Archives of Oral Biology 70 (2016) 47–54

Contents lists available at ScienceDirect

Archives of Oral Biology

journal homepage: www.elsevier.com/locate/aob

Microvibration stimulates b-catenin expression and promotes

osteogenic differentiation in osteoblasts
Yilin Zhanga , Weiwei Houa,b , Yang Liua , Hui Longa , Ling Zhanga , Zhuoli Zhua ,
Haiyang Yua,*
a
State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, PR China
b
Affiliated Hospital of Stomatology, Medical College, Zhejiang University, Hangzhou, PR China

A R T I C L E I N F O A B S T R A C T

Article history:
Received 6 August 2015 Previous studies have demonstrated that low-magnitude, high-frequency (LMHF) mechanical vibrations
Received in revised form 30 May 2016 (LM < 1 g; HF < 20–90 Hz) can benefit bone formation. However, the underlying mechanism is unclear. In
Accepted 8 June 2016 this study, MC3T3-E1 cells were exposed to LMHF vibrations of different magnitudes to assess the effect
of vibrations on b-catenin expression, which regulates osteogenic differentiation. LMHF vibrations (0.14–
Keywords: 0.49 g)increased cell viability, alkaline phosphatase activity and calcification in a dose (magnitude)-
Osteoblasts dependent manner. The level of b-catenin expression increased 1.6-fold using 0.49 g LMHF vibrations
Microvibration compared to the control. Similarly, the use of LMHF vibrations increased Runx2 protein expression with
Proliferation
the greatest effect at 0.32 g exposure. The levels of BMP2, Osterix and Cyclin D1 protein expression were
Osteogenic differentiation
also elevated and were expressed highest in cells exposed to 0.49 g. mRNA expression levels of these
proteins were similarly affected by exposure to LMHF vibrations. These results suggest that LMHF
vibrations promote cell viability and osteogenic differentiation of osteoblasts by up-regulating related
proteins and genes. The activation of b-catenin plays an important role in the effect of microvibration
exposure in osteoblasts.
ã 2016 Elsevier Ltd. All rights reserved.

1. Introduction Zhou, Zhang, & Yu, 2011). In addition, LMHF vibrations promote
bone marrow stromal cell (BMSC) differentiation and increase
Osteointegration of dental implants is crucial for bone bone formation from BMSC progenitors seeded on bone-derived
remodeling. Micromotion exerts its effects at the dental-implant scaffolds along with increased expression ofCbfa1, ALP, collagen I
interface (Gao, Zhang, Zhu, & Yu, 2012), and micromotion of certain and osteocalcin (Zhou et al., 2011). However, the underlying
magnitudes is beneficial for osteogenesis and osteointegration molecular events in osteoblasts exposed to LMHF vibrations
(Szmukler-Moncler, Salama, Reingewirtz, & Dubruille, 1998), remain unclear.
promoting newly formed bone volume, bone density and cortical b-catenin regulates osteoblast differentiation and bone forma-
bone ratio (Wang et al., 2016). However, the underlying mecha- tion by mediating the Wnt signaling pathway (Krishnan, Bryant, &
nisms are largely unknown. Macdougald, 2006). When T-cell transcription factor and lymphoid
Osteoblasts play a key role in mechanotransduction, which is enhancer binding transcription factor are present in osteoblasts,
involved in the regulation of alveolar bone resorption and b-catenin is stabilized in expression (Huelsken & Birchmeier,
formation. Although the micromechanical environment is involved 2001), translocates into the nucleus, and activates downstream
in alveolar bone remodeling and is important for implant osteogenic transcription (Willert, Epping, Pollack, Brown, & Nusse,
osteointegration, there is little information regarding the molecu- 2002). Increased b-catenin expression causes an increase in
lar response of cells to micromovement forces. Our previous study expression of CyclinD1, Runx2 and c-myc, while decreased
showed that a LMHF mechanical vibration of 0.49 g best activates expression of b-catenin causes a reduction in expression of
Wnt10b and promotes osteogenesisinMC3T3-E1 cells (Hou, Zhu, collagen I, osterix and osteocalcin production (Day, Guo, Garrett-
Beal, & Yang, 2005).
CyclinD1 and Runx2 are downstream genes in the Wnt pathway
* Corresponding author at: Department of Prosthodontics, West China Hospital of that could be functionally enhanced by binding b-catenin to
Stomatology, Sichuan University, Chengdu, 610041, PR China. promote cell proliferation (Jaiswal, Marlow, Gupta, & Narayan,
E-mail address: [email protected] (H. Yu).

