleum hydrocarbons into the
environment, mainly in the marine ecosystem caused by human activity. Environmental
pollution caused by an oil spill is detrimental. This is because petroleum hydrocarbons are
harmful to all aquatic and terrestrial organisms.
Prevention and Possible Solutions:
Water pollution can be minimised from a personal level to national and international
level. Every people have a duty to reduce water pollution. There are various sources of water
contamination. Thus, various preventive measures can control of water pollution.
• We should not throw the rubbish in places like the beach, riverside and water bodies rather
we put it in a dustbin.
• Water should be used wisely and we should stop the running tap water when not in use.
• We should not throw oils, plastics, paints, chemicals and medicines down the sink drain, or
the toilet.
• We should use more environment-friendly and safe cleaning liquids at home and other
public places.
• Use of pesticides and fertilizers should be reduced rather organic fertilizers should be
promoted.
• We should implement water quality laws to protect our environment.
• Proper use and disposal of chemicals prevent the aquatic environments from contamination.
• Detergents use should be minimised because high phosphate content of it can create
eutrophication of lakes.
• We should control storm water run-off as while flowing over surfaces, it carries debris,
chemicals, sediments and other pollutants that can have harmful impacts on the water
environment if it is left untreated.

133
Bhumi Publishing, India

• We should not wash our vehicles at home rather we should use appropriate facilities because
this reduce the amount of pollutants entering into the drainage by treating the wastewater
prior to its release.
• To reduce water contamination in our society we should prevent dumping of waste from
industry into the local water bodies
• We should not dispose non-biodegradable products into the drain.
Conclusion:
Human activities are the major causes of the depletion of aquatic environment. Increased
industrialization and unplanned urbanization are prime causes of the water contamination. Water
pollution is a great concern to this present world. It is essential to test the water quality before its
use for any purposes. Environmental education amongst the mass is very necessary to decrease
the pollution of aquatic ecosystems.
Proper bioremediation techniques should be used to improve water quality when some
pollutants are detected. Stopping the source of pollutants cannot restore the water quality, thus it
becomes imperative to regularly monitor the quality of water bodies and to design ways and
means to protect it.
References:
1. Kushram, P. (2016). Physico-chemical studies on Narmada River water at Dindori (M.P.)
India. International Journal of Applied Research, 2(2), 226–228.
2. Jeffries, M., & Mills, D. (1990). Freshwater Ecology: Principles and Applications (1st
ed.). London and New York: Belhaven Press.
3. Akabugwo, I. F., Ofoegbu, C. J., & Ukwuoma, C. U. (2007). Physicochemical studies on
Uburusalt lake Ebonyi State, Nigeria. Pakistan Journal of Biological Science, 10, 3170–
3174.
4. Igbokwe, S. O., Ogueri, C., & Ajima, M. N. O. (2021). Seasonal variation in
physicochemical characteristics of Agulu Lake, South Eastern Nigeria. International
Journal of Fisheries and Aquatic Studies, 9(2), 91–97.
5. Tamizhazhagan, V., & Pugazhendy, K. (2016). Physico-chemical parameters from the
Manappadaiyur and Swamimalai fresh water ponds. Indo American Journal of
Pharmaceutical Sciences, 3(5), 444–449.
6. Kavitha, R., & Elangovan, K. (2010). Review article on Ground water quality
characteristics at Erode district, (India). International Journal of Environmental Sciences,
1(2), 145–150.
7. Dixit, A. K., Pandey, S. K., Mehta, R., Ahmad, N. G., Pandey, J., et al. (2015). Study of
physico-chemical parameters of different pond water of Bilaspur District, Chhattishgarh,
India. Environmental Skeptics and Critics, 4(3), 89–95.

134
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
8. Kiran, B. R. (2010). Physico-chemical Characteristics of fish ponds of Bhadra project at
Karnataka. Rasayan Journal of Chemistry, 3(4), 671–676.
9. Ogueri, C. (2004). Physical and chemical parameters, fish Fauna and Fisheries of River
Katsina-Ala, Benue State, Nigeria (Ph.D. Thesis). University of Ibadan.
10. Romin, M., Azad, S., & Saleh, E. (2021). Variations in the Physicochemical Water
Parameters and Phytoplankton Community in Coastal Water of Kudat, Sabah, Malaysia.
Journal of Geoscience and Environment Protection, 9, 86–99.
11. Venkatesh, N., & Kiran, B. R. (2016). Assessment of heavy metals in sediments of fish
culture ponds at Bhadra fish farm, Karnataka. International Journal of Engineering
Research and Modern Education, I(II), 43–46.
12. Spellman, F. R., & Drinan, J. E. (2012). The Drinking Water Handbook (2nd ed.). Boca
Raton: CRC Press.
13. Dohare, D., Deshpande, S., & Kotiya, A. (2014). Analysis of Ground Water Quality
Parameters: A Review. Research Journal of Engineering Sciences, 3(5), 26–31.
14. Sajitha, V., & Vijayamma, S. (2016). Study of Physico-Chemical Parameters and Pond
Water Quality Assessment by using Water Quality Index at Athiyannoor Panchayath,
Kerala, India. Emergent Life Science Research, 2(1), 46–51.
15. American Public Health Association. (2005). Standards Methods for the Examination of
Water and Wastewater (21st ed.). Washington DC: American Public Health Association.
16. Muthukumaravel, K., et al. (2010). Evaluation of Ground Water Quality in Perambalur.
Indian Journal of Environmental Sciences, 14(1), 47–49.
17. American Public Health Association. (2012). Standards Methods for the Examination of
Water and Wastewater (22nd ed.). Washington DC: American Public Health Association.
18. Bashir, I., Lone, F. A., Bhat, R. A., Mir, S. A., Dar, Z. A., & Dar, S. A. (2020). Concerns
and Threats of Contamination on Aquatic Ecosystems. Bioremediation and Biotechnology,
27, 1–26. https://doi.org/10.1007/978-3-030-35691-0_1. PMCID: PMC7121614.

135
Bhumi Publishing, India

RECOMMENDATIONS OF BALANCED NUTRITION USING LOCAL FOOD

SOURCING FOR SANTHAL TRIBAL COMMUNITIES
Abhaya Dutta
Department of Physiology,
Vidyasagar College for Women, Kolkata, India Pin-700006
Corresponding author E-mail: [email protected]

Abstract:
In our dynamic world, essential elements are indispensable for survival, with proper
nutrition standing out as a fundamental necessity crucial for both physical and physiological
well-being. A balanced diet plays a pivotal role in preventing deficiency disorders arising from
insufficient intake of vital vitamins, minerals, and essential nutrients. Astonishingly, a substantial
portion of global regions lacks awareness regarding the fundamental dietary requirements for a
healthy life. Even in the 21st century, countries like India, undergoing developmental strides,
grapple with a significant scale of malnutrition, particularly prevalent in tribal areas. According
to the 2011 census, India was home to 104 million tribal individuals, constituting 8.6% of the
total population. Among these, the Santhals stand as the largest tribal community in India and
West Bengal. Malnutrition, especially on maternal bodies, poses a serious threat to the future of
the nation in these tribal regions. Consequently, it is imperative to raise awareness about the
health of maternal, neonatal, post-neonatal, weaning infants, and children among tribal
communities, educating them on proper nutrition for enhanced physiological well-being. This
article aims to delve into the nutritional status, deficiency diseases, and health indicators within
these communities. Additionally, it will explore essential indigenous food items, whether foraged
or cultivated in their small farms, emphasizing their nutritional composition. The promotion of
the cultivation of these indigenous foods not only improves the health of the tribal population but
also enhances their economic well-being.
Keywords: Santhal Tribal groups, Essential nutrients, Malnutrition, West Bengal, Indigenous
food
Introduction:
To survive in this world with a good health, every period of life requires variable amount
of nutritious food. This study aims to provide an appropriate knowledge about significant dietary
elements for tribal communities. Therefore, at first, we have to focus on the primary definition of
tribes. They are a class of common people who stay together in a geographical area mainly hill
and forest and their occupations are also same. According to article 342 of Indian constitution,
705 non identical tribal groups are located in different places, approximately 30 states and Union

136
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Territories of India. They all have their own traditional believes, cultural rules, life practices and
have lack of education, lack of nutrition and unorganised sanitation which effect their health
(Amit Sengupta, 2019).
In this article, we will discuss about a tribal group among all of these, Santhal. A major
reason to choose them is that they belong from different states of India in same type of
geographical land. Santhals are completely different in every feature of daily life and even the
climates of their habitats are slightly dissimilar from urban locality which change the type of
their availability of food. Due to the climate and the soil nature, some types of vitamins or
minerals rich foods are not easily available throughout the year in these areas which act on the
maternal heath in the gestation period and even after the parturition. In the absence of important
substances in body of lactating woman may affect the infant with nutritive disorders [Tulsi
Adhikari, 2020]. Sometimes these diseases are protein-energy related and sometimes they are
vitamin-mineral related (Stiller et al., 2020). It is fully depended on which type of food is
consumed by the mother or pregnant women. So, the availability of proper nutritious food
through local food sourcing for tribal communities is pivotal for their healthy life.
Idea about the tribal group: Santhal and their dietary practice
Santhal is one of the largest groups of tribal in India which is widely distributed in the
districts of Jharkhand, Odisha, Bihar, and West Bengal (list of notified scheduled tribes). They
normally communicate with each other through Santali language, yet with the time span,
Santhals are now acquiring languages of the populated areas, such as Oriya in Odisha, Hindi in
Bihar, Assamese in Assam, and Bengali in West Bengal. In Bengal, they have been mostly found
in the rural areas of Birbhum district and the population is 2,512,331 in all over the state (district
wise scheduled tribe population, West Bengal-2011). Santhals are either associated with
agriculture not more than one hector of area (Chandramouli, 2011) or both men and women work
as daily labourer in agriculture (Kartick Chandra Barman, 2014). Rice cultivation is the most
significant economic activity in the community and some of them are with a job in coal mines.
Hence, they survive on a very low income or are under poverty. In their own small kitchen
garden or backyard, they grow mostly indigenous varieties green leafy vegetables and other
vegetables which are integral component of daily dietary intake. Other than cultivation they are
engaged in foraging, hunting, livestock breeding to supplement their income as well as daily diet.
The most important aspect of their diet is the consumption of locally available, indigenous wild
foods comprised of culturally important wild plant foliage, fungi species, vegetables, fruits,
locally raised livestock, and small aquatic species. However, due to urbanization there is a shift
in food consumption to easily available packaged market food those have less nutrient content
than the indigenous variety. As a result, there is chronic energy deficiency, anemia and
malnutrition (Stiller et al., 2020a).

137
Bhumi Publishing, India

Figure:1 native of Santhal community in India [PC-Google]

Malnutrition among Santhal Tribes
The term ‘malnutrition’ has no universally accepted definition. It has been used to
describe a deficiency, excess or imbalance of a wide range of nutrients, resulting in a measurable
adverse effect on body composition, function and clinical outcome (Lia, 2000). Although
malnourished individuals can be under- or overnourished, ‘malnutrition’ is often used
synonymously with ‘undernutrition’, as in this article.
The prevalence of malnutrition in Indian tribes can be attributed to a complex interplay of
factors. Limited access to essential resources, including education, healthcare, and proper
sanitation, compounds the problem. Traditional livelihoods and subsistence practices, often
reliant on agriculture or forest-based activities, may not provide a consistently balanced and
nutritious diet. Additionally, issues such as displacement due to development projects and
changes in land use can disrupt their access to food sources.
Cultural factors also play a role, with certain tribes adhering to specific dietary practices
or facing challenges due to food taboos. Lack of awareness about proper nutrition and healthcare
exacerbates the problem, contributing to the cycle of malnutrition in these communities. In this
paper, we only consider the significance of nutrients. So now we will discuss about the present
scenario of malnutrition in pregnant and young mothers, infants (neonatal and post neonatal) and
children.

138
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Malnutrition in Santhal pregnant and young mothers
A uterine body goes through many switching stages on those particular trimesters.
Uncountable hormonal changes take place from 1st day to 280th day of gestation period (A.M.
Jukic, 2013). For handling these all course of actions, we stand in need of energy which is
obtained from foods. As a consequence, an organised meal for this period of time is highly
required. Malnutrition among Santhal tribal pregnant women and young mothers is a critical
concern that requires targeted interventions addressing various interconnected factors. The
Santhal tribe, like many other tribal communities, faces unique challenges that contribute to the
vulnerability of pregnant women and young mothers to malnutrition. Here are key factors
influencing this issue:
• Limited Healthcare Access: Santhal tribal communities often reside in remote areas with
limited access to quality healthcare facilities. This is been reported to result in inadequate
prenatal care, nutritional counselling, and maternal health services for pregnant women and
young mothers (Stiller et al., 2020a; Sengupta et al., 2020).
• Traditional Dietary Practices: Santhals have their own traditional dietary practices that
lack diversity and essential nutrients. Dependency on locally available foods and traditional
cooking methods does not provide the necessary nutrition to pregnant women and lactating
mothers which has been reflected in several scientific studies elsewhere (Ghosh-Jerath et al.,
2016).
• Economic Constraints: Economic challenges within Santhal communities may lead to food
insecurity, impacting the availability of nutritious foods. Poverty can limit access to a
balanced diet during pregnancy and breastfeeding, affecting both maternal and child health
(Adhikari et al., 2020; Stiller et al., 2020b).
• Lack of Maternal Nutrition Awareness: Limited education and awareness about proper
maternal nutrition practices contribute to malnutrition among pregnant Santhal women and
young mothers. This lack of knowledge can affect the health and development of both the
mother and the child (Stiller et al., 2020b).
• Cultural Factors: Cultural practices, including food taboos and traditional beliefs
surrounding pregnancy, can influence dietary choices and contribute to malnutrition among
Santhal pregnant women and young mothers.
Malnutrition in Santhal tribal infants and children
According to World Health Organisation (2011), breastfeeding is essential for the initial
six months following delivery to carry off the ideal growth and the development of physiological
body with emotional health. That means even after parturition, an infant who is in good health,
fully depended on their mother for nourishment up to first few moths from birth. This is based on
the fact that mother's milk is superior to all other types of animal milk. Breast milks including

139
Bhumi Publishing, India

colostrum, transitional milk and mature milk are fully packed by essential nutrients vitamins,
minerals, digestive enzymes, growth factors and immunoglobins, antibacterial agents for defence
in beginning of life.
Table 1: Essential nutrients of mother’s milk (Olivia Ballard, 2013)
1 Nutrients Lactose, lactalbumin, casein
2 Minerals Sodium, calcium, Potassium, iodine, iron
3 Vitamins A, B, D, K
4 Immunoglobulins IgA, IgA, IgM
5 Growth factors Growth factor β
After six months from parturition, little one starts to consume liquid foods from external
world which means that they become weaning infant. At that period, teeth begin to appear in the
buccal cavity. After a while they finally start eat solid foods and proper development of body go
ahead. In this stage to growth all the essential and semi essential organs, need proper organised
nutrients. The physiological body craves additional minerals and vitamins, which are essential
for the formation of bones. To overcome growth retardation in this initial stage of life,
appropriate nourishments are vital. Santhals, being one of the largest tribal communities in India,
face unique challenges that contribute to the prevalence of malnutrition among their youngest
members. Here are key factors:
• Traditional Dietary Practices: Santhals, like many tribal communities, may have
traditional dietary practices that might lack diversity and essential nutrients. Dependence on
specific locally available foods and traditional cooking methods can contribute to nutritional
gaps in the diet of infants and children (Singh et al., 2023).
• Economic Challenges: Economic constraints in Santhal communities may lead to food
insecurity, affecting the availability of nutritious foods. Poverty can limit access to a
balanced diet, impacting the growth and development of infants and children.
• Poor Maternal Nutrition: The nutritional status of mothers directly affects the health of
newborns. Studies have shown that tribal mothers who experience malnutrition during
pregnancy or lack awareness about proper nutrition, have contributed to low birth weight
and increased vulnerability to malnutrition in infants (Adhikari et al., 2020).
• Limited Education and Awareness: Low levels of education and awareness within Santhal
communities may contribute to a lack of knowledge about proper infant and child feeding
practices. This can result in inappropriate feeding patterns and nutritional deficiencies
(Stiller et al., 2020b).
• Anonymous about Family Planning: Most tribes are clueless about family planning
including the space between child births, unwanted pregnancies and genetic counselling. If a

140
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
mother conceives in the lactating period, then first child will be malnourished due to absence
of breast milk from that mother.
• Infectious Diseases: In rural areas, infectious diseases like malaria, dengue, typhoid are
very common. After recovery from these life-threatening diseases, a proper nutrition is
needed for leading the normal life again. Otherwise, insufficient nutrients cause malnutrition
even after recovery from infection diseases. (Narain JP, 2019)
Dietary requirements and importance of indigenous food for Santhals
A dietary requirement is the minimum quantity of a particular nutrient that an individual
needs to eat to sustain an adequate amount of nourishment (Food Safety and Standard Authority
of India, 2022). Dietary requirements are not constant throughout of life. Even it changes with
work status, gender, and period of life. Food Safety and Standard Authority of India, pays
alertness on the balancing of food quantity to improve human health. They have made tabulation
form of all the type of nutrients with their respective required quantity.
Studies have shown that despite of various availability constraints, people from the
indigenous community who are still consuming more indigenous food in their daily diet have
shown better nutritional status than others who are not consuming. A very little contribution of
indigenous food in their daily meal have shown less micronutrient deficiency in their diet
(Ghosh-Jerath et al., 2016, Singh et al., 2023).
Sources of nutrients from cultivation of Santhal tribes
In the beginning of this chapter, we have discussed that Santhal’s are mainly agricultural
labourer. Majority of their food comes from the agricultural land and from their own kitchen
garden. So following are the food items in brief with their nutritional contributions which are
grown in their farming land season wise. However, more will be the diversity in the food source
more will be the nutritional supplementation. It has been observed that less diversity in food
items in their meal plate have shown more nutrient deficiency in their diet.
Table 2: Dietary sources for Santhal households from farming land and locally raised
livestalk (Singh et al., 2023; Kapoor et al., 2022)
Essential nutrients
1. Macronutrients
I. Protein • Pulses (Urad dal, Arhar dal)
• Meat (chicken, goat)
• Milk (cow, goat)
II. Carbohydrate • Potato, Rice, Sugarcane, Wheat
II. Fat • Oilseed (Mustard oil)

141
Bhumi Publishing, India

2. Micronutrients
Vitamines Sources
A Liver oils, Mango, Papaya, Pumpkin, Milk, Khesari leaves, Mustard leaves
D Exposure to Sunlight
E Meat, Wheat germ oil
K Cabbage, Cauliflower, Tomatoes
B Oil seeds, Unpolished rice, Liver, Egg yolk, Cabbage
C Citrus fruits, Guava, Cabbage, Tomatoes

Minerals Sources
Calcium Milk, Cabbage
Sodium Common salt
Magnesium Cauliflower, Fruits
Iron Pulses, Milk, Organ meat (liver), Wheat
Iodine Drinking water, Banana

Own type food preparation and traditional foods

The idea about traditional foods comes with that, these ingredients exist locally from the
environment itself rather than being bought (Suparna Ghosh-Jerath, 2016). Other than cultivation
Santhals are highly dependent on foraged food from forests. Some of the important foraged food
and their nutritional benefits are briefly discussed here.
A. Red ant chutney (Chapra)
A chutney is prepared with red ants with their eggs very common masalas like garlic,
chilli, ginger and coriander leaves. This preparation is consumed by santhal and other tribal
communities as freshly prepared as well as preserved upto a year in glassware. This savoury food
item is rich in valuable proteins, calcium, zinc, vitamin B-12, iron, magnesium, potassium,
sodium, copper, fiber and 18 amino acids, is known to boost the immune system and keep
diseases at bay. The red ant chutney among the indigenous communities has been known to serve
medicinal purposes apart from being a delicacy. The red ants in a dish has the potential to
remedy myriad of illness. The dishes are given to people suffering from jaundice, common cold,
joint pain, cough and poor eyesight.
B. Wild Fungi
There are various types of wild mushrooms grows in different seasons in forest in huge
quantity. Come monsoon, and there is a flood of mushrooms in the jungle. Tribals relish wild
mushrooms a lot. They are aware of all the places where mushrooms can thrive-- be it loamy
soil, streams and creeks, dying trees, burn sites,under the soil, etc. For example, Baans khukhri

142
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
(bamboo mushroom) are edible wild mushrooms seen only near bamboo shoots. They grow in
plenty in the monsoon. They are considered the tastiest of the lot. Jamun khukhri (Indian
blackberry or Java plum mushroom), is an edible wild mushroom. The mushroom doesn't look
appealing to the eyes but ranks high in the tribal food list. They grow abundantly in monsoon and
is known to be a rich source of protein and found only in forest under the Jamun tree ( Syzygium
cumini). Rugra (puttu) is an indigenous mushroom of Jharkhand. They look like puffballs or
small camphor balls, rough-textured, with an outer shell with soft yolk black or white interior.
Rugra grows soon after the first showers of rain hit the thirsty soil followed by 3-4 days of
sunshine and humidity. They grow under the soil in the canopies of sal trees. They are collected
by tribal women, washed properly, and then cooked into curry. All these varieties of mushrooms
are nutritious meal that is low in calories as well as fat while high in minerals and fiber. They are
rich in potassium, selenium, and vitamin C (Kapoor et al., 2022)
C. Smal Aquatic Animals
Freshwater small aquatic animals like snails, crabs, fish and turtle are used as indigenous
food source for tribal communities in India. These aquatic animals are in high demand as they
are a cheap source of protein and provide food security, livelihoods and medicine. They are good
source of protein, iron, calcium and vitamin A. The communities across North east Indian states
believe consuming them enhances or helps maintain good eyesight and normal functioning of
kidneys and reduces joint pain. (Jadhaba et al., 2023; Kapoor et al., 2022)
D. Mahua
Some of the delicious dishes of Mahuwa popular in tribal community are Mahuwa
Laddu, Mahuwa Methi Roti, Mahuwa Halwa, Mahuwa Liquor etc. Mahua flower is prepared as
laddu with sesame seeds, peanuts and jagarry. It’s a very good source of iron and known as to
increase haemoglobin. Even now the tribal pregnant women use them as iron supplement. The
fruit of the Mahuwa tree is edible and highly nutritious, rich in protein, carbohydrates, and
minerals. It is a valuable source of food for many people in India, especially in tribal areas where
other food sources may be scarce. The honey produced from mahua flowers is known for its
distinct flavor and aroma and is considered to be a delicacy in some parts of India. The honey is
also used in traditional medicine and is believed to have various health benefits (Mishra and
Poonia, 2019).
E. Handia/haria
Handia, a rice-based fermented drink, is integral to the tribal lives. They consume handia
on every occasion. It is believed that, this rice fermented drink has medicinal and nutritional
benefits. The analysis of the nutrient composition of raw (before mixing water) handia shows
that raw handia has a high protein content, followed by carbohydrates, alcohol, glucose and fat
(Bisai et al., 2023).

143
Bhumi Publishing, India

F. Concept of thali in Santhal tribals

In a very recent study, it has been observed that two types of plates are present in the
Santhal areas. 1st one is Kanhu Thali for winter and 2nd one is Jhano Thali from the end of the
summer to monsoon (Armes et al., 2024) where both are having a sufficient nutritional value
with rice, flat beans, wild leafy vegetables, dried fish, wild mushroom curry, chicken egg curry,
and mango pickle, mahua flower, etc. However, this is been observed that in these thalis are
devoid of animal-based protein sources and dairy. It is worth to remember here that these are the
representative thalis of their food habitat, may not be their all-different habitual food items are
incorporated in these thalis.
Conclusion:
In order to combat malnutrition effectively, it is advisable to integrate a diverse range of
indigenous foods rather than relying solely on specific sources. This approach involves
incorporating strategies like encouraging the cultivation of native plants, raising indigenous
animals, and cultivating aquatic species within existing agricultural policies. Implementing
activities that boost indigenous food production through agricultural extension services is crucial.
Additionally, integrating indigenous foods into ongoing food security programs, such as the
targeted public distribution system, and supplementation initiatives like those under ICDS, is
essential. These efforts can be reinforced by behaviour change communication strategies,
including nutrition education programs. The aim is to promote the inclusion of indigenous foods
in the regular diets of the Santhal community in India.
References:
1. Narain, J. P. (2019). Health of tribal populations in India: How long can we afford to
neglect?. The Indian Journal of Medical Research, 149(3), 313–316.
https://doi.org/10.4103/ijmr.IJMR_2079_18
2. Sengupta, A., Sahoo, M., Khan, A., Shaikh, R., & Khan, R. (2020). Maternal Health Status
in Tribal India: A 5-Year Intervention Program and its Outcome. Indian Journal of
Community Medicine: Official Publication of Indian Association of Preventive & Social
Medicine, 45(2), 189–193. https://doi.org/10.4103/ijcm.IJCM_158_19
3. Adhikari, T., Yadav, J., Tripathi, N., Tolani, H., Kaur, H., & Rao, M. (2021). Do tribal
children experience elevated risk of poor nutritional status in India? A multilevel analysis.
Journal of Biosocial Science, 53(5), 683–708. https://doi.org/10.1017/S0021932020000474
4. Stiller, C. K., Golembiewski, S. K. E., Golembiewski, M., Mondal, S., Biesalski, H. K., &
Scherbaum, V. (2020). Prevalence of Undernutrition and Anemia among Santal Adivasi
Children, Birbhum District, West Bengal, India. International Journal of Environmental
Research and Public Health, 17(1), 342.

