Elife 49882 v2

RESEARCH ARTICLE
Obesity-linked suppression of membrane-

bound O-acyltransferase 7 (MBOAT7)
drives non-alcoholic fatty liver disease
Robert N Helsley1,2, Venkateshwari Varadharajan1, Amanda L Brown1,
Anthony D Gromovsky1, Rebecca C Schugar1, Iyappan Ramachandiran1,
Kevin Fung1, Mohammad Nasser Kabbany1, Rakhee Banerjee1,
Chase K Neumann1, Chelsea Finney1, Preeti Pathak1, Danny Orabi1,
Lucas J Osborn1, William Massey1, Renliang Zhang1, Anagha Kadam1,
Brian E Sansbury3, Calvin Pan4,5,6, Jessica Sacks7, Richard G Lee8,
Rosanne M Crooke8, Mark J Graham8, Madeleine E Lemieux9,
Valentin Gogonea10, John P Kirwan7, Daniela S Allende11, Mete Civelek12,
Paul L Fox1, Lawrence L Rudel13, Aldons J Lusis4,5,6, Matthew Spite3,
J Mark Brown1*
1
Department of Cardiovascular and Metabolic Sciences, Cleveland Clinic, Cleveland,
United States; 2Department of Internal Medicine, University of Cincinnati,
Cincinnati, United States; 3Center for Experimental Therapeutics & Reperfusion
Injury, Department of Anesthesiology, Perioperative and Pain Medicine, Brigham
and Women’s Hospital, Harvard Medical School, Boston, United States;
4
Department of Medicine, University of California, Los Angeles, Los Angeles, United
States; 5Department of Microbiology, University of California, Los Angeles, Los
Angeles, United States; 6Department of Human Genetics, University of California,
Los Angeles, Los Angeles, United States; 7Department of Pathobiology, Cleveland
Clinic, Cleveland, United States; 8Cardiovascular Group, Antisense Drug Discovery,
Ionis Pharmaceuticals, Inc, Carlsbad, United States; 9Bioinfo, Plantagenet, Canada;
10
Department of Chemistry, Cleveland State University, Cleveland, United States;
11
*For correspondence: Department of Anatomical Pathology, Cleveland Clinic, Cleveland, United States;
[email protected] 12
Department of Biomedical Engineering, University of Virginia, Charlottesville,
Competing interest: See United States; 13Department of Pathology, Section on Lipid Sciences, Wake Forest
page 30 University School of Medicine, Winston-Salem, United States
Funding: See page 30
Received: 03 July 2019

Accepted: 11 October 2019
Published: 17 October 2019
Abstract Recent studies have identified a genetic variant rs641738 near two genes encoding
membrane bound O-acyltransferase domain-containing 7 (MBOAT7) and transmembrane channel-
Reviewing editor: Peter like 4 (TMC4) that associate with increased risk of non-alcoholic fatty liver disease (NAFLD), non-
Tontonoz, University of alcoholic steatohepatitis (NASH), alcohol-related cirrhosis, and liver fibrosis in those infected with
California, Los Angeles, United viral hepatitis (Buch et al., 2015; Mancina et al., 2016; Luukkonen et al., 2016; Thabet et al., 2016;
States
Viitasalo et al., 2016; Krawczyk et al., 2017; Thabet et al., 2017). Based on hepatic expression
Copyright Helsley et al. This quantitative trait loci analysis, it has been suggested that MBOAT7 loss of function promotes liver
article is distributed under the disease progression (Buch et al., 2015; Mancina et al., 2016; Luukkonen et al., 2016; Thabet et al.,
terms of the Creative Commons 2016; Viitasalo et al., 2016; Krawczyk et al., 2017; Thabet et al., 2017), but this has never been
Attribution License, which formally tested. Here we show that Mboat7 loss, but not Tmc4, in mice is sufficient to promote the
permits unrestricted use and
progression of NAFLD in the setting of high fat diet. Mboat7 loss of function is associated with
redistribution provided that the
accumulation of its substrate lysophosphatidylinositol (LPI) lipids, and direct administration of LPI
original author and source are
credited.
promotes hepatic inflammatory and fibrotic transcriptional changes in an Mboat7-dependent
Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 1 of 36

Research article Human Biology and Medicine
manner. These studies reveal a novel role for MBOAT7-driven acylation of LPI lipids in suppressing
the progression of NAFLD.
DOI: https://doi.org/10.7554/eLife.49882.001
Introduction
Non-alcoholic fatty liver disease (NAFLD) is an increasingly common condition that affects roughly
one-third of adults in the United States (Cohen et al., 2011; Machado and Diehl, 2016; Rinella and
Sanyal, 2016; Wree et al., 2013). The expansion of adipose tissue in obese individuals is strongly
associated with the development of NAFLD, yet mechanisms linking obesity to NAFLD and more
advanced forms of liver disease such as NASH and cirrhosis are not well understood (Cohen et al.,
2011; Machado and Diehl, 2016; Rinella and Sanyal, 2016; Wree et al., 2013). Genome-wide
association studies (GWAS) provide a powerful unbiased tool to identify new genes and pathways
that are involved in human disease, allowing for pinpoint accuracy in identification of new drug tar-
gets. This is exemplified by the recent success story of human genetic studies leading to rapid devel-
opment of monoclonal antibodies targeting proprotein convertase subtilisin/kexin type 9 (PCSK9)
for hyperlipidemia and cardiovascular disease (Hess et al., 2018). Within the last two years, several
independent GWAS studies have identified a liver disease susceptibility locus (rs641738) within a
linkage-disequilibrium block that contains genes encoding MBOAT7 and TMC4 (Buch et al., 2015;
Mancina et al., 2016; Luukkonen et al., 2016; International Liver Disease Genetics Consortium
et al., 2016; Viitasalo et al., 2016; Krawczyk et al., 2017; Thabet et al., 2017). Strikingly, the
rs641738 variant is associated with all major forms of liver injury including NAFLD, alcoholic-liver dis-
ease (ALD), and viral hepatitis-induced fibrosis (Buch et al., 2015; Mancina et al., 2016;
Luukkonen et al., 2016; International Liver Disease Genetics Consortium et al., 2016;
Viitasalo et al., 2016; Krawczyk et al., 2017; Thabet et al., 2017). The rs641738 variant is associ-
ated with a C > T missense single nucleotide polymorphism (SNP) within the first exon the TMC4
gene, yet available data suggest that TMC4 is not abundantly expressed in human liver
(Mancina et al., 2016). Based on eQTL studies in the liver it has been suggested that instead
reduced expression and activity of MBOAT7 may be mechanistically linked to liver disease progres-
sion (Mancina et al., 2016; Luukkonen et al., 2016; International Liver Disease Genetics Consor-
tium et al., 2016; Viitasalo et al., 2016; Krawczyk et al., 2017; Thabet et al., 2017).
The MBOAT7 gene encodes an acyltransferase enzyme that specifically esterifies arachidonyl-
CoA to lysophosphatidylinositol (LPI) to generate the predominant molecular species of phosphati-
dylinositol (PI) in cell membranes (38:4) (Gijón et al., 2008; Zarini et al., 2014; Lee et al., 2012;
Anderson et al., 2013). Given this biochemical activity, MBOAT7 is a unique contributor to the
Lands’ cycle, which is a series of phospholipase-driven deacylation and lysophospholipid acyltransfer-
ase-driven reacylation reactions that synergize to alter phospholipid fatty acid composition, creating
membrane asymmetry and diversity (Shindou and Shimizu, 2009; Shindou et al., 2009). It is impor-
tant to note that MBOAT7, unlike other lysophospholipid acyltransferases, only diversifies the fatty
acid composition of membrane PI species and not phospholipids with other head groups
(Gijón et al., 2008; Zarini et al., 2014; Lee et al., 2012; Anderson et al., 2013). Despite recent
progress in characterizing the selective biochemistry of MBOAT7 (Gijón et al., 2008), and the clear
genetic links to liver disease (Buch et al., 2015; Mancina et al., 2016; Luukkonen et al., 2016;
International Liver Disease Genetics Consortium et al., 2016; Viitasalo et al., 2016;
Krawczyk et al., 2017; Thabet et al., 2017), there is no information regarding how MBOAT7 activ-
ity or its substrate (LPI) or product (PI) lipids impact liver disease progression. Here, we demonstrate
that MBOAT7 expression is suppressed in obese humans and rodents. Furthermore, we show that
Mboat7, but not Tmc4, loss of function in mice is sufficient to drive NAFLD progression, and show
that Mboat7 substrate lipids (LPIs) may be critical mediators of obesity-linked liver disease
progression.