http://dx.doi.org/10.1016/j.archoralbio.2016.06.009
0003-9969/ã 2016 Elsevier Ltd. All rights reserved.
48 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54

2002) and osteogenic differentiation (Gaur et al., 2005). BMP2 nitrophenol (p-NP) at 405 nm was measured. Values were normal-
promotes osteogenic differentiation, which is enhanced with over ized to total protein content, which was measured using a BCA
expression of b-catenin (Zhu et al., 2009). Osterix, which is (bicinchoninic acid reagent) protein assay kit (Pierce Protein
involved in the b-catenin pathway and induced by BMP2 (Lee, Research Products [part of Thermo Fisher Scientific Inc.]), and
Kwon, Park, Wozney, & Ryoo, 2003), also plays an essential role in expressed as U/mg total protein. Cells were harvested for this
osteogenic differentiation. assessment each day after vibration treatment. Images of ALP
In order to confirm further the role of LMHF vibrations as a stained cultures were obtained by digital camera (A5100, Sony,
biophysical signal in MC3T3-E1 cells, this study examined Japan).
changes in expression of b-catenin and osteogenic markers,
including CyclinD1, Runx2, Osterix and BMP2, at both the protein 2.4. Calcification assay
and mRNA level in MC3T3-E1cells treated with LMHF vibrations.
The primary goal of this study was to elucidate how micro- Calcification of MC3T3-E1 cells was examined using alizarin red
vibrations affect the b-catenin pathway. S (Sigma-Aldrich, St. Louis, MO, USA) staining and the process
described by Zhao, Zou, Shi, Wu, and Chen (2007) previously.
2. Materials and methods Images of alizarin red S stained cultures were obtained by digital
camera (A5100, Sony, Japan). The number of calcification nodules
2.1. Cell culture and LMHF vibrations was calculated by averaging six values of different microscopic
fields (100) (DM IRB, Leica, Germany).
MC3T3-E1 cells (obtained from the State Key Laboratory of Oral
Diseases at Sichuan University) were cultured and treated with 2.5. Western blot analysis
LMHF vibrations as previously described (Hou et al., 2011). The
vibration frequency was 40 Hz, while the magnitude was set to 0.06, Total protein was separated using 10% SDS polyacrylamide gel
0.14, 0.32, 0.49, 0.66 or 0.8 g as previous studies indicated these electrophoresis and transferred to polyvinylidene difluoride
values to be optimal for bone remodeling (Hou et al., 2011; Judex, Lei, membranes. The blots were incubated over night at 4  C with
Han, & Rubin, 2007; Xie et al., 2006; Zhou et al., 2011). Twelve hours murine anti-CyclinD1 (1:10000 dilution), anti-Runx2 (1:1000
after a 3-day vibration treatment (30 min/day), cells were harvested dilution), anti-Osterix (1:1000 dilution), anti-BMP2 (1:200 dilu-
for assessing biochemical markers. tion) and anti-b-catenin (1:1000 dilution) monoclonal antibodies
(Abcam, Cambridge, UK). The housekeeping gene glyceraldehyde-
2.2. Cell viability assay 3-phosphate dehydrogenase (GAPDH) was used as an internal
control using an anti-GAPDH antibody (1:1000 dilution; Abcam,
Cell viability was evaluated by annexin V-FITC and propidium Cambridge, UK). The membranes were then incubated at room
iodide (PI) co-staining (Yuan, Ge, Li, Wu, & Hu, 2002) using an temperature with horseradish peroxidase-conjugated rabbit anti-
annexin V-FITC apoptosis detection kit (Sigma-Aldrich, St. Louis, MO, mouse secondary antibody (1:5000 dilution; Invitrogen Cop.,
USA) according to the manufacturer’s instructions. Cells were Carlsbad, CA) for 1 h. The protein signal was detected using an
observed and photographed using a fluorescence microscope enhanced chemiluminescence detection kit (Pierce Protein Re-
(100) (Leica DM6000 B, Wetzlar, Germany). Quantitative analysis search Products). Signal intensity was quantified by densitometry.
was performed by counting cells in each examination using flow
cytometry (Beckman Coulter, Indianapolis, IN, USA). 2.6. Real-time PCR
3
H-Thymidine incorporation was used to determine cell prolifer-
ation rate. Cells were incubated for 6 h with a-MEM containing Total RNA was isolated from cells using Trizol reagent, and total
tritiated thymidine (3H-TdR; 1 mCi/well). Cells were washed and RNA concentration was quantified by spectrophotometry. RNA was
lysed, and labeled cells were filtered onto glass fiber filters (Millipore, reverse transcribed using the Superscript III Reverse Transcriptase
Billerica, MA, USA). The filters were later dried and dissolved in a Kit (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed
scintillation cocktail (Rotiszint1-ecoplus, Carl Roth, Karlsruhe, using the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA)
Germany) for 2 h in the dark. Radioactivity was measured using a according to the manufacturer’s instructions. The level of GAPDH
liquid scintillation counter (LS 6500; Beckman Coulter Inc., Brea, CA, mRNA and mRNA levels of relevant genes b-catenin, BMP2, Runx2,
USA). Data are expressed as the mean incorporated counts per Osterix and CyclinD1 (Xiong et al., 2013) were determined using an
minute (CPM)  SD. ABI Prism 7700 Sequence Detector System (Applied Biosystems,
Foster City, CA, USA). mRNAs were reverse transcribed at 45  C for
2.3. Alkaline phosphatase activity 30 min followed by the predenaturation at 95  C for 30 s and were
amplified via 40 cycles of: denaturation at 95  C for 5 s, and
Alkaline phosphatase (ALP) activity was assessed using a annealing and extension at 60  C for 31 s. Primer sequences were
quantitative colorimetric assay (Varioskan1 Flash; Thermo Fisher listed in (Table 1). Relative values of target gene expression were
Scientific Inc., Rockford, IL, USA) and ALP staining (BCIP/NBT Alkaline normalized to GAPDH and determined using the 2 DDCT method
Phosphatase Color Development Kit, Beyotime, Shanghai, China) (Livak & Schmittgen, 2001). Data are presented as fold changes
according to the manufacturer’s instructions. The absorbance of p- compared with control.