144
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
5. Stiller, C. K., Golembiewski, S., Golembiewski, M., Mondal, S., Biesalski, H. K., &
Scherbaum, V. (2020). Maternal nutritional status and child feeding practices: A
retrospective study in Santal communities, Birbhum District, West Bengal, India.
International Breastfeeding Journal, 15(1), 50. https://doi.org/10.1186/s13006-020-00262-
3
6. Chandramouli, C.; General, R. (2011). Census of India 2011. Provisional Population
Totals; Government of India: New Delhi, India, pp. 409–413.
7. Barman, K. (2014). Socio-Economic Profile of Tribal Populations in Birbhum District of
West Bengal. Central India Journal of Historical Archaeological Research, 3, 187–192.
8. Jukic, A. M., Baird, D. D., Weinberg, C. R., McConnaughey, D. R., & Wilcox, A. J.
(2013). Length of human pregnancy and contributors to its natural variation. Human
Reproduction (Oxford, England), 28(10), 2848–2855.
https://doi.org/10.1093/humrep/det297
9. Ballard, O., & Morrow, A. L. (2013). Human milk composition: Nutrients and bioactive
factors. Pediatric Clinics of North America, 60(1), 49–74.
https://doi.org/10.1016/j.pcl.2012.10.002
10. World Health Organisation. (2011, January 15). Exclusive breastfeeding for six months
best for babies everywhere.
11. Ghosh-Jerath, S., Singh, A., Magsumbol, M. S., Lyngdoh, T., Kamboj, P., & Goldberg, G.
(2016). Contribution of indigenous foods towards nutrient intakes and nutritional status of
women in the Santhal tribal community of Jharkhand, India. Public Health Nutrition,
19(12), 2256–2267. https://doi.org/10.1017/S1368980016000318
12. Kiani, A. K., Dhuli, K., Donato, K., Aquilanti, B., Velluti, V., Matera, G., Iaconelli, A.,
Connelly, S. T., Bellinato, F., Gisondi, P., & Bertelli, M. (2022). Main nutritional
deficiencies. Journal of Preventive Medicine and Hygiene, 63(2 Suppl 3), E93–E101.
https://doi.org/10.15167/2421-4248/jpmh2022.63.2S3.2752
13. Food Safety and Standard Authority of India. (2022, February 3). Retrieved from
https://fssai.gov.in/upload/advisories/2022/03/62414c50d2342Direction_RDA_03_02_202
2.pdf
14. Armes, S., Bhanjdeo, A., Chakraborty, D., Kaur, H., Ray, S., & Rao, N. (2024). Aligning
Santal Tribe Menu Templates with EAT-Lancet Commission's Dietary Guidelines for
Sustainable and Healthy Diets: A Comparative Analysis. Nutrients, 16(3), 447.
https://doi.org/10.3390/nu16030447
15. Mishra, A., Poonia, A. (2019). Mahua (Madhucaindica): A boon for tribal economy. Indian
Food Industry Magazine, 38(1), Jan-Feb.

145
Bhumi Publishing, India

16. Bisai, S., Dutta, S., & Das Mohapatra, P. K. (2023). Traditional food consumption pattern
and nutritional status of Oraons: An Asian Indian indigenous community. Frontiers in
Sustainable Food Systems, 7, 969264. https://doi.org/10.3389/fsufs.2023.969264
17. BAPEN. (2000). Guidelines for detection and management of malnutrition. Malnutrition
Advisory Group, Standing Committee of BAPEN. Maidenhead: BAPEN.
18. Jadhava, A., Das, N. K., Sila, M., & Aravinda, N. A. (2023). Snails on the plate: Edible
freshwater molluscs of Northeast India. Indian Journal of Traditional Knowledge, 22(2),
April, 409–419. https://doi.org/10.56042/ijtk.v22i2.55225
19. Kapoor, R., Sabharwal, M., & Ghosh-Jerath, S. (2022). Indigenous Foods of India: A
Comprehensive Narrative Review of Nutritive Values, Antinutrient Content and Mineral
Bioavailability of Traditional Foods Consumed by Indigenous Communities of India.
Frontiers in Sustainable Food Systems, 6, 696228.
https://doi.org/10.3389/fsufs.2022.696228
20. Singh, A., Dhasmana, A., Bandhu, A., Kapoor, R., Baalasubramanian, S., & Ghosh Jerath,
S. (2023). Contribution of natural food environments to nutritional intake and biomarker
status: Insights from the women of indigenous Santhal communities of Jharkhand, India.
BMC Nutrition, 9(20). https://doi.org/10.1186/s40795-023-00669-1

146
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

SENSITIZATION OF SCHOOL STUDENTS FOR SCHOOL GARDEN AND

SUSTAINABLE -UTILIZATION
Sima Biswas
Department of Botany,
Vidyasagar College for Women, 39, Sankar Ghosh Lane, Kolkata – 06
Corresponding author E-mail: [email protected]

Abstract:
Raising awareness or to sensitize students about school garden is the key to progress the
school education. Over the period the school garden has been promoted as an important
nurturing site for school children. India may be the second largest producer of food but it has its
second largest undernourished population. An unbalanced diet and lack of food is directly linked
to the high rates of stunting, gaining excessive weight and death in children under five years of
age. Govt. of India has implemented programmes for providing food security but to combat with
the malnutrition and to geta healthy environment along with healthy life school gardening is
important. Gardens engage students by providing environments where they can observe,
discover, learn through experiment.
Gardens are the living laboratories which will provide the knowledge of sustainability
and the concept of ecofriendly utilization beyond the garden also. So the sensitization
programme is vital since the neighbouring places are also dependent on the institution to have
light and hope for their lives directly or indirectly through their children.
Keywords: Sensitization, Sustainability, School children, Gardening, Ecofriendly
Introduction:
The students of School are the future citizens of our country. Development of values
from the school level will help them to build their character and personality to serve the nation.
School garden which gives the opportunity to learn in nature will help the student for all round
development. The school garden directly connects the students to plants, soil and gives the
opportunities for hands on training, environment of experimental learning. Youth become aware
of healthy food. It is the living laboratory. Students acquire knowledge about flower, fruit, and
vegetables. Gardening will also develop their responsibility and skill, like problem solving
capacity and critical thinking ability (Driscoll et al., 2016).
Lack of proper nutrition and balanced diet can lead to the death of children. To combat
this problem a nutrition garden which is a part of school garden can play important role (Suri,
2020).

147
Bhumi Publishing, India

Students can record the observations of plant growth, collect data, analyse the data. With
all of these record they can maintain a science journal. Besides knowledge gaining and
experimentation, students do the physical activity in gardening which will build their body. They
can burn the calories through the gardening. This school garden will help the students to develop
knowledge about ecology and environment (Diclaudio et al., n.d.).
Young adults are interested and curious to learn the nature but for rapid urbanisation
students get less chance to build bond with nature. So this is the need to give opportunities to the
students to learn aboutenvironment (Kwasi, n.d).
Research on physical activity and curriculum development of an ‘after school gardening
programme’ were done where A Curriculum of theory based after school gardening club were
produced to increase the healthy behaviors with the help of accelerometer study. It showed that
garden can be a valuable tool for the physical activity in youth. The target group was to develop
Curriculum on theory based after school garden. (Domenghini & Cynthia, 2004).
Here all the research showed the effect and impact of school garden except the last one
which mentioned about Curriculum development after school gardening. But to develop a proper
mindset for Gardening, sensitization, sustainable utilization and gaining theoretical knowledge
before building up a school garden is very much important, which was not found in these
literatures. Here the problem of “Sensitizing Students for School Garden” arises.
Objectives:
1. To aware school children about biodiversity, conservation, the sustainable use of
biodiversityand Indigenous plant.
2. To develop a mind set about gardening and to grow knowledge about indigenous
plant,medicinal plant, healthy food and theories of gardening.
3. To involve students in hands on experimental activities through gardening and applying
this practical knowledge in the study of other science subject.
4. To develop values and, critical thinking ability skill.
5. To make them understand the role of plants, in our life and in the existence of earth.
6. To give the students a green breathable space and eco-friendly environment
7. To bring all the stakeholders of the school and to bring other participant under one umbrella
to develop social connection.
8. Building community support for the long term garden sustainability.
9. To inspire students from school gardening to make kitchen garden at home
10. Providing the knowledge of holistic health care both in traditional and modern system of
medicine through herbal garden

148
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Methodology:
Target group for this activity should be the 7th to 12th standard students of School. Ten
schools could be selected, out of which 5 will be of rural area and 5 will be of urban area. The
programme will run for two years for direct sensitization and follow up.
The sensitization programme will include the following steps:
1. Selection of School: Consultation with School education department and School
Administration (Head master/head Mistress or Principal) and Signing a MoU with School.
2. To hire Farmer and Nursery worker as wells as getting information about Nursery and
cultivated land consultation with Gram Panchayat in Rural area and Municipality in urban
area will be done.
3. After consultation with School Principal the dates to be decided for 3 days’ workshop in
eachschool.
4. A list of members of School garden including students, parents, community members,
Farmers (2 from each area) and two skilled members from nursery is to be made. Pre - test
willbe taken for selection of students to make the group of 18 students. Parents of each
studen will also be invited on the 1st Day of workshop.
5. When a group of students will be selected then the 3 days Sensitization Program will begin
with another test to know their knowledge on environment, biodiversity, healthy food,
balanced food, vitamins, and sustainable utilization.
The details of 3 Days Sensitization Programme are given below.
Day 1:
• Team selection on the basis of pre – test.
Orientation Programme with another Test or survey and lecture in an interactive way on
environment, Biodiversity and conservation, changes in environment due to pandemic situation,
food and nutrition and health, soil types and preparation of soil, sustainable development,
community development, Green campus, importance of plants in our life , experience sharing of
students on home gardening
Day 2:
• Field visit: Visit to nursery or cultivated land to see the plants, to know and identify some
indigenous plant, medicinal plant and few other vegetables and fruits. In case of urban area same
will be done from nursery, and a visit to any national park or visit to “vegetable and flower
show” could be done in the winter and autumn.
Interaction with the concerned person for theoretical knowledge about those plants and
plantation process and bringing some plants to school for plantation purpose.
Day 3:
Hands on training on making soil, preparation of garden and planting (with the help of farmer/

149
Bhumi Publishing, India

nursery worker) and proper bed sizing for garden and how to maintain and conserve.
Follow up:
After each workshop a survey with post-test will be taken and the students will be
given the work for a project and they will be asked to write the report and submit it after every 6
months. The final report submission of students about the observation of plant growth, how
many plants have survived ,how they prepared soil, what type of manure was used, how they
maintained the garden, which types of vegetables, fruits , medicinal and indigenous plant they
have planted and were the vegetables and fruits consumed by them, if so how they felt ,which
type of physical activity they have done, their health information, their life style changes and the
body weight before the start of gardening and at the time of submission which will be after 18
month . A survey after 18 months will also be done to know the progress and the critical thinking
ability of the students and to analyse the overall outcome. Then in last three months the Report of
the whole Programme will be prepared after data analysis.
According to the study published in PubMed central by Timothy et.al.(mar 2023)
➢ School children will be able to design the garden which will further help them to be enriched
with exchanged cultural activities, languages and will help in solving mathematics, health
and physical educations, science and technology, art, design, enhancing writing skills.
➢ Students will enjoy the kitchen and garden experiences.
➢ Develop leadership, decision making, model building, sustainable behavioral change
➢ Students will be aware about health and nutrition from the garden and will be able to
understand better about food groups.
➢ Will be encouraged to publish newsletter about food and vegetable intake by family.
Opportunity to investigate and compare the basic physical characters of the plants, what
hinders their growth, their response to stimuli and environment throughout the season as well
as garden will built enthusiasm about eating fresh and locally grown fruits and vegetables.
Reconnects with nature and ecology and environment. Danelle Di Claudio et.al.(2013)
➢ Students will achieve the knowledge about the ecosystem, pollinators, nutrition and utilize
the experience for further study and gardening. Driscoll, et.al.(2016)
Case study from Zimbabwe by Shoba Suri (June 2010) reveals
➢ Nutrition gardens have a positive impact on livelihood as they provide steady income and
curb diet related disease.
➢ Kitchen gardens as a promising opportunity to grow fruits and vegetables high in
micronutrients and to address food security and malnutrition issues (study from rural
Tanzania)

150
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Conclusion:
Learning is most effective when the subject matter is immediate and familiar to the
learner and presented in a way that takes into account the varied learning styles and even abilities
of the student population found in today’ classroom. The Govt. of India launched the National
Nutrition Mission to ensure attainment of a malnutrition free India by 2022. The national Rural
Livelihood Mission is promoting kitchen gardens as part of farm livelihood intervention strategy
for national Nutrition mission. School garden which would inspire to kitchen garden creates an
accessible environment to investigate science, maths, reading, writing and other creativity. A
garden builds a community within a school and its surroundings, creating relationships and that
last a lifetime.
References:
1. DiClaudio Denelle et al. (2013). Learning Through the Garden, Rutgers, The state
University of New Jersy
2. Driscoll Liz et al. (2016). Teaching from the Garden: Creating Transformative Learning
landscapes at Schools, N C State university
3. Dierickx S (2018). Community sensitization and decision making for trial participation
NMPB Scheme for medicinal plants
4. School Gardens: Growing Ideal Children and Future Adults, Springer International
Handbooks of education
5. Holloway P. Timothy, et al. (2023). PMID 36904189, School Gardening and Health and
well-Being ofSchool-aged Children: A Realist synthesis
6. Rozer Emily J (2008). Health Education and Behavior 34(6):846-63. The Effects of School
Gardens on Students and Schools
7. Suri Shoba (June 2020), ORF ISSUE BRIEF, Issue No. 369. Nutrition Gardens: A
sustainable model for Food Security and Diversity
8. Brown Richard and Kathy (2005). Annuals, Bulbs and Perennials, Anness
Publishing Ltd

151
Bhumi Publishing, India

ASIAN SOYBEAN RUST: AN UPCOMING THREAT TO SOYBEAN

CULTIVATION
Disha Dasgupta1,2, Anuron Banerjee1, Arijita Majumder1,
Anamika Paul1, Nilanjan Chakraborty*1
1Department of Botany, Scottish Church College, Kolkata 700006, India
2Department of Botany, Vidyasagar College for Women, Kolkata 700006, India
*Corresponding author E-mail: [email protected]

Abstract:
Annual economic losses resulting from Asian soybean rust, which is caused by the fungal
pathogen Phakopsora pachyrhizi, are substantial and pose a significant threat to soybean
cultivation worldwide. Due to the devastation caused by this disease, which notably impacts
significant soybean-producing nations such as India, it was formerly classified as a form of
bioterrorism. Phakopsora pachyrhizi, an obligate biotrophic pathogen, infects a wide variety of
hosts, including 31 species of legume plants, and concludes its asexual life cycle via uredospore
production. Particulate lesions ranging in colour from dark brown to shady brown, situated on
the ventral surfaces of leaflets, are indicative of the disease, which is predominantly transmitted
via wind. Currently, fungicide application is the most effective method of soybean rust control;
DMI, SDHI, and QoI are prevalent options. Six resistance genes (R genes) have been identified
in diverse soybean cultivars; these genes confer resistance to P. pachyrhizi. In addition,
resistance-building potential is demonstrated by non-host plants, transgenic soybeans, and
genetic engineering. RNA interference and biological control methods that employ beneficial
microorganisms provide sustainable protection against Asian soybean rust. In order to mitigate
the detrimental effects of Asian soybean rust on soybean cultivation, this article emphasizes the
need for effective control measures. It details disease progression, infection occurrences, and
control strategies.
Keywords: Demethylation Inhibitor, Phytoalexins, Resistance Gene, Rpp, Uredospores
Introduction:
Rapid increase in the world population is a severe threat for various food producing
industries including agricultural sectors. Providing sufficient food to all the individuals is an
important challenge which has been faced for a long time. Though advancement in the modern
agricultural system able to provide considerable food security but still various biotic and abiotic
stresses in the crop field is always been a severe problem that leads to huge economic loss. Rapid
climate change introduces various abiotic stresses which causes significant yield loss. Beside
this, attack of different plant pathogens and pests is also an important issue. One of such recent

152
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
instances is the occurrence of Asian soybean rust caused by the fungal pathogen Phakopsora
pachyrhizi. It is a major disease of soybean crop field that results in huge economic loss every
year worldwide. Globally soybean (Glycine max) is recognized as an economically important
crop, since it is a rich source of both protein (about 40%) and vegetable oil (about 20%). Thus
soybean is also called as “two in one crop” (Chander et al., 2019). The dietary fiber and
isoflavones present in soybean help to protect several chronic diseases including diabetes,
obesity, heart diseases and cancer (Asif et al., 2013). Soybean has a great adaptability to
different latitudes, climatic and soil conditions which enabled them to become fourth most
widely grown crop across the globe after wheat, maize and rice. But one of the major problems is
the presence of biotic stresses. The severity of Asian soybean rust is so explosive for the soybean
crop fields that this disease was previously considered as the bioterrorism (Balardin et al., 2006).
The pathogen P. pachyrhizi can spread through the wind over a long distance and the
consequences are so dangerous that it is now one of the most feared diseases of soybean field
(Rosa et al., 2015).
At present, three strategies have been followed widely to check the disease progression
which incorporates use of different chemical fungicide, production of genetic engineered
resistant soybean plant and specific cultivation techniques (Kendrick et al., 2011). Chemical
control using chemical fungicide belongs from the class Demethylation inhibitors (DMI) and
Quinone outside inhibitors (QoI) is found to be most effective against P. pachyrhizi (Guicherit et
al., 2014). Beside this biological control using beneficial microbes and other biological
organisms like fungi and essential oils from different plants have been also tested in vitro and
exhibited promising results (Langenbach et al., 2016). Genome analysis of soybean plant
revealed the presence of six resistance gene which referred as Rpp 1-6. Further studies have
shown that there are three genes present namely GmEDS1, GmPAD4, and GmNPR1which
directly involved in the mechanism of Rpp 2 mediated resistance in soybean plant (Pandey et al.,
2011). In order to draw resistance scientists have proposed another approach that is the
application of recessive R genes. Three recessive R genes to P. pachyrhizi have been isolated and
help to draw resistance in soybean plants (Langenbach et al., 2016). Elimination of susceptibility
gene (S) is another approach to draw resistance against P. pachyrhizi (Uppalapati et al., 2012).
Another effective molecular control can be made through the application of RNAi mediated gene
silencing (Koch and Kogel 2014). Beside this, different biotechnological methods are also
investigated like R gene pyramiding, introduction of engineered R gene, use of non-host plant,
application of antimicrobial peptides and production of secondary metabolites which found to be
effective against the Asian soybean rust (Tremblay et al., 2009; Langenbach et al., 2016).
To overcome the threat of the rust and to minimize the accruing yield loss it is become
very important to know more about the disease and its eco-friendly integrated management. In

153
Bhumi Publishing, India

the present review an attempt has been made to compile and synthesize the important
information on geographical distribution, yield losses, casual organism, disease cycle, host range,
disease management, rust resistant gene and biological control, chemical control and to reveal
the gaps in knowledge on various aspects of this serious disease of soybean by the pathogen P.
pachyrhizi.
Geographical footprints of the soybean rust pathogen
The rust disease was first recorded in Japan in the year 1902 by Nakanishiki who
identified the fungus as Uredo sojae (Bromfield et al., 1980). Later, Hennings (1903) confirmed
the fungus as Uredo sojae on leaves of wild grown soybean G. soja when it was collected from
Tosca Province of Japan by Yoshinaga (Sharma and Gupta 2006). By 1934 the pathogen had
been found in several Asian countries and as far south as Australia (Bromfield and Hartwig
1980). In the second half of the 20th century, the footprints of P. pachyrhiziappeared to be
moving into several soybean growing countries in Africa. In 1996 the soybean rust spread in
Uganda and Kenya. From these countries, the disease possibly expanded southwards to Rwanda,
Zambia, and Zimbabwe in 1998 (Pretorius et al., 2001; Levy 2005).
In India, the appearance of soybean rust was first reported on in 1951 (Sharma and Mehta
1996). The first authentic report of soybean rust in India was available from Pantnagar in 1970
(Sarbhoy et al., 1972). Later, rust was also found in low hills of UP and Kalyani in West Bengal.
Till 1974 the rust remained restricted in and around Pantnagar and subsequently disappeared
from India. However, in 1980, after a lapse of almost 5 years the rust resurrected in high altitude
areas of Meghalaya and later reports came from the plains of Assam in North east regions of
India (Maiti et al., 1981). Till 1993, the rust remained confined to this region and afterwards it
spread to other soybean production areas of India (Sharma and Gupta 2006). In the following
Figure 1 the worldwide occurrence of Asian soybean rust has been presented.

Figure 1: Distribution of Asian soybean rust and the year it was first reported for each
location
154
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
The pathogen life wheel and infection process
Uredospores can be dispersed by wind and deposited on the host leaf surface which
begins to germinate followed by the initiation of infection. Infection process takes place in the
presence of water and an optimum temperature of 21°C to 25°C.Approximately eight days after
the infection fungus begins reproduction that leads to hyphal aggregation forming the uredosorus
primordium. Uredospores start producing in about three to four days after the formation of
uredosorus primordium (Rosa et al., 2015).
After germination of the uredospore on the leaf surface of the host plant the infection
process begins. The growth of the germ tube is terminated by the formation of appressorium.
Appressorium is a specialized, globose infection structure which is separated from the germ tube
by the formation of a septum. The asexual cycle has been summarized in the Figure 2.

Figure 2: Life cycle of P. pachyrhizi. app; appressorium, sp; spores,

hmc; haustorial mother cell, hau; haustoria
The fungus P. pachyrhizi penetrates into the host epidermal cells within the appressorium
by building of an internal structure called the appressorial cone (Figure 3) which then elongates
into the penetration peg (Bromfield and Hartwig 1980). The penetration of the parasite directly
through the cuticle and epidermal cell wall of the host is a special characteristic feature of Asian

155
Bhumi Publishing, India

soybean rust that helps to differentiates P. pachyrhizi from other rust fungi. In contrast to P.
pachyrhizi, majority of other rust fungi exhibited stomatal penetration (Rosa et al., 2015;
Chander et al., 2019).

Figure 3: Initial interaction of P. pachyrhizi with host plant. Sp; spore, gt; germ tube, app;
appressorium, penh; penetration hypha, ph; primary hypha, sh; secondary hypha, hmc;
haustorial mother cell

Figure 4: Different series of events that takes place during the infection
The infection process of P. pachyrhizi includes a sequence of events (Figure 4). The
epidermal cells of the host plant undergo cell death after penetration by P. pachyrhizi, it is a very
uncommon feature among biotrophic pathogens particularly in rust diseases (Keogh et al., 1980;
Hartman et al., 2011). However, the cell death event does not affect the growth of the penetration
hyphae, growth of the hyphae goes on and they branched after they reached the mesophyll tissue
and differentiating into haustorial mother cells (Koch et al., 1983). The haustorial mother cell
gives rise to formation of a specialized infection structure called haustoria which is an essential

156
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
feeding organ of the pathogen. All obligate biotrophic fungal plant pathogens produce haustoria,
it is a very common feature among them and failure of which is a knock-out criterion for
infection (Goellner et al., 2010). The fungal mycelium intensively colonizes the host tissue after
the haustoria successfully established and then the production of new uredospores completes the
pathogens life cycle (Koch et al., 1983).
Disease epidemiology
Asian soybean rust favors the environments that are humid and warm. The spores of the
pathogen can be able to germinate on the leaf of the host plant only after a continuous period of
wetness, this situation will aid the growth of this disease. Temperature, rainfall and leaf wetness
are some of the main factors which determines the severity of the disease (Tschanz et al., 1982).
Rust epidemics are most severe when the average daily temperature is less than 28°C and
presence of an extended period of leaf wetness with relative humidity of 75-80% (Hartman et al.,
1999). Dry conditions, excessive precipitation or daily mean temperatures greater than 30°C or
less than 15°C inhibit rust development (Bromfield et al., 1980). Moisture on plant surfaces is
crucial for germination to occur. Hence areas where prolonged periods of leaf wetness due to
dew, mist and light rain occurs provide optimum conditions for germination (Goellner et al.,
2010). Temperatures above 27°C for extended periods retard rust development even with
adequate free moisture on the leaf surface (Hartman et al., 2005). Soybean rust develops more
rapidly in the areas where rainfall occurs more evenly throughout the season, as compared to the
areas where rainfall occurs in an uneven pattern. Hence rust development varies according to
prevailing rainfall patterns.
The uredospores are the primary inoculum of soybean rust. These are asexual, small,
lightweight spores, which are released from uredosorus when the infected leaf surface gets dry.
They can be able to spread from one field to another through the air current. The uredospores
deposited on the leaf surface, infects the host plant and starts germinating in the presence of
21°C to 25°C temperature (Miles et al., 2003). The direct penetration is a characteristic of the P.
pachyrhizi fungus that differentiates it from other rust causing fungi (Rosa et al., 2015).
Control measures
To control soybean rust different strategies has been incorporated by different
researchers. In the following context some of the potential disease management techniques have
been discussed.
Chemical Controls
The importance and application of fungicides in crop the field has increased significantly
as their efficacy of protection has evolved drastically. In the present time the application of
fungicides is the most effective means of control of soybean rust. During 1960s the first report of
chemical control of soybean rust was recorded. Based on the effectiveness of lime-sulphur,

157
Bhumi Publishing, India

Bordeaux mixture, mercurials and zineb that are initially tested on soybean plant in Japan,
scientists have showed their interest in development of fungicides to control soybean rust
(Bromfield and Hartwig 1980). The most commonly used fungicides are belonged from the
group triazoles, carboxamide and strobulirins.
Protective fungicides are used before the pathogen attack that ensures protective barriers
against the fungal pathogens by inhibiting spore germination. Recently due to the problem of the
efficacy of two most commonly used fungicide DMI and QoI, copper based multisite fungicide
like dithiocarbamate and chloronitriles with combination of systemic chemicals has been tested
to obtain resistance (Miles et al., 2007). The group sterol biosynthesis inhibitor includes three
groups of fungicides viz amines, DMI and hydroxyanilides. These compounds are so much
versatile and used in various crops including soybean. Triazole is another group of fungicides
with potential eradicative property and long residual effects. Triazoles such as frutriafol and
tebuconazole are extensively used in the management of Asian soybean rust which gives
significant resistance against P. pachyrhizi. There are some triazole fungicides which are
commercially registered for Asian soybean rust including cyproconazole, epoxyconazole,
fluquinconazole, tetraconazole, metconazole and flutriafol (Langenbach et al., 2016).
Strobilurins is also used in the rust disease management program. Strobilurins in combination
with triazole exhibited significant resistance against the rust fungi in soybean. In the following
Table 1 some of the commercially available fungicides are listed which are used to control P.
pachyrhizi.
Table 1: Some of the major fungicides with their trade name and active ingredients used to
control Asian soybean rust (After Yorinori et al., 2005).
Sl. No. Active constituents Trade name Dose of usage (ml/ha)
1. Triforine Funginex® 1500
2. Cyproconazole Alto® 300
3. Flutriafol Impact® 800
4. Tebuconazole Folicur® 1000
5. Triademenol Shavit® 500
6. Carbendazim Punch Xtra® 350
7. Propiconazole Tilt® 500
8. Difenoconazole Score® 300