eLife digest Non-alcoholic fatty liver disease, or NAFLD for short, is a medical condition that
develops when the liver accumulates excess fat. It can lead to complications such as diabetes and
liver scarring. In humans, mutations that inactivate a protein called MBOAT7 increase the risk of fat
accumulating in the liver.
Genetic studies suggest that low levels of MBOAT7 in a human’s liver cells increase the severity
of NAFLD. Yet the links between MBOAT7, NAFLD and obesity are not well understood. Helsley
et al. used data from humans and from obese mice that had been fed a high-fat diet to investigate
the relationship between NAFLD and MBOAT7. This revealed that people who are obese have
lower levels of MBOAT7 in their livers. Next, obese mice were genetically manipulated to produce
less MBOAT7, which led them to develop more severe NAFLD.
Helsley et al. then grew human liver cells in the laboratory and lowered their levels of MBOAT7,
which led to excess fat accumulating in the cells. This increase in fat accumulation was, at least in
part, due to how these cells metabolize fats when MBOAT7 is reduced: they start making more new
fats and consume fewer lipids to produce energy.
These findings provide a link between obesity and liver damage in both humans and mice, and
show how a decrease in MBOAT7 levels causes changes in fat metabolism that could lead to
NAFLD. The results could drive new approaches to treating liver damage in patients with mutations
in the gene that codes for MBOAT7.
Results
MBOAT7 expression is suppressed in obese humans and rodents
NAFLD progression is commonly associated with obesity, and it has even been suggested that obe-
sity is a causative factor in the pathogenesis of NAFLD (Younossi et al., 2018). Although, there is
now strong support that the common MBOAT7 SNP (rs641738) is associated with NAFLD, it is not
known whether MBOAT7 expression is significantly altered in obese people. To investigate this, we
obtained wedge liver biopsies from sequentially consenting obese bariatric surgery patients and nor-
mal weight controls (Schugar et al., 2017), and examined the expression levels of MBOAT7 mRNA.
We found that hepatic MBOAT7 expression was dramatically reduced in obese people, when com-
pared to normal weight controls (Figure 1A). It is important to note that this striking reduction in
MBOAT7 expression was not due to presence of the rs641738 MBOAT7 SNP, as we found the minor
allele frequency was quite similar in lean, obese, and severely obese subjects (Figure 1A). To follow
up on our findings in human obesity, we also examined hepatic expression levels of Mboat7 in obese
leptin-deficient mice and high fat diet-fed rats. Mboat7 expression was reduced in ob/ob mice com-
pared to lean WT controls (Figure 1B). In agreement, we found that high fat diet-induced obesity in
Sprague-Dawley rats was also associated with significant reductions in hepatic Mboat7 expression
(Figure 1C). Collectively, these results demonstrate that hepatic expression of MBOAT7 is sup-
pressed in obese humans and rodents.
Next, we used a systems genetics approach to examine links between Mboat7 expression and
adiposity traits in mice by leveraging data generated using the hybrid mouse diversity panel (HMDP)
(Ghazalpour et al., 2012). To induce obesity, all HMDP mouse strains were fed an obesity-promot-
ing high fat and high sucrose diet (Parks et al., 2013). Across the different strains in the HMDP, we
found that Mboat7 expression in the liver was only modestly correlated (r = 0.244, p=0.01) with
adiposity (Figure 1D). However, Mboat7 expression in white adipose tissue (WAT) was strongly neg-
atively correlated (r = 0.68, p=2.3e-15) with both fat pad weight and % body fat in male and
female mice (Figure 1E). Given the fact that obesity is commonly associated with insulin resistance
and type 2 diabetes mellitus (Cohen et al., 2011; Machado and Diehl, 2016; Rinella and Sanyal,
2016; Younossi et al., 2018), we also examined the relationship between Mboat7 expression and
insulin sensitivity in the HMDP. We found that expression of Mboat7 in adipose tissue was negatively
(r = 0.38, p=0.0002) associated with indices of insulin sensitivity (Figure 1F). Collectively, these

Figure 1. Obesity suppress MBOAT7 expression in humans, mice, and rats. (A) To investigate the impact human obesity has on MBOAT7 expression,
we obtained wedged liver biopsies from sequentially consenting bariatric surgery patients and normal weight controls. We used these biopsies to
isolate RNA and measure MBOAT7 expression via qPCR. The data are stratified based on BMI. A total of 52 liver biopsies were analyzed. Lean
(BMI <30; n = 10), Obese (30 < BMI > 40; n = 13), and Severely Obese (BMI >40; n = 29) ***p0.001 compared to the lean group. Status of the
rs641738 SNP is shown in the top inset. (B) Liver MBOAT7 expression was measured by QPCR from wild type and ob/ob mice 16–20 weeks of age
(n = 8; **p0.01; two-tailed t-test; Data are presented as mean ± S.E.M.) (C) Liver MBOAT7 expression was measured by QPCR from Sprague Dawley
rats fed a low fat or high fat high diet for 24 weeks (n = 8; **p0.01; two-tailed t-test; Data are presented as mean ± S.E.M.). (D–F) We used a systems
genetics approach to examine links between MBOAT7 expression and metabolic traits in mice from the hybrid mouse diversity panel (HMDP). To
induce obesity, all mouse strains represented in the HMDP were fed an obesity-promoting high fat and high sucrose diet. Across the different strains in
the HMDP, we found that the expression of MBOAT7 in adipose tissue was strongly negatively correlated with body fat percentage (E), and HOMA-IR
(F), while liver MBOAT7 expression was also negatively correlated with fat mass (D).
data suggest that MBOAT7 may be mechanistically linked to the well-known association between
obesity, insulin resistance, and NAFLD progression.
Mboat7 loss of function in mice is sufficient to promote NAFLD

progression
To test whether MBOAT7 impacts obesity-linked NAFLD progression we utilized an in vivo knock-
down approach in high fat diet-fed C57BL/6 mice. Metabolic phenotyping of global Mboat7-/- mice
has been limited due to the fact that these mice are only viable for several weeks after birth due to
the critical role Mboat7 plays in cortical lamination and neuronal migration in the brain (Lee et al.,

2012; Anderson et al., 2013). To overcome this barrier, we have generated second-generation anti-
sense oligonucleotides (ASOs), which predominately target liver, adipose tissue, and cells within the
reticuloendothelial system to selectively knock down Mboat7 expression in adult mice using meth-
ods we have previously described (Schugar et al., 2017). This ASO approach allows us to circumvent
the postnatal lethality of global Mboat7 deletion (Lee et al., 2012; Anderson et al., 2013), and per-
mits investigation into obesity-linked liver disease progression with near complete loss of function of
Mboat7 in the liver. Mboat7 ASO treatment resulted in significant reductions of Mboat7 mRNA and
protein in the liver (Figure 2A), and white adipose tissue (Figure 2—figure supplement 1), without
altering Mboat7 expression in the brain, spleen, heart, or skeletal muscle (Figure 2—figure supple-
ment 2). Although Mboat7 ASO treatment significantly reduced adipose Mboat7 expression (Fig-
ure 2, Figure 2—figure supplement 1), this was not associated with alterations in body weight
(Figure 2B), fat mass (Figure 2—figure supplement 1L), adipose gene expression (Figure 2—figure
supplement 1A–K), food intake (Figure 2C), energy expenditure (Figure 2D, and Figure 2—figure
supplement 3), or physical activity (Figure 2—figure supplement 3). Despite this lack of phenotypic
differences in adipose tissue, Mboat7 knockdown resulted in large alterations in the liver lipid stor-
age. Mboat7 ASO treatment promoted an increase in liver weight (Figure 2F) and striking hepatic
steatosis in HFD-fed, but not chow-fed mice (Figure 2E,I). Importantly, Mboat7 ASO-driven hepatic
steatosis was consistently seen with two distinct ASOs targeting different regions of the Mboat7
messenger RNA (Figure 2—figure supplement 4). Mboat7 ASO-driven hepatic steatosis was char-
acterized by accumulation of triglycerides, free cholesterol, and cholesterol esters only in high fat
fed cohorts (Figure 2J–M). Despite these significant alterations in hepatic lipids, Mboat7 knockdown
did not dramatically alter the levels of triglycerides or cholesterol in circulating lipoproteins (Fig-
ure 2—figure supplement 5). Mboat7 knockdown was also associated with hepatocyte injury as
indicated by elevated liver enzyme levels (AST and ALT), but this only occurred in high fat-fed mice
(Figure 2G,H).
To more comprehensively understand the global effects of Mboat7 knockdown on liver function,
we performed unbiased RNA sequencing experiments in control versus Mboat7 ASO-treated mice
(Figure 3). Principal component analysis of RNA expression profiles showed separation by ASO
group according to principal component analysis and hierarchical clustering analyses (Figure 3A,B).
ASO groups were also partitioned by unsupervised hierarchical clustering (data not shown). Mboat7
knockdown resulted in a number of differentially expressed genes (DEGs), with 124 DEGs being sup-
pressed and 887 DEGs being upregulated by Mboat7 ASO treatment (top 50 DEGs shown in
Figure 3B and overall changes in Figure 3C). To understand the major pathways affected by
Mboat7 knockdown, we performed Gene Ontology Molecular Function enrichment analysis, and
found that many of the pathways that were significantly enriched are mechanistically linked to liver
injury such as leukocyte extravasation, monocyte/macrophage activation, and fibrosis/hepatic stel-
late cell activation (Figure 3D). As predicted Mboat7 mRNA levels were dramatically suppressed by
Mboat7 ASO treatment, but quite unexpectedly we also saw that the expression of Tmc4 was
reduced in Mboat7 ASO-treated mice (Figure 3B,E). These data shown for the first time that ASO-
mediated knockdown of Mboat7 results in coordinated suppression of its neighboring gene Tmc4
(the rs641738 polymorphism is located in exon 1 of the TMC4 gene), indicating some potential cross
talk that deserves further exploration (Figure 3E). Quantitative real time PCR (qPCR) analysis also
confirmed the RNA sequencing results showing that Mboat7 knockdown resulted in elevated expres-
sion of gene associated with inflammation (Tnfa and Il1b) and early fibrosis (Col1a2 and Acta2) in
high fat fed mice (Figure 3E). In addition, Mboat7 knockdown was associated with altered immune
cell populations in the liver. Mboat7 knockdown increased Cd8+ T lymphocytes, while decreasing
the total number of Cd11b+ macrophages in the liver (Figure 3—figure supplement 1). Of the
hepatic macrophages that were present, more were skewed towards the proinflammatory M1
(Cd11c+) state, and less were skewed towards the alternative M2 (Cd206+) phenotype (Figure 3—
figure supplement 1). Collectively, these data suggest that specifically under high fat feeding condi-
tions, Mboat7 loss of function is associated with dysregulated immune cell homeostasis, inflamma-
tion, and gene expression signatures that are consistent with early activation of pro-fibrotic
programs in the liver (Figure 3).