Table 1
Primers used for quantitative real-time PCR.

Gene Name Forward Reverse

Cyclin D1 ATGAGAACAAGCAGACCATCCGCA GCTTGACTCCAGAAGGGCTTCAAT
Runx2 GAGGGACTATGGCGTCAAACA GGATCCCAAAAGAAGCTTTGC
Osterix AGCGACCACTTGAGCAAACAT GCGGCTGATTGGCTTCTTCT
BMP2 AGTGATGTGGGGTGGGAATGAC TGGTTAGTGGAGTTCAGGTGGT
b-catenin CAGCCAAGAGAGGAAGTGGTC CAATGGTGGAGTGGTAGAGTGAG
GAPDH 5GACATCAAGAAGGTGGTGAAGC GAAGGTGGAAGAGTGGGAGTT
 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54 49

2.7. Statistical analysis

All assays were repeated in 3 independent experiments, and

results are expressed as the mean  SD. Between-group data were
compared using one-way analysis of variance and the post-
hocmultiple-comparison Dunnett’s test. Relationships between
levels of biochemical markers were characterized using Pearson’s
linear correlation coefficient. Statistical analyses were performed
using the SPSS1 statistical package, version 11.5 (SPSS, Chicago, IL,
USA) for Windows1. A P-value of <0.05 was considered to be
statistically significant.

3. Results

3.1. Cell viability under conditions of LMHF vibration

There was no significant difference in the viability of cells

exposed to vibration of magnitudes lower than 0.49 g compared
with controls. Cells exposed to vibration magnitudes of 0.66 g and
0.8 g showed significant increased apoptotic and necrotic cells
(Fig. 1).
3
H-thymidine incorporation increased with vibration magni- Fig. 2. Incorporation of 3H-thymidine into MC3T3-E1 cells after mechanical
tude. Compared with controls (201 cpm), 3H-thymidine incorpo- microvibration at different magnitudes. Data are expressed as the mean  SD
ration was initially decreased to 183 cpm at 0.06 g magnitude, and counts per minute (CPM) (n = 9); *p < 0.05 versus control.
significantly increased with increasing magnitude to reach its
highest point of 250 cpm at 0.49 g. Incorporation later decreased to 3.2. Increased expression of alkaline phosphatase under conditions of
210 cpm at 0.66 g, which was still slightly higher than the control LMHF vibration
(Fig. 2).
During Day 1, the level of ALP activity in all groups remained
unchanged (4 U/ug). On Day 2, the level of ALP activity increased
(5.5 U/ug) at 0.49 g compared with the control group (4.3 U/ug), but
other groups still remained unchanged. On Day 3, the level of ALP