Biological controls
Protection against Asian soybean rust using beneficial microbes and other biological
organism has been obtained. The bio control of soybean rust not yet clearly found through

158
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
studies, but some macro parasites such as Trichothecium rosae and Simplicillium lanosoniveum
seem to be potential biocontrol agents. These organisms colonize in the uredosori of P.
pachyrhizion the infected leaves which eventually reduce both sporulation and disease severity
(Kumar et al., 2002; Ward et al., 2012). It was also found that T. rosae mediate the lysis of the
growing uredospores by causing shrinkage and hypertrophy. In addition to this some of the
Bacillus species were also found to be effective against P. pachyrhizi. The bacterium Bacillus is
used as an active constituent of the commercially available fungicides named as Ballad® which
is a potential protective agent in soybean rust disease management. A soilborne bacterium,
Xanthomonas parasitica that are spread by rain splash, parasitizes uredia of various cereal rust
fungi and causes uredospore lysis (Pon et al., 1954). Beside these antagonistic microbes, it has
been demonstrated that farnesyl acetate, a naturally occurring plant volatile emitted by rust
infected plants, negatively affects haustorial development. Thus, this compound might be used to
control soybean rust in an environmentally compatible manner (Mendgen et al., 2006). These are
the some evidences of biological control of soybean rust. However, more studies and trials are
needed to obtain resistance through biological control.
Secondary metabolites
Accumulation of secondary metabolites in response to invading pathogens attacks is a
very common defense mechanism of plants. In most of the cases these metabolites are cell wall
degrading agents and antimicrobial chemicals which draw a barrier against an infection.
Secondary metabolite plays an important role in the interaction of P. pachyrhizi and soybean
plant during the disease progression. It was reported that during the infection events
isoflavonoids compounds like genistein, glyceollin and daidzein is accumulated which affects the
spore germination and reduces disease severity in both resistant and susceptible soybean plants
(Lygin et al., 2009). The role of phytoalexins is also observed in providing resistance against
soybean rust. In Glycine tomentella an alternative host of P. pachyrhizi, accumulates an
isoflavonoid upon infection which inhibits uredospore germination (Chung and singh 2008).
Accumulation of medicarpin in Medicago truncatula a non-host plant of P. pachyrhizi supported
the potential ability of phytoalexins in defeating the rust. It was reported that medicarpin
negatively regulate the infection events by blocking the uredospore germination (Ishiga et al.,
2015). The molecular investigation on this chemical pathway could identify the specific genes
which can be used to construct resistant transgenic soybean plants. Moreover these metabolites
can be used as natural fungicides that could provide resistance in susceptible hosts. The
importance of phenylpropanoid pathway in disease resistance has been studied by gene silencing.
When the phenylalanine ammonia lyase enzyme gene gets silenced the Rpp-2 mediated
resistance in infected plants was compromised (Pandey et al., 2011). Beside this, antimicrobial
peptides can also provide resistance against soybean rust. However the efficacy of these peptides

159
Bhumi Publishing, India

is not well studied. Intragenic antimicrobial peptides from the other organisms can be used to
construct transgenic plant. For instance penetratin and dermaseptin SI are two IAP which
provides soybean rust resistance by inhibiting uredospore germination (Brand et al., 2012).
Non-host resistance
Incorporation of non-host plant is another promising approach of soybean rust resistance.
Application of non-host plant is an effective technique to identify the resistance trait. Use of
these plants enables the utilization of vast genetic resources. It is a complex type of resistance
strategies which shares defense mechanism with the host plant. It is very difficult to distinguish
host and non-host plant since there is many intermediate resistance (Bettgenhaeuser et al., 2014).
Genetic analysis of these resistance traits in soybean plant may provide alternative resistance
beside chemical fungicides and biological control. In terms of non-host resistance Arabidopsis
thaliana and M. truncatula are best described non host plant. However the initial stage of
development of P. pachyrhizi in both, A. thaliana and soybean are similar. Although there is no
report of hyphal proliferation in leaf mesophyll cells of A. thaliana. To encounter the preinvasion
resistance in Arabidopsis penetration mutants were used. Three mutant pen1, pen2 and pen3
were prepared and it was observed that hyphal proliferation occurred in these mutants. However
despite of hyphal proliferation in mesophyll tissue fungus did not complete its life cycle and
failed to colonize. This indicates the preinvasion resistance in this plant. The post invasion
resistance was also encountered in this plant with triple mutant pen2, pad4, sag101. This study
reveals that interspecies transfer of these genes can induce resistance against P. pachyrhizi
(Langenbach et al., 2013).
Phakopsora pachyrhizi can infect various plants but its occurrence in non-host plant is
very rare. Medicago truncatula is the only legume non host plant in which sporulation does not
occurs. The mutants in this plant were identified by forward genetic screening as the plant
contains diploid genome. The mutant M. truncatula exhibited altered resistance to P. pachyrhizi.
Genetic screening identified a irg 1 (inhibitor of rust germ tube differentiation) mutant which
inhibits the formation of pre-infection structure in this plant (Uppalapati et al., 2012). Moreover,
the interaction between P. pachyrhizi and M. truncatula induces several genes which are
associated with isoflavonoids, phenylpropanoid and flavonoid pathway. These groups of
chemicals block the uredospore formation which eventually slows down disease progression
(Ishiga et al., 2015). In addition to this the role of phytoalexins in rust resistance is also explored.
These genes provide resistance in soybean plants against P. pachyrhizi.
Resistance genes
It is very interesting that pathogens exhibit different levels of virulence and
aggressiveness in different hosts. These host specific physiologic specializations are known as
pathotypes or pathogenic races (Chander et al., 2019). To overcome the virulence of these

160
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
pathogens superior genetic resources are needed to achieve a long durable resistance. In plant use
two types of defense against a pathogen, race specific resistance and race non-specific resistance
(Rosa et al., 2015). During the infection process pathogens releases effectors to establish a
successful infection. In response to effectors plant induce their resistance mechanisms by
activating different downstream signaling cascades. At the early stages of infection pathogens
releases pathogen associated molecular pattern (PAMPs) which is identified by pathogen
recognition receptors (PRR) present in plant and initiate immune responses. This type of immune
response is known as PAMP triggered immunity or PTI. This plant defense response is the first
line of defense and not so durable. At the later stage plant exhibit effectors trigger immunity
(ETI) which is a long lasting and durable resistance. Due to ETI plant initiate different signaling
cascade which results in R gene expressions (Mackey and McFall 2006; Langenbach et al.,
2016). Similarly different dominant R genes were also identified from different varieties of
soybean plants which is presented in the following Table 2.
Table 2: List of resistance genes indentified in different soybean variety in different
country
Resistance Variety/ Original name Origin Chromosome Reference
gene Plant line no.
Rpp 1 PI 200492 Komata Japan 18 (G) Rosa et al., 2015

Rpp 1 PI 561356 Jin Yun Dou China 18 (G) Kim et al., 2012
Rpp 1 PI 594177 Himeshirazu Japan 18 (G) Yamanaka et al.,
2015
Rpp 1 Xiao Jing Xiao Jing China 18 (G) Yamanaka et al.,
Huang Huang 2015
Rpp 1b PI Min Hou Bai China 18 (G) Chakraborty et al.,
594538A Sha Wan Dou 2009
Rpp 1b PI 587886 Bai Dou China 18 (G) Ray et al., 2009

Rpp 2 PI 230970 No. 3 Japan 16 (J) Bromfield and

hartwig 1980; Rosa et
al., 2015
Rpp 2 PI 197182 Raub 16.1422 Malayasia 16 (J) Rosa et al., 2015
Rpp 3 PI 462312 Ankur India 6 (C2) Hartwig and
Bromfield 1983
Rpp 3 PI 628932 FT-2 Brazil 6 (C2) Chander et al., 2019

161
Bhumi Publishing, India

Rpp 3 D86-8286 D86-8286 USA 6 (C2) Kato 2017

Rpp 4 PI 459025 Bing Nan China 18 (G) Hartwig 1986

Rpp 5 PI 200487 Kinoshita Japan 3 (N) Garcia et al., 2008

Rpp 5 PI 471904 Orba Indonesia 3 (N) Garcia et al., 2008

Rpp 6 PI MARIF 2767 Indonesia 18 (G) Li et al., 2012;
567120B Chander et al., 2019
Rpp 7 PI 605823 SAMPLE 87 Vietnam 19 (L) Chander et al., 2019

Beside the dominant resistance genes, R gene pyramiding is another potential strategy of
soybean rust resistance. R Gene pyramiding is the process of combine two different R genes into
a single genetic background. Several evidences supported this process as a potential technique of
conferring resistance. Different researchers applied this technique and got promising result
towards the Asian soybean rust resistance.
Host induced gene silencing and RNAi technique
Gene silencing by using small double stranded interfering RNA has been a potential
technique in various disease management. To control soybean rust RNAi can be used to silence
genes of P. pachyrhizi which are critical for disease development. Host induced gene silencing is
another version of RNAi technique which is very effective against different fungi, virus,
oomycetes, nematodes, bacteria and sucking insects (Langenbach et al., 2016). Previously it was
reported that gene silencing of nematodes by using siRNA in soybean plant provides protection
against the pathogen. However there is no such report found about the soybean rust resistance by
using this technique. Although different destructive rust fungi has been controlled in different
crops by gene knockout technique which includes Puccinia graminis, P. striiformis and P.
triticina (Yin et al., 2010; Panwar et al., 2013). These evidences support that host induced gene
silencing could be used as an alternative strategy in case of soybean rust resistance. Several stage
specific genes of P. pachyrhizi has already been identified including kinase family protein, cell
wall degrading enzymes, metabolism linked genes etc. (Stone et al., 2012; Link et al., 2014;
Langenbach et al., 2016). Targeting these genes might provide resistance in soybean.
Conclusion and Future Outlook:
Asian soybean rust caused by P. pachyrhizi is a devastating disease of soybean field thus
it is a great threat to soybean production worldwide. This virulent pathogen can spread a wide
range of area since the uredospores are dispersed by wind and can initiate several infection cycle
in a single growing season. It is very difficult to study the pathogen outside of its host since it is
an obligate parasite. Till now majority of the researches on Asian soybean rust are mainly

162
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
targeted on the disease development, epidemiology and control measures. Though these
researchers are centered on the diseased plants but it is still not clearly known whether all the
soybean cultivars are resistant to P. pachyrhizi or not. The interaction between the host and
pathogen during the infection events should be explored more thoroughly to identify the crucial
elements of disease progression. More studies on the pathogen are required as there is not
sufficient data present about P. pachyrhizi. Gene expression analysis during the infection could
identify novel strategies for induced resistance against the fungus. Though researchers have
already indentified some of the crucial genes in soybean but still more information is needed
about the up regulation of different genes during appressorium formation and epidermal
penetration to achieve a clear idea on the asexual cycle of P. pachyrhizi.
Chemical control is one of the effective means of controlling rust. There are many novel
compounds like DMI, QoI and SDHI which holds a promising control of soybean rust in near
future. But it was also found that excess and long term use of these fungicides achieve
insensitivity in P. pachyrhizi. Since R gene mediated resistance in the cultivars variety exhibited
long lasting and potential resistance it is very essential to explore more transcriptional analyses
on this disease. Engineered R gene and induction of phytoalexins biosynthesis pathway is also
promising way of rust resistance. Beside this exploration of non-host plant mediated resistance
would provide a vast range of germplasm resources in upcoming years. More application of new
biotechnological techniques like gene knockout, gene silencing and genome editing tools like
CRISPR/Cas9 has to be incorporated to achieve promising resistance in soybean. It can be
concluded that genetic tools along with biological control would provide a sustainable soybean
production in future.
References:
1. Balardin RS, Meneghetti R, Navarini L, Debortoli MP (2006). Residual Relativo. Revista
Cultivar 90:17–21
2. Bettgenhaeuser J, Gilbert B, Ayliffe M, Moscou MJ (2014). Nonhost resistance to rust
pathogens– a continuation of continua. Frontiers in Plant Sciences 5:664-679
3. Brand GD, Magalhães MTQ, Tinoco MLP, Aragão FJL, Nicoli J, Kelly SM, Cooper A,
Bloch jr. C (2012). Probing protein sequences as sources for encrypted antimicrobial
peptides. PLoS ONE 7:e45848
4. Bromfield KR, Hartwig EE (1980). Resistance to soybean rust [Phakopsorapachyrhizi]
and mode of inheritance. Crop Science 20:254-255
5. Bromfield KR, Melching JS, Kingslover CH (1980). Virulence and aggressiveness of
Phakopsorapachyrhizi isolates causing soybean rust. Phytopathology 70:17-21

163
Bhumi Publishing, India

6. Chakraborty N, Curley J, Frederick RD, Hyten DL, Nelson RL, Hartman GL, Diers BW
(2009). Mapping and confirmation of a new allele at Rpp1 from soybean PI594538A
conferring RB lesion-type resistance to soybean rust. Crop Science 49:783-790
7. Chander S, Beltran AO, Bandyopadhyay R, Sheoran P, lge GO, Vasconcelos MW,
Oliveira ALG (2019). Prospects for Durable Resistance Against an old Soybean Enemy: A
Four-Decade Journey from Rpp1 (Resistance toPhakopsorapachyrhizi). to Rpp7.
Agronomy 9:348-370
8. Chung G, Singh RJ (2008). Broadening the genetic base of soybean: a multi disciplinary
approach. Critical Reviews in Plant Sciences 27:295–341
9. Garcia A, Calvo ES, de Souza Kiihl RA, Harada A, Hiromoto DM, Vieira LGE (2008).
Molecular mapping of soybean rust (Phakopsorapachyrhizi). resistance genes: Discovery
of a novel locus and alleles. Theoretical and Applied Genetics 117:545–553.
10. Goellner K, Loehrer M, Langenbach C, Conratg UWE, Koch E, Schaffrath U (2010).
Phakopsorapachyrhizi, the casual agent of Asian soybean rust. Molecular Plant Pathology
11:169-177
11. Guicherit E, Bartlett D, Dale SM, Haas HU, Scalliet G, Walter H (2014). Solatenol-the
second generation benzonorbornene SDHI carboxamide with outstanding performance
against key crop diseases. Sygenta Crop Protection 2014:67–72
12. Hartman GL, Chang HX, Leandro LF (2015). Research advancement and management of
soybean sudden death syndrome. Crop Protection 73:60-66
13. Hartman GL, Miles MR, Frederick RD (2005). Breeding for resistance to soybean rust.
Plant Disease 89:664-666
14. Hartman GL, Sinclair JB, Rupe JC (1999). Compendium of Soybean Diseases. 4th ed.
American Phytopathological Society Press, St paul, MN, USA
15. Hartman GL, West ED, Theresa KH (2011). Crops that feed the world 2.Soybean-
worldwide production, use, and constraints caused by pathogens and pests. Food security
3:5-17
16. Hartwig EE (1986). Identification of a fourth major gene conferring resistance to soybean
rust. Crop Science 26:1135-1136
17. Hartwig EE, Bromfield KR (1983). Relationships among three genes conferring specific
resistance to rust in soybeans. Crop Science 23:237-239
18. Hennings P (1903). EinigeneuejapanischeUredineen IV. HedwigiaBeiblatt 42:107-108
19. Kato M (2017). Effectiveness of Resistance Genes to the Soybean Rust Pathogen
Phakopsorapachyrhizi. Japan Agricultural Research Quarterly 51:199 – 207

164
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
20. Kendrick MD, Harris DK, Ha BK, Hyten DL, Cregan PB, Frederick RD, Boerma HR,
Pedley KF (2011). Identification of a second Asian soybean rust resistance gene in Hyuuga
soybean. Phytopathology 101:535–543
21. Keogh RC, Deverall BJ, Mcleod S (1980). Comparison of histological and physiological
responses to Phakopsorapachyrhiziin resistant and susceptible soybean. Transactions of
the British Mycological Society 2:329-333
22. Killgore E, Heu R, Gardner DE (1994). First report of soybean rust in Hawaii. Plant
Disease 78:1216
23. Kim KS, Unfried JR, Hyten DL, Frederick RD, Hartman GL, Nelson RL, Song Q, Diers
BW (2012). Molecular mapping of soybean rust resistance in soybean accession PI 561356
and SNP haplotype analysis of the Rpp1 region in diverse germplasm. Theoretical and
Applied Genetics 125:1339-1352
24. Koch A, Kogel K (2014). New wind in the sails: improving the agronomic value of crop
plants through RNAi-mediated gene silencing. Plant Biotechnology Journal 12:821–831
25. Koch E, Ebrahimnesbat F, Hoppe HH (1983). Light and electron-microscopic studies on
the development of soybean rust (Phakopsorapachyrhizi Syd). in susceptible soybean
leaves. PhytopathologischeZeitschrift 106:302-320
26. Kumar S, Jha DK (2002). Trichotheciumroseum: A potential agent for the biological
control of soybean rust. Indian Phytopathology 55:232–234
27. Langenbach C, Campe R, Schaffrath U, Goellner K, Conrath U (2013). UDP-glucosyl
transferase UGT84A2/BRT1is required for Arabidopsis non host resistance to the Asian
soybean rust pathogen Phakopsorapachyrhizi. New Phytologist 198:536–545
28. Langenbach C, Schultheiss H, Rosendahl M, Tresch N, Conrath U, Goellner K (2016).
Interspecies gene transfer provides soybean resistance to a fungal pathogen.
Plant Biotechnology Journal 14:699-708
29. Levy C (2005). Epidemiology and chemical control of soybean rust in southern Africa.
Plant Disease 89: 669-674
30. Li S, Smith JR, Ray JD, Frederick RD (2012). Identification of a new soybean rust
resistance gene in PI 567102B. Theoretical and Applied Genetics 125:133–142
31. Link TI, Lang P, Scheffler BE, Duke MV, Graham MA, Cooper B, Tucker ML, Van De
Mortel M, Voegele RT, Mendgen K, Baum TJ, Whitham SA (2014). The haustorial
transcriptomes of Uromyces appendiculatusandPhakopsorapachyrhiziand their candidate
effector families. Molecular Plant Pathology 15:379–393.
32. Lygin AV, Li S, Vittal R, Widholm JM, Hartman GL, Lozovaya VV (2009). The
importance of phenolic metabolism to limit the growth of Phakopsorapachyrhizi.
Phytopathology 99:1412–1420

165
Bhumi Publishing, India

33. Mackey D, McFall AJ. MAMPs and MIMPs: proposed classifications for inducers of
innate immunity. Molecular Microbiology 61:1365–1371
34. Maiti S, Dhar V, Verma RN (1981). Rust of soybean in India. Soybean Rust Newsletter 1:
14-16
35. Mendgen K, Wirsel SGR, Jux A, Hoffmann J, Boland W (2006). Volatiles modulate the
development of plant pathogenic rust fungi. Planta 224:1353-1361
36. Miles MR, Corrales MAP, Hartman GL, Fredrick RD (2007). Differential response of
common bean cultivars to Phakopsorapachyrhizi. Plant Disease 91:698-704
37. Miles MR, Hartman GL, Levy C, Morel W (2003). Current status of soybean rust control
by fungicides. PesticideOutlook14:197-200
38. Ogot H, Okoth S, Obiero G, Mahasi J (2017). Assessment of Asian soybean rust
(Phakopsorapachyrhizi). disease severity in selected districts of Western Kenya. IJAAR.
International Journal of Agronomy and Agricultural Research 11:50-53
39. Pandey AK, Yang C, Zhang C, Graham M, Horstman HD, Lee Y, Zabotina O, Hill JH,
Pedley KF, Whitham SA (2011). Functional Analysis of the Asian Soybean Rust
Resistance Pathway Mediated by Rpp2. Molecular Plant Microbe Interactions 24:194-206
40. Panwar V, McCallum B, Bakkeren G (2013). Endogenous silencing of Puccinia
triticinapathogenicity genes through inplanta-expressed sequences leads to the suppression
of rust diseases on wheat. The Plant Journal 73:521–532
41. Pon DS, Townsend CE, Wessman GE, Schmitt CG, Kingsclover CH (1954). A
Xanthomonas parasitic on uredia of cereal rusts. Phytopathology 44:707-710
42. Pretorius ZA, Kloppers FJ, Frederick RD (2001). First Report of Soybean Rust in South
Africa. Plant Disease 85:1288
43. Ray JD, Morel W, Smith JR, Frederick RD, Miles MR (2009). Genetics and mapping of
adult plant rust resistance in soybean PI 587886 and PI 587880A. Theoretical and Applied
Genetics 119: 271-280
44. Rosa CRE, Spehar CR, Liu JQ (2015). Asian Soybean Rust Resistance: An Overview.
Journal of Plant Pathology and Microbiology 6:307-313
45. Sarbhoy A, Thapliyal PN, Payak MM (1972). Phakopsorapachyrhizi on soybean in India.
Science and Culture 4:198
46. Sharma ND, Mehta SK (1996). Soybean rust in Madhya Pradesh. TVIS Newsletter 2: 19-
20
47. Sharma SK, Gupta GK (2006). Current Status of Soybean Rust (Phakopsorapachyrhizi). –
A Review. Agricultural Review 27: 91-102

166
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
48. Stone CL, McMahon MB, Fortis LL, Nuñez A, Smythers GW, Luster DG, Frederick RD
(2012). Gene expression and proteomic analysis of the formation of
Phakopsorapachyrhiziappressoria. BMC Genomics 13:269-290.
49. Tremblay A, Hosseini P, Li S, Scheffler BE Matthews BF (2009). Laser capture
microdissection and expressed sequence tag analysis of uredinia formed by
Phakopsorapachyrhizi, the causal agent of Asian soybean rust. Physiological and
Molecular Plant Pathology 73:163–174
50. Tschanz AT, Tsai BY (1982). Effect of maturity on soybean rust development. Soybean
rust Newsletter 5:39-41
51. Uppalapati SR, Ishiga Y, Doraiswamy V, Bedair M, Mittal S, Chen J, Nakashima J, Tang
Y, Tadege M, Ratet P, Chen R, Schultheiss H, Mysore KS (2012). Loss of abaxial leaf
epicuticular waxinMedicago truncatulairg1/palm1 mutants results in reduced spore
differentiation of anthracnose and non host rust pathogens. Plant Cell 24:353–370
52. Ward NA, Robertson CL, Chanda AK, Schneider RW (2012). Effects of
Simplicilliumlanosoniveumon Phakopsorapachyrhizi, the soybean rust pathogen, and its
use as a biological control agent. Phytopathology 102:749–760
53. Yamanaka N, Hossain MM, Yamaoka Y (2015). Molecular mapping of Asian soybean rust
resistance in Chinese and Japanese soybean lines, Xiao Jing Huang, Himeshirazu, and
Iyodaizu B. Euphytica 205:311–324
54. Yin C, Jurgenson JE, Hulbert SH (2010). Development of a host- induced RNAi system in
the wheat stripe rust fungus Puccinia striiformisf. sp.tritici. Molecular Plant Microbe
Interaction 24:554–561
55. Yorinori JT, Paiva WM, Frederick RD, Costamilan LM, Bertagnolli PF, Hartman GE,
Godoy CV, Nunes JJ (2005). Epidemics of soybean rust (Phakopsorapachyrhizi). in Brazil
and Paraguay. Plant Disease 89:675–677

167
Bhumi Publishing, India

INSECT BIODIVERSITY: PINPOINTING THEIR BENEFICIAL ROLE

Chaitali Banerjee
Department of Zoology,
Vidyasagar College for Women,
39, Sankar Ghosh Lane, Kolkata 700006, West Bengal, India

Abstract:
Insects’ world is diverse from different perspectives. Taxonomically they are the most
diversified; functionally they have been reported to be involved in numerous phenomena and
their dominance at all ecosystems is largely established. Statistically they account for more than
fifty percentages of the reported species. This wider distribution is largely associated with the
various adaptability in morphological, functional and genetic features that have enabled them to
cope up with the diverse habitats. They largely influence human & animal health, agriculture and
natural resources. They are rigorously referred as disease carriers affecting health and
agricultural practices. Conversely, they are the prime agent that brings about important beneficial
consequences like scavenging, pollination, yielding essential products, serving important
informative models, rendering forensic related important information and others. There are
factors that severely impacts insects population and diversity. Altered environmental conditions,
increasing anthropogenic activities and changing agricultural practices have brought about
marked changes in insect richness and biodiversity. Various categories of plant protection
chemicals are targeting different systems and developmental stages of insects differentially. In
the aspect of Anthropocene era, recent findings have conclusively shown dwindling diversity
with reduction in terrestrial, aquatic and flying lineages of insect species. Contrary, the
increasing herbivory have instigated diversification of various insect clades. There are diverse
points relating to and emerging from insect biodiversity. This article is an attempt to unravel the
beneficial insects and their detailed overview.
Keywords: Insects, Diversity, Beneficial, Environment, Plants, Richness
Introduction:
Insects are important components of the various ecosystems and are intricately linked to
distinctive ecological functioning and services. They dominate all the major ecosystems as the
predominant component except the coldest and most saline one. They are variously sized and
inhabit all terrestrial and freshwater habitats (Stork et al., 2015). The name Insects originate from
Latin, inseco, from in, “to cut up”; as insects can be cut into 3 major parts – Head, thorax and
abdomen. Insects have always been featured in taxonomy by various scientists. Aristotle in his
“Scala Naturae” distinctly placed insects as a separate group just above the sponges and worms
but below the marine shells. Carl Linnaeus in his “Systema Naturae”, 1758 divided animal
kingdom into six major classes including “Class Insecta”. Jean Baptiste de Lamarck in his
“Philosophie Zoologique” considered insects as one of the major nine invertebrate phyla.