Figure 2. Mboat7 knockdown promotes hepatic steatosis and worsen liver injury. (A and B) C57BL/6 mice were fed chow or HFD with concurrent
Control and Mboat7 ASO Injections at 12.5 mg/kg week for 20 weeks. Liver Mboat7 expression was measured via qPCR (A); n = 8–10; *p0.05,
****p0.0001; Two-way ANOVA with Tukey’s post-hoc test). The inset show a representative Western blot for hepatic MBOAT7 protein levels, which
was replicated in n = 4 mice. (B) Body weight was measured weekly. (C) Food intake was measured in C57BL/6 mice at 12 weeks of diet and ASO
injections (n = 6). (D) Oxygen consumption was measured by indirect calorimetry in C57BL/6 mice after 12 weeks of diet and ASO injections (n = 6). (E)
Representative liver hematoxylin and eosin stained sections. 20x magnification. (F) Liver-to-body weight measurements from mice fed Chow and HFD
with Control and Mboat7 ASO Injections for 20 weeks (n = 8–10; ****p0.0001; Two-way ANOVA with Tukey’s post-hoc test). (G and H) Plasma ALT (G)
and AST (H) levels were measured after 20 weeks of diet feeding and ASO injections (n = 8–10; ****p0.0001; Two-way ANOVA with Tukey’s post-hoc
test). (I) Percent steatosis quantified by a blinded board certified pathologist at the Cleveland Clinic (n = 3; ****p0.0001; Two-way ANOVA with
Tukey’s post-hoc test). (J–M) Hepatic triglycerides (J), hepatic cholesterol (K), hepatic esterified cholesterol (L), and hepatic free cholesterol (M) were
measured colorimetrically (n = 8–10; **p0.01, ***p0.001, ****p0.0001; Two-way ANOVA with Tukey’s post-hoc test). All data are presented as
mean ± S.E.M., unless otherwise noted.
The following figure supplements are available for figure 2:
Figure supplement 1. Mboat7 ASO treatment reduces Mboat7 expression in white adipose tissue (WAT), but does not dramatically alter WAT gene
expression or adiposity.
Figure supplement 2. Mboat7 ASO treatment does not alter Mboat7 expression in several extrahepatic tissues.
Figure supplement 3. A reduction in hepatic MBOAT7 expression does not alter metabolic parameters.
Figure supplement 4. Hepatic steatosis is observed in two distinct ASOs targeting different regions of the Mboat7 mRNA.
Figure supplement 5. Knockdown of Mboat7 alters plasma lipid levels in chow but not HFD-fed mice.

Figure 3. Mboat7 inhibition exacerbates inflammation and fibrotic gene expression in the liver. (A–C) C57BL/6 mice were fed a HFD with concurrent
Control and Mboat7 ASO Injections at 12.5 mg/kg week for 20 weeks. Liver RNA was used for RNA-sequencing. ASO groups clustered by principal
component analysis (A). Row-normalized expression for the top 50 DEGs are shown by heat map (B) while the volcano plot (C) summarizes log2 fold
changes vs significance in response to Mboat7 inhibition (n = 5; genes with FDR < 0.05 and fold change >2 were considered significantly differentially
expressed). (D) Summary of significantly differentially regulated pathways in mice treated with a non-targeting Control ASO vs the Mboat7 ASO. (E)
qPCR validation of selected gene expression changes discovered in the RNA-sequencing analysis in both Chow and HFD-fed mice receiving Control or
MBOAT7 ASOs for 20 weeks (n = 8–10; *p0.05, ***p0.001, ****p0.0001; Two-way ANOVA with Tukey’s post-hoc test). All data are presented as
mean ± S.E.M., unless otherwise noted.
The following figure supplement is available for figure 3:
Figure supplement 1. A reduction in Mboat7 expression alters hepatic immune cell populations.
Figure 3 continued on next page

Figure 3 continued
Genetic deletion of Tmc4 does not result in hepatic steatosis

Given the fact that the rs641738 polymorphism is located in exon 1 of the TMC4 gene, and we unex-
pectedly found that Mboat7 ASO treatment also reduces Tmc4 expression (Figure 3B,E), we wanted
to examine whether alteration in Tmc4 may also be a key regulator of hepatic steatosis. To under-
stand the role of Tmc4 in hepatic steatosis, we generated global Tmc4 knockout mice using CRISPR-
Cas9-mediated gene editing and examined hepatic lipid levels under high fat feeding conditions
(Figure 4). Global Tmc4 knockout mice have marked reductions in hepatic Tmc4 mRNA (Figure 4A)
and protein (Figure 4B), yet importantly Mboat7 expression is unaltered (Figure 4A). In contrast to
the striking hepatic steatosis seen with Mboat7 loss of function (Figure 2E, Figure 2—figure supple-
ment 4), Tmc4 null mice show similar levels of hepatic lipids when fed a high fat diet (Figure 4).
These data strongly implicate Mboat7, but not Tmc4, as the primary mediator of hepatic steatosis
seen with the rs641738 variant or in Mboat7 ASO-treated mice.
Mboat7 knockdown promotes profound hyperinsulinemia and impairs

hepatic insulin action
The abnormal accumulation of lipids (i.e., lipotoxicity) in tissues such as the pancreas and liver is fre-
quently associated with the pathogenesis of type 2 diabetes (Unger and Scherer, 2010;
Figure 4. Tmc4 knockout mice do not exhibit fatty liver. Male wild type (Tmc4+/+) or Tmc4 global knockout mice (Tmc4-/-) were fed a high fat diet for 2
weeks. (A) Hepatic gene expression for Tmc4 and Mboat7 measured by qPCR. (B) Western blot of TMC4 protein levels in the liver and kidney. (C)
Representative H and E-stained liver sections from Tmc4+/+ and Tmc4-/-. (D) Hepatic triglyceride (TG) levels in Tmc4+/+ and Tmc4-/- were quantified
biochemically. Data shown represent n = 5–6 mice per group, ***p<0.001; two-tailed t-test relative to Tmc4+/+ mice.

Samuel and Shulman, 2018). Given that Mboat7 knockdown promoted striking hepatic steatosis
(Figure 2E), and the fact that adipose tissue expression of Mboat7 is negatively correlated with insu-
lin sensitivity across strains of the HMDP (Figure 1F) we examined glucose homeostasis in Mboat7
ASO-treated mice fed a high fat diet (Figure 5). Mboat7 knockdown was associated with signifi-
cantly impaired systemic glucose tolerance (Figure 5A). Mboat7 ASO-treated mice also exhibited
profound hyperinsulinemia in the fasted state and throughout an intraperitoneal glucose tolerance
test (Figure 5B). In parallel, glucose-stimulated C-peptide release was elevated in Mboat7 ASO-
treated mice, potentially indicating overproduction of insulin in the pancreatic b-cell (Figure 5C).
During an intraperitoneal insulin tolerance test, Mboat7 ASO-treated mice showed blunted plasma
glucose lowering (Figure 5D). To more directly measure tissue-specific insulin action in Mboat7
knockdown mice we examined the acute phosphorylation of the insulin receptor (IR) and protein
kinase B (Akt) in response to a single insulin injection (Figure 5E–G). Mboat7 ASO-treated mice had
reduced insulin-stimulated phosphorylation of IR and downstream Akt in the liver (Figure 5E). How-
ever, Mboat7 ASO treatment did not significantly alter insulin signal transduction in either skeletal
muscle or white adipose tissue (Figure 5F,G). These data suggest that ASO-mediated knockdown of
Mboat7 promotes hyperinsulinemia, yet impairs insulin action specifically in the liver.
ASO-mediated knockdown of Mboat7 results in tissue-specific