Fig. 1. (A) The images under fluorescence micrographs of apoptosis (green: annexin V-FITC stained cells) and necrosis (red: propidium iodide stained cells) in MC3T3-E1 cells
after microvibration at different magnitudes.
(A1) Control; (A2) 0.49 g; (A3) 0.66 g (100).
(B) Cell count of annexin V-FITC and PI co-staining using flow cytometry. Data are expressed as the mean  SD [n = 9]; *p < 0.05 versus control. (For interpretation of the
references to colour in this figure legend, the reader is referred to the web version of this article.)
50 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54

Fig. 3. (A) The images of ALP stained cultures of MC3T3-E1 cells after different magnitudes of vibration displacement in day 3.
(A1) Control, (A2) 0.06 g, (A3) 0.14 g, (A4) 0.32 g, (A5) 0.49 g, (A6) 0.66 g.
(B) ALP activities of MC3T3-E1 cells after different magnitudes of vibration displacement. Data are expressed as the mean  SD [n = 9]; *p < 0.05 versus control.
 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54 51

activity increased gradually with increasing magnitude, until it fell 0.49 g, and finally decreased to a level lower than that of the control
below the control level at 0.66 g. Compared with the control group (0.7-fold) at 0.66 g.
(5 U/mg), ALP activity increased to reach its highest level (8 U/mg) Compared with control, b-catenin protein expression also
at 0.49 g. At higher vibration magnitudes, ALP activity steeply decreased (0.7-fold) at 0.06 g, then increased with magnitude to
declined and fell below control level (3 U/mg) at 0.66 g. ALP activity reach its highest point (1.6-fold) at 0.49 g, and finally decreased to a
level increased each day, except for that of the 0.66 g group, which level lower than that of the control (0.9-fold) at 0.66 g (Fig. 5).
decreased on day 3. ALP staining showed similar results (Fig. 3).
3.5. Changes in mRNA expression of MC3T3-E1 cells under conditions
3.3. Increased calcium deposition level under conditions of LMHF of LMHF vibration
vibration
Similar alteration patterns with protein expression were found
The level of calcium deposition increased significantly (78) at in mRNA expression.
0.32 g compared to the control (50). Calcium deposition was Compared with the control, transcription of Cyclin D1, Osterix,
greatest (99) at 0.49 g, and then reduced to the control level at BMP2 and b-catenin all decreased at 0.06 g, then increased
0.66 g (Fig. 4). gradually with increasing magnitude, reached their highest points
at 0.49 g, and finally slightly decreased at 0.66 g.
3.4. Protein expression of osteogenic markers under conditions of Runx2 mRNA expression decreased compared with the control
LMHF vibration at 0.06 g, then increased at 0.14 g, reached its highest point at
0.32 g, and finally decreased with magnitude to a level slightly
Protein expression was reduced by vibration at 0.06 g, but then higher than that of the control at 0.66 g (Fig. 6).
significantly increased with magnitudes up to 0.49 g before
declining to control levels at 0.66 g. 4. Discussion
Compared with the control, Cyclin D1 protein expression
decreased (0.7-fold) at 0.06 g, then increased gradually with Vibration promotes osteogenesis (Bacabac et al., 2006). The
magnitude to reach its highest point (2.8-fold) at 0.49 g, and finally b-catenin mediated Wnt signaling pathway plays a critical role
decreased again (1.8-fold) at 0.66 g. among such bone responses (Robinson et al., 2006). In previous
Runx2 protein expression decreased (0.8-fold) compared with work, MC3T3-E1 cells responded to LMHF vibration by activating
the control at 0.06 g, then increased (1.2-fold) at 0.14 g, reached its Wnt10b at both mRNA and protein levels, and caused micro-
highest point (3-fold) at 0.32 g, and finally decreased with vibration-induced osteogenesis (Hou et al., 2011). However, the
magnitude to a level slightly higher than that of the control alteration of b-catenin expression and expression of downstream
(1.2-fold) at 0.66 g. genes in this process are unknown.
Osterix protein expression decreased slightly (0.9-fold) at 0.06 g Consistent with previous results, 0.32–0.49 g of microvibrations
compared with the control, then increased with magnitude to optimally intensified b-catenin expression and promoted osteo-
reach its highest point (2-fold) at 0.49 g, and finally decreased to a blast proliferation and differentiation. b-catenin activates down-
level lower than that of the control (0.7-fold) at 0.66 g. stream genes, up-regulates protein expression and eventually
BMP2 protein expression decreased (0.6-fold) at 0.06 g, then regulates proliferation and differentiation of osteoblasts (Kestler &
increased with magnitude to reach its highest point (2.4-fold) at Küh, 2008). In osteoblasts treated with optimal levels of