168
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Modern taxonomic classification based on morphology-based systematics and various
phylogenetic data have placed insects as a major class under sub-phylum Uniramia of Phylum
Arthropoda. Approximately insects constitute 66% of all animal species and 82% of the
arthropods (Redak, 2023).
They are reported to evolve during Devonian period and as per records, their oldest fossil
dates back to Early Devonian period which was of a primitive wingless insect. The oldest flying
insects howsoever date back to mid-carboniferous. They subsequently diversified and majorly
these four large-scale radiations of insects were considered – beetles, flies, moths and wasps. The
insects are characterized for their interconnected three-part body - head, thorax and abdomen.
The head supports a pair of sensory structures – the antennae, simple eyes (0 to 3), compound
eyes (1 pair) and small appendages in its modified form to make the mouthparts. The thorax
carries legs (3 pairs) &up to 2 pairs of wings. The abdomen harbours major systems – digestive,
excretory, reproductive etc. Besides being a deleterious pests and parasite, they are effective
pollinators and yields useful substances for diverse use like honey, silk, wax, lacquer etc (Redak,
2023). The article gradually will cover different role of the insects with major emphasis on the
beneficial aspects.
Beneficial role of insects
1. Pollination:
This is the process by which flowering plants reproduce and it is integral for their
survival. Pollens, the repertoire of genetic information are needed to travel from anther, the male
reproductive part to stigma, the female reproductive part. The natural phenomenon like rain and
wind often executes this; however in many different plant species pollination is specifically
accomplished by agents like insects. Insects as a pollinators dates back to Cretaceous period. The
tumbling flower beetle trapped in amber has been reported by researchers. Cretoparacucujus
cycadophilus was the earliest beetle as per fossil record that was retrieved carrying the pollen of
cycads. Of the many popular insect pollinators, few worth mentioning are Bumblebees,
Hoverflies, Solitary bees, Wasps, Moths, Butterflies, Beetles, Ants etc. To elaborate the vivid
relationship, it is important to discuss a few. The lepidopterans – butterflies and moths serve an
important role in pollination in both wild ecosystems as well as managed ones. Bees are general
visitors and generally pollinate a variety of crops and vegetables. The insect pollinators get the
floral reward by getting access to nectar, heat sources, materials for nesting and glimpses of sites
for mating, brooding and sleeping on their journey from one to another. There are a series of
effective steps involved in this process of communication between flower and insect pollinators.
Generally olfactory and visual cues stimulate nectar feeding responses in the pollinators. The
sensory responses of the insects are important to perceive different floral traits like floral size,
colouration pattern, organised positioning, helping the insects in understanding pre-existing
biases, proper landing, subsequent feeding and detachment. Technical advancement and data
from different projects like “1000 Plant Transcriptome Project” and “5000 Insects Genome

169
Bhumi Publishing, India

Project” have delineated the involvement of several genes shaping the plant-pollinators
relationship and subsequent evolutionary trend.
Table 1: important floral characteristics and subsequent preferences and patterns of
readily involved insect visitors (Wojcik 2021)
Floral Trait Colour Shape Nectar Odour Pollen Nectar Bloom
Guides
Canatharophily pale/dull, large, none strong abundant accessible day
(beetle) white, bowl- fruity or nectaries
green shaped foul
Melittophily yellow, complex, present, fragrant, abundant abundant day
(bees, pollen blue, disc, or obvious pleasant
wasps) purple, tubula
ultraviolet
Psychophily red, pink, disc present strong limited Abundant, day
(butterflies) purple, shaped, and deep
bright landing fragrant
pad
Phalaenophily pale, tubular, none strong limited Abundant, day
(moths) cream, with and and deeep and
white, without fragrant night
yellow landing
pad
Myophily yellow, disc present strong limited abundant day
(flies) white shaped and and
fragrant night
Sapromyophily marron, funnel or present strong limited absent day
(carrion flies) green, trap, and and
dull small putrid night
Myrmacophily varied open, present none varied abundant, day
(ants) small extrafloral
nectaries
A cascade of gene has been implicated in floral development that often shows impact to
co-ordinate pollinators’ oriented floral attributes. Conversely, the visiting insects have specific
physical adaptations like presence of hairs or scales for adhering the pollens. Bees are specialised
in harbouring “scopa”, dense aggregation of hairs on the underside of the abdomen or on their
hind limbs. Few are even more specialised in having structures like “corbicula” that facilitates
carrying a tightly packed ball. Flies are eventually covered by hairs throughout their body
rendering passive uptake of pollens. Butterflies and moths have scales on face, thorax, wings,

170
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
abdomen and hind limbs. Pollens gets transported along these scales variously located in the
body. Beetles feeds on pollens, hence the mouthparts itself or at times the rows of dense hairs or
pollen broom on the maxilla and labium mediates the transportation of pollen (Wojcik, 2021).
Precisely the cumulative approaches of molecular developmental studies, population
genetic approaches and detailed structural dynamics have rendered significant information on
key floral traits and insects’ capabilities rendering successful pollination generations after
generations (Fattorini and Glover, 2020).

Figure 1: Pictures of different flowers pollinated by insects. (a) Fly-pollinated Selinum

carvifolia. (b) Bee-pollinated Phacelia tanacetifolia. (c) Moth-pollinated Angraecum
sesquipedale. (d) Butterfly-pollinated Calendula officinalis. (e) Bird-pollinated Aquilegia
canadensis. (f). Bat-pollinated Strongylodon macrobotrys (Fattorini and Glover, 2020)
2. Efficient predators and parasitoids:
Predator insects often prey upon harmful organisms like ladybird beetles, ground beetles,
lace wings, yellow jacket wasps, hover flies, mantids, dragonflies, damseflies etc. Usually the
insect predators are characterized for having chewing mouth parts that enables them to chew and
swallow up as found in ladybugs, preying mantis etc. Some of the assassin bugs, larvae of
lacewings have piercing and sucking mouthparts. They stick their mouthparts into the prey,
immobilize them using powerful toxins & digestive juices and then suck out the body content.

171
Bhumi Publishing, India

Few predating insects are slow runners and wait for the prey to fall to them. Others are efficient
flyers or runners that aids in catching even the fast flying prey. Many insects can camouflage
themselves well with the background facilitating easy ambush of the prey (Winterton, 2009).
• Family Coccinellidae – Insects like lady bug belong to this. They are active and voracious
feeder of aphidsthat abundantly target pine, willow, several vegetable crops like potatoes
etc.
• Family Carsbidae – Ground beetles and tiger beetles attacks aphids and other larvae of
beetles & flies.
• Family Reduviidae –Assassin bugs kill the prey even of larger body size than themselves.
They have strong sucking mouthparts allowing them to insert their proboscis and inject
its digestive enzymes leading to oozing out of the body fluid.
Ambush bug crypt itself to hide behind floral attributes as they wait for the prey. As the
prey approaches, the raptorial front legs specialised in grabbing prey catch it firmly.
Many small flies, beetles, bees, wasps that visit flowers are foraged by ambush bugs.
• Family Chrysopidae –Insects like green lacewings characterised for lacy looking wings
belong to this family. They generally prey upon aphids, small caterpillars and beetles’
larvae.
• Family Syrphidae –Syrphids or Hoverflies are named for their nature of hovering around
flowers. Their larvae are the voracious feeder of scales, aphids, thrips and even smaller
caterpillars. The adult hoverfly often lay eggs near or among the aphid colony as a
strategy to ensure eating up of aphids.
• Family Asilidae –The representatives of this family efficiently hunt down the prey in the
mid-air. They inject neurotoxin present in the saliva that rapidly immobilizes the prey,
which is then carried back by themselves to the perch for feeding. Ex- Robberflies prey
mostly on flying insects such as butterflies, bees, true bugs etc.
• Family Libellulidae – Dragonflies are characterized for their agile flying, strength and
sharp eyesight. They are also efficient insect catcher that can hold an insect even in the
middle of air. Mainly they target mosquitoes, butterflies, midges, damselfies.
• Family Vespidae–Wasps are the eusocial insects. They are opportunistic feeders as well
feeding on caterpillars, leaf miners, spiders, aphids etc.
Parasitoids are the insects that parasitize oninsect species. Basically, they survive in or on
the body of another insect (host), which is usually a parasite. They derive nutrition and enjoy
protection therein. However, parasitoids execute it’s affected in one of its immature stages and as
they develop, they destroy its host eventually. The larvae of wasps, beetles and flies often act as
parasitoids. The cotton bollworm, Helicoverpa armigera is a polyphagous species that affects
important crop species like cotton, tomato, chickpea, rice, legumes, various fruits and flowering
plants as well. The flies and waspscan parasitize Helicoverpa sp. The adult females often target
the different developmental stages of Helicoverpa sp. by laying eggs either inside or on it. As the

172
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
eggs hatch, they start feeding. The parasitoid larva gradually spins its cocoon and pupates to
emerge into adult. Depending upon the life stage of the host they attack, the entomologists have
devised nomenclature. The wasp, Trichogramma sp., parasitizes the eggs of Helicoverpa sp.;
henceit is referred as egg parasitoid. Microplitis attacks Helicoverpa caterpillars, hence referred
to as larval parasitoid. Parasitoids are important considering their natural ability of pest
management without any financial investment (Conti and Colazza, 2012).

Figure 2: Trichogramma sp sitting on the eggs of different agricultural pest (Parra and
Zucchi, 2004)
3. Insects as scavengers and weed killers:
There are insects like Rove beetles, carrion beetles, midges, sand fliesetc. that feed on
dead and decaying materials like animal dungs, vegetables’ refuse, rotten substances etc. In an
experiment by Ilardi et al., a burying beetle, Nicrophorus vespilloides was shown to have
accelerated decomposition of soil carrying mouse carcasses. These scavenging beetles also
enrich the organic matter and nitrify the soil (Ilardi et al., 2021).
Weeds are the plants that grow undesirably at a wrong place at the cost of native
cultivation. They interfere with the natural yield and severely harm livestock, wildlife and even
human beings. Insects can directly destroy weeds and serve as important biological control. Ex-
water hyacinth, Eichhornia crassipes was effectively controlled in the southern part of India by
the weevil Neochetina sp. & mite Orthogalumna terebrantis. There are several other examples
worldwide and this process of biological control is relatively inexpensive (Jimanez and Balandra,
2007).
4. Insects in forensic science:
The forensic or medico-legal science is the investigative science that examines the site of
crime and the associated evidences. The insects’ species and developmental stages associated
with the corpse can render lot of information. This is the time that has elapsed since death,
173
Bhumi Publishing, India

shifting of the body from site of crime or any other disturbance to the body. It’s first implications
were reported from China in the 13th century for investigating the death of a poor farmer.
Forensic entomology primarily estimates “post mortem interval”. This is the time that has
elapsed after the death of the individual. It is determined by the evaluation of the insects or its
succession pattern present at the crime spot and on the body itself by thorough scientific
investigations. Francesco Redi, the Italian physician, discarded the theory of spontaneous
generations in 1668. This theory brought huge revolution and gradually spurred analysing
insects’ life cycle and presence in corpses’ respect, thus gradually paving the way for forensic
entomology.
Hermann Reinhard, a Germany based doctor is associated to contribute significantly to
this field. Dr. Louis Francois E Bergeret, French physician of 19th century, for the first time used
forensic entomology and determined the post mortem interval for a case. The succession of
insects on the buried and exposed corpse was studied. His theories have significantly contributed
to the field of forensic entomology and have laid the foundation of it. Some of the books that he
authored are Faune des Tombeaux and La Faune des Cadavres; they form the basics of forensic
entomology (Benecke, 2001).
The readily investigated insects for the said purpose are as follows (Joseph et al., 2011):
• Flies: These are the first to arrive and attach to the dead bodies and their maggots
specialized to feed upon moistened remains. Blow flies can smell dead decaying flesh from
up to 16 km. Flesh flies thrive on decaying garbage, corpse, dung and other remains;
though a few of the fire flies sp. lay eggs in the open wounds as well.
• Beetles: They arrive generally after flies and are the residents of the corpses at its later
stages of decomposition. The hide or skin beetles, precisely known as Dermestid beetles
infest a decaying corpse after soft tissues are eaten up by other organisms. Generally, they
propagate on hairs and skin of the cadaver and are amongst the most readily collected
insects by entomologists. Similar are the conditions implicated with Bone beetles. Carrion
beetles relish the maggots whereas the larvae of the carrion beetles propagate chiefly on
carcasses. Scarab beetles feed on fungi and decaying flesh. Another important organism
from this group are Sap beetles that feed on infested remains and are crucial in the
investigation purpose.
• Mites and Moths: Macrocheles mites feed on carcasses and are spotted at the earlier stages
of decomposition whereas Tyroglyphidae & Oribatidae thrives on skin and hence
considered to join the later stages of decomposition. Moths’ larvae are primarily active
during twilight and feed the hair of corpses. These are amongst the last animals joining the
body for decomposition.
The application of this particular investigative science is employed in several other cases
as well in the determination of food infestation by looking at the debris, analysing the presence
of drugs in the faeces, bodies and dead skin of insects feeding on corpse or extraction of DNA

174
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
from blood consuming insects. The application of entomology for investigating the crime is in
rapid progress worldwide. In India, dedicated IFF Lab (Incognito Forensic Foundation), a private
enterprise is present with its centres at Bangalore and Chennai. Howsoever, this technique is not
much given importance in India yet. Even there are some outstanding instances, majorly the
consideration of insects at the site of crime are not much in practice. There are lack of experts
and infrastructure as well dedicated for this study and analysis (Amendt et al., 2011).

Figure 3: Different insects of forensic entomology (https://qr.ae/psI2b8)

Conclusion:
Insects, the distinctly segmented arthropods are widely distributed in the universe. Their
anatomy and adaptability make them successful. They are harmful causing losses to vegetation,
resources etc. But there is huge list of insects that brings about considerable benefits to mankind
and ecosystem. This article is an attempt to describe some of the important beneficial aspects of
insects. Theypromote soil aeration, fill the top layer of soil with nutrients for being excellent
decomposer, acts as natural pest control, acts as scavengers by feeding on dead decaying matter,
channelize water by digging the soil, bring about pollination in 75% of global crops, helps in
building nation’s economy by making several important medicinal & commercial products,
immensely helpful to pharmaceutical industries and are important tool for investigating
science.Threats to insects decline are immense ranging from deforestation, urbanization, habitat
destruction, introduction of invasive species and several others. The meta analysis data suggest
decline in insect population by 9% per decade with more threats to terrestrial insects than aquatic
ones. It is important that we understand the several positive attributes of insects and make efforts
to preserve them. Without insects, earth will be less attractive withecological imbalances owing
to disturbance in food web and disruption in ecosystem.
References:
1. Stork N E., McBroom J G., Gely C et al., New approaches narrow global species estimates
for beetles, insects and terrestrial arthropods. Proceedings of the National Academy of
Sciences of USA (2015). 112, 7519-7523. https://doi.org/10.1073/pnas.1502408112.

175
Bhumi Publishing, India

2. Redak R (2023). Introduction to and importance of insects. In: D. Allison, J., Paine, T.D.,
Slippers, B. Wingfield, M.J. (eds) Forest Entomology and Pathology. Springer, Cham.
https://doi.org/10.1007/978-3-031-11553-0_1.
3. Wojcik V. Pollinators: Their evolution, ecology, management and conservation.
Arthropods - Are they beneficial for mankind? IntechOpen; 2021.
https://dx.doi.org/10.5722/IntechOpen.97153.
4. Fattorini R., and Glover B.J. Molecular mechanisms of pollination biology. Annual
Review of Plant Biology 2020 71, 487-515.
5. Shaun L. Winterton, Chapter 229- Scales and Setae. Editors: Vincent H. Resh, Ring T.
Card. Encyclopedia of Insects (Second Edition), Academic Press, 2009, 901-904. ISBN
9780123741448. https://doi.org/10.1016/B978-0-12-374144-8.00238-1.
6. Conti E., and Colazza S. Chemical ecology of egg parasitoids associated with true bugs.
Psyche: A Journal of Entomology. https://doi.org/10.1155/2012/651015.
7. Parra, J.R., and Zucchi, R.A. (2004). Trichogramma in Brazil: feasibility of use after
twenty years of research. Neotropical Entomology, 33, 271-281.
8. Ilardi M. O., Cotter S. C, Hammer E. C., et al., Scavenging beetles control the temporal
response of soil communities to carrion decomposition. 2021.
https://doi.org/10.1111/1365-2435.13849.
9. Jimanez M. M, Balandra M. A. G. Integrated control of Eichhornia crassipes by using
insects and plant pathogens in Mexico. Crop Protection (2007). 26, 1234-1238.
https://doi.org/10.1016/j.cropro.2006.10.028.
10. Benecke M. A brief history of forensic entomology. Forensic Science International 120, 2-
14, 2001.
11. Joseph I., Mathew D. G., Sathyan P., et al., The use of insects in forensic investigations:
An overview on the scope of forensic entomology. Journal of Forensic Dental Sciences 3
(2), 89, 2011.
12. Amendt J., Richards C. S., Campobasso C. P., et al., Forensic entomology: applications
and limitations. Forensic Science, Medicine and Pathology 7, 379-392, 2011.

176
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

THE ROLE OF ECOTOURISM IN BIODIVERSITY CONSERVATION EFFORTS

IN TRIPURA, INDIA
Dipak Das1* and Samik Acharjee2
1Department of Zoology, Ramkrishna Mahavidyalaya, Kailashahar, Tripura, India
2Department of Zoology, Rammohan College, Kolkata, West Bengal, India
*Corresponding author E-mail: [email protected]

Abstract:
Tripura is a hilly North-Eastern state of India blessed with rich flora and faunal
biodiversity. It has a variety of ecosystems and moderate climate throughout the year, all of
which supports a multitude of wildlife species and thus considered the state Tripura has immense
scope for ecotourism. It involves participation of local communities in overall economic
development of area along with learning environment friendly way of life and support
biodiversity conservation efforts while observing nature and wildlife. This study highlights how
biodiversity conservation efforts have been made based on holistic approach of ecotourism
development in the state of Tripura. It further looks at the other factors that play a role in
successfully conserving biodiversity through ecotourism activities in the state of Tripura, a part
of Indo-Burma biodiversity hotspot region of India.
Keywords: Ecotourism; Biodiversity Conservation; Community-Based Ecotourism;
Overexploitation; Sustainable Ecotourism; Tripura
Introduction:
Ecotourism development and biodiversity conservation efforts have worked in tandem
since the early twentieth century (1). Biodiversity conservation and sustainably utilizing natural
resources improve the benefits of ecotourism development (2, 4). The International Union for
Conservation of Nature suggested that biodiversity and ecotourism are mutually related (6). The
International Ecotourism Society offers the following definition: “responsible travel to natural
areas that conserves the environment, sustains the well-being of the local people, and involves
interpretation and education” (3). Nature-based tourism considering environmental sustainability
reduces the impact on native species of a specific habitat and there is a strong correlation exists
between biodiversity conservation and growth of ecotourism businesses (5,7, 8).It has been
proven fact that nature-based tourism should be coupled with biodiversity conservation efforts
throughout the globe. Several studies recommend that positive impact has been found regarding
biodiversity conservation with the help of a “coexistence model”, i.e., community-based
ecotourism (CBET). Further, by gathering proper knowledge regarding carrying capacity of

177
Bhumi Publishing, India

ecotourism sites, information about local biodiversity register, providing vocational training and
awareness to the local peoples will increase the ecotourism growth.
Implication of sustainable ecotourism approach become a promising driver to support the
livelihood of local communities which play a key role behind achieving biodiversity
conservation goals (9). On the other hand, ecotourism threats to biodiversity values such as over
exploitation sometimes create negative impact on biodiversity in worldwide in many hotspot
region including Eastern Himalayan region of India (10,11).
Ecotourism in the state of Tripura gaining its momentum in the last five years with
raising global interest as it is listed under two mega biodiversity hotspots of India. As per Tripura
Forest Department record (TFD,2016), the state Tripura is home to 1545 plant species with
highest numbers of species belonging to Angiosperms followed by Dicotyledons,
Monocotyledons, Pteridophyta and Gymnosperms. Several variety of wild animals belonging to
different groups are found in Tripura and host of over 90 species of mammals and few of them
are under rare, endangered and endemic species of IUCN category and home to a large numbers
of bird species. The recorded bird species were 342 and there is also 47 fish species recorded in
the state. Besides these, 55 herpeto fauna were recorded and several category of invertebrates
animals like odonata, butterflies etc. (14). An empirical analysis of biodiversity conservation
goals and ecotourism development in Tripura is of vital importance. Therefore, this study
attempted to assess current biodiversity conservation efforts and ecotourism development
scenario in the state of Tripura, a North Eastern part of India.
Methodology:
This study is based on mainly secondary sources like published research article, review
work, book, electronic data bases etc. and in few cases also used primary information related
with ecotourism and biodiversity conservation efforts in Tripura and elsewhere. The literature
searched with keywords such as ecotourism, biodiversity, sustainable development, man wildlife
conflict etc.
Identified trust area of Tripura Tourism Policy 2020-2025 related to ecotourism
development
Tripura Tourism Policy 2020-2025 has been identified few thrust area related to
ecotourism development in Tripura. Some of the important initiatives are development of bird
watching sites, development of different wetlands, nature walk sites and Eco Park, development
of some area for eco friendly recreation, identification of sacred grooves etc.
From the literature review it has been found that the biodiversity conservation effort
throughout the state have been taken only by means of establishment of eco park, sanctuary,
protected area etc. and these sites are the potent destination for local as well as foreign visitors.

178
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Some important Ecotourism sites in Tripura with key biodiversity aspects
Jampui Hill
Jampui hills are well-known for its attractive landscape. Tourists visit this place to see
green forests, beautiful orange garden and soul inspiring sun rise. It is fall under the subdivision
of Kanchanpur, district North Tripura and share its boundary with neighboring state Mizoram. In
this area so many undisturbed vegetation are found and due to its peculiar characteristic different
types of wildlife particularly wild boar, cat, snakes and avian fauna are easily encountered. It is a
heaven place for ornithologist and butterfly lover.
Dumboor Lake
It is the largest important wetland in the state of Tripura located in Gandacheerra which is
120 km away from state capital city Agartala and covers an area of 41 sq. km. with an unending
spell of luxuriant green vegetation and rich bio diverse wetland area. Migratory birds and
traditional fishing gears are additional attraction. Various species of migratory birds are noticed
in the winter and it has rich reservoir of natural fishes. The lake is the confluence of rivers Raima
and Sarma. The most important Gomati River is originating from these reservoirs. So many
indigenous fish species are found in this lake.
Sepahijala Wildlife Sanctuary
It is an area of 18.53 square kilometers and situated in Bishalgarh subdivision of
Sepahijala district. It has a perennial different tree locally known as sal, segun, karai etc. and
large sized water body which attract so many bird species including migratory bird particularly
in the winter seasons. Also, one well managed botanical garden and zoo are the main
components of this sanctuary. The habitat is primarily deciduous in nature but little evergreen
vegetation is also seen throughout the year. Different types of bamboo are one of the significant
natural resources of this sanctuary as it supports so many wild animals in many ways. Core area
of this sanctuary is designated as National Park particularly for Clouded Leopard enclosures.
Several local resident birds along with some migratory birds with about 150 species. Four
species of primate, the rhesus macaque, pig tailed macaque, capped langur and dusky langur is
found. It is rich in countless medical and therapeutically botanical species of plants. The
sanctuary has been developed both as a wildlife sanctuary and as an academic and research
centre. Also butterfly beauty can see in this sanctuary.
Rowa Wildlife Sanctuary
The Rowa Wildlife Sanctuary is located in the Panisagar subdivision of north district of
Tripura. This Sanctuary in Tripura is a small wildlife sanctuary covering an area of 0.86 square
kilometer. From conservation point of view, Rowa Wildlife Sanctuary is an important destination
for wildlife biologist. Despite its small size has over the years gained a great deal of popularity,
because of its natural beauty, restored with the active cooperation of the local community.