alterations in LPI and PI lipids
Given the fact that Mboat7 is known to catalyze the selective esterification of arachidonyl-CoA to
LPI lipids in neutrophils (Gijón et al., 2008), we wanted to examine its lysophosphatidylinositol acyl-
transferase (LPIAT) activity in the liver and also examine both substrate LPI and product PI species
across a range of tissues. First, we isolated hepatic microsomes from control and Mboat7 ASO-
treated mice and assayed LPIAT enzymatic activity using saturated and monounsaturated LPI sub-
strates (Figure 6A). In chow fed mice Mboat7 knockdown only modestly decreased hepatic LPIAT
activity toward 18:1 LPI (Figure 6A), yet in high fat diet-challenged mice Mboat7 knockdown
resulted in a highly significant ~50% reduction in LPIAT activity using either 16:0, 18:0, or 18:1 LPI
substrates (Figure 6A). These data suggest that Mboat7 is a significant contributor to total hepatic
LPIAT activity, especially under high fat feeding conditions. Aligned with these alterations in enzyme
activity, knockdown of Mboat7 in high fat-fed mice resulted in alterations in LPI and PI lipids in a
highly tissue-specific manner. Mboat7 ASO treatment did not significantly alter LPI levels in the cir-
culation, but was associated with selective reduction in the 38:3 and 38:4 species of circulating PI
lipids (Figure 6B, Figure 6C, and Figure 6—figure supplements 1–2). In contrast to effects in the
circulation, Mboat7 knockdown was associated with significant accumulation of 16:0 and 18:1 LPI
species in the liver (Figure 6D and Figure 6—figure supplement 2). Furthermore, Mboat7 ASO-
treatment resulted in reduced 38:3 and 38:4 PI levels, while increasing more saturated (34:1, 34:2,
36:1, and 36:2) PI species in the liver (Figure 6E and Figure 6—figure supplement 1). In white adi-
pose tissue, Mboat7 knockdown did not significantly alter LPI levels (Figure 6—figure supplement
2), but promoted marked accumulation of more saturated PI species both in chow and high fat fed
mice (Figure 6—figure supplement 1). Also, Mboat7 ASO treatment resulted in significant reduc-
tions in several PUFA-enriched PI species (38:3, 38:4, 38:5, and 38:6) in adipose tissue (Figure 6—
figure supplement 1). In contrast to alterations in LPI and PI levels in liver and adipose tissue (Fig-
ure 6 and Figure 6—figure supplements 1–2), Mboat7 ASO treatment did not significantly alter LPI
or PI levels in the brain (Figure 6—figure supplement 3) or pancreas (Figure 6—figure supplement
4). In contrast to marked changes in inositol-containing phospholipids, it is also important to note
that Mboat7 knockdown did not significantly alter the hepatic levels of other major phospholipids
including phosphatidylcholines, lysophosphatidylcholines, phosphatidylethanolamines, lysophospha-
tidylethanolamines, phosphatidylserines, phosphatidylglycerols, or phosphatidic acids (Figure 6—
figure supplement 5). Collectively, these data show that ASO-mediated knockdown of Mboat7 pri-
marily alters LPI and PI levels in the liver and white adipose tissue, which creates the potential to
induce an imbalance of local lipid mediators that originate from PI metabolism.

Figure 5. A reduction in Mboat7 expression exacerbates hepatic insulin resistance in HFD-fed mice. (A–C) C57BL/6 mice were fed a HFD with
concurrent Control and Mboat7 ASO Injections at 12.5 mg/kg week for 20 weeks. Plasma glucose (A), plasma insulin (B), and plasma C-peptide (C)
levels were measured throughout the course of an intraperitoneal glucose tolerance test (n = 4–5; *p0.05, **p0.01; two-tailed t-test relative to
control ASO at same time point). (D) Plasma glucose was measured after an intraperitoneal insulin injection in mice fed HFD for 20 weeks with Control
and Mboat7 ASO injections (n = 4–5; *p0.05, **p0.01; two-tailed t-test relative to control ASO at same time point). (E–G) Mice were fed a HFD for
20 weeks while injected with Control or Mboat7 ASOs, then saline or insulin (0.35 U/kg) was injected into the portal vein for 5 min. The insulin signaling
pathway was examined via western blot in tissues: liver (E), skeletal muscle (F), and white adipose tissue (G) (n = 5) each sample represents an
independent mouse; western blot is quantified by densitometry on the right; *p0.05; Two-way ANOVA with Tukey’s post-hoc test). All data are
presented as mean ± S.E.M., unless otherwise noted.

Figure 6. HFD-feeding and Mboat7 inhibition results in an accumulation of LysoPIs. Male C57BL/6 mice were fed either chow or a HFD for 20 weeks
along with receiving a control non-targeting ASO or an ASO targeting the knockdown of Mboat7. (A) Liver microsomes were isolated and assayed for
lyso-phosphatidylinositol acyltransferase (LPIAT) activity, using [14C]-arachidonyl-CoA and either 16:0 LPI, 18:0 LPI, or 18:1 LPI as substrates. Plasma LPI
(B) or PI (C) species were measured by LC-MS/MS (n = 5; *p0.05; two-tailed t-test). Liver LPI (D) and PI (E) species were measured by LC-MS/MS
(n = 5–10 per group; *p0.05, **p0.01, ***p0.001; two-tailed t-test). All data are presented as mean ± S.E.M.
Figure supplement 1. Mboat7 ASO treatment impacts PI metabolism.
Figure supplement 2. Mboat7 ASO treatment impacts LPI metabolism.
Figure supplement 3. Mboat7 ASO treatment does not influence brain LPI and PI levels.
Figure supplement 4. Mboat7 ASO treatment does not influence pancreas LPI and PI levels.

Figure 6 continued
Figure supplement 5. Mboat7 ASO treatment does not significantly alter other major phospholipid species.
Figure supplement 6. Mboat7 ASO treatment does not drastically influence AA-derived lipid mediators.
LPI lipids increase hepatic inflammatory and fibrotic gene expression in

an Mboat7-dependent manner
The major enzymatic product of MBOAT7 (38:4 PI) is a potential reservoir for the generation of
arachidonic acid-derived immunomodulatory lipid mediators (Serhan et al., 2015; Dennis and Nor-
ris, 2015). Therefore, we initially hypothesized that Mboat7 loss of function might limit the pool of
arachidonic acid in PI lipids available for arachidonic acid-derived lipid mediator production. How-
ever, when we examined arachidonic acid-derived pro-inflammatory (LTB4, PGE2, PGD2, PGF2a, and
TXB2) and pro-resolving (15R-LXA4) lipid mediators there was no apparent alteration in the liver of
Mboat7 ASO-treated mice (Figure 6—figure supplement 6). Collectively, these data do not support
a rate-limiting role for MBOAT7 in arachidonic acid-derived lipid mediator production in mice. Given
the fact that Mboat7 knockdown is associated with increases in LPI lipids, we next hypothesized that
MBOAT7 substrate LPI lipids themselves may be the main drivers of liver disease progression under
conditions of HFD-induced obesity and Mboat7 loss of function. In further support of this concept,
we found that saturated LPI lipids are significantly elevated in the circulation of humans with
advanced fibrosis compared to healthy controls (Figure 7).
To more directly test the hypothesis that LPI lipids may promote liver disease in a Mboat7-depen-
dent manner, we directly treated mice with LPI lipids to transiently increase circulating LPI levels
Figure 7. Circulating levels of saturated lysophosphatidylinositol (LPI) lipids are increased in humans with
advanced fibrosis. Plasma from healthy subjects with no fibrosis (Ishak score = 0) or pathology proven advanced
fibrosis (Ishak score = 4) were analyzed by LC-MS/MS to quantify MBOAT7 substrates (16:0 LPI, 18:0 LPI, and 18:1
LPI) and product (38:4 PI) lipids. All data are presented as mean ± S.E.M from n = 10 subjects per group, and
group differences were determined using Mann-Whitney testing.

within a physiologic level (~2 fold) (Figure 8—figure supplement 1). Injection of 16:0, 18:0, or 18:1
Figure 8. Lysophosphatidylinositol (LPI) lipids stimulate pro-inflammatory and pro-fibrotic gene expression in a Mboat7-dependent manner. Male
C57BL/6 mice were treated with either a non-targeting control ASO or Mboat7 ASO while being fed a high fat diet for 11 weeks. Thereafter, mice were
injected IP with saline (vehicle) or 12.5 mg of the Mboat7 substrate lipids 16:0 or 18:1 LPI (2 injections at 7 am and seven pm), and liver was collected 12
hr later. (A–H) Liver mRNA levels were measured by qPCR. (I) Liver triacylglycerol (TG) levels. Data are presented as mean ± S.E.M. (n = 5; *p0.05).
Figure supplement 1. Accumulation of LPI species elevate after 4 hr post-injection.
Figure supplement 2. 18:0 LPI stimulates pro-inflammatory and pro-fibrotic gene expression in a Mboat7-dependent manner.
Figure supplement 3. LPI lipids alter hepatic gene expression.