Fig. 4. (A) Calcium deposition of MC3T3-E1 cells stained by alizarin red S after different magnitudes of vibration displacement.
(A1) Control, (A2) 0.06 g, (A3) 0.14 g, (A4) 0.32 g, (A5) 0.49 g, (A6) 0.66 g.
(B) Average numbers of the calcification nodules after different magnitudes of vibration displacement by counting 6 microscopic views (100) for each group. Data are
expressed as the mean  SD [n = 9]; *p < 0.05 versus control.
52 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54

Fig. 5. (A and B) Levels of Cyclin D1, Runx2, Osterix, BMP2, b-catenin and GAPDH protein, as measured by Western blotting, in MC3T3-E1 cells after microvibration at different
magnitudes. Data are expressed as the mean  SD [n = 3]; *p < 0.05 versus control.

microvibration, b-catenin protein and mRNA expression levels (Ducy, Zhang, Geoffroy, Ridall, & Karsenty, 1997). BMP2 promotes
were elevated approximately 2-fold. When stabilized and accu- differentiation by activating Smad genes (Liu et al., 2007). Protein
mulated, b-catenin enhances transcription of its target gene Cyclin and mRNA expression of Runx2 also increased in osteoblasts
D1, which regulates G1/S-phase cell cycle progression (Tetsu & treated with vibrations. Others have previously shown a similar
McCormick, 1999; Shtutman et al., 1999) and enhancesprolifera- response to fluid shear forces and cyclic tensile strain (Koike,
tion (Knudsen, Diehl, Haiman, & Knudsen, 2006). In this study, Shimokawa, Kanno, Ohya, & Soma, 2005). Also in this study, BMP2
protein and mRNA expression of Cyclin D1 increased under protein and mRNA levels were significantly upregulated when
conditions of optimal microvibrationin agreement with b-catenin treated with the optimal level of microvibrationin a similar
expression. Because transcribed Cyclin D1 promotes cell prolifera- manner to b-catenin, possibly due to correlation of the enhancer
tion, the number of cells in S phase increases, causing an elevated and target.
3
H-thymidine incorporation rate (Stanford, Morcuende, & Brand, As a result of increased Runx2 and BMP2 expression, alkaline
1995). In this study, the 3H-thymidine incorporation rate increased phosphatase (ALP) activity (Cooper, Harris, Bruder, Kowalski, &
in a dose (magnitude)-dependent manner similar to b-catenin and Kadiyala, 2001) is significantly increased during ossification. In this
Cyclin D1 expression, which suggests that LMHF vibrations study, ALP activity gradually increased in a dose (magnitude)-
promote osteoblast proliferation via the b-catenin signal. dependent manner with increasing vibration magnitude, which
BMP2, Runx2 and Oxterix are also downstream genes of was consistent with changes in b-catenin, BMP2, and Runx2
stabilized b-catenin that are important for osteogenic differentia- expression. Alizarin red staining showed as increased level of
tion. During osteogenic differentiation, Runx2 directly regulates calcium deposition, which is a strong indication of osteogenic
bone marker genes specific for OPN, OCN, and type I collagen differentiation. These data are consistent with previous results in
 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54 53

Fig. 6. mRNA expression of Cyclin D1, Runx2, Osterix, BMP2 and b-catenin in MC3T3-E1 cells treated with microvibration at different magnitudes. Data are expressed as the
mean  SD [n = 9]; *p < 0.05 versus control.

that Wnt signaling increases BMP expression in C3H10T1/2 cells Ethical approval
(Winkler et al., 2005) and suggests that optimal microvibration
promotes osteoblast proliferation via the b-catenin signal. All surgical procedures followed protocols approved by the
In conclusion, LMHF vibrations of 0.32–0.49 g optimally Institution of Animal Care and Use Committee of State Key
enhance cell viability and osteogenic differentiation of osteoblasts. Laboratory of Oral Diseases, West China Hospital of Stomatology,
b-catenin expression was promoted by optimal treatment, and Sichuan University (Grant No.: SKLODLL2013A093).
together with subsequent enhancement of Cyclin D1, Runx2,
Osterix and BMP2 expression, osteoblast proliferation and Acknowledgements
differentiation were enhanced as exhibited by significant up
regulation of 3H-thymidine incorporation rate, ALP activity and This study was supported by grants from the Sichuan Province
calcification. Science and Technology Supporting Program (No. 2014SZ0037)
and the Sichuan Province Science and Technology Innovation Team
Conflict of interest Program (No. 2011JTD0006).

