BIO4320 Mid-Term Examination Oct.

16, 2001
Name: Student ID:
Part II (Dr. Lam’s Portion; total 60 marks) Answer all questions.

Question 1

Many students wrongly believe that the Polymerase Chain Reaction (PCR) technique was
invented after the discovery of the Taq polymerase (a heat-stable DNA polymerase). In fact,
the idea of PCR was proposed by Dr. Kary Mullis (1993 Nobel Laureate) in 1983. The first
successful experiment was completed in 1984. Detection of DNA at that time was mainly
based on hybridization techniques.
Imagine you were the inventor of PCR in 1984. You were given a clone of the human β-
globin gene as the template. You were allowed to synthesize any primers needed. However,
you could only use Klenow to synthesize DNA. Thermo-cycler, of course, was not available.

(a) Design an experiment to show the feasibility of the PCR concept (8 marks).

• Design a pair of primers (0.5) based on the DNA sequence of the β-gobulin gene (0.5), so
that they will in theory amplify and give DNA fragments of a specific size (0.5).
• Heat denature the DNA template (1).
• Add dNTPs and primers (1).
• Cool down to 37oC or less before adding Klenow (1).
• Allow synthesis to occur at low temperature (1), i.e. to 37oC.
• Repeat the cycle (1) manually (0.5).
• Since Klenow is heat unstable (1), new Klenow should be added in each new cycle (2)
• To facilitate the manual thermal cycling process, water baths of different temperature
should be set up (1).

(b) In the real experiments done in 1984, although successful amplification was seen, the
amplified DNA bands were weak and multiple bands were observed. How could you
prove the specificity of the target DNA fragment (6 marks).

• Make probes based on the β-globulin gene (1).

• The probes should cover the expected amplification region (2).
• Description of any methods in making probes (2).
• Gel electrophoresis of the amplified DNA (1).
• Perform Southern blot hybridization to detect the specific band (2).

(c) For nowadays PCR reaction, Taq polymerase (successfully purified in 1986) is used.
Using a clean template and well-designed primers, Taq polymerase gives a clear and
distinct band that can be easily detected by simple ethidium bromide staining. State
three differences between Taq polymerase and Klenow (3 marks).

• Taq is active at high temperature, Klenow is not (1).

• Taq will not be denatured by high temperate, Klenow will (1).
• Taq is more specific then Klenow (1).
• Taq has a higher specificity then Klenow (1).
• Taq does not process 3’ to 5’ exonuclease, i.e. proofreading activity, Klenow does (1).

-1-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
Question 2

In year 2050, Hong Kong was under a terrorist attack. A genetically engineered
pathogenic E. coli Strain was spread all over the city. This E. coli strain infected all
mammals and was resistant to all antibiotics available.
A secret mission coded BIO4320 was undertaken by a group of CUHK students. Their
task was to synthesize new antibiotics that would act against this bacterium.
Dr. Lam Jr. told the students that microorganisms such as fungi were good sources for
new antibiotics. In this respect, all fungal collections in the Biology Department of CUHK
were tested.

(a) Design a strategy for the antibiotic screen (3 marks).

• Prepare extracts from all fungal collections (0.5).

• Spread (or pour) the target bacterium onto an agar plate (1).
• Place a sterile filter disc in the center of the agar plate (0.5).
• Apply each fungal extract to a separate sterile filter disc (1).
• Record any growth inhibition (1)
• Perform serial dilution to check the minimal dose (0.5).

A slow-growing fungus (take several years to grow) was found to produce a useful
peptide antibiotic. There was only several hundred grams of the fungus available. Using
this amount of raw material, about one milligram of the purified peptide antibiotic could be
obtained. A much higher amount was needed.

(b) Carefully design an approach to produce this peptide antibiotic in large quantity (12 marks).

• Purify the target peptide antibiotic (1).