LPI into control ASO-treated mice did not alter hepatic inflammatory or fibrotic gene expression
(Figure 8 and Figure 8—figure supplement 2). This is not surprising, given that it was previously
reported that exogenously provided LPI is rapidly esterified into membrane PI pools (Darnell and
Saltiel, 1991; Darnell et al., 1991; Jackson and Parton, 2004). In other words, under normal condi-
tions MBOAT7 activity rapidly acylates LPI to divert this signaling lipid into a membrane PI storage
pool. We next postulated that under conditions such as obesity where Mboat7 activity is diminished,
LPI-driven signaling can be sustained and promote liver injury. In support of this concept, direct
injection of exogenous 18 carbon LPIs can rapidly (24 hr) increase the expression of genes character-
istic of hepatic inflammation (Cd11c, Tnfa, IL1b) and early fibrosis (Desmin, Col1A1, Col1A2, and
Acta2) in mice with Mboat7 knockdown (Figure 8 and Figure 8—figure supplement 2). These data
suggest that 18 carbon LPI lipids can acutely induce hepatic inflammatory and fibrotic gene expres-
sion programs, but only when MBOAT7 function is compromised, as is seen in obesity or with loss of
function variants like rs641738. It is important to note that 18 carbon LPI lipids can only significantly
elicit such pro-inflammatory and pro-fibrotic effects in high fat fed mice (Figure 8 and Figure 8—fig-
ure supplement 2), as we did not see this same effect in chow fed cohorts (not shown). Although
direct administration of 18 carbon LPI lipids in chow fed mice did not significantly alter the same
pro-inflammatory or pro-fibrotic genes as we found with Mboat7 knockdown (Figure 3), we did find
that a small subset of acute phase response genes (serum amyloid A genes, Saa1 and Saa2) and
other immunomodulatory genes (Gdf15, Ly6d, Lcn2, Socs2, etc.) were altered by 18:0 LPI treatment
in a Mboat7-dependent manner (Figure 8—figure supplement 3). Interestingly, when liver triacyl-
glycerol levels were examined in this LPI injection experiment, we only found significantly elevation
in the saline and 18:1 LPI injection groups, but not in the 16:0 LPI injection group (Figure 8I). Collec-
tively, these results suggest that 18 carbon LPI lipids can alter hepatic inflammatory transcriptional
programs, but this is highly reliant on both diminished Mboat7 expression/activity and high fat diet
feeding.
Steatosis Seen with Mboat7 Knockdown is Associated with

Reorganization of the Hepatic Lipid Droplet Lipidome and Proteome in
vivo, and Alterations In Lipogenesis and Fatty Acid Oxidation in
Cultured Cells
Mboat7 loss of function results in a striking accumulation of neutral lipids including triglycerides and
cholesteryl esters (Figure 2E–I), yet the mechanism(s) behind this are poorly understood. We there-
fore examined several potential mechanisms driving the mixed hepatic steatosis in Mboat7 ASO-
treated mice. First, we examined the expression of genes involved in lipogenesis, fatty acid oxida-
tion, and cholesterol sensing and export under both fed and fasted conditions (Figure 9). Unlike
many other models of hepatic steatosis, there were no significant alterations in lipogenic gene
expression either in the fed or fasted state with Mboat7 knockdown (Figure 9A). Unexpectedly, the
expression of carnitine palmitoyl transferase 1 (Cpt1) was significantly elevated with Mboat7 knock-
down (Figure 9A), but this would not be expected to promote the accumulation of neutral lipids.
The expression of enzymes involved in cholesterol biosynthesis (Hmgcr and Hmcgs1) were modestly
reduced in Mboat7 ASO-treated mice, but only in the fasted state (Figure 9A). In addition, expres-
sion of the cholesterol efflux regulator Abca1 was elevated in Mboat7 ASO-treated mice, but only in
the fasted state. Altogether, these minor differences in hepatic gene expression are unlikely to be
driving the lipid accumulation in Mboat7 ASO treated mice. Next, we evaluated whether Mboat7
may influence the export of neutral lipids via packaging on nascent very low density lipoproteins
(VLDL). However, Mboat7 ASO-treated mice did not have significant differences in VLDL-TG secre-
tion during a detergent block (Figure 9B). Furthermore, steady state plasma levels of triglycerides
and total cholesterol were not significantly altered in Mboat7 ASO-treated mice other than a minor
reduction in cholesterol content in both low density lipoproteins (LDL) and high density lipoproteins
(HDL) only in chow-fed cohorts (Figure 2—figure supplement 5). Another common cause of fatty
liver is increased delivery of adipose-derived fatty acids to the liver, as is commonly seen with pro-
longed fasting and certain types of lipodystrophies. However, Mboat7 knockdown did not alter basal
or catecholamine-stimulated adipocyte lipolysis in vivo (Figure 9C), ruling out a role for altered adi-
pose lipolysis as a contributing factor. Finally, we examined the possibility that MBOAT7 may be a
determinate of metabolism locally at the surface of cytosolic lipid droplets to regulate hepatic stea-
tosis, given that one recent study reported that MBOAT7 can localize to cytosolic lipid droplets

Figure 9. Mboat7 knockdown promotes hepatic steatosis by altering the lipidome and proteome of the cytosolic lipid droplets. Male C57BL/6 mice
were fed either chow or a HFD for 12–20 weeks along with receiving a control non-targeting ASO or an ASO targeting the knockdown of Mboat7. (A)
Mice were necropsied either in the fed or fasted (12 hr fast) state, and the hepatic expression of genes involved in lipogenesis, fatty acid oxidation, or
sterol sensing analyzed using qPCR. (B) Plasma triglyceride (TG) secretion rate in mice administered Triton WR-1339 (tyloxapol). (C) Fed mice were
treated with either saline vehicle or the b3-adrenergic receptor agonist CL316243 (0.1 mg/g body weight) to stimulate adipocyte lipolysis, and plasma
glycerol and NEFA were measured after 15 min. Panels D–F), ASO-treated mice were fasted for 4 hr (from 9:00 a.m. to 1:00 p.m.) prior to necropsy, and
hepatic lipid droplets were isolated using sucrose gradient fractionation to analyze both the lipidome and proteome of cytosolic lipid droplets. Lipid
droplet fractions were extracted and analyzed by LC-MS/MS to quantify either lysophosphatidylinositol (D) or phosphatidylinositol (E) species on
isolated lipid droplets. (F) Lipid droplet fractions were analyzed using Western blotting for MBOAT7, glycerol 3-phosphate dehydrogenase (as a non-

Figure 9 continued
lipid droplet fraction control), perilipin 2 (PLIN2), perilipin 3 (PLIN3), CTP:phosphocholine cytidylyltransferase a (CCTa), or glycerol-3-phosphate 4
(GPAT4); four individual mice per group are shown. Data are presented as mean ± S.E.M, (n = 4–6 per group; *p0.05, **p0.01, ***p0.001,
****p0.0001; Two-way ANOVA with Tukey’s post-hoc test).
(Mancina et al., 2016). We confirmed that MBOAT7 can indeed be found in lipid droplets isolated
by sucrose gradient fractionation (Figure 9F), and plays a regulatory role in both the lipidome and
proteome of cytosolic lipid droplets. Cytosolic lipid droplets isolated from Mboat7 ASO-treated
mice showed marked accumulation of 18:0 LPI and 20:4 LPI, but not 16:0 LPI or 18:1 LPI
(Figure 9D). This is in stark contrast to what is seen in the whole liver, where Mboat7 knockdown
instead promotes accumulation of 16:0 LPI and 18:1 LPI (Figure 6D). Also, lipid droplets isolated
from Mboat7 ASO-treated mice have a reduced level of 38:4 PI but a reciprocal increase in 36:3 and
38:3 PI (Figure 9E), which is quite different when to compared to effects in whole liver (Figure 6E).
In addition to alterations in the lipid droplet lipidome, Mboat7 knockdown is associated with accu-
mulation of several proteins involved in lipid synthesis and storage on isolated lipid droplets
(Figure 9F). Both perilipin 2 and 3 (PLIN2 and PLIN3) were much more abundant on lipid droplets
isolated from Mboat7 ASO-treated mice, as were the critical lipid synthetic enzymes CTP:phospho-
choline cytidylyltransferase a (CCTa) and glycerol-3-phosphate 4 (GPAT4). Given that recent reports
have shown that lipid droplet targeting of CCTa and GPAT4 are critical regulators of the overall size
and triglyceride storage capacity of lipid droplets (Guo et al., 2008; Krahmer et al., 2011;
Wilfling et al., 2013), these proteomic alterations at the lipid droplet surface may to contribute to
the hepatic steatosis seen in Mboat7 ASO-treated mice. In order to understand cell autonomous
effects of MBOAT7 lipid metabolism we generated MBOAT7-deficient cells via CRISPR-Cas9-medi-
ated genome editing. Huh7 lacking MBOAT7 have increased lipid droplets upon fatty acid loading
(Figure 10A,B). This lipid accumulation was due in part to increases in de novo lipogenesis rates
(Figure 10C), and reciprocal decreases in fatty acid oxidation rates (Figure 10D). However, MBOAT-
deficient Huh7 cells did not have altered turnover of stored triacylglycerol (Figure 10E) or choles-
terol ester (Figure 10F).
Discussion
Given that several recent studies have found a strong link between the common rs641738 variant
allele and liver disease progression, there is considerable interest in identifying the causative gene
within this locus. Although the rs641738 polymorphisms maps to the first exon of the poorly anno-
tated gene TMC4, this study is the first to demonstrate that genetic deletion of Tmc4 does not result
in hepatic steatosis. Instead, selective loss of function of the neighboring gene Mboat7 is sufficient
to sensitize mice to high fat diet-driven liver disease progression. The major findings of the current
study include the following: (1) Genetic deletion of Tmc4 does not alter hepatic lipid storage, (2)
Hepatic expression of MBOAT7 is reduced in obese humans and rodents, independent of rs641738
status, (3) Mboat7 expression in mouse liver and adipose tissue is negatively correlated with obesity
and insulin sensitivity across the strains represented in the Hybrid Mouse Diversity Panel, (4) Mboat7
knockdown promotes hepatic steatosis, hepatocyte death, inflammation, and early gene expression
profiles consistent with fibrosis, but this only happens when mice are challenged with a high fat diet,
(5) Mboat7 loss of function promotes striking hyperinsulinemia and hepatic insulin resistance, (6)
Mboat7 knockdown results in tissue-specific reorganization of its substrates (LPI) and product (PI) lip-
ids, (7) LPI lipids can rapidly induce hepatic inflammatory and fibrotic gene expression programs in
an Mboat7-dependent manner in mice, and (8) the hepatic steatosis seen with Mboat7 knockdown is
not related to differences in lipogenic gene expression, VLDL secretion, or tissue lipolysis, but
instead may be related to alterations in hepatic lipid droplet accumulation of lipogenic enzymes
(CCTa and GPAT4) that allow for expansion of large lipid droplets (Guo et al., 2008;
Krahmer et al., 2011; Wilfling et al., 2013), and increased rates of de novo lipogenesis and
reduced fatty acid oxidation. Collectively, these data support a role for Mboat7-driven acylation of
LPI lipids as a key protective mechanism against obesity-linked NAFLD progression.