The authors had no conflicts of interest to declare in relation to

this article.
54 Y. Zhang et al. / Archives of Oral Biology 70 (2016) 47–54

References Robinson, J. A., Chatterjee-Kishore, M., Yaworsky, P. J., Cullen, D. M., Zhao, W., Li, C., et
al. (2006). Wnt/beta-catenin signaling is a normal physiological response to
Bacabac, R. G., Smit, T. H., Van Loon, J. J., Doulabi, B. Z., Helder, M., & Klein-Nulend, J. mechanical loading in bone. Journal of Biological Chemistry, 281(42), 31720–
(2006). Bone cell responses to high-frequency vibration stress: does the nucleus 31728.
oscillate within the cytoplasm? FASEB Journal, 20(7), 858–864. Shtutman, M., Zhurinsky, J., Simcha, I., Albanese, C., D’Amico, M., Pestell, R., et al.
Cooper, L. F., Harris, C. T., Bruder, S. P., Kowalski, R., & Kadiyala, S. (2001). Incipient (1999). The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway.
analysis of mesenchymal stem-cell-derived osteogenesis. Journal of Dental Proceedings of The National Academy of Sciences of The United States of America, 96
Research, 80(1), 314–320. (10), 5522–5527.
Day, T. F., Guo, X., Garrett-Beal, L., & Yang, Y. (2005). Wnt/beta-catenin signaling in Stanford, C. M., Morcuende, J. A., & Brand, R. A. (1995). Proliferative and phenotypic
mesenchymal progenitors controls osteoblast and chondrocyte differentiation responses of bone-like cells to mechanical deformation. Journal of Orthopaedic
during vertebrate skeletogenesis. Developmental Cell, 8(5), 739–750. Research, 13(5), 664–670.
Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., & Karsenty, G. (1997). Osf2/Cbfa1: a Szmukler-Moncler, S., Salama, H., Reingewirtz, Y., & Dubruille, J. H. (1998). Timing of
transcriptional activator of osteoblast differentiation. Cell, 89(5), 747–754. loading and effect of micromotion on bone-dental implant interface: review of
Gao, S. S., Zhang, Y. R., Zhu, Z. L., & Yu, H. Y. (2012). Micromotions and combined experimental literature. Journal of Biomedical Materials Research, 43(2), 192–203.
damages at the dental implant-bone interface. International Journal of Oral Tetsu, O., & McCormick, F. (1999). Beta-catenin regulates expression of cyclin D1 in
Science, 4(4), 182–188. colon carcinoma cells. Nature, 398(6726), 422–426.
Gaur, T., Lengner, C. J., Hovhannisyan, H., Bhat, R. A., Bodine, P. V., Komm, B. S., et al. Wang, S., Liu, Y., Tang, Y., Zhao, W., Li, J., Yang, Y., et al. (2016). Direct Radial LMHF
(2005). Canonical WNT signaling promotes osteogenesis by directly stimulating Microvibration induced bone formation and promoted implant
Runx2 gene expression. Journal of Biochemistry, 280(39), 33132–33140. osseointegration. Clinical Implant Dentistry and Related Research, 18(2), 401–409.
Hou, W. W., Zhu, Z. L., Zhou, Y., Zhang, C. X., & Yu, H. Y. (2011). Involvement of Wnt Willert, J., Epping, M., Pollack, J. R., Brown, P. O., & Nusse, R. (2002). A transcriptional
activation in the micromechanical vibration-enhanced osteogenic response of response to Wnt protein in human embryonic carcinoma cells. BMC
osteoblasts. Journal of Orthopaedic Science, 16(5), 598–605. Developmental Biology, 2, 8.
Huelsken, J., & Birchmeier, W. (2001). New aspects of Wnt signaling pathways in Winkler, D. G., Sutherland, M. S., Ojala, E., Turcott, E., Geoghegan, J. C., Shpektor, D.,
higher vertebrates. Current Opinion in Genetics & Development, 11(5), 547–553. et al. (2005). Sclerostin inhibition of Wnt-3a-induced C3H10T1/2 cell