179
Bhumi Publishing, India

Several species of butterflies, birds, herpatofauna are easily encountered. The key habitats in the
sanctuary are small size wetland, botanical garden, regenerated secondary forest and bamboo
bush. Fifty-three butterfly species has been recorded from this sanctuary (12). 20 species of
Amphibia and 33 species of Reptilia also were recorded from this site. Interestingly one of the
amphibian species Hoplobatrachus litoralis is the first record from this site in India (13). To
protect the plants including several species of medicinal plants as well as animal native
biodiversity is important as these serves a so many ecosystem services to the local communities.
Gomati Wildlife Sanctuary
It covers an area of about 389.54 square kilometers and located in south part of the state.
It is considered largest sanctuary in the state. Most of the forest types are deciduous in nature but
some semi evergreen type is also visible in this sanctuary. It is a significant habitat of several
types of wild life animals like macaque, Rhesus, Capped langur, pigtailed macaque and
spectacled langur. A large numbers of bird’s species including migratory and non migratory
birds are seen here. The significant encounter of large body size mega herbivores Asian elephant
Elephas maximus which is an endangered animal as per Schedule-I of the Indian Wildlife
Protection Act (1972) in this sanctuary.
Trishna Wildlife Sanctuary
It has an area of 194.708 square kilometers and is situated in South district of Tripura and
most of the area is undisturbed forests which support rich in vegetation and wildlife. The Indian
Gaur (Bison), birds like Pheasant tailed Jacana, White breasted King Fisher, Red Jungle Fowl,
and Hornbill etc are the important wildlife in the sanctuary. This sanctuary has a number of
different types of wetlands and grass land which support different types of fish species and birds.
Different species of migratory birds are visit during the winter period. The first butterfly park of
the state of Tripura was established near to this sanctuary and now become a important tourist
destination for local as well as foreigner to get an experience on conservation biology. Several
types of butterfly are found in this park. It is also the habitat of Hoolock Gibbon and primates
like Capped Langur, Golden Langur, Maccaca mullata, Spectacle monkey etc.
Unakoti Eco Park
It is situated in Kailashahar sub division of Unakoti district of Tripura. It is famous
because of presence of sculpture emblem and ancient shiva that hosts rock carvings, figures and
images of gods and goddesses. It is not just a place to see rock reliefs of Shiva, but also an
important tourist destination due to its scenic beauty while trekking. The trek starts from the
Unakoti Eco Park and goes through an undisturbed forest area. So many perennial streams are
available in the vicinity of park. Many types of endemic flora and fauna is found in the park and
its adjoining area. A great number of butterfly species has been explored in this site. This is

180
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
becoming famous place for nature walk among students, wildlife saver and common peoples of
Tripura and its neighboring states Assam and Mizoram.
Hathaikotor (Baramura) Park
This park is located in Baramura Hill Range under Khowai district of Tripura. The
habitat is characterized by deciduous forest with a small perennial stream flowing through it.
This part is famous for its undulating greenery habitat and also great number of wildlife like
butterflies, birds, rhesus monkey, spectacle monkey etc. One of the important bird species
Oriental pied hornbills Anthracoceros albirostris found in this eco park. Every year with the
initiative of Forest Department, Government of Tripura Hornbill festival has been organized at
the premises of Hathaikotor (Baramura) Eco Park aiming to conserve the striking forest bird
Hornbill. The Hornbill festival began on 8th February 2020.Now a days it is a most attractive
place to visit by eco-lover.
Rudrasagar
The Rudrasagar wetland is located in the Melaghar under Sonamura sub-division of
Sephahijala district. The Government of India’s Ministry of Environment, Forest and Climate
Change has recognized it as an important wetland from conservation point of view considering
the parameters like biodiversity of it and ecosystem services render to the local peoples etc. The
secretary general of the Ramsar Convention has declared Rudrasagar Lake as a wetland of
international importance. It harbours atleast 55 numbers of freshwater fish species such as
Sperata aor, Wallago attu, Heteropneustus fossilis, Anabus testudineus, Nandus nandus, Chitala
chitala etc. The state fish Ompok pabda are also found to be in this important wetland. So many
ecologically important bird species can be seen in this wetland throughout the year like Grey
headed fish eagle, Cotton pygmy goose, Coppersmith barbet, Painted snipe etc. It is a potential
Important Bird Area (IBA) in the state of Tripura and attracts a large number of waterfowl
particularly in the winter season.
Kalapania Nature Park
Kalapania Nature Park situated in Sabroom subdivision of South district. It was
established in 2004 covering 21 hectares of deserted land into natures paradise set amidst
charming ambience of natural beauty. A perennial water body is found in the park. The park has
so many host plants for butterflies. Avian diversity is also available throughout the year. It is one
of the important managed Eco Park in the state.
Tepania Eco Park
Tepania Eco-Park was established in 1995 under the control of Forest Department,
Government of Tripura in Udaipur which is known as Lake City of the state. With time Eco Park
ambience of natural beauty has been upgraded some extent considering different environmental
issues as well as eco tourism angle. The most important appeal of Tepania Eco Park are a only

181
Bhumi Publishing, India

one of its kind of medicinal plant resources and a number of wooden made watch tower for
viewing the wild life spectacle in a perfect and panoramic habitat. Large number of bird species,
butterfly color beauty, dragonfly and spider are common encounter. Among the mammals rhesus
monkey are seen common. It is an ideal place for educational tour for environmental studies. The
state bird Green Imperial Pigeon Ducula aenea can seen in this park.
Khumulwng Eco Park
The Khumulwng Eco Park is within the Tripura Tribal Areas Autonomous District
Council, Head Quarter Khumulwng, West district of Tripura. Thet total area of the park is 14.5
hectre only although due to its heterogenous habitat it harborus so many flora and faunal
diversity. Different types of colourful insects like moth, butterfly, odonata species are easily
encounter. A perennial water body is found here which support different types of fish species.
Some kind of amphibian fauna can also be seen. A good number of flowering plantations is also
maintained in this park.
Lembucheera Eco Park
It is situated in West district of Tripura and is near to state capital Agartala city. It is a
beautiful place for urban biodiversity conservation point of view. It is an ideal place for butterfly
watching as well as bird watching. The state insect Apis cerana can be seen in this place.
Oxygen Park
It is established in Salbagan near to Agartala city of west district. Undisturbed forest is
found in the park. Different types of wildlife like Squirrel, rhesus monkey, jungle fowl, bird
watching can easily available. To visiting this park one can, get experience true beauty of Sal
forest, an important tree plant in deciduous type forest. Different types of bamboo bushes are
also can seen. In the periphery of the park by the initiative of Forest Department, Government of
Tripura is establishing the largest Orchidarium in the State as the state is the home for varieties
of orchids. In near future it becomes one of the exceptional tourist destinations of the state for
peoples across the state as well as other parts of the country.
Forest City Park
It was established in the kumarghat subdivision of Unakoti district near Kumarghat-
Kailashahar road. So many woody plants along with natural vegetation are present here and it
helps to mitigate wildlife human conflict in nearby area by proving them home support. This
place is support so many butterflies as it is rich of fodder and nectar sources of so many butterfly
species and also home to many types of bird species. Different types of big tree species are found
here.
Conclusion:
Ecotourism is often viewed as an effective strategy for promoting the conservation of
endangered species and habitats as it plays an important role in raising awareness of sustainable

182
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
development, motivating people to save biodiversity and teaching the importance of biodiversity
conservation for human livelihood. It provides economic, social, and cultural incentives for the
local people while staying on the environmentally friendly way in conserving high biodiversity
value. At this early growing phase of ecotourism development in Tripura some degree of
conflicts in terms of habitat degradation and over exploitation has occurred. Increasing
awareness among all the stakeholders of the society and developing integrated management
strategies are the only promising resolutions for successful ecotourism development and
biodiversity conservation in the state of Tripura.
Recommendations:
1. Focus should be necessary on identification of sacred groove of Tripura considering
biodiversity rich area for both flaora and fauna.
2. Identification and proper management of many more significant wetlands across the state
for conservation aspects.
3. Capacity building on biodiversity conservation approach and its linking with ecotourism
industry among the relevant stakeholders should need to be done properly.
4. Proper implementation of Tripura Tourism Policy 2020-2025 for ecotourism development
and biodiversity conservation approach should be followed.
5. Priority should be given on community based ecotourism development.
6. Before starting of any developmental work in the eco sensitive zone Environmental Impact
Assessment need to be carried out properly.
Acknowledgements:
The authors wish to gratefully acknowledge the support of the authority of Ramkrishna
Mahavidyalaya, Kailashahar, Tripura and Rammohan College, Kolkata, West Bengal.
Conflicts of Interest:
The author declares no conflicts of interest regarding the publication of this work.
References:
1. Sellars, R. W. (1997). Preserving Nature in the National Parks: A History. Yale University
Press.
2. Stronza, A. L., Hunt, C. A., & Fitzgerald, L. A. (2019). Ecotourism for conservation?
Annual Review of Environment and Resources, 44, 229–253.
3. The International Ecotourism Society (TIES). (2018). What is Ecotourism? Retrieved from
http://www.ecotourism.org/what-is-ecotourism
4. Noriega, J. A., Zapata-Prisco, C., García, H., Hernández, E., Hernández, J., Martínez, R.,
Santos-Santos, J. H., Pablo-Cea, J. D., & Calatayud, J. (2020). Does ecotourism impact
biodiversity? An assessment using dung beetles (Coleoptera: Scarabaeinae) as

183
Bhumi Publishing, India

bioindicators in a tropical dry forest natural park. Ecological Indicators, 117(February),

106580. https://doi.org/10.1016/j.ecolind.2020.106580
5. Jurkus, E., Povilanskas, R., & Taminskas, J. (2022). Current trends and issues in research
on biodiversity conservation and tourism sustainability. Sustainability (Switzerland), 14(6).
https://doi.org/10.3390/su14063342
6. De Zoysa, M. (2022). Ecotourism development and biodiversity conservation in Sri Lanka:
Objectives, conflicts, and resolutions. Open Journal of Ecology, 12, 638-666.
https://doi.org/10.4236/oje.2022.1210037
7. International Union for Conservation of Nature and Natural Resources (IUCN). (2012).
Integrating Business Skills into Ecotourism Operations. Retrieved from
https://portals.iucn.org/library/efiles/documents/2012-032.pdf
8. World Tourism Organization (WTO). (2013). Sustainable Tourism for Development
Guidebook.
9. Bashar, M. A. (2018). Vision on biodiversity: Ecotourism and biodiversity conservation in
Bangladesh. Journal of Biodiversity Conservation and Bio-Resource Management, 4, 1-10.
https://doi.org/10.3329/jbcbm.v4i1.37871
10. Higgins-Desbiolles, F. (2011). Death by a thousand cuts: Governance and environmental
trade-offs in ecotourism development at Kangaroo Island, South Australia. Journal of
Sustainable Tourism, 19, 553-570. https://doi.org/10.1080/09669582.2011.560942
11. Brandt, J. S., Radeloff, V., Allendorf, T., Butsic, V., & Roopsind, A. (2019). Effects of
ecotourism on forest loss in the Himalayan biodiversity hotspot based on counterfactual
analyses. Conservation Biology, 33, 1318-1328. https://doi.org/10.1111/cobi.13341
12. Lodh, R., & Agarwala, B. K. (2016). Rapid assessment of diversity and conservation of
butterflies in Rowa Wildlife Sanctuary: A Indo-Burmese hotspot-Tripura, N.E India.
Tropical Ecology, 57(2), 231-242.
13. Purkayastha, J., Khan, N., & Roychoudhury, S. (2021). A preliminary checklist of
Herpetofauna occurring in Rowa Wildlife Sanctuary, Tripura, India. In N. Roy, et al.
(Eds.), Socio-economic and Eco-biological Dimensions in Resource use and Conservation,
Environmental Science and Engineering. https://doi.org/10.1007/978-3030-32463-6_10
14. Tripura Forest Department (TFD). (2016). Forest and wildlife resources of Tripura.
Retrieved from http://forest.tripura.gov.in/forest-and-wildlife-resurces-of-tripura.

184
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

IMPACT OF FOOD SAFETY AND FOOD CONTAMINATION ON COMMUNITY

HEALTH
Madhurima Sharma, Prateeti Chattopadhyay, Paromita Mondal and Sutapa Datta*
Post Graduate Department of Zoology,
Bethune College, Kolkata, 700006, West Bengal, India
*Corresponding author E-mail: [email protected]

Abstract:
Food is considered as safe and hygienic for intake when there is no dangerous substance
present in it that may be injurious for human health. Foods and drinks can be sometimes
contaminated, and due to that it’s becoming inappropriate for human consumption. Food
contamination is a pervasive issue with far-reaching implications for public health. Food
contamination mainly happens when bacteria or other germs get into food, which can eventually
cause food-borne illness. While most food contaminations are accidental, there has been some
evidence of intentional food contamination. This abstract mainly explores the sources, types, and
consequences of food contamination. It delves into microbial, chemical, and physical
contaminants, emphasizing their potential to cause foodborne illnesses. The abstract also
highlights preventive measures and regulatory efforts aimed at ensuring food safety, emphasizing
the critical role of education and awareness in mitigating the risks associated with food
contamination.
Keywords: Food Contamination, Food Safety, Food-Borne Illness, Microbial Contamination,
Environmental Contaminants.
Introduction:
Food contamination refers to the presence of harmful substances or microorganisms in
food, compromising its safety and quality (1). Contaminants can include bacteria, viruses,
parasites, chemicals, or foreign objects (2). Contamination can occur at various stages, from
production and processing to distribution and preparation (3). It poses serious health risks,
leading to foodborne illnesses. Common sources of contamination include improper handling,
inadequate storage, and contaminated water or raw ingredients (4). Effective food safety
measures, such as proper hygiene, sanitation, and quality control, are crucial to prevent and
mitigate the risks of food contamination (5,6).
Concept of food contamination
• Biological food contamination: It involves the presence of living microorganisms such
as bacteria, viruses, parasites, or fungi in food, posing a risk to human health. These
contaminants can multiply rapidly under favorable conditions, leading to foodborne
illnesses (7). Common sources include-raw or undercooked meat, unpasteurized dairy

185
Bhumi Publishing, India

products, contaminated water, and improperly handled fruits and vegetables. Proper
food handling, cooking, and hygiene practices are essential to prevent and control
biological contamination. Additionally, maintaining a clean and sanitary environment
during food processing and production is crucial to mitigate the risk of introducing
harmful microorganisms into the food supply (8).
• Chemical food contamination: It occurs when harmful substances, either naturally
occurring or introduced during food processing, handling, or storage, contaminate food.
These substances can include pesticides, food additives, preservatives, heavy metals,
and environmental pollutants. Chemical contamination may result from the use of
pesticides in agriculture, improper use of food additives, contamination during food
processing, or the leaching of chemicals from packaging materials. Adverse health
effects can range from acute poisoning to long-term health issues. Rigorous monitoring,
adherence to safety regulations, and proper handling of chemicals throughout the food
supply chain are essential to minimize the risk of chemical contamination in food (9).
• Physical food contamination: It involves the presence of foreign objects or substances
in food that can cause harm if consumed such as glass, metal, wood, plastic, or other
materials inadvertently introduced during the production, processing, packaging, or
handling of food. Physical contaminants can lead to injuries such as cuts, choking, or
internal damage. Prevention measures include strict quality control, proper handling
practices, and the use of appropriate materials in food processing and packaging.
Regular inspection and adherence to safety protocols help minimize the risk of physical
contamination in the food supply chain, ensuring consumer safety and product integrity
(10).

Figure 1: Common types of food contamination

186
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Common sources of food contamination in fridge
• Raw ingredients: Contaminated raw materials, such as fruits, vegetables, and meats,
can introduce harmful microorganisms into the food supply.
• Cross-Contamination: Transfer of contaminants from one surface or food item to
another, typically during food preparation, if proper hygiene practices are not followed.
• Storage: Improper storage conditions, such as incorrect temperatures or exposure to
contaminants, can lead to food spoilage and contamination.
• Transportation: Contamination may occur during transportation if proper handling and
storage procedures are not followed.
• Water and air quality: Water used in food production and air quality in food
processing areas can be sources of contamination (11).
• Personnel: Poor personal hygiene of food handlers can introduce harmful
microorganisms during food preparation and handling.
• Packaging Materials: Materials used in packaging, if not food-safe, may transfer
harmful substances to the food (12).
Contamination during the food production, processing, storage, and preparation phases
Contamination risks exist at various stages of the food production and consumption
process.
• Food Production: During agricultural practices use of pesticides and fertilizers can
leave residues on crops (13). Livestock farming involve application of antibiotics and
hormones to animals and thus facilitate their transfer into meat and dairy products (14).
• Food Processing: Cross contamination may occur through shared equipment and
surfaces and lead to the transfer of pathogens between different food products. Improper
use or contamination of additives and preservatives can impose health risks (15).
• Storage: Inadequate refrigeration can promote bacterial growth, especially in perishable
foods. Packaging Materials: Contaminants from packaging materials may leach into the
food (16).
• Preparation: Poor personal hygiene practices by food handlers can introduce
pathogens.
Cross-Contamination
Using the same cutting board or utensils for raw and cooked foods can lead to
contamination (17). Addressing contamination at each phase involves implementing proper
hygiene practices, adhering to safety standards, regular testing, and educating both producers and
consumers about safe food handling practices (18-19). Environmental influences can contribute
to food contamination in several ways (Figure 2).
• Water Contamination: Polluted water sources used in irrigation or processing can
introduce harmful microorganisms, chemicals, or heavy metals to crops and seafood (20).

187
Bhumi Publishing, India

• Airborne Contaminants: Dust, pollutants, or contaminants in the air can settle on crops
or food during outdoor storage, posing a risk to food safety (21).
• Soil Contamination: Contaminated soil may transfer pollutants or heavy metals to crops,
affecting the safety of the harvested food (22).
• Climate Change: Altered weather patterns can impact the spread of pests, pathogens,
and mycotoxins, influencing the safety of agricultural products (23-28).

Figure 2: Contamination in the food production and processing

Chemical contaminants in drinking water
Chemical contaminants in drinking water can include various substances, posing
potential health risks. Some common examples are:
• Heavy Metals: Lead, arsenic, mercury, and cadmium can leach into water sources from
natural deposits or industrial activities, leading to long-term health issues (29).
• Disinfection Byproducts: Chlorine or other disinfectants used in water treatment can
react with organic matter, forming byproducts such as trihalomethanes, which may have
health implications (30).
• Pesticides and Herbicides: Agricultural runoff can introduce pesticides and herbicides
into water sources, impacting drinking water quality (31).

188
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

• Industrial Chemicals: Effluents from industrial activities may contain various

chemicals, including solvents, heavy metals, and persistent organic pollutants, which can
contaminate water (32-35).
Cross contamination of food products
To avoid cross-contamination in food preparation, segregate raw meats from ready-to-eat
items, utilizing separate cutting boards and utensils for each. Hands should be washed
thoroughly after handling raw meat and before touching other foods. Colour-coded or labeled
tools need to be employed to distinguish between different types of ingredients. Surfaces,
countertops, and equipment are to be cleaned and sanitized regularly, particularly after working
with raw meats. Raw and cooked foods should be stored separately in the refrigerator, ensuring
raw meats are at the bottom to prevent drips onto other items. Adhering to these practices
minimizes the risk of harmful bacteria spreading and enhances overall food safety (36).
Naturally occurring contaminants in food
Mycotoxins produced by certain molds, mycotoxins can contaminate crops like grains,
nuts, and fruits. Mycotoxin such as aflatoxins can be carcinogenic (37). Biogenic Amines are
formed during the decay of proteins in certain foods. Biogenic amines like histamine and
tyramine can be found in aged cheeses, fermented products, and some fish. While not
contaminants in the traditional sense, allergens naturally present in foods can cause adverse
reactions in sensitive individuals. Common allergens include peanuts, tree nuts, shellfish, and
gluten (38). Certain foods can contain naturally occurring heavy metals such as mercury, lead,
and cadmium due to environmental factors Fish for instance, may accumulate mercury from
water sources (39).
Types of bacteria in refrigerated food
Refrigeration slows down bacterial growth but doesn't eliminate it entirely. Several types
of bacteria can still persist in refrigerated food.
Psychrotrophs: These bacteria can grow at colder temperatures, including those found in
refrigerators such as Listeria monocytogenes and Yersinia enterocolitica.
Spoilage Bacteria: While not necessarily harmful, spoilage bacteria can affect the taste, texture,
and appearance of food such as Pseudomonas and Bacillus species.
Pathogenic Bacteria: Some pathogenic bacteria can survive in refrigerated conditions, albeit at
a slower rate such as Salmonella, Escherichia coli (E. coli) etc.
Fecal coliforms, S. aureus, Enterobacteriaceae are also some of the food contamination
pathogens in the fridge. Campylobacter sp, Yersinia enterocolitica and Staphylococcus aureus
are also reported.
Overall reason for food contamination
Food contamination can result from various factors. Microbial pathogens like bacteria,
viruses, and parasites are common causes of foodborne illnesses. Improper handling, storage, or

189
Bhumi Publishing, India

cooking can lead to the proliferation of these pathogens (40). Cross-contamination causes
transfer of harmful microorganisms from one surface of a food item to another can occur during
food preparation, often through shared utensils or inadequate cleaning practices (41). Poor
hygiene practices like lack of proper handwashing, sanitation, and personal hygiene by food
handlers can introduce harmful bacteria into the food. Contaminated water and raw ingredients
used in food preparation and raw ingredients may carry contaminants. Agricultural practices,
such as pesticide use, can also contribute to contamination (42). Improper storage and
temperature control can promote the growth of bacteria, making food unsafe for consumption
(43-44).
Effects of food contamination
Food contamination can have various adverse effects on individuals and public health.
Consuming contaminated food can lead to foodborne diseases, causing symptoms like nausea,
vomiting, diarrhea, abdominal pain, and, in severe cases, hospitalization or death. Certain
contaminants, such as heavy metals or mycotoxins, may have cumulative effects over time,
leading to chronic health issues like organ damage, neurological disorders, or cancer. Outbreaks
of foodborne illnesses can result in significant economic losses due to medical expenses, reduced
productivity, and damage to the food industry's reputation. Food contamination incidents can
erode public trust in food safety systems and the reliability of certain food products or brands.
Preventing food contamination through robust food safety measures, education, and effective
regulation is crucial to safeguard public health and maintain the integrity of the food supply
chain (45).
Global implication of food contamination
Foodborne illnesses resulting from contamination can lead to widespread health issues,
affecting individuals, communities, and healthcare systems globally. The severity ranges from
mild illnesses to severe cases and even fatalities. Foodborne diseases result in significant
economic burdens due to medical expenses, lost productivity, and costs associated with
managing outbreaks. Additionally, contamination events can lead to the destruction of large
quantities of food, causing financial losses for both producers and distributors. High-profile cases
of food contamination can erode consumer confidence in the safety of food products. This loss of
trust can affect consumer behavior, leading to changes in purchasing habits and preferences.
Contamination can pose a threat to food security by reducing the availability of safe and
nutritious food. This is particularly critical in regions where access to a diverse and secure food
supply is already a challenge (46).
Ineffective refrigeration and food borne illness at home
Ineffective refrigeration at home can contribute to foodborne illnesses due to temperature
fluctuations, overcrowding, inadequate sealing, poor organization and delayed consumption.

190
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Inconsistent temperature maintenance can lead to bacterial growth. A refrigerator set above 40°F
(4°C) may not adequately slow down bacteria, increasing the risk of contamination. Overloading
the refrigerator restricts airflow, causing uneven cooling. Certain areas may not reach the
necessary temperature, allowing bacteria to thrive in warmer zones. Damaged gaskets or seals
can result in air leaks, affecting the refrigerator's efficiency. This comprises the applicant's ability
to maintain a consistently low temperature, promoting bacterial proliferation. Improper storage
and organization can lead to cross-contamination. Raw meats, seafood, or poultry stored above
ready-to-eat foods can transfer harmful bacteria, posing a health risk. Failing to consume
perishable items before their expiration dates increases the likelihood of consuming spoiled or
contaminated food.
To prevent foodborne illnesses, it's crucial to maintain proper refrigeration conditions,
practice good hygiene, and adhere to safe food storage practices at home. Regular cleaning,
temperature monitoring, and awareness of food expiration dates are essential components of food
safety (47).
Factors that affect food safety
• Poor personal hygiene of food handlers, inadequate handwashing, and unsanitary
conditions in food preparation areas can introduce contaminants.
• Inadequate refrigeration or cooking temperatures can promote the growth of bacteria and
other pathogens in food.
• Water used in food preparation and the quality of raw ingredients, including produce and
meats, can introduce contaminants.
• As food production becomes more globalized, complex supply chains increase the risk of
contamination during transportation, storage, and distribution.
• Cross-Contamination: Improper handling of raw and cooked foods, as well as using the
same utensils or surfaces for both, can lead to the transfer of harmful microorganisms.
• Technology and Processing Methods: Innovations in food processing, packaging, and
preservation methods can introduce new challenges or risks if not implemented correctly
(48).
Importance of food safety for community health
Foodborne infections affect millions of people annually, leading to significant morbidity
and mortality. The World Health Organization (WHO) estimates that approximately 600 million
individuals worldwide experience foodborne illnesses each year. Out of this staggering number,
around 420,000 people succumb to these infections. Various factors contribute to foodborne
infections, including bacteria (e.g. Salmonella, Campylobacter), viruses (e.g. Norovirus,
Hepatitis A), parasites (e.g. Giardia, Cryptosporidium), and toxins produced by certain
microorganisms. Contaminated food, inadequate hygiene practices during food preparation, and
improper storage conditions are common causes. The impact of foodborne illnesses extends

191
Bhumi Publishing, India

beyond immediate health effects. Economic costs related to medical treatment, loss of
productivity, and food recalls pose additional burdens on societies and industries. Preventive
measures such as stringent food safety regulations, proper hygiene education, and robust
surveillance systems are essential to reduce the incidence of foodborne infections and their
associated fatalities. Public awareness and adherence to safe food handling practices also play a
crucial role in minimizing the global burden of foodborne diseases (49). Ensuring safe food
practices helps prevent the spread of foodborne illnesses, which can lead to severe health
consequences. Contaminated food can harbor bacteria, viruses, parasites, and toxins, causing
infections and diseases.
Proper food safety measures reduce the risk of foodborne diseases, minimizing the
number of individuals falling ill and requiring medical attention. Children, elderly individuals,
pregnant women, and those with compromised immune systems are more susceptible to severe
consequences of foodborne infections. Food safety measures safeguard these vulnerable groups
Reducing Fewer cases of foodborne illnesses mean less strain on healthcare systems, decreasing
hospitalizations, medical expenses, and the demand for healthcare resources.
Foodborne outbreaks can lead to economic losses due to medical costs, lost productivity,
and damage to the reputation of food producers and distributors. Ensuring food safety helps
maintain a robust and trustworthy food industry. Strict adherence to food safety standards fosters
trust among consumers. When people have confidence in the safety of their food supply, they are
more likely to make healthy food choices and support local food industries. Chronic health issues
can result from repeated exposure to low levels of contaminants in food. Adhering to food safety
practices promotes long-term community health and reduces the risk of chronic diseases related
to food consumption. Overall, prioritizing food safety is essential for maintaining a healthy
community, preventing the spread of diseases (50)
Safe handling and storage of food in the refrigerator
The refrigerator temperature is kept at or below 40°F (4°C) to slow down bacterial
growth. A refrigerator thermometer is used to monitor and maintain the proper temperature.
Separation of raw and ready-to-eat foods done during storage like raw meats on the bottom shelf
to prevent cross-contamination and to be kept in leak-proof containers or sealed plastic bags. The
ready-to-eat foods, like fruits and leftovers, are to be kept on higher shelves. Proper Storage
Containers are used for different food items. Use of airtight containers or wrap foods tightly in
plastic wrap or aluminum foil prevent odors from spreading and to maintain freshness. Labeling
and Dating must be done. Containers with the early date need timely consumption. Regular
Cleaning are to be ensured. Any spills should be cleaned promptly to prevent the growth of
bacteria and the transfer of odors. Shelves and drawers are wiped down regularly. Frequent
checks on expiration dates on packaged foods need to be monitored and discard items that have
passed their use-by dates. Inspect fruits and vegetables for signs of spoilage and discard if

192
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
necessary. By following these precautions, one can minimize the risk of foodborne illness and
maintain food quality (51).
Discussion:
A 2006 study revealed that in India a notable reason behind most of the foodborne
illnesses is pathogenic contamination of stored, prepared and even preserved food. Some studies
found that refrigerators can cause wider spectrum cross contamination of food if not used
properly. A study in Scotland said that maximum cases of household food poisoning occur
because of mishandling of food. Salmonella is the most widely known pathogen for refrigerator
food contamination in Australia. Almost every house keeps raw foods and cooked foods side by
side on the same fridge shelves. In some houses, covering the food containers was not done
properly. In a few cases, raw fish were stored in the fridge for several days. Even sometimes raw
meat and cold food like ice cream were stored in the same place in the fridge without proper
covering. Maximum houses don’t even clean the fridge on a regular basis, and remain uncleaned
for a long time. A study in the USA showed — only 6% people clean refrigerators weekly and
80% people clean it monthly once or less. Sometimes a water bottle is kept even without a cap in
the fridge. It is reported from many houses that they are unaware of the knob for temperature
setting or regulating the fridge. Lack of knowledge and awareness that food contamination can
happen even in refrigerators, among people. A study says that 50% of people in the survey were
unaware of ‘cross contamination’ due to their poor education level. Even they were unaware of
microbial growth in food stored in the fridge due to uncleanliness (52). Apparently, the survey
showed that younger than 25 years respondents were more aware about the correct temperature
for refrigeration. Urban respondents have more general knowledge of pathogens which causes
food contamination than rural respondents (53). Preventing food contamination involves
implementing a combination of good practices at various stages of the food supply chain.
Enforce strict hygiene practices among food handlers, including regular handwashing, proper use
of gloves, and maintaining a clean working environment. Follow safe food handling practices,
including separate storage for raw and cooked foods, avoiding cross-contamination, and using
clean utensils and surfaces. Ensure that food is cooked thoroughly to kill harmful
microorganisms, and maintain proper temperatures during storage and transportation to prevent
bacterial growth. Implement rigorous quality control measures during food processing,
manufacturing, and packaging to detect and eliminate contaminants. Ensure the quality and
safety of water used in food production and maintain clean air in food processing areas to
prevent contamination (54). Implement effective pest control measures to prevent insects or
rodents from contaminating food storage and processing areas. Provide ongoing training for
personnel involved in food handling to keep them informed about proper practices and the
importance of food safety. Use food-safe packaging materials and ensure proper sealing to
prevent physical and chemical contamination (14).