Figure 10. Genetic deletion of MBOAT7 in Huh7 cells results in cell autonomous alterations in lipogenesis and fatty acid oxidation. CRISPR-Cas9 gene
editing was used to delete the MBOAT7 gene from Huh7 hepatoma cells: (A), Immunoblot confirmation of genetic deletion of MBOAT7 (MBOAT7D):
Microsome were isolated from WT and MBOAT7Dcells, and MBOAT7 protein levels were detected via Western blotting. (B) Fluorescent microscopy
image of control and MBOAT7D-Huh7 cells were supplemented with 400 mM oleic acid for 24 hr. Following 24 hr of lipid loading, cells were washed
with PBS and stained with Bodipy (493/503). Scale bar = 10 mm. (C) Effect of MBOAT7D on de novo lipogenesis: Control and MBOAT7D-Huh7 cells
were incubated [14C]acetate in the presence of broad lipase inhibitors. Cells were harvested at various time point, lipids extracted and the
incorporation of [14C]acetate into [14C]triacylglycerol. (D) Effect of MBOAT7D on complete fatty acid oxidation: The graph shows the amount of 14C-
palmitic acid oxidized to 14C-CO (Mancina et al., 2016). (E–F), Effect of MBOAT7D on triacylglycerol (E) and cholesterol ester (F) hydrolysis: Control
and MBOAT7D-Huh7 cells were incubated with 100 mM oleate complexed to bovine serum albumin + 1 mCi[3H]-cholesterol + 0.5 mCi-[14C]-oleate for 24
hr to label cellular cholesteryl ester and triacylglycerol pools to steady state. The supplemental fatty acids were withdrawn, and the cells were incubated
with 6 mM triacsin C to inhibit triacylglycerol synthesis and re-esterificaiton. Cells were harvested, lipids were extracted and separated by thin layer
chromatography to determine the turnover of cholesteryl esters and triacylglycerols. Data shown are mean ± S.E.M. and are representative of two
separate experiments; ***p<0.0002, ****p<0.0001; two-way ANOVA with Bonferroni’s multiple comparisons test.
The MBOAT family of enzymes are critical players in determining the composition of fatty acids in
cellular membranes, and are emerging as key players in cardiometabolic disease (Rong et al., 2013;
Harayama et al., 2014). It is important to note that several other lysophospholipid acyltransferase
enzymes have been linked to inflammatory diseases (Rong et al., 2013; Harayama et al., 2014). In
particular, lysophosphatidylcholine acyltransferases (LPCAT1, LPCAT2, and LPCAT3) are known to
regulate tissue inflammation and endoplasmic reticulum stress by altering arachidonic acid availabil-
ity as well as determining membrane phosphatidylcholine saturation (Rong et al., 2013;
Harayama et al., 2014). In fact, the lysophospholipid acyltransferase family sits at a critical signaling
nexus, given that they can play key roles in the generation of arachidonic acid-derived lipid media-
tors as well as regulating the levels of lysophospholipid signaling lipids (Shindou and Shimizu, 2009;
Shindou et al., 2009). Given the fact that MBOAT7 preferentially generates PUFA-enriched PIs it
also has the unique potential to also impact phosphorylated PI species (PtdInsP, PtdInsP2, and
PtdInsP3, etc.) (Anderson et al., 2013). In agreement with our findings with PI lipids (Fil) in Mboat7
ASO-treated mice, global genetic deletion of Mboat7 selectively lowers the 38:4 molecular species
of PIPs, while increasing more saturated species (Anderson et al., 2013). Therefore, we cannot rule
out that alterations in PIP-dependent signal transduction may also play a role in MBOAT7 loss of
function-driven liver disease progression.
Unexpectedly, Mboat7 knockdown did not significantly alter hepatic lipid storage or inflammation
in chow-fed mice. Instead there is a clear unmasking of Mboat7-dependent fatty liver phenotypes
only when mice are fed with a high fat diet. This could potentially indicate that unknown dietary fac-
tors play a regulatory role and limit hepatic LPIAT activity via unknown mechanisms (Figure 6A). Our
data also support the idea that when mice, rats, and humans become obese MBOAT7 expression is

reduced to varying degrees (Figure 1A–C), indicating regulation either at the transcriptional of post-
transcriptional level. Future work should focus on understanding how dietary factors and adiposity
itself impacts MBOAT7 expression and activity, and under what dietary and BMI conditions are
MBOAT7 polymorphisms predicted to be most deleterious. In humans, the rs641738 variant has
been clearly linked to end stage fibrotic liver disease (Buch et al., 2015; Mancina et al., 2016;
Luukkonen et al., 2016; International Liver Disease Genetics Consortium et al., 2016). However,
an important limitation of our studies is that high fat diet feeding in mice is not sufficient to drive
bridging fibrosis. In future studies, it will be important to examine how Mboat7 loss of function
impacts the development of fibrosis in appropriate fibrosis-prone animal models, and whether
Mboat7 expression in hepatic stellate cells plays a regulatory role in the progression from NASH to
cirrhosis. From this study it is clear that MBOAT7 can diversify the inositol-containing phospholipids
and the associated proteome on cytosolic lipid droplets, and this could in part explain the large lipid
droplets that accumulate in Mboat7 ASO-treated mice. It is interesting to note that the well-known
PNPLA3 variant associated with fatty liver disease (I148M) accumulates on lipid droplets, and simi-
larly reorganizes the lipidome and proteome to promote liver disease progression (BasuRay et al.,
2019; Wang et al., 2019; Mitsche et al., 2018; BasuRay et al., 2017). Our findings here with
MBOAT7-driven restructuring of the lipid droplet surface, and those recently published with PNPLA3
(BasuRay et al., 2019), suggest that alterations in lipid modifying enzyme access to the surface of
cytosolic lipid droplets may be a common mechanism by which human fatty liver develops. Further-
more, we show that genetic deletion of MBOAT7 in Huh7 hepatoma cells can promote cell autono-
mous increases in cytosolic lipid droplets, and this enhanced lipid storage is associated with
augmented lipogenesis rates and reduced fatty acid oxidation rates. Our studies provide new clues
into new therapeutic leads for advanced liver diseases.
Another particularly striking finding from the current study is that Mboat7 knockdown promotes
severe hyperinsulinemia (Figure 5B). Based on our results examining both insulin and C-peptide
release during a glucose tolerance test (Figure 5B,C), it is reasonable to assume that Mboat7 knock-
down is enhancing glucose-stimulated insulin secretion (GSIS) in pancreatic b cells. However, it is
important to note that Mboat7 ASO treatment did not alter Mboat7 expression (data not shown) or
LPI/PI lipids in the pancreas (Figure 6—figure supplement 4). Therefore, it is tempting to speculate
that ASO-mediated knockdown of Mboat7 facilitates the production of an endocrine signaling lipid
(possibly LPI) that may impact b cell GSIS. Interestingly, there are reports demonstrating that LPI lip-
ids can stimulate b cell GSIS (Metz, 1986; Metz, 1988). It is interesting to note that expression of
Mboat7 in white adipose tissue is modestly negatively correlated with HOMA-IR in the hybrid mouse
diversity panel (Figure 1F), yet ASO-mediated knockdown of Mboat7 did not alter insulin signaling
in adipose tissue (Figure 5F). These data suggest that additional studies are needed to clarify a
potential role for Mboat7 in adipose tissue insulin sensitivity. Collectively, our data suggest that
under conditions where MBOAT7 activity is suppressed (obesity or with the rs641738 variant) ineffi-
cient acylation of LPI substrate allows for these lipids to accumulate and initiate autocrine, paracrine,
and potentially endocrine signaling that impact the progression of NAFLD and insulin resistance.
Therefore, further investigation into the receptor system(s) that sense LPI lipids could hold therapeu-
tic promise in liver disease and other associated metabolic diseases. Collectively, these studies iden-
tify MBOAT7-driven acylation of LPI lipids as an important modulator of both liver disease
progression and associated type 2 diabetes.
Materials and methods