Jaiswal, A. S., Marlow, B. P., Gupta, N., & Narayan, S. (2002). Beta-catenin-mediated differentiation is indirect and mediated by bone morphogenetic proteins.
transactivation and cell–cell adhesion pathways are important in curcumin Journal of Biological Chemistry, 280(4), 2498–2502.
(difemylmethane)- induced growth arrest and apoptosis in colon cancer cells. Xie, L., Jacobson, J. M., Choi, E. S., Busa, B., Donahue, L. R., Miller, L. M., et al. (2006).
Oncogene, 21(55), 8414–8427. Low-level mechanical vibrations can influence bone resorption and bone
Judex, S., Lei, X., Han, D., & Rubin, C. (2007). Low-magnitude mechanical signals that formation in the growing skeleton. Bone, 39(5), 1059–1066.
stimulate bone formation in the ovariectomized rat are dependent on the Xiong, C. J., Li, P. F., Song, Y. L., Xue, L. X., Jia, Z. Q., Yao, C. X., et al. (2013). Insulin
applied frequency but not on the strain magnitude. Journal of Biochemistry, 40 induces C2C12 cell proliferation and apoptosis through regulation of cyclin D1
(6), 1333–1339. and BAD expression. Journal of Cellular Biochemistry, 114(12), 2708–2717.
Kestler, H. A., & Küh, M. (2008). From individual Wnt pathways towards a Wnt Yuan, Y. J., Ge, Z. Q., Li, J. C., Wu, J. C., & Hu, Z. D. (2002). Differentiation of apoptotic
signaling network. Philosophical Transactions of The Royal Society of London Series and necrotic cells in suspension cultures of Taxuscuspidata by the combined use
B Biological Sciences, 363(1495), 1333–1347. of fluorescent dying and histochemical staining methods. Biotechnology Letters,
Knudsen, K. E., Diehl, J. A., Haiman, C. A., & Knudsen, E. S. (2006). Cyclin D1: 24, 71–76.
polymorphism, aberrant splicing and cancer risk. Oncogene, 25(11), 1620–1628. Zhao, Y., Zou, B., Shi, Z. Y., Wu, Q., & Chen, G. Q. (2007). The effect of 3-
Koike, M., Shimokawa, H., Kanno, Z., Ohya, K., & Soma, K. (2005). Effects of hydroxybutyrate on the in vitro differentiation of murine osteoblast MC3T3-E1
mechanical strain on proliferation and differentiation of bone marrow stromal and in vivo bone formation in ovariectomized rats. Biomaterials, 28(20), 3063–
cell line ST2. Journal of Bone and Mineral Metabolism, 23(3), 219–225. 3073.
Krishnan, V., Bryant, H. U., & Macdougald, O. A. (2006). Regulation of bone mass by Zhou, Y., Guan, X., Zhu, Z., Gao, S., Zhang, C., Li, C., et al. (2011). Osteogenic
Wnt signaling. Journal of Clinical Investigation, 116(5), 1202–1209. differentiation of bone marrow-derived mesenchymal stromal cells on bone-
Lee, M. H., Kwon, T. G., Park, H. S., Wozney, J. M., & Ryoo, H. M. (2003). BMP-2- derived scaffolds: effect of microvibration and role of ERK1/2 activation.
induced Osterix expression ismediated by Dlx5 but is independent of Runx2. European Cells & Materials, 22, 12–25.
Biochemical and Biophysical Research Communications, 309(3), 689–694. Zhu, M., Tang, D., Wu, Q., Hao, S., Chen, M., Xie, C., et al. (2009). Activation of beta-
Liu, T., Gao, Y., Sakamoto, K., Minamizato, T., Furukawa, K., Tsukazaki, T., et al. (2007). catenin signaling in articular chondrocytes leads to osteoarthritis-like
BMP-2 promotes differentiation of osteoblasts and chondroblasts in Runx2- phenotype in adult beta-catenin conditional activation mice. Journal of Bone And
deficient cell lines. Journal of Cellular Physiology, 211(3), 728–735. Mineral Research, 24(1), 12–21.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2( Delta DeltaC(T)) method. Methods, 25(4),
402–408.