193
Bhumi Publishing, India

Conclusion:
Food contamination is a critical concern that poses serious risks to public health and
safety. Whether biological, chemical, or physical, contaminants can enter the food supply chain
at various stages, from production to distribution and preparation. Preventing contamination
requires a comprehensive approach, including stringent hygiene practices, proper food handling,
quality control measures, and compliance with regulatory standards. Ongoing education and
training, along with the use of safe packaging materials, contribute to maintaining the integrity of
the food supply. Vigilance across the entire food industry is essential to identify and address
potential sources of contamination, ultimately safeguarding consumers and ensuring the delivery
of safe and high-quality food products.
Acknowledgement:
The authors acknowledge their departments and Institute. This review received no
external funding.
References:
1. Robertson L., Sprong H., Ortega Y., van der Giessen J., Fayer R. (2014). Impacts of
globalisation on foodborne parasites. Trends Parasitol. 30, 37–52.
https://doi.org/10.1016/j.pt.2013.09.005
2. Salter S. (2014). The food-borne identity. Nat. Rev. Microbiol. 12, 533–533.
https://doi.org/10.1038/nrmicro3313
3. Callejón R., Rodríguez-Naranjo M., Ubeda C., Hornedo-Ortega R., Garcia-Parrilla M.,
Troncoso A. (2015). Reported foodborne outbreaks due to fresh produce in the United
States and European Union: trends and causes. Foodborne Pathog. Dis. 12, 32–38.
https://doi.org/10.1089/fpd.2014
4. CDC (2013). Surveillance for Foodborne Disease Outbreaks—United States, (2009-2010).
Ann. Emerg. Med. 62, 91–93. https://doi.org/10.1016/j.annemergmed.2013.04.001
5. Song Q., Zheng Y. J., Xue Y., Sheng W. G., Zhao M. R. (2017). An evolutionary deep
neural network for predicting morbidity of gastrointestinal infections by food
contamination. Neurocomputing 226, 16–22. https://doi.org/10.1016/j.neucom.2016.11.018
6. Rather IA, Koh WY, Paek WK, Lim J. (2017). The Sources of Chemical Contaminants in
Food and Their Health Implications. Front Pharmacol. 17;8:830.
https://doi.org/10.3389/fphar.2017.00830
7. Wilcock A., Pun M., Khanona J., Aung M. (2004). Consumer attitudes, knowledge and
behaviour: a review of food safety issues. Trends Food Sci. Technol. 15, 56–66.
https://doi.org/10.1016/j.tifs.2003.08.004
8. Ingelfinger J. (2008). Melamine and the global implications of food contamination. N.
Engl. J. Med. 359, 2745–2748. https://doi.org/10.1056/NEJMp0808410

194
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
9. Mastovska K. (2013). Modern Analysis of Chemical Contaminants in Food. Food Safety
Magazine. Available online at: http://www.foodsafetymagazine.com/magazine-
archive1/februarymarch-2013/modern-analysis-of-chemical-contaminants-in-food/
10. chrenk D. (2004). Chemical food contaminants. Bundesgesundheitsblatt
Gesundheitsforschung Gesundheitsschutz 47, 841–877. https://doi.org/10.1007/s00103-
004-0892-6
11. Hussain MA. (2016) Food Contamination: Major Challenges of the Future. Foods, 5(2):21.
https://doi.org/10.3390/foods5020021
12. Stefano V. D. & Avellone, G. (2014) “Food contaminants,” Journal of Food Studies,
3,(1),88-103. https://doi.org/10.5296/jfs.v3i1.6192
13. Sadiku, M., Ashaolu, T.J. & Sarhan. M. (2020). Food Contamination: A Primer.
International Journal of Advances in Scientific Research and Engineering. 06. 01-07.
https://doi.org/10.31695/IJASRE.2020.33736
14. Nerín, C., Margarita, A., & Carrizo, D. (2015). Food contamination during food process.
Trends in Food Science & Technology. 48. https://doi.org/10.1016/j.tifs.2015.12.004
15. Villanueva, C. M., Gracia-Lavedan, E., Julvez, J., Santa-Marina, L., Lertxundi, N.,
Ibarluzea, J., Llop, S., Ballester, F., Fernández-Somoano, A., Tardón, A., Vrijheid, M.,
Guxens, M., & Sunyer, J. (2018). Drinking water disinfection by-products during
pregnancy and child neuropsychological development in the INMA Spanish cohort
study. Environment international, 110, 113–122.
https://doi.org/10.1016/j.envint.2017.10.017
16. Wang, R. Y., & Needham, L. L. (2007). Environmental chemicals: from the environment
to food, to breast milk, to the infant. Journal of toxicology and environmental health. Part
B, Critical reviews, 10(8), 597–609. https://doi.org/10.1080/10937400701389891
17. Ingelfinger J. R. (2008). Melamine and the global implications of food contamination. The
New England journal of medicine, 359(26), 2745–2748.
https://doi.org/10.1056/NEJMp0808410
18. Yiğit, V. & Duran, T. 1997. Institutional Nutrition Technology I (in Turkish). Ekin
Publishing, Istanbul, Turkey.
19. WHO, 2012. Five keys to growing safer fruits and vegetables: promoting health by
decreasing microbial contamination, Geneva.
20. WHO, 2003. Assuring food safety and quality: guidelines for strengthening national food
control systems. Food and Agriculture Organization of the United Nations.
21. United States Department of Health and Human Services. Healthy People 2020: Food
Safety; United States Department of Health and Human Service, Office of Disease
Prevention and Health Promotion: Washington, DC, USA, 2010.

195
Bhumi Publishing, India

22. WHO 2004 Surveillance programme for control of food borne infections and toxications in
Europe 8th report. Journal Infec.43, 80-84.
23. Calderon, R. (2000). The epidemiology of chemical contaminants of drinking water. Food
Chem. Toxicol. 38, S13–S20. https://doi,org/10.1016/S0278-6915(99)00133-7
24. Bai, Y., Lin, X. H., Zhu, J. H., Cui, S. H., Guo, L. X., Yan, S. F., Wang, W., Xu, J., & Li,
F. Q. (2021). Quantification of Cross-Contamination of Campylobacter jejuni during Food
Preparation in a Model Kitchen in China. Journal of food protection, 84(5), 850–856.
https://doi.org/10.4315/JFP-20-280
25. Osaili, T. M., Obaid, R. S., Alowais, K., Almahmood, R., Almansoori, M., Alayadhi, N.,
Alowais, N., Waheed, K., Dhanasekaran, D. K., Al-Nabulsi, A. A., Ayyash, M., &
Forsythe, S. J. (2020). Microbiological quality of kitchens sponges used in university
student dormitories. BMC public health, 20(1), 1322. https://doi.org/10.1186/s12889-020-
09452-4
26. Sinha, A., & Dutta, S. (2019). Waterborne & foodborne viral hepatitis: A public health
perspective. The Indian journal of medical research, 150(5), 432–435.
https://doi.org/10.4103/ijmr.IJMR_1430_18
27. Pal, M, Ayele, Y. (2020). Emerging Role of Foodborne Viruses in Public Health. 5. 1-04.
28. Pal, M. & Hofmeister, M. (2021). Food Contamination Poses a Threat to Food Safety. 3: 1-
4.
29. Pal, M & Jadhav, V. (2013). Microbial Contamination of various Indian Milk Products.
Beverage and Food World. 39. 43-44.
30. Gibb, H. J., Barchowsky, A., Bellinger, D., Bolger, P. M., Carrington, C., Havelaar, A. H.,
Oberoi, S., Zang, Y., O'Leary, K., & Devleesschauwer, B. (2019). Estimates of the 2015
global and regional disease burden from four foodborne metals - arsenic, cadmium, lead
and methylmercury. Environmental research, 174, 188–194.
https://doi.org/10.1016/j.envres.2018.12.062
31. Gleason, K., Shine, J. P., Shobnam, N., Rokoff, L. B., Suchanda, H. S., Ibne Hasan, M. O.,
Mostofa, G., Amarasiriwardena, C., Quamruzzaman, Q., Rahman, M., Kile, M. L.,
Bellinger, D. C., Christiani, D. C., Wright, R. O., & Mazumdar, M. (2014). Contaminated
turmeric is a potential source of lead exposure for children in rural Bangladesh. Journal of
environmental and public health, 2014, 730636. https://doi.org/10.1155/2014/730636
32. Naujokas, M. F., Anderson, B., Ahsan, H., Aposhian, H. V., Graziano, J. H., Thompson,
C., & Suk, W. A. (2013). The broad scope of health effects from chronic arsenic exposure:
update on a worldwide public health problem. Environmental health perspectives, 121(3),
295–302. https://doi.org/10.1289/ehp.1205875

196
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
33. Currie, J., Zivin, J. G., Meckel, K., Neidell, M., & Schlenker, W. (2013). Something in the
water: contaminated drinking water and infant health. The Canadian journal of economics.
Revue canadienne d'economique, 46(3), 791–810. https://doi.org/10.1111/caje.12039
34. Gibb, H., Devleesschauwer, B., Bolger, P. M., Wu, F., Ezendam, J., Cliff, J., Zeilmaker,
M., Verger, P., Pitt, J., Baines, J., Adegoke, G., Afshari, R., Liu, Y., Bokkers, B., van
Loveren, H., Mengelers, M., Brandon, E., Havelaar, A. H., & Bellinger, D. (2015). World
Health Organization estimates of the global and regional disease burden of four foodborne
chemical toxins, 2010: a data synthesis. F1000Research, 4, 1393.
https://doi.org/10.12688/f1000research.7340.1
35. Muir, D. C., & Howard, P. H. (2006). Are there other persistent organic pollutants? A
challenge for environmental chemists. Environmental science & technology, 40(23), 7157–
7166. https://doi.org/10.1021/es061677a
36. Ruzzin J. (2012). Public health concern behind the exposure to persistent organic
pollutants and the risk of metabolic diseases. BMC public health, 12, 298.
https://doi.org/10.1186/1471-2458-12-298
37. Marriott, N.G. & Gravani, R.B. (2006) Principles of Food Sanitation, New York, NY:
Springer,5th Edition.
38. Isara, A. R., Isah, E. C., Lofor, P. V., & Ojide, C. K. (2010). Food contamination in fast
food restaurants in Benin City, Edo State, Nigeria: Implications for food hygiene and
safety. Public health, 124(8), 467–471. https://doi.org/10.1016/j.puhe.2010.03.028
39. Maftoonazad, N., & Badii, F. (2009). Use of edible films and coatings to extend the shelf
life of food products. Recent patents on food, nutrition & agriculture, 1(2), 162–170.
https://doi.org/10.2174/2212798410901020162
40. Wang RY, Needham LL. Environmental chemicals: from the environment to food, to
breast milk, to the infant. J Toxicol Environ Health B Crit Rev. 2007 Dec;10(8):597-609.
https://doi.org/10.1080/10937400701389891
41. Olaimat, A. N., Taybeh, A. O., Al-Nabulsi, A., Al-Holy, M., Hatmal, M. M., Alzyoud, J.,
Aolymat, I., Abughoush, M. H., Shahbaz, H., Alzyoud, A., Osaili, T., Ayyash, M.,
Coombs, K. M., & Holley, R. (2024). Common and Potential Emerging Foodborne
Viruses: A Comprehensive Review. Life (Basel, Switzerland), 14(2), 190.
https://doi.org/10.3390/life14020190
42. Hamidiyan, N., Salehi-Abargouei, A., Rezaei, Z., Dehghani-12. Tafti, R., Akrami-
Mohajeri, F. The prevalence of Listeria spp. food contamination in Iran: A systematic
review and meta-analysis. Food Research International, 107, 437-450.2018.
43. Troeger, C., Khalil, I.A., Rao, P.C, Cao, S., Blacker, B.F., 13. Ahmed, T., Armah, G.,
Bines, J.E., Brewer, T.G., Colombara, D.V., Kang, G., Kirkpatrick, B.D., Kirkwood, C.D.,
Mwenda, J.M., Parashar, U.D., Petri, W.A. Jr., Riddle, M.S., Steele, A.D., Thompson,

197
Bhumi Publishing, India

R.L., Walson, J.L., Sanders, J.W., Mokdad, A.H., Murray, C.J.L., Hay, S.I., Reiner, R.C.Jr.
Rotavirus vaccination and the global burden of rotavirus diarrhea among children younger
than 5 years. Journal of American Medical Association Pediatrics, 172, 958-965.2018.
44. Sospedra, I., Rubert, J. V., Soler, C., Soriano, J. M., & Mañes, J. (2009). Microbial
contamination of milk and dairy products from restaurants in Spain. Foodborne pathogens
and disease, 6(10), 1269–1272. https://doi.org/10.1089/fpd.2009.0337
45. Fung, F., Wang, H. S., & Menon, S. (2018). Food safety in the 21st century. Biomedical
journal, 41(2), 88–95. https://doi.org/10.1016/j.bj.2018.03.003
46. Fung, F., Wang, H. S., & Menon, S. (2018). Food safety in the 21st century. Biomedical
journal, 41(2), 88–95. https://doi.org/10.1016/j.bj.2018.03.003
47. Uyttendaele M, Franz E, Schlüter O. Food safety, a global challenge. Int J Environ Res
Public Health. 2016;13(1):67. https://doi.org/10.3390/ijerph13010067
48. Pal, M., Selamawit, M., Muluken, T., Suneeta, P. & Jashbhai, P. (2016). Bacterial
Contamination of Dairy Products. Beverage and Food World. 43. 40-43.
49. Scott, E., Bloomfield, S. F., & Barlow, C. G. (1982). An investigation of microbial
contamination in the home. The Journal of hygiene, 89(2), 279–293.
https://doi.org/10.1017/s0022172400070819
50. Towns, R. E., Cullen, R. W., Memken, J. A., & Nnakwe, N. E. (2006). Food safety-related
refrigeration and freezer practices and attitudes of consumers in Peoria and surrounding
counties. Journal of food protection, 69(7), 1640–1645. https://doi.org/10.4315/0362-028x-
69.7.1640
51. Gettings, M. A., & Kiernan, N. E. (2001). Practices and perceptions of food safety among
seniors who prepare meals at home. Journal of nutrition education, 33(3), 148–154.
https://doi.org/10.1016/s1499-4046(06)60184-x
52. Obande, D. and Young, L., Safe food refrigeration knowledge, attitudes, and practices of
university students. Br. Food J., 2020, 122(4), 1085-1098. https://doi.org/10.1108/BFJ-05-
2019-0327
53. Yella, R., Ramachandrappa, N.K.,Vemula, S., Balakrishna, N. & Gavaravarapu, S. (2016).
Food Safety in Domestic Refrigerators - A Mixed Methods Study to Identify Key
Messages for Promoting Safe Storage Practices among Households. The Indian journal of
nutrition and dietetics. 53. 1-14. https://doi.org/10.21048/ijnd.2016.53.1.3871
54. Kennedy, J., Jackson, V., Blair, I. S., McDowell, D. A., Cowan, C., & Bolton, D. J. (2005).
Food safety knowledge of consumers and the microbiological and temperature status of
their refrigerators. Journal of food protection, 68(7), 1421–1430.
https://doi.org/10.4315/0362-028x-68.7.1421

198
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

DIRECTING HUMAN FOOD HABITS TOWARD GLOBAL SUSTAINABILITY

Biswajit Saha
Department of Physiology,
Vidyasagar College for Women,
39, Sankar Ghosh Lane, Kolkata 700006, West Bengal, India

Abstract:
It's important to note that the world population is expected to exceed 9 billion by 2050,
and there are growing concerns about the sustainability of livestock farming. Red meat in
particular has a larger environmental footprint. Modest meat consumption has been
recommended not only to avoid deficiencies in essential nutrients but also to reduce the
development of chronic diseases and have a significant positive impact on global food security.
Studies have shown that vegetarian and vegan diets are the most affordable, while pescatarian
diets are the most expensive. Sustainable diets that address health and environmental concerns
associated with food production and consumption can be pursued by replacing animal-based
foods with plant-based foods. Such diets are particularly effective in high-income countries,
improving nutritional content, reducing premature mortality, and reducing some environmental
impacts. Regulated public health strategies that focus on improving energy balance need to be
implemented by governments.
Introduction and background:
Providing adequate human nutrition within the carrying capacity of ecosystems is a key
element of the global challenge of environmental sustainability. The 2030 Agenda for
Sustainable Development is a vision that was launched by the United Nations in 2015. The
agenda's primary objective is to promote a healthy and progressive future for all people on the
planet. The agenda aims to stop climate change and prevent its most devastating effects to
protect and restore the planet's environment and natural resources. The world population, which
currently stands at 7.3 billion, is expected to exceed 9 billion by 2050. The Food and Agriculture
Organization (FAO) has predicted that by 2050, 70% more food will be needed to meet the needs
of the growing population, which is a major challenge due to limited resources and arable land
(Silva, 2012). Although meat consumption is declining in developed countries, it is increasing
worldwide as consumers are generally unwilling to limit their meat consumption (Turnes, A.,
Pereira, P., Cid, H., & Valente, A., 2023). This is particularly true for developing countries such
as China, India, and Russia, as these populations are increasingly middle class and demand more
luxury products such as meat or other animal products (e.g. cheese, and dairy products) (Chen,
C., Chaudhary, A., & Mathys, A., 2019).

199
Bhumi Publishing, India

The adoption of healthy and sustainable diets could be critical to protecting the Earth's
natural resources and reducing diet-related mortality, but their adoption could be hindered if such
diets prove more expensive and unaffordable for some populations. Demand-side interventions,
such as change in food habits, can significantly contribute towards the achievement of 2030
national sustainable development goals at the global level.
Environmental impact of current eating habits
Our current eating habits, especially our meat and dairy consumption, have a high
environmental impact. Meat is an important source of high-quality dietary protein and a wide
range of micronutrients, including iron, zinc, selenium, vitamin D, and vitamin B12, for a large
proportion of the world's population. While these nutrients can be obtained in sufficient
quantities by consumption of a range of fruits and vegetables, access to meat often protects
against malnutrition and improves cognitive development in children in many developing
countries where the availability of such foods may be limited. However, excessive consumption
of meat and meat products, particularly in developed countries, is often associated with excessive
energy and fat consumption, leading to overweight, obesity, and an increased risk of chronic
diseases such as cardiovascular disease and type 2 diabetes, as well as cancer, particularly
colorectal cancer (Salter A. M., 2018). Because of population growth and global warming, there
is growing concern about the sustainability of livestock farming. Recently, environmental
concerns have also grown, with greenhouse gas emissions being 57% higher for beef when
compared with tofu and four times higher for poultry (Millward, D. J., & Garnett, T., 2010). Red
meat, in particular, has a larger environmental footprint. Despite the environmental concerns,
studies have shown that meat consumers are often unwilling to change their eating habits for
environmental reasons. While modest meat consumption is essential to avoid nutrient
deficiencies, limiting meat consumption can help reduce the development of chronic diseases
and significantly boost global food security. Consumers need to consider the impact of their
dietary choices on the environment.
Sustainable diets: concept, benefits and challenges
The vegetarian and vegan diets are most commonly used in terms of the different dietary
change scenarios. While the vegan diet excludes all animal foods, the vegetarian diet may
include dairy products. The pescatarian diet excludes meat but may include fish. Another variant
like the ovo-lacto-vegetarian diet may include both eggs and dairy products. The flexitarian or
semi-vegetarian diet is a predominantly plant-based diet that occasionally includes meat or fish.
In the face of population growth and global warming, there is growing concern about the
sustainability of agricultural animal production. Modest meat consumption is an important
strategy not only to avoid deficiencies in essential nutrients but also can reduce the development
of several chronic diseases and could have a significant positive impact on global food security.

200
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
Meat alternatives are products that are similar to meat in taste and texture but are made
from protein sources that are not derived from animals. Plant-based proteins are the most
commonly used ingredients in the preparation of meat alternatives. Soy, wheat gluten, and
mushrooms are the most important ingredients in this context. Soy is used for its high nutritional
value in producing protein-rich products such as tofu, which is obtained by curdling and pressing
soy curd into a compact block. Soy flour is the least processed soy product used for the
production of texturized vegetable soy protein as well as soy protein concentrate (70% protein)
and isolate (90% protein). Soy meat alternatives, such as texturized vegetable protein, are usually
produced by an extrusion process that allows for different shapes and sizes of the product. Wheat
gluten, also known as seitan, is obtained by isolating starch from wheat flour and is used for its
binding, dough-forming, and leavening properties. Its cohesive and chewy quality gives products
made with wheat gluten a meat-like texture. Mushrooms are sometimes added to make the dish
more palatable (Kumar, P.; Chatli, M.K.; Mehta, N.; Singh, P.; Malav, O.P.; Verma, A.K., 2017)
(Malav, O.P.; Talukder, S.; Gokulakrishnan, P.; Chand, S., 2015). Legume proteins from peas,
lentils, lupins, or chickpeas are also used to make meat alternatives. Research shows that pea-
based protein is indeed one of the most promising alternatives to animal-based protein. It has a
high nutritional value, is rich in essential amino acids, and is easily digestible. Pea protein is also
sustainable and environmentally friendly as it requires less water and land to produce compared
to animal-based protein sources. In addition, it is a good option for people with dietary
restrictions such as lactose intolerance, as it is dairy-free. When heated, oilseed proteins from
rapeseed and canola can be used as structuring agents, promoting a meat-like texture
(Kyriakopoulou, K.; Dekkers, B.; van der Goot, A.J., 2019).
Mycoprotein is a protein-rich product that is obtained from the mycelium of the fungus
Fusarium venenatum during fermentation and can be processed for human consumption. When
mixed with a small amount of egg albumin, some roasted barley malt extract and water or a
natural flavoring is added instead of malt to mycoprotein to obtain a savory character (Finnigan,
2011). The thread-like structure of mycoprotein also gives texture to this product like meat.
Plant-based milk alternatives are extracts from legumes (chickpeas, soybeans), cereals
(oats, rice), pseudo-cereals (quinoa, teff, amaranth), nuts (almonds, cashew nuts, hazelnuts,
walnuts, coconut) or seeds (sesame, sunflower) that are consumed as a substitute for cow's milk.
These plant-based milk alternatives are made by breaking down (size reduction) plant material
(cereals, pseudo-cereals, legumes, oilseeds, nuts) in water and further homogenizing the fluids to
resemble cow’s milk in appearance and consistency. The main reasons for consuming these milk
alternatives are adopting a vegetarian or vegan diet and health reasons such as lactose intolerance
or cow’s milk protein allergy.