Key resources table
Reagent type Additional
(species) or resource Designation Source or Reference Identifiers Information
Genetic reagent C57BL/6NJ - Jackson Laboratory Stock #:
(M. musculus) C57BL/6NJ- 46062-JAX;
Tmc4em1(IMPC)J/Mmjax RRID:
MGI:5882504;
RRID:
IMSR_JAX:032275
Continued on next page

Continued

Sequence- Mboat7 Sigma F: CATGCGGTACTGGAACATGA
based reagent R: CCAGTAGGCGCTCAGCAG
Sequence- Cyclophilin A Sigma F: CCTGCTCTCCTCTCACCTCCT
based reagent R: TAGAAGCGCATGCGGAAGG
Sequence- Mboat7 Sigma F: atggcatgcgatactggaac
based reagent R: agcatggtccaggcactc
Sequence- Tmc4 Sigma F: CGGTACATCCACAAACATGG
based reagent R: GAGATCGTTCAGCACAGACG
Sequence- Tnfa Sigma F: CCACCACGCTCTTCTGTCTAC
based reagent R: AGGGTCTGGGCCATAGAACT
Sequence- IL-1b Sigma F: AGTTGACGGACCCCAAAAG
based reagent R: AGCTGGATGCTCTCATCAGG
Sequence- Col1a2 Sigma F: GCAGGTTCACCTACTCTGTCCT
based reagent R: CTTGCCCCATTCATTTGTCT
Sequence- a-SMA Sigma F: GTCCCAGACATCAGGGAGTAA
based reagent R: TCGGATACTTCAGCGTCAGGA
Sequence- Cd11c Sigma F: gagccagaacttcccaactg
based reagent R: tcaggaacacgatgtcttgg
Sequence- Srebp1c Sigma F: tctcactccctctgatgctac
based reagent R: gcaaccactgggtccaatta
Sequence- Col1a1 Sigma F: ATGTTCAGCTTTGTGGACCTC
based reagent R: CAGAAAGCACAGCACTCGC
Sequence- Fas Sigma F: GCTGCGGAAACTTCAGGAAAT
based reagent R: AGAGACGTGTCACTCCTGGACTT
Sequence- Acc1 Sigma F: CCTGAGGAACAGCATCTCTAAC
based reagent R: GCCGAGTCACCTTAAGTACATATT
Sequence- Scd1 Sigma F: TTCCCTCCTGCAAGCTCTAC
based reagent R: CAGAGCGCTGGTCATGTAGT
Sequence- Cpt1a Sigma F: TCCATGCATACCAAAGTGGA
based reagent R: TGGTAGGAGAGAGCAGCACCTT
Sequence- Cgi58 Sigma F: gcggtgatgaaagcgatg
based reagent R: caccctgtcagccatcctg
Sequence- Atgl Sigma F: CTTCCTCGGGGTCTACCACA
based reagent R: GCCTCCTTGGACACCTCAATAA
Sequence- Cd68 Sigma F: ATCCCCACCTGTCTCTCTCA
based reagent R: ACCGCCATGTACTCCAGGTA
Sequence- F4/80 Sigma F: GGATGTACAGATGGGGGATG
based reagent R: CATAAGCTGGGCAAGTGGTA
Sequence- Desmin Sigma F: GTGGATGCAGCCACTCTAGC
based reagent R: TTGCCGCGATGGTCTCATAC
Sequence- Rgs16 Sigma F: AGGGCTCACCACATCTT
based reagent R: AGGTTTGTCTTGGTCAGTTC
Sequence- Lcn2 Sigma F: ccatctatgagctacaagagaacaat
based reagent R: tctgatccagtagcgacagc
Sequence- Saa1 Sigma F: CCAGGATGAAGCTACTCACCA
based reagent R: TAGGCTCGCCACATGTCC
Sequence- Saa2 Sigma F: ACTATGATGCTGCCCAAAGG
based reagent R: CTCTGCCGAAGAATTCCTGAAA
Sequence- Ly6d Sigma F: CAACTGTAAGAACCCTCAGGTC
based reagent R: CACTCTTTCCTCACCAGGTTC
Sequence- Onecut1 Sigma F: atcctcatgcccacctga
based reagent R: cctgaattacttccattgctga

Continued

Sequence- Fasn Sigma F: GTCACCACAGCCTGGACCGC
based reagent R: CTCGCCATAGGTGCCGCCTG
Sequence- Me1 Sigma F: ggagctccaggtccttagaata
based reagent R: tctgtcttgcaggtccattaac
Sequence- Acly Sigma F: CTCACACGGAAGCTCATCAA
based reagent R: TCCAGCATTCCACCAGTATTC
Sequence- Ppara Sigma F: GGAGGCGTTTCCTGAGACC
based reagent R: CAGCCACAAACGTCAGTTCAC
Sequence- LCAD Sigma F: ccggttctttgaggaagtgaa
based reagent R: agtgtcgtcctccaccttctc
Sequence- Hmgcr Sigma F: CTTGTGGAATGCCTTGTGATTG
based reagent R: AGCCGAAGCAGCACATGAT
Sequence- Hmgcs1 Sigma F: GCCGTGAACTGGGTCGAA
based reagent R: GCATATATAGCAATGTCTCCTGCAA
Sequence- Abca1 Sigma F: GGGCTGCCACCTCCTCAGAGAAA
based reagent R: CACATCCTCATCCTCGTCATTC
Sequence- Abcg5 Sigma F: TCCTGCATGTGTCCTACAGC
based reagent R: ATTTGCCTGTCCCACTTCTG
Sequence- CycloA Sigma F: gcggcaggtccatctacg
based reagent R: gccatccagccattcagtc
Sequence- MBOAT7 Sigma MBOAT7- CACCGTCCATCAGGGAGGGCACGTC
based reagent E5-Nick-5F
Sequence- MBOAT7 Sigma MBOAT7- AAACGACGTGCCCTCCCTGATGGAC
based reagent E5-Nick-5R
Sequence- MBOAT7 Sigma MBOAT7- CACCGCAGCTACAGCTACTGCTACG
based reagent E5-Nick-3F
Sequence- MBOAT7 Sigma MBOAT7- AAACGTAGCAGTAGCTGTAGCTGC
based reagent E5-Nick-3R
Antibody Anti-MBOAT7 PMID: 23097495 RRID:AB_2813851 1:1000
(Rat monoclonal)
Antibody Anti-pIRbY1150/1151(Rabbit monoclonal) Cell Signaling RRID: AB_331253 1:1000
Antibody Anti-TMC4 Thermo Fisher Cat#: OSR00225W; 1:500
(Rabbit polyclonal) RRID: AB_2204190
Antibody Anti-IRb Cell Signaling Cat#: 3025S; 1:1000
(Rabbit monoclonal) RRID: AB_2280448
Antibody Anti-pAktS473(rabbit polyclonal) Cell Signaling Cat#: 9271S; 1:1000
RRID: AB_329825
Antibody Anti-pAktT308 Cell Signaling Cat#: 13038S; 1:1000
Antibody Anti-Akt Cell Signaling Cat#: 9272S; 1:1000
Antibody Anti-PLIN2 Novus Biologicals Cat#: NB110-40877; 1:1000
Antibody Anti-PLIN3 Novus Biologicals Cat#: NB110-40764; 1:1000
Antibody Anti-CCTa Cell Signaling Cat#: 6931; 1:1000
Antibody Anti-GPAT4 Novus BIologicals Cat#: NB100-2390; 1:1000
(Rabbit Polyclonal) RRID: AB_2273811
Antibody Anti-GAPDH-HRP Cell Signaling Cat#: 8884; 1:5000
Antibody Anti-b-Actin-HRP Proteintech Cat#: HRP-60008; 1:5000
(Mouse monoclonal) RRID: AB_2289225

Continued

Antibody Anti-CD3e-APC-Cy7 BD Pharm; Cat#: 557596; 1:100
(Hamster monoclonal) clone: 145–2 C11 RRID: AB_396759
Antibody Anti-CD4-Alexa BD Pharm; Cat#: 557308; 1:100
Fluor 700 clone: RM4-5 RRID: AB_396634
(Rat monoclonal)
Antibody Anti-CD8a-PE-Cy7 eBiosciences; Cat#: 25-0081-81; 1:100
(Rat monoclonal) clone: 53–6.7 RRID: AB_469583
Antibody Anti-Cd11b-PE-Cy7 BD Pharm Cat#: 552850; 1:100
(Rat monoclonal) RRID: AB_394491
Antibody Anti-Cd11c-PE-CF BD Pharm Cat#: 562454; 1:100
594 RRID: AB_2737617
(Hamster monoclonal)
Antibody Anti-CD206 Alexa Biolegend Cat#: 141712; 1:100
Fluor 647 RRID: AB_10900420
(Rat monoclonal)
Antibody Anti-rabbit IgG GE-Healthcare Cat#: NA934-100UL; 1:5000
HRP (Donkey) RRID: AB_772206
Antibody Anti-rat IgG Santa Cruz Cat#: SC-2006; 1:5000
HRP (Goat) RRID: AB_1125219
Antibody IRDye 800 anti- LiCor Cat#: 926–32211; 1:10,000
Rabbit IgG (Goat) RRID: AB_621843
Sequence-based reagent Mboat7 Ionis
Commercial Supersignal West Thermo Fisher 34577
assay or kit Pico Plus substrate
Commercial AST kit Sekisui Diagnostics 319–30
assay or kit
Commercial ALT kit Sekisui Diagnostics 318–30
assay or kit
Commercial Liver TG Wako 994–02891
assay or kit
Commercial Free Cholesterol Wako 993–02501
assay or kit
Commercial Phospholipid C Wako 433–36201
assay or kit
Commercial Total Cholesterol Fisher Sci TR134321
assay or kit
Commercial Insulin ELISA Millipore EZRMI-13K
assay or kit
Commercial C-Peptide ELISA Crystal Chem 90050
assay or kit
Chemical 16:0 LPI Avanti Polar 850102P 50 mM
compound, drug Lipid, Inc
Chemical Arachidonyl American ARC 0519 0.025 mCi
compound, drug Coenzyme A Radiolabeled
[arachidonyl-1–14C]; Chemicals
50–60 mCi/mmol
1.85–2.22 GBq/mmol
Other TLC silica gel Millipore 1055540001 reagent
Plate 60 F254 Triton WR-1339