• Perform partial protein sequencing (1).
• Design degenerate primers based on the amino acid sequence (1).
• Construct a cDNA library of the target fungus (1).
• The cDNAs should be placed 3’ to an inducible (1) promoter that can function in E. coli
cells (1).
• Fusion protein will be constructed so that the target people antibiotic is tagged (2).
• Shine-Delgarno sequence should be included right upstream of the start codon (1).
• Using the degenerate primers, screen for the full-length cDNA clone encoding the peptide
antibiotic (2).
• After obtaining the target clone, transform to E. coli (1) and grow the transform under
non-inducible conditions (1).
• For production in large quantity, fermenters can be used (1).
• Induce the expression of the target cDNA a few hours before harvesting (1).
• Using the tag added, obtain highly purified products (1).

-2-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:
Question 3

In year 5000, the Federation of Solar System was formed. Through effective
communication via the Cybermail system, it was known that all planets in the Solar System
have human-like living creatures. A research was conducted to verify one old saying on the
Earth: “Men are from Mars and Women are from Venus”.
In one experiment, scientists decided to compare the sex-determining region Y (SRY)
genes of male humans in all planets. In Earth’s male human, this gene was cloned and found
to be male specific. Analysis of the gene sequences of male humans in different planets may
help to understand their evolutionary relationship.
The human SRY gene was cloned into the multiple cloning sites of a vector. The
multiple cloning site was flanked by a T7 and a T3 promoter.

T7 p romoter SRY T3 p romoter

DNA sequencing of the middle portion of the coding region gave the following results:

T7 ……………………………………………………………………………………….

agagaaccctcaaatgcaaaactcagagatcagcaagtggctgggatgcaagtggaaaatgcttacagaagccgaaaagc

………………………………………………………………………………………. T3

(a) If you need to make a riboprobe for Northern blot analyses of the SRY gene, will
you use T7 or T3 RNA polymerase for this purpose? Explain you answer (8
marks) [Hint: you may need to use the table in Prof. Fung’s part]

• When translate in all 6 reading frames, stop codons were found in frames -1, -2, and -3
while no stop codons were found in frames +1, +2, and +3 (4).
• Therefore the orientation of the coding strand must be in a direction T7 to T3 (2; this two
marks must follow the reasoning in point #1).
• To perform Northern blot, the sequence of the probe should be complementary to the
coding strand (2).
• Therefore, to make riboprobe, T3 RNA polymerase should be used (2).

-3-
BIO4320 Mid-Term Examination Oct. 16, 2001
Name: Student ID:

(b) Making use of the SRY gene from the Earth’s male human, design an experiment
to obtain homologous genes from other male humans (10 marks)

• Make probes from the SRY gene from the Earth’s male human (1).
• Description of how to make probes (2).
• Construct cDNA libraries of male humans from all other planets (1).
• Using the probes generated, perform low-stringency screening (2) of all cDNA libraries to
obtain homologous SRY genes (1).
• Low-stringency allows mismatches (1) and hence enable identification of homologous
genes of similar but not identical sequences (1).
• To achieve low-stringency, use lower hybridization temperature (1), lower washing
temperature (1), and higher salt concentration in the washing step (1).

After obtaining all SRY genes and submit them to the Universe GenBank, a Blastp
search was performed for the human SRY.

(c) What is a Blastp search? How does it differ from the Blastx search (4 marks).

• Blastp: comparison of a target protein sequence (1) to the protein database (1).
• Blastx: the computer will translation (1) (in six reading frames) your input DNA sequence
(1), before compared to the protein database (1).

(d) If men are really originated from Mars, do you expect to see a large or small E
value when compared the homology between the SRY proteins of Earth’s male
and Mars’ male (1 mark).

• Small (1)

(e) When investigating the Blastp results, it was found that one region of the SRY
protein sequence was replaced by XXXXXXX, what had happened and how can
you prevent this (5 marks).

• The XXXXXXX indicates a region of low complexity (with repeated sequences) (3). to
prevent this, uncheck the filter for low complexity region (3).

- End of Part II -

-4-