201
Bhumi Publishing, India

Cultured meat is produced by growing cells from farm animals using a culture medium to
replicate the complex structure of animal muscle tissue. Although the use of animals to obtain
animal cells is technically necessary, only a few animals are needed to produce large quantities
of meat due to cell proliferation (Chriki, S., & Hocquette, J. F., 2020).
Microalgae, the tiny organisms living in aquatic environments, have gained increasing
attention in recent years due to their immense nutritional value. These microorganisms are a rich
source of proteins, carbohydrates, lipids, and various bioactive compounds. Microalgae proteins
have a complete essential amino acid profile, making them an excellent dietary option.
Moreover, their protein content surpasses that of traditional sources like meat, poultry, and dairy.
Unlike most plant-based protein sources that lack certain essential amino acids, microalgae
proteins contain the complete essential amino acid profile. This makes microalgae an excellent
choice for those seeking alternative, sustainable, and complete protein sources and a promising
option in addressing global food security challenges. With the growing global population and
increasing demand for protein-rich foods, alternative and sustainable sources like microalgae can
play a significant role in meeting nutritional needs. Due to their exceptional nutritional
composition, microalgae and their derived compounds have gained recognition as dietary
supplements and potential food sources. Various forms of microalgae, such as spirulina and
chlorella, are available in the market as supplements and are often regarded as superfoods. These
supplements are rich in nutrients, easily digestible, and offer numerous health benefits. In
addition to their nutritional benefits, microalgae have also been acknowledged for their potential
positive impact on the environment. The National Academies of Sciences and Medicine,
comprising 130 academies worldwide, have recognized microalgae as one of the innovative
foods that could benefit both health and the climate. The cultivation of microalgae requires fewer
resources, such as land, water, and fertilizers, compared to traditional livestock farming.
Furthermore, microalgae can sequester carbon dioxide and produce oxygen through
photosynthesis, contributing to mitigating climate change (Alcorta, A., Porta, A., Tárrega, A.,
Alvarez, M. D., & Vaquero, M. P., 2021).
A comparative analysis of sustainable diets and the present diet, focusing on their
nutritional and environmental impact
The consumption of meat and dairy products has long been associated with a variety of
health and environmental concerns. In recent years, there has been a growing interest in plant-
based alternatives to these products. A model study was conducted with adult Dutch subjects to
investigate the effects of a diet with less or no meat and dairy products on nutrient intake and to
assess the adequacy of nutrient intake when these products are replaced with plant-based
alternatives. The study examined the nutrient intake of adults who partially (30%) or completely
(100%) replaced meat and dairy products with plant-based alternatives. The results of the study

202
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
revealed that partial replacement did not significantly change the percentages below the nutrient
spectrum when compared to the reference intake. This suggests that individuals who choose to
partially replace meat and dairy products with plant-based alternatives can maintain similar
levels of nutrient intake. Furthermore, the study found that greenhouse gas emissions and land
use were both reduced by approximately 14% when individuals partially replaced meat and dairy
products with plant-based alternatives. This demonstrates the potential environmental benefits of
adopting a diet with fewer animal products.
However, the study also found that full replacement of meat and dairy products with
plant-based alternatives was insufficient in terms of certain nutrient intake. Specifically, vitamin
A, thiamine, vitamin B12, and zinc intake were found to be inadequate in individuals following a
100% plant-based diet. These nutrients are typically found in higher quantities in animal
products, and their absence in a fully plant-based diet can lead to nutrient deficiencies
It is important to highlight that while the study focused on the nutrient intake of Dutch
adults, the findings may be applicable to other populations as well. The results suggest that
individuals who choose to completely replace meat and dairy products with plant-based
alternatives should pay special attention to ensuring adequate intake of the nutrients mentioned
earlier. This can be achieved through careful meal planning and the inclusion of fortified plant-
based alternatives. Thus, this model study conducted on adult Dutch subjects provides valuable
insights into the nutrient intake of individuals who partially or completely replace meat and dairy
products with plant-based alternatives. (Seves, 2017).
The cost of healthy and sustainable diets: their affordability and future projections
A handful of global and regional studies have been conducted by pairing a comparative
risk assessment of dietary risks with cost to estimate the costs of healthy and sustainable dietary
patterns and the costs of climate change by combining dietary scenarios with greenhouse gas
emissions footprints and estimating the social cost of carbon.
Results of those studies suggest that in high-income and upper-middle-income countries,
dietary change interventions that incentivize the adoption of healthy and sustainable diets can
help consumers in those countries not only reduce costs but also at the same time, contribute to
fulfilling national climate change commitments and reduce public health spending. Currently, in
lower-middle-income to low-income countries, conventional healthy and sustainable diets are
moderately more expensive. However, reducing food waste, a favorable socioeconomic
development scenario and a more comprehensive cost accounting that incorporates the diet-
related costs of climate change and health care into the cost of diets increased the affordability of
sustainable dietary patterns in our future projections. When these measures were combined,
healthy and sustainable dietary patterns in low-income to lower-middle-income countries were
up to 25-29% and on average up to 37% more affordable than in 2050. In general, vegetarian and

203
Bhumi Publishing, India

vegan diets were found to be the most affordable, while pescatarian diets were the most
expensive (Springmann, M., Wiebe, K., Mason-D'Croz, D., Sulser, T. B., Rayner, M., &
Scarborough, P., 2018).
Environmental and health analysis of sustainable diets
Sustainable diets aim to address the increasing health and environmental concerns
associated with food production and consumption. A joint environmental and health analysis of
different sustainable diets based on three different approaches to sustainable diets motivated by
environmental, food security, and public health objectives, conducted at the regional level using
an integrated health and environmental model across more than 150 countries, shows that
pursuing environmental goals by replacing animal-based foods with plant-based foods was
particularly effective in high-income countries in terms of improving nutritional content,
reducing premature mortality (up to 12% reduction) and reducing some environmental impacts,
particularly greenhouse gas emissions (up to 84% reduction). However, more freshwater was
also consumed (an increase of up to 16%) and the effectiveness in countries with low or
moderate consumption of food of animal origin was low. Pursuing food security goals by
reducing underweight and obesity resulted in a similar reduction in premature mortality (up to
10% reduction) and a moderate improvement in nutritional content. The adoption of an energy-
balanced, low-meat diet is also expected to meet public health goals, which are consistent with
available evidence that a healthy diet leads to an adequate supply of most nutrients and a large
reduction in premature mortality (19% reduction in flexitarian diets and 22% reduction in vegan
diets).
The outcome of another global modeling analysis with country-level details showed a
significant reduction in global environmental pollution (54-87% reduction in greenhouse gas
emissions, 23-25% reduction in nitrogen deposition, 18-21% reduction in phosphorus deposition,
8-11% reduction in cropland use and 2-11% reduction in freshwater use) and in low-income
countries in most regions, except for some environmental domains like cropland use, freshwater
use, and phosphorus deposition (Springmann, M., Clark, M. A., Rayner, M., Scarborough, P., &
Webb, P., 2021).
Conclusion:
The current findings emphasize the need for further research and education on balanced
plant-based diets to ensure optimal nutrient intake while reducing environmental impacts. While
some studies have been conducted to assess the environmental impact of food production value
chains and identify potential improvement strategies, there is still a lack of integration between
environmental, nutritional, economic, and health indicators when assessing the consequences of
dietary change. To address this gap, more case studies should be conducted in different countries
to identify sustainability indicators for various dietary transition scenarios. These studies can

204
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
help explore potential synergies and trade-offs between different indicators, allowing for a more
comprehensive understanding of the impacts of dietary choices. By accounting for not only
health and environmental factors but also economic costs, a more accurate assessment of the true
costs of different diets can be made. To promote healthy and sustainable diets, governments must
implement regulated public health strategies that focus on improving energy balance and
advocating for predominantly plant-based diets. Updating national dietary guidelines to reflect
the latest evidence on healthy eating should be prioritized not only for improving health
outcomes but also for reducing environmental impacts and meeting broader sustainability
criteria. Overall, further research, education, and policy changes are necessary to ensure that
balanced plant-based diets become the norm. By integrating different indicators and considering
the costs of diets, a healthy and sustainable diet can be the most cost-effective option in most
countries in the future. We must continue to explore the environmental, nutritional, economic,
and health implications of dietary choices to ensure a sustainable and prosperous future for all.
References:
1. Silva, J. G. (2012, June). Feeding the World Sustainably. Retrieved February 10, 2024,
from United Nation, Peace, dignity and equality:
https://www.un.org/en/chronicle/article/feeding-world-sustainably
2. Turnes, A., Pereira, P., Cid, H., & Valente, A. (2023). Meat Consumption and Availability
for Its Reduction by Health and Environmental Concerns: A Pilot Study. Nutrients, 15(14),
3080. https://doi.org/10.3390/nu15143080.
3. Chen, C., Chaudhary, A., & Mathys, A. (2019). Dietary Change Scenarios and
Implications for Environmental, Nutrition, Human Health and Economic Dimensions of
Food Sustainability. Nutrients, 11(4) , 856. https://doi.org/10.3390/nu11040856.
4. Salter A. M. (2018). The effects of meat consumption on global health. Revue scientifique
et technique (International Office of Epizootics), 37(1), 47–55.
https://doi.org/10.20506/rst.37.1.2739.
5. Millward, D. J., & Garnett, T. (2010). Plenary Lecture 3: Food and the planet: nutritional
dilemmas of greenhouse gas emission reductions through reduced intakes of meat and
dairy foods. The Proceedings of the Nutrition Society, 69(1), , 103–118.
https://doi.org/10.1017/S0029665109991868.
6. Kumar, P.; Chatli, M.K.; Mehta, N.; Singh, P.; Malav, O.P.; Verma, A.K. (2017). Meat
Analogues: Health Promising Sustainable Meat Substitutes. Crit. Rev. Food Sci. Nutr. , 57,
923–932.
7. Malav, O.P.; Talukder, S.; Gokulakrishnan, P.; Chand, S. (2015). Meat Analog: A Review.
Crit. Rev. Food Sci. Nutr. , 55, 1241–1245.

205
Bhumi Publishing, India

8. Kyriakopoulou, K.; Dekkers, B.; van der Goot, A.J. (2019). Plant-Based Meat Analogues.
In Sustainable Meat Production and Processing. Elsevier: Amsterdam, The Netherlands,
2019 , pp. 103–126; ISBN 978-0-12-814874-7.
9. Finnigan, T. (2011). Mycoprotein: Origins, production and properties. In Handbook of
Food Proteins. Elsevier: Amsterdam, The Netherlands , pp. 335–352; ISBN 978-1-84569-
758-7.
10. Chriki, S., & Hocquette, J. F. (2020). The Myth of Cultured Meat: A Review. Frontiers in
nutrition , 7, 7. https://doi.org/10.3389/fnut.2020.00007.
11. Alcorta, A., Porta, A., Tárrega, A., Alvarez, M. D., & Vaquero, M. P. (2021). Foods for
Plant-Based Diets: Challenges and Innovations. Foods (Basel, Switzerland), 10(2) , 293.
https://doi.org/10.3390/foods10020293.
12. Seves, S. M.-K. (2017). Are more environmentally sustainable diets with less meat and
dairy nutritionally adequate?. Public health nutrition, 20(11), 2050–2062.
https://doi.org/10.1017/S136898001700.
13. Springmann, M., Wiebe, K., Mason-D'Croz, D., Sulser, T. B., Rayner, M., & Scarborough,
P. (2018). Health and nutritional aspects of sustainable diet strategies and their association
with environmental impacts: a global modelling analysis with country--level detail. The
Lancet. Planetary health, 2(10), e451–e461. https://doi.org/10.1016/S2542-
5196(18)30206-7.
14. Springmann, M., Clark, M. A., Rayner, M., Scarborough, P., & Webb, P. (2021). The
global and regional costs of healthy and sustainable dietary patterns: a modelling study.
The Lancet. Planetary health , 5(11), e797–e807. https://doi.org/10.1016/S2542-5.

206
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

A REVIEW ON ARSENIC: A DUAL PLAYER CYTOTOXIC AND

CYTOPROTECTIVE
Priyanka Chakraborty
Culcatta University
&
Department of Physiology, Vidyasagar College for Women, Kolkata, West Bengal

Abstract:
A well-known hazardous element that is present across the earth, arsenic has gained
international attention. The majority of our groundwater is heavily contaminated with arsenic,
and a large number of people drink the water, which could cause a variety of abnormalities.
Surveys in arsenic-affected states assessed over 100,000 persons for symptoms of arsenicosis;
9.7% of these individuals had skin lesions related to arsenic. It can be used to treat cancer even
though it damages DNA by producing reactive oxygen species (ROS), which causes cytotoxicity.
Arsenic-produced free radicals can elevate oxidative stress in cancer cells to the point where the
cells decide to undergo apoptosis in order to escape the burden of oxidative stress. This chemical
change allows it to also operate as a cytoprotective agent.
Keywords: Arsenic, Arsenicosis, ROS, Cytotoxicity, Cytoprotective Function
Worldwide scenario of arsenic contamination
Arsenic contamination of groundwater is a global issue. People who rely entirely on deep
tube wells or manual pumps for drinking water are at high risk from arsenic contamination. In
India, there are several prominent locations that are on the verge of disaster owing to arsenic
toxicity. Crops produced in hazardous areas contribute to further contamination of groundwater.
In India, around 80% of the rural population and 50% of the urban population use groundwater
for residential reasons. Over 33% of the country's groundwater is deemed unsafe for
consumption. Arsenic contamination in groundwater in South Asia is primarily found in
floodplains of rivers that originate in the Himalayan Mountains. The first groundwater arsenic
event and health repercussions in India were recorded in 1976 in the Indian Union Territory of
Chandigarh (Datta 1976). This first report suggests the probability of widespread groundwater
arsenic pollution, notably in the Ganga River Basin. Groundwater contamination and its impact
on individuals have been highlighted in Bihar (2002), Uttar Pradesh (2003), Jharkhand (2004),
and the Upper Ganga Plain in Uttar Pradesh (2009) (Chakraborti et al., 2009). Between 2004 and
2006, arsenic contamination was observed across the Brahmaputra Plain, including Assam and
Manipur. In six states, groundwater arsenic pollution has affected 35 districts with a population
of 70.4 million people. Over 100,000 people were evaluated for arsenicosis symptoms during

207
Bhumi Publishing, India

surveys in arsenic-affected states, and 9.7% of them had arsenical skin lesions (Chakraborti et
al., 2009). Groundwater arsenic contamination in the Allahabad-Kanpur Track of the Upper
Ganga Plain has also been discovered (Chakraborti et al., 2009). It has been observed that
arsenic concentration decrease with increasing depth of tube wells (Roy Chowdhury et al.,
1999). Not only Asian countries but also China, Mongolia, Nepal, Cambodia, Myanmar,
Afghanistan, DPR Korea, and Pakistan faced arsenic intoxication due to ground water
contamination. There are reports of arsenic contamination from Kurdistan province of Western
Iran and Vietnam, where several million people may have a considerable risk of chronic arsenic
poisoning (Mukherjee et al., 2006). A high arsenic content in drinking water is the leading cause
of arsenicosis worldwide (Mukherjee et al., 2006). Groundwater poisoning with arsenic was first
documented in the western USA and Alaska in the mid-20th century. However, it was not
completely recognised in Oklahoma, Texas, and Arkansas, as well as the Midwest and
northeastern regions, until the 1980s (AWWA, 1999). Recently, groundwater carrying arsenic
levels higher than the USA Federal and State MCLs was discovered in sections of the Atlantic
Coast Plain. Arsenic contamination of groundwater in Canada dates back to the 1970s in New
Brunswick and Nova Scotia, and the 1960s and 1980s in Western Canada (Budinova et al.,
2009). Groundwater contamination with arsenic has also been observed in Chile, Argentina,
Vietnam, Hungary, Laos, and Cambodia (Mukherjee et al., 2006). In Europe, the findings of
arsenic pollution of groundwater happened over a duration of approximately 100 years.
Health effects of arsenic
Arsenicosis is a chronic
condition caused by consuming
water with high arsenic levels over
an extended period. It is frequently
referred to as arsenic poisoning.
Arseniasis refers to chronic arsenical
poisoning, while arsenicism is a
disease characterised by gradual
arsenic poisoning (Kapaj et al.,
2006). Recent reviews have not
provided a comprehensive summary
of arsenic's effects on human health.
Studies in Bangladesh and West Bengal (India) found that chronic arsenic exposure might
produce respiratory system consequences, including chronic cough and bronchitis (Guha
Mazumder, 2003; Milton et al., 2002). It is found that patients with chronic arsenic exposure
experience skin manifestations such as weakness, conjunctival congestion, redness of the eyes,

208
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
persistent cough, and chronic bronchitis (respiratory tract inflammation). Long-term exposure to
arsenic has been shown to harm the respiratory system (Milton et al., 2002; Milton et al., 2003).
Not only that, it has been reported that arsenic consumption damages platelets. Platelets are
important components in cardiovascular disease. Arsenite, a trivalent form of arsenic, has been
linked to increased platelet aggregation when combined with thrombin. It is claimed that arsenic
in drinking water causes arterial thrombus development in rats. Long-term exposure to arsenic in
drinking water has been linked to an increase in platelet aggregation, which contributes to
cardiovascular disease. Arsenic neuropathy is a known consequence of arsenic exposure.
Chronic arsenic exposure leads to peripheral neuropathy, a degenerative condition of the
peripheral nerves. This is a common nervous system issue. Neuropathy typically affects
sensations and develops gradually. Patients may have chronic pain, hypersensitivity to stimuli,
muscular weakness, or atrophy (Guha Mazumder 2003; Mukherjee et al., 2003). In this case,
sensory and sensorimotor (sensation and muscles) neuropathy have also been documented
(Rahman et al., 2003). Additionally, a number of studies revealed an adverse relationship
between verbal IQ and long-term memory and arsenic levels (Kapaj et al., 2004). Furthermore, it
was discovered that exposure to arsenic in individuals with chronic malnutrition may have an
impact on long-term memory, attention, and speech comprehension (Calderon et al., 2001).
Additionally, several studies have demonstrated that elevated arsenic exposure in children can
impair their intellectual ability.
Hepatic abnormalities were documented in people who had lived in places contaminated
with arsenic for an extended period of time. According to Santra et al., (2007), there is a linear
correlation between the occurrence of hepatomegaly and the amount of arsenic present in
drinking water. Numerous negative health effects have been linked to long-term arsenic
exposure. Patients who used drinking water tainted with arsenic for an extended period of time
experienced a number of inflammatory clinical disorders, such as hypertrophy of the liver and
spleen (Mazumder 2005). These conditions finally led to liver cirrhosis and ultimately drove the
patient's body towards cancer. It has been suggest that inorganic arsenic serves as a diabetogenic
agent in humans, but little is known about pathophysiological mechanisms. The underline fact is
that people exposed to arsenic suffer from type two-diabetes.
According to Centeno et al., (2006), arsenic is a special kind of carcinogen. The only
known human carcinogen for which there is sufficient proof of a carcinogenic risk through both
ingesting and inhalation is arsenic. Since 1980, arsenic has been recognised as a human
carcinogen by the International Agency for Research on Cancer (IARC) (IARC, 2005). The
possible health risk that arsenic in drinking water poses to people has been highlighted by
numerous researchers. Many nations have established a link between arsenic exposure and
cancer, including the USA, Taiwan, Bangladesh, India, Argentina, and Chile, to mention a few.

209
Bhumi Publishing, India

Patients in West Bengal who were exposed to arsenic experienced severe skin lesions. The exact
number of people with cancer remained unknown since they were unable to pay for the
necessary tests. In addition to the skin, arsenic exposure also caused cancer in the lung, liver,
kidney, and bladder.
How arsenic leads to cytotoxicity and cytoprotective function
Arsenic actually damages DNA by acting as an uncoupler to produce reactive oxygen species. It
also damages tissue, which can result in diseases. It is clear from this that arsenic harms
biological systems in a number of ways, one of which is the production of an excessive amount
of reactive oxygen species (ROS) (Barchowsky et al., 1999). According to experimental
research, arsenic causes a rise in the generation of reactive oxygen species, including hydroxyl
radicals (Wang et al., 1996), hydrogen peroxide (Barchowsky et al., 1999; Chen et al., 1998),
and others (Barchowsky et al., 1999). The byproduct of cellular metabolism, reactive oxygen
species (ROS) are essential for activating different signalling pathways in both plants and
animals.

Arsenic in different oxidation states

Arsenic in producing free radicals

Hydroxyl radicals, superoxides, and hydroperoxides are the three main classes of reactive
oxygen species (ROS) that can be generated. Each class has unique properties related to its half-
life, reactivity, target specificity, localization, and most significantly, consequences on biology
and pathology. Currently, a variety of nitrogen-containing substances, also known as RNS
(Reactive Nitrogen Species), such as nitric oxide (NO), nitroxyl anion (NO−), and peroxynitrite
(ONOO−), can be classified as ROS. Inducible nitric oxide synthase (iNOS) generates NO,
which combines with superoxide to form the other reactive nitrogen specie s(RNS). Other

210
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
acronyms for ROS include ROI (Reactive Oxygen Intermediates) and RNI (Reactive Nitrous
Intermediate). Typical byproducts of the biological reduction of molecular oxygen include
superoxide anion (O2.), hydrogen peroxide (H2O2), hydroxyl radical (OH.), and organic
peroxides. As arsenic sequentially reduces from its trivalent to pentavalent form, it interferes
with vital enzyme’s functional groups and impairs crucial biochemical events, both of which
contribute to the production of reactive oxygen species (ROS) (Bashir et al., 2006). Prolonged
and sustained ROS can result in somatic mutations, neoplastic transformation, and severe harm
to cell structure and function. ROS have been linked to a broad range of illnesses, such as
chronic inflammation, which can eventually cause the start and spread of several types of cancer
(Droge 2002). As a result, inflammation and oxidative stress may coexist. The relationship
between oxidants and inflammation has been the subject of numerous investigations, yet it is still
mostly unclear. The majority of the research concluded that oxidative stress and inflammation
are two distinct phenomena that work together negatively to affect the physiological system. The
activation of signalling pathways mediated by ROS is initiated by an inflammatory trigger. ROS
functions as an inflammatory mediator as well as a signalling molecule. For example, superoxide
has a high affinity for reactive nitrogen species (RNS), which raises the cell's proinflammatory
burden and causes nitrosative stress. Thus, the physiological system experiences an additional
oxidative burden from both inflammation and oxidative stress at the same time. However,
despite numerous reports from early studies indicated that arsenic has immunomodulatory, or
more precisely immunosuppressive effects, the effect of arsenic on the immune system is still
unknown (Choudhury et al., 2016). It is also known that arsenic can combat with leukemia. The
anti-leukemic properties of arsenic were initially documented in the late 1800s. Up until
radiation therapy took its place, As2O3 was used as the main anti-leukemic medication. However
the hematologic use of arsenic experienced a re-emergence in popularity in the 1930s when its
efficacy was reported in patients with chronic myelogenous leukemia (CML) (Forkner et al.,
1931). Arsenic trioxide has been reported to induce both clinical and hematologic responses in
patients with recurrent acute promyelocytic leukaemia (APL) in recent Chinese publications
(Zhang et al., 1996; Shen et al., 1997). The way that arsenic trioxide functions in APL patients
are a significant observation, since 20% to 30% of individuals with this kind of acute
myelogenous leukaemia relapse even after receiving combination chemotherapy and all-trans
retinoic acid treatment. Arsenic trioxide showed positive clinical responses in nine out of ten
patients with recurrent APL, according to a Chinese investigation (Shen et al., 1997). The
process by which arsenic has an anti-leukemic impact reveals that it promotes significant cellular
changes, such as the induction of apoptosis, the inhibition of proliferation, the encouragement of
differentiation, and the inhibition of angiogenesis (Snow 1992). Critical cell proteins may react
with closely related cysteine residues in response to arsenic, which primarily takes the trivalent

211
Bhumi Publishing, India

forms of arsenite and arsenic trioxide, to cause biological consequences. Most proteins that have
a lot of cysteine and readily accessible thiol groups are likely to interact with arsenic. Some
recent evidences showed that arsenic is also act against breast cancer (Skoczynska et al., 2022).
Conclusion:
From the discussion above, we deduced that arsenic, a well-known poisonous element,
acts both as a harmful agent and has a beneficial therapeutic effect on cancer. We propose that
arsenic functions as both a cytotoxic and a cytoptrotective agent, depending on the amount and
degree of exposure. Arsenic-induced changes in membrane transport, cellular signalling
pathways, and organelle function such as mitochondria, endoplasmatic reticulum, and nucleus all
contribute to carcinogenic or anticancer effects of arsenic. The baseline activity of membrane
receptors, cytokines, transcription factors, pro- and antiapoptotic enzymes, and the cell cycle all
influence cellular responsiveness to arsenic. The final cell response to arsenic is determined by
the genome's overall stability, changes in gene expression, and DNA repair capabilities. Arsenic
may have beneficial benefits due to considerable metabolic variations between cancer and
healthy cells.
References:
1. AWWA (1999). Water Quality and Treatment: a handbook of community water supplies.
McGraw- Hill, New York.
2. Barchowsky A, Klei L R, Dudek E J, Swartz H M & James P E, Stimulation of reactive
oxygen, but not reactive nitrogen species, in vascular endothelial cells exposed to low
levels of arsenite, Free Radic Biol Med, 27 (1999). 1405.
3. Bashir S, Sharma Y, Irshad M, Gupta S D & Dogra T D, Arsenic-induced cell death in
liver and brain of experimental rats, Basic Clin Pharmacol Toxicol, 98(2006). 38-43.
4. Budinova T, Savova D, Tsyntsarski B, Ania CO & Cabal B, Parra J B & Petrov N,
Biomass waste-derived activated carbon for the removal of arsenic and manganese ions
from aqueous solutions, Applied Surface Science, 255 (2009). 4650-4657.
5. Calderon J, Navarro M E, Jimenez-Capdeville M E, Santos-Diaz M A, Golden A,
RodriguezLeyva I, Borja-Aburto V & Diaz-Barriga F, Exposure to arsenic and lead and
neuropsychological development in Mexican children, Environ. Res, 85 (2001). 69–76.
6. Centeno J A, Tchounwou P B, Patlolla A K, Mullick F G, Murakata L, Meza E, Gibb H,
Long fellow D & Yedjou C G, Environmental Pathology and Health Effects of Arsenic
Poisoning: A Critical Review, In Managing Arsenic in the Environment: From Soil to
Human Health, Naidu R, Smith E, Owens G, Bhattacharya P, Nadebaum, Eds.; CSIRO
Publishing: Melbourne, Australia, (2006). 311–327.