Continued

Chemical Beta-3 AR Sigma C5976-5mg
compound, drug Agonist
Chemical Tyloxapol Sigma T0307-10G 500 mg/kg
compound, drug
Peptide, Insulin Sigma I2643 0.35 U/kg
recombinant protein
Human MBOAT7 expression levels in lean and obese subjects

The majority of subjects recruited to examine MBOAT7 expression levels were morbidly obese bar-
iatric surgery patients, but we were able to obtain liver biopsies from 10 subjects with a BMI under
30 as normal weight controls. For recruitment, adult patients undergoing gastric bypass surgery at
Wake Forest School of Medicine were consented via written consent and enrolled by a member of
the study staff following institutionally approved IRB protocols as previously described
(Shores et al., 2011). Exclusion criteria included: positive hepatitis C antibody, positive hepatitis B
surface antigen, history of liver disease other than NAFLD, Childs A, B, or C cirrhosis, past or present
diagnosis/treatment of malignancy other than non-melanocytic skin cancer, INR greater than 1.8 at
baseline or need for chronic anticoagulation with warfarin or heparin products, use of immunomodu-
lation for or history of inflammatory diseases including but not limited to malignancy, rheumatoid
arthritis, psoriasis, lupus, sarcoidosis and inflammatory bowel disease, and greater or equal to seven
alcohol drinks per week or three alcoholic drinks in a given day each week. In addition to bariatric
surgery patients, a small number of non-obese subjects (body mass index <30.0) consented to liver
biopsy during elective gall bladder removal surgery (n = 10). Each subject was assigned a unique
identifier which was used throughout the study and did not include any identifiable information
about the patient such as name, address, telephone number, social security number, medical record
number or any of the identifiers outlined in the HIPAA Privacy Rule regulations. Only the principal
investigator had access to the code linking the unique identifier to the study subject. Basic clinical
information was obtained via self-reporting and a 15 ml baseline blood sample was obtained at the
time of enrollment. A subset of this cohort has been previously described (Schugar et al., 2017;
Shores et al., 2011). At the time of surgery, the surgeon collected a roughly 1-gram sample from
the lateral left lobe. Wedge biopsies were rinsed with saline and immediately snap frozen in liquid
nitrogen in the operating room before subsequent storage at 80˚C. For data shown in Figure 7
showing levels of MBOAT7 substrate and product lipids, de-identified patient samples from the
Cleveland Clinic hepatology clinic (IRB # 10–947) were analyzed. These patients had biopsy proven
Ishak fibrosis scores (Ishak et al., 1995) of 0 (normal) or 4 (advanced fibrosis). For analysis of hepatic
MBOAT7 expression, RNA isolated from liver biopsies were used for quantitative real time PCR
(qPCR) as described below.
Rat studies of diet-induced obesity

Sprague Dawley Rats were received at 12 weeks of age and were housed in individual cages, kept at
a constant temperature and ambient humidity in a 12-h light/dark cycle. Animals were then randomly
assigned to either a standard chow diet or a high-fat diet (D12492, 60% fat, Research Diets, New
Brunswick, NJ, USA) ad libitum to establish diet-induced obesity as previously described
(Schugar et al., 2017). After 6 months of HFD-feeding, livers were excised for standard qPCR analy-
sis of Mboat7 expression.
Hybrid Mouse Diversity Panel

92 inbred strains of 8-week-old male mice (180 individual mice) were fed a high fat, high sucrose
diet (D12266B, Research Diets, New Brunswick, NJ) for 8 weeks before tissue collection
(Parks et al., 2013). Gene expression of Mboat7 in white adipose tissue and liver were measured
and correlated with obesity related traits using biweight midcorrelation analysis as previously
described (International Liver Disease Genetics Consortium et al., 2016).

Mouse studies of Mboat7 loss of function

To explore the role of Mboat7 in diet-induced obesity, NAFLD progression, and insulin resistance,
we utilized an in vivo knockdown approach in 8 week old adult mice. Selective knockdown of
Mboat7 was accomplished using 2’-O-ethyl (cET) modified antisense oligonucleotides (ASO). All
ASOs used in this work were synthesized, screened, and purified as described previously
(Crooke et al., 2005) by Ionis Pharmaceuticals, Inc (Carlsbad, CA). For Mboat7 knockdown studies,
adult (8 week old) male C57BL/6 mice were purchased from Jackson Labs (Bar Harbor, ME USA),
and maintained on either a standard rodent chow diet or a high fat diet (HFD, D12492 from
Research Diets Inc) and injected intraperitoneally biweekly with 12.5 mg/kg of either non-targeting
control ASO or one of two independent ASOs directed against murine Mboat7 for a period of 20
weeks. Similar results were seen with two independent ASOs targeting different regions of the
Mboat7 mRNA, hence key data using one Mboat7 ASO are shown. All mice were maintained in an
Association for the Assessment and Accreditation of Laboratory Animal Care, International-approved
animal facility, and all experimental protocols were approved by the Institutional Animal Care and
use Committee of the Cleveland Clinic (IACUC protocols # 2015–1519 and # 2018–2053).
Studies in global Tmc4 knockout mice

Global Tmc4 knockout mice (C57BL/6NJ-Tmc4em1(IMPC)J/Mmjax) were provided by the Knockout
Mouse Phenotyping Program (KOMP) at The Jackson Laboratory using CRISPR technology. Briefly,
guide RNAs (GGAACCAGACCTTTTCCCAA and GAGTCAGCGTCAGAAAATGA) were designed to
insert create a 277 bp deletion in exon 3 of the transmembrane channel-like gene family 4 (Tmc4)
gene beginning at Chromosome 7 position 3,675,326 bp and ending after 3,675,602 bp (GRCm38/
mm10). The mutation is predicted to delete ENSMUSE00001301550 (exon 3) and 131 bp of flanking
intronic sequence, including the splice acceptor and donor, and is predicted to cause a change of
amino acid sequence after residue 87 and early truncation six amino acids later. Guide RNAs and
Cas9 nuclease were introduced into C57BL/6NJ-derived fertilized eggs with well recognized pronu-
clei. Embryos were transferred to pseudopregnant females. Correctly targeted pups were identified
by sequencing and further bred to C57BL/6NJ (Stock No. 005304) to develop the colony. Once the
stock mice arrived at the Cleveland Clinic heterozygous mice were intercrossed to generate addi-
tional heterozygous (Tmc4+/-) and homozygous wild type (Tmc4+/+) and knockout (Tmc4-/-) progeny.
In addition to wild type mice on the mixed C57BL/6NJ background, we also studied parallel wild
type mice on a pure C57BL/6J strain to increase sample size of experimental controls. Experimental
mice were fed a high fat diet for 2 weeks prior to necropsy for analysis of hepatic steatosis.
Standardized necropsy conditions

To keep results consistent, the vast majority of experimental mice were fasted for 4 hr (from 9:00
a.m. to 1:00 p.m.) prior to necropsy. For the fasting versus fed experiments, fed mouse tissue were
collected at the beginning of the light cycle (7:00 a.m.) in ad libitum fed mice, whereas the fasted
group had food removed at 7:00 p.m. and were necropsy after a 12 hr fast (7:00 a.m.). At necropsy,
all mice were terminally anesthetized with ketamine/xylazine (100–160 mg/kg ketamine-20–32 mg/
kg xylazine), and a midline laparotomy was performed. Blood was collected by heart puncture. Fol-
lowing blood collection, a whole body perfusion was conducted by puncturing the inferior vena cava
and slowly delivering 10 ml of saline into the heart to remove blood from tissues. Tissues were col-
lected and immediately snap frozen in liquid nitrogen for subsequent biochemical analysis or fixed
for morphological analysis.
Plasma ALT and AST analysis

To determine the level of hepatic injury in mice fed chow and HFD with ASO treatment for 20 weeks,
plasma was used to analyze aminotransferase (AST) and alanine aminotransferase (ALT) levels using
enzymatic assays (Sekisui Diagnostics, Lexington, MA, USA).
In vivo measurement of adiposity and lean mass

Quantitation of lean and fat mass were done using an EchoMRITM-130 Body Composition Analyzer
(EchoMRI International).

Isolation and characterization of lipid droplets from mouse liver

Hepatic LDs were isolated by sucrose gradient centrifugation as