212
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
7. Chakraborti D, Ghorai S K, Das B, Pal A, Nayak B & Shah B A, Arsenic exposure through
groundwater to the rural and urban population in the Allahabad-Kanpur track in the upper
Ganga plain, J. Environ. Monit, 11(2009). 1455–1459.
8. Chen Y C, Lin-Shiau S Y & Lin J K, Involvement of reactive oxygen species and caspase
3 activation in arsenite-induced apoptosis, J Cell Physiol, 177 (1998). 324.
9. Choudhury S, Gupta P, Ghosh S, Mukherjee S, Chakraborty P, Chatterji U &
Chattopadhyay S, Arsenic-induced dose-dependent modulation of the NF-kB/IL-6 axis in
thymocytes triggers differential immune responses, Toxicol, 357 (2016). 85–96.
10. Droge W, Free radicals in the physiological control of cell function, Physiol Rev, 82
(2002). 47-95.
11. Forkner C E & Scott T F M, Arsenic as a therapeutic agent in chronic myelogenous
leukemia, JAMA, 97(1931). 3-5.
12. Guha Mazumder D N, Chronic arsenic toxicity: clinical features, epidemiology, and
treatment: experience in West Bengal, J. Environ Sci Health, A38 (2003).141– 163.
13. International Agency for Research on Cancer. Arsenic and arsenic compounds. 1980 Vol.
23, 39p.
14. Kapaj S, Peterson H, Liber K, & Bhattacharya P, Human Health Effects From Chronic
Arsenic Poisoning– A Review, J. Environ. Sci. Health, A41 (2006). 2399–2428.
15. Mazumder D N, Effect of chronic intake of arsenic-contaminated water on liver, Toxicol
Appl Pharmacol, 206 (2005). 169-175.
16. Milton A H & Rahman M, Respiratory effects and arsenic contaminated well water in
Bangladesh, Int. J. Environ. Health. Res, 12 (2002). 175–179.
17. Milton A H, Hasan Z, Rahman A & Rahman M, Non-cancer effects of chronic arsenicosis
in Bangladesh: preliminary results, J. Environ. Sci. Health, A38 (2003). 301– 305.
18. Mukherjee S C, Rahman M M, Chowdhury U K, Sengupta M K, Lodh D, Chanda C R,
Saha KC & Chakraborti D, Neuropathy in arsenic toxicity from groundwater arsenic
contamination in West Bengal, India, J. Environ. Sci. Health, A38 (2003). 165–183.
19. Mukherjee A, et al., Arsenic contamination in groundwater: a global perspective with
emphasis on the Asian scenario, J Health Popul Nutr, 24 (2006).142-163.
20. Rahman M M, Mandal B K, Chowdhury T R, Sengupta M K, Chowdhury U K, Lodh D,
Chanda C R, Basu G K, Mukherjee S C, Saha K C & Chakraborti D, Arsenic groundwater
contamination and sufferings of people in North 24-Parganas, one of the nine arsenic
affected districts of West Bengal, India, J. Environ. Sci. Health, A38 (2003). 25–59.
21. Roy Chowdhury T, Basu G K, Mandal B K, Biswas B K, Chowdhury U K, Chanda C R,
Lodh D, Roy S L, Saha K C, Roy S, Kabir S, Zaman Q Q & Chakraborti D, Arsenic
poisoning in the Ganga delta, Nature, 401(1999).545–546.

213
Bhumi Publishing, India

22. Santra A, Chowdhury A, Ghatak S, Biswas A & Dhali G.K, Arsenic induces apoptosis in
mouse liver is mitochondria dependent and is abrogated by N-acetylcysteine, Toxicol Appl
Pharm,220 (2007).146-155.
23. Shen Z-X, Chen G-Q & Ni J-H,Li X-S, Xiong S-M, Qiu Q-Y , Zhu J, Tang W, Sun G-L,
Yang K-Q, Chen Y, Zhou L, Fang Z-W, Wang Y-T, Ma J, Zhang P, Zhang T-D, Chen S-J,
Chen Z & Wang Z-Y, Use of arsenic trioxide (As2O3). in the treatment of acute
promyelocytic leukemia (APL).:II. Clinical efficacy and pharmacokinetics in relapsed
patients, Blood, 89 (1997). 3354-3360.
24. Shen S, Lee J, Weinfeld M & Le C S, Attenuation of DNA damage-induced p53
expression by arsenic: A possible mechanism for arsenic co-carcinogenesis, Mol Carcinog,
47(7). (2008). 508-18.
25. Snow E T, Metal carcinogenesis: mechanistic implications, Pharmacol Ther, 53(1992). 31-
65.
26. Sun H D, Ma L & Hu X-C et al., Ai-Lin 1 treated 32 cases of acute promyelocytic
leukemia, Chin J Integrat Chin Western Med, 12 (1992).170-172.
27. Skoczynska A, Skoczynska M, Breast Cancer and Arsenic Anticancer Effects: Systematic
Review of the Experimental Data from In Vitro Studies, BioMed Research International,
2022 (2022). 16.
28. Wang T S, Kuo C F, Jan K Y & Huang H, Arsenite induces apoptosis in Chinese hamster
ovary cells by generation of reactive oxygen species, J Cell Physiol, 169 (1996). 256.
29. Zhang P, Wang SY & Hu XH, Arsenic trioxide treated 72 cases of acute promyelocytic
leukemia, Chin J Hematol, 17 (1996). 58-62.

214
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)

SUSTAINABLE DEVELOPMENT OF RIVER FRONT GHATS OF VARANASI,

UTTAR PRADESH
Shouvonik Bala
Department of Geography,
Vidyasagar College for Women, Kolkata-06

Abstract:
India's ancient and historical cities have a unique built and cultural heritage that attracts
tourists which become one of the major economic activities of that area. but! all these historical
cities and heritage sites are deteriorating with time. Due to the rapid growth of modern
urbanization, the quality of the traditional buildings, living environment and infrastructure of the
city has also declined. As a result, a sustainable development of today's fast-growing modern
cities has become a very important issue that integrates cultural heritage and aspirations for the
future. Through sustainable development, cultural heritage, urban development planning and
local economic development are linked together to meet the needs of the present generation and
preserve things for future generations. The city of Varanasi has beautifully nurtured the natural,
architectural, artistic and religious expressions of traditional Indian culture, the holy Ganga
riverside Ghats, numerous temples and holy water bodies are part of the city's heritage and glory
as well as major tourist attractions of the city. This article mainly points out the heritage of river
front historical sites and monuments of the city and focuses on the importance of sustainable
development for the conservation and development of it.
Keywords: River Front, Sustainability, Conservation, Development, Cultural Landscape,
Heritage.
Introduction:
The tangible heritage of the city includes the riverside Ghats, sacred ponds, magnificent
buildings, religious structures and archaeological sites, while intangible heritage such as
tradition, performing arts, food, rites and rituals etc. form the backbone of Varanasi's traditional
culture. The riverfront Ghats are an integral part of local culture as well as a place of tourist
attractions. The Ghats of Varanasi on the west bank of the river are especially sacred for all
Hindu rituals. The integration of the Ganges with the religious, traditional and cultural milieu has
had an important impact on the economic and social life of the city. In the 2 nd century AD, the
Ghats were first described. Later, during the Gupta period, from the 3rd to 6th century AD, the
Ghats became an economic and cultural center. The riverfront landscape (Ghats) became
prominent in the overall landscape of Varanasi under the patronage of the Marathas in the 18th –
19th centuries. Palaces, buildings, temples and pilgrims' rest houses were built along the Ghats.

215
Bhumi Publishing, India

Even during the 19th-20th centuries, many Ghats were rebuilt, renamed and reshaped. From the
1950s, the state government of Uttar Pradesh proceeded to build stone steps on the Ghats and
repair them. The riverfront is a complex ecosystem emerging from the practice of spatial rituals,
cultural and natural phenomena that respond to its cycles that reflect the Hindu understanding of
cosmic order. Overuse and exploitation of rivers have increased pollution levels that have put
pressure on ecosystems, disrupting the purity of rivers and the continuity of spatial practices.
Varanasi's riverfront landscape has developed as a complex ecosystem where culture and nature
exist in a reciprocal relationship (Ramakrishnan 2003). But the city's uncontrolled growth, poor
governance and lack of awareness have resulted in neglect and degradation of historical and
cultural sites. Unscientific maintenance of the river front, illegal encroachment, management of
solid and liquid wastes and increasing pressure due to three million visitors annually are
endangering the heritage of this cultural city (Sinha 2017, pp158). With over 3,500 heritage
footprints, Varanasi has perhaps the largest collection of built stock of any living city in the
world. But over time the primitive temples, mythical Ghats, old riverside palaces, and colonial
buildings have fallen into disrepair and are completely dilapidated. We have to be conscious and
active to preserve the wonderful glory and cultural structure of Varanasi, India's cultural capital
(Praharaj. S. 2014, pp 167-174).
Literature Review:
Rana P.B. Singh (2018), It is beautifully described that the geological structure of
Varanasi provided the basis for the growth of a crescent-shaped city, symbolically described as
the crescent moon on Lord Shiva's forehead. He also considered this characteristic in the context
of river ecology as a unique aspect of energy quantum and direction of energy flow. Sirima and
Backman (2013) state that the main focus when discussing sustainable tourism is economic and
environmental sustainability. As tourism growth does not always ensure the development of
local communities, he also points out the importance of social sustainability and calls for giving
equal importance to the issue. Xing et al., (2013). Sustainable tourism development policy and
local environment protection are emphasized on these two issues. Engel and Engel (1990:20):
The spirit of sustainability defines development depending upon the emergence of holistic
understanding and action in every segment of society (cf.) Praharaj. S, (2014): He discussed
local economic development through the rehabilitation of historical areas, development of
infrastructure and the preservation of cultural heritage by developing a tourism system. That is to
say, an integrated approach is both sustainable preservation of heritage, development of the local
economy and propagation of native culture. Sherring states that (1868: 9): For beauty and
majesty, no scene on earth can better surpass that of Vararanasi, seen from the river Ganges.
Singh, Rana P.B. (2004): Here he records his views on the debates on traditional issues under the
special scheme of the government. He states that heritage conservation has not been recognized

216
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
as part of inclusive development because religious concepts play an important role there and can
be managed in terms of the 'religio-politics interface'. Feizabadi, T. N. (2015): Elucidated on the
emergence of the concept of sustainable development and its impact on tourism and the
government's approach to tourism development. According to him, with the increase in the
population and tourists, there has been a proportional increase in environmental problems and the
resulting pressure on natural resources. He drew attention to how tourism, the environment,
society and the economy can have a positive impact using sustainable development.
Objectives of the study:
The main objective of this research paper is to create awareness among the public about
the sustainable development of the beautiful Ghats of Varanasi city and to highlight our
traditional heritage, culture and history

Source: Varanasi Riverfront (Singh, 2009)

Location of the study area:
The Ganga River and the riverfront Heritage Zone of Varanasi spread between 25º
17.350’ to 25º 19.678’ North and 83º 00.340’ to 83º 02.374’east and it covers an area of 374ha
area. Asi river in the south and varna river is the northern limit of this river front zone which

217
Bhumi Publishing, India

covers a length of 7 k.m along the river bank of Ganga. The western edge of this rive front
heritage zone is marked by an ancient road connecting Asi-Godaulia-Chowk-Maydagin
Matyodari-Raj Ghat (Singh, Rana P.B. 2004, pp 25).
Heritage zone of Varanasi city:
According to the VDA Zoning Plan, five heritage zones were identified in the previous
master plan of Varanasi (1991–2011) and the same has been retained in the current plan (2011–
2031) (Singh and Pal 2012). These are the heritage areas Riverfront Ghats, Durgakund-
Sankatmochan hanuman temple area, Kamachcha-Bhelupura Area, Kabir Math (Lahartara) Area,
and Sarnath. Among these heritages, riverfront heritage is discussed in this research paper.
The Ganges is always regarded by Hindus as the "mother" and is worshiped as an
essential power in life-force. The riverfront landscape should be viewed not as an isolated
element, but as a holistic subject of meaningful relationships where life and experience are
intertwined with the everyday world. The Ganga riverfront is the nexus of major rituals and
festivals in the holy city of Varanasi. Any festival, any ritual and religious circumambulation
begins with a holy bath in the Ganges and ends with the Ganges.
The geological structure affects the flow of the Ganga from south to north in a
semicircular shape near Varanasi. The Ganga River adjacent to Varanasi is an example of natural
heritage. The multiculturalism of India is observed along the Ganga Ghats of Varanasi as people
from different parts of India have settled in the Ghats adjoining the city of Varanasi since ancient
period.
A symbol of great cultural heritage:
There are 84 important Ghats and 96 holy shrines from Ganga-Varna confluence north of
Varanasi to Asi- Ganga confluence in the south. These 84 Ghats have been compared with 84
lakh organic species (yoni) according to Hindu mythology. It is believed that each Ghats frees
man from the pains of being born in one million organic species (yoni) and helps in salvation by
washing away the sins of the people. Therefore, to get rid of 84 lakh organic species, to purify
the soul and to be free from the cycle of rebirth, it is necessary to take a bath in every Ghats of
Varanasi city (84Ghats x 10, 00000 organic species or yoni = 84,000000 organic speies). Further
12 months / 12 Zodiac x 7 layers of atmosphere is equal to 84 in this way one can complete the
annual cycle of cosmic journey by bathing all 84 Ghats and can attain salvation by being
completely free from the bondage of birth and death. On the other hand, 96 holy water-shrines
near the Ghats have been explained 12x 8 = 96, (12 is division of time/Zodiac and 8 is direction)
so it is also representing manifestive transcendental dimension of Varanasi (Singh Rana, 2009).
According to The Kashikhanda (KKh 84.107-10, 114) among all the 84 Ghats, five Ghats have
been given more importance in terms of spirituality. To the north of these Ghats are "Adikeshab,
then gradually to the south are Panch Ganga Ghats, Manikarnika Ghats, Dashaswamedh Ghats

218
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
and Asi Ghats respectively. These most sacred five Ghats are called ―Panch tirthas‖. It is
believed that by bathing in these five Ghats, one attains the same virtue of bathing in all the
Ghats and one is freed from the cycle of life and death and attains salvation.
Although Varanasi has improved urban civic infrastructure such as sanitation, solid waste
management, water supply etc. and has been improved and measures have been taken to reduce
pollution of the Ganges through the schemes launched by the government, it has so far failed to
fully address the issues yet so far it has failed to fully resolve the issues. Modern engineering and
construction styles are not compatible with or sensitive to the city's ancient cultural heritage,
myths, legends and local ecology.
Heritage risk and challenges:
Heritage zones, areas and properties are being irreversibly altered or even destroyed due
to the massive pressures of tourism, economic development and population pressure, which are
now under threat. The integrity of the cultural landscape and atmosphere and urban skylines in
the region are collectively at risk. The growing population is having a severe impact on the
environment and the carrying capacity of river ecosystems and unplanned mass tourism. In many
cases, old heritage buildings and structures are altered or demolished in the name of
development, especially those with multi-ownership or ownership legal complications or those
that are too expensive to renovate. The buffer zone and the skyline of the old city, the status quo
of which is currently preserved, are also threatened by encroachment and rising building heights.
(Singh, 2004). Cultural practices and rituals at the Ganga Ghats are generating waste that
contributes to local pollution, resulting in a disconnect between ideals and reality and a mismatch
between perceptions of the Ganga as pure and clean (Conaway 2015). The Ganga in Varanasi,
far from nourishing health and life, is a source of water-borne enteric diseases for those who
bathe in it and drink its waters (Sinha.A 2018). Ghat priests believe that the Ganga will always
remain pure even if it is not cleaned, thereby pointing to a lack of religious solidarity in the
state's efforts to clean the Ganga. (Alley 1998). River Ganges flows past Varanasi as a holy
blessing that purifies the city and gives it unique shape and prosperity. But now the Ganges is
considered as a dumping ground for city waste water and flowers. Today in Varanasi Ganga is
only a symbol of religious frenzy with no respect and no effort to revive the holy river and lack
of awareness and conservation initiatives is observed. Due to neglect and inadequate efforts, the
living environment of the heritage precincts of Ghat areas has deteriorated considerably. Most of
the traditional areas are surrounded by slums and the location of these densely populated
settlements is indicative of past degradation of local environmental services. Most of the
traditional areas are surrounded by slums and the location of these densely populated settlements
indicates the deterioration of local environmental and civic services. As Varanasi is mainly a city
of temple and religious importance, the production of flower waste (4.2MT/day) is high.

219
Bhumi Publishing, India

Varanasi also has 84 Ghats where a large number of pilgrims and tourists perform various
religious rituals at these Ghats thereby generating various types of waste almost every day.
Development and population pressure:
Like most urban areas in India, Varanasi has to deal with intense development pressures.
Every inch of the old city center and riverbanks are built up, with a population density of around
400 to 500 people/per 0.01sq km).
Table 1: Development and population pressure of Varanasi city
Year Population Increasing/ Decadal
Decreasing Growth Rate
1901 226105 - -
1911 217012 -9093 -4.20
1921 210745 -6269 -2.89
1931 220143 +9398 +4.46
1941 278955 58812 +26.72
1951 369799 90844 +32.57
1961 505952 136153 +36.82
1971 635175 129223 +25.54
1981 797162 161987 +25.50
1991 1027819 230657 +28.93
2001 1211749 183930 +17.89
2011 1435113 223364 +18.43

Population growth of Varanasi city (1901-2011)

The graph shows that the growth rate has decreased significantly after 1991 suggesting
that residential preference in the core urban area may have shifted to the peripheries of the city.
This indicates probably the urban renewal may be needed this city. The Varanasi urban area is

220
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
also promoted to million cities in 1991. The situation changed in 2001 the population growth rate
had slightly decrease 17.89%. The situation has changed in the year 2011, the population growth
rate has increased 18.433% and it is estimated that it will reach at 20.03 % by the year 2021. The
current estimate population of Varanasi city in 2024 is 1,701,000. Additionally, an estimated
30,000 daily floating population is recorded in the city. This huge population pressure is causing
traffic congestion during peak and normal times. The result is noise pollution and smog.
Therefore, the built heritage of the city is seriously threatened today due to population pressure.
Tourist and pilgrimage pressure:
Around lakhs of pilgrims visit the city every year, six months, October to March, being
the main season for tourists. Among important tourist attractions Dasaswamedh Ghat area
attracts maximum tourists visiting Varanasi. This tourism often affects the heritage of the place
socially, ecologically and culturally.
Table 2: Increasing trend in tourist flow in Varanasi city (Source: Year-wise-Tourist-
Statistics, UP)
Year Domestics Foreign Total
2017 5947355 334708 6282063
2018 6095890 348970 6444860
2019 6447775 350000 6797775
2020 876303 106189 982492
2021 3075913 2566 3078479
2022 71147310 83741 71231051

Tourism obviously has economic benefits, but uncontrolled tourism also has negative
effects on the environment. Tourism is a threat to tourism and can be a huge burden on
resources. Resource depletion, social pollution, environmental pollution and tourism are the three
main negative impacts. This does not mean that only tourism is creating environmental problems
in Varanasi, there are already many environmental problems and tourism is greatly exacerbating
those problems.
Environmental pressure:
Low level of sanitation infrastructure coupled with increase in floating population has led
to increased rate of defecation in Ghats and river banks or exposed areas. As a result these
valuable sacred heritages which are attractive to these tourists are gradually losing their
traditional value and are turning into highly polluted and unhealthy areas The river's eco-system
is facing increasing pressure from the population of the Riverfront Heritage Zone and other parts
of the city whose sewage flows directly into the river. It also faces the pressure of polluting
agricultural run-off from villages surrounding the city. However, about 80% of the pollution in

221
Bhumi Publishing, India

Varanasi's river Ganges is urban waste. About 60% of the total pollution is concentrated in the
riverfront and the Old City Heritage Zone near Varanasi. Waterborne diseases are occurring in
this area due to polluted water (singh2004).
One of the most important aspects of heritage conservation and urban renewal is efficient
and effective governance, Varanasi has recently seen a strong and efficient institution dedicated
to heritage, which is still in its infancy. But many critics feel that VUDA- in the name of heritage
management only adds a new chapter on heritage in the master plan document, but it does
nothing. Municipal corporations, VUDA (Varanasi urban development authority) and INTACH
(The Indian National Trust for Art and Cultural Heritage) all have separate lists of heritage
structures and monuments but have never shown interest in making a single comprehensive list.
There is a lack of linkages between various institutions and technical expertise in matters related
to heritage conservation and management.
Main findings and suggestion:
The bio-centric approach to the urban development of Partick Geddes in the early 20th
century is particularly important in this regard. He believed that the heritage of cities could be
preserved by planning for individual and social development, by linking cultural perspectives
with ecological niches. Decentralization, civic responsibility, heritage preservation, cooperative
and alternative and complementary planning are of particular importance (Tyrwhitt 1947). The
current ongoing development which does not take proper care of the old city and its heritage
buildings, is facing criticism for maintaining the continuity and cleanliness of the river Ganga
and preserving the river banks. It has been argued that most of these plans rely on the theoretical
ideals of outsiders, which do not fit the local environment. For the sustainable development of
the Ganga and its Ghat areas and to ensure a healthy and resilient river course, planning and
management strategies need to integrate the spiritual and phenomenal aspects of nature. The
divinity of the Ganga and its material properties should be bridged in such a way that its
transcendental powers are inherent in its earthly flow (Amita Sinha, 2018).
The city of Varanasi is in a precarious position with the pressure of increasing
urbanization, the struggle for modernization and the precious heritage and antiquities. Even as
the level of economic activity in Varanasi continues to increase, the city suffers from the threat
of losing its distinct ancient heritage character, making the city seem a little less vibrant. This is
not only a concern for Varanasi and India's culture-loving intellectuals, but also for all residents
of the local community, so we all need to adopt new innovative tools to bring back the unique
heritage and glory of Varanasi.
Heritage conservation and management are often people's awareness. A man's own heritage
depends on his level of respect for wealth and culture. Both the above-mentioned aspects are
clearly lacking in the case of Varanasi. Washing clothes, throwing waste, open defecation in holy

222
 Environment, Development and Sustainability
(ISBN: 978-93-95847-87-2)
rivers, Ghats and holy pools is a routine for the people of Varanasi. If Varanasi is to become a
world heritage city, these things need to be stopped
1. For sustainable conservation of Ghats, the design of a healthy and resilient cultural
landscape must be ensured. Reform and management strategies should be based on a
systematic approach.
2. Documentation, preservation and revival of tangible and intangible heritage of Varanasi
should be given priority. In this case, local people and organizations involved in the
promotion business can be taken along.
3. Investments should be allocated for the development of the heritage assets that Varanasi
has (such as the tourism industry) these historical and cultural assets, which distinguish
Varanasi from other cities.
4. Protecting and maintaining heritage and its protection shall be continuously monitored,
evaluated and prioritized where necessary
5. It is imperative to have the support of local residents, stakeholders and local politicians in
developing heritage protection programs for heritage protection and development.
6. Urban development planning should follow specific guidelines, planning support systems
for traditional areas.
7. To promote heritage to bring sustainable economic benefits to the local people and above
all to create awareness among the citizens and promote their active participation through
information and cultural programs on heritage issues through government channels.
8. Modernity should be avoided if heritage is in danger.
Concluding remarks:
Moral and ethical pollution caused by materialism and consumerism is replacing the old
sense of values that supported sustainability. Over the past eight hundred years of foreign rule
and cultural domination, beginning with the entry of Islam and ending with the British, the
ancient Hindu value system has lost much of its essence. However, a massive awakening of old
cultural values and awareness will promote a new consciousness of sustainability.
References:
1. Ramakrishnan, P. S. (2003). The sacred Ganga river‐based cultural landscape. Museum
International, 55(2), 7-17.
2. Pati, A., & Husain, M. (2023). People’s perspectives on heritage conservation and tourism
development: a case study of Varanasi. Built Heritage, 7(1), 17.
3. Singh, Rana P.B. 2004 g. The Ganga Riverfront in Varanasi, a Heritage Zone in
Contestation. Context: Built, Living and Natural, vol. 1 (1), September: pp. 25-30.
4. Singh, Rana P.B. (2018), The Gaṅgā Ghāṭs, Varanasi(Kashi):The Riverfront Landscape,
Varanasi.pp.1-77

223
Bhumi Publishing, India

5. Singh, R. P., & Rana, P. S. (2016). Riverfront Varanasi, India: Interfacing Contestation in
Heritage Making. Contemporary Geographer, 1(1), 49-65.
6. Sinha, A. 2017.Ghats on The Ganga In Varanasi, India: A Sustainable Approach To
Heritage Conservation, Landscape Research Record No. 6.pp158.
7. Praharaj, S. (2014). Conservation and Urban Renewal as a base for Sustainable
Development in Historic Cities: A Case of Varanasi. Sustain. Constr. Tradit. visà-vis Mod.
Archit., sayı April, 167-174
8. Feizabadi, T. N. (2015). A Critical Review of the Sustainability of Tourism in Varanasi.
Department of Geography, Banaras Hindu University.
9. Eck, D. L. (1983) Banaras. The City of Light. New Delhi: Penguin India.
10. Shyju, P. J., Bhat, I. A., Myers, K, & Tanwar, N. (2020). Local stakeholders’ perspectives
on religious heritage and tourism development in Varanasi. International Journal of
Tourism Cities, 6(3), 529-544.
11. Singh, Rana P.B. and Pal, Neelam 2012. Varanasi: Master Plans and Perspectives of
12. Heritagescapes. Radha Publications, New Delhi: pp. 97-115.
13. Maurya, R., Pandey, B. W., & Negi, V. S. (2017). Sustainable Urban Development
Through Ghats: A Case Study of Varanasi, Uttar Pradesh. Sustainable Smart Cities in
India: Challenges and Future Perspectives, 637-654.
14. https://uptourism.gov.in/en/post/Year-wise-Tourist-Statistics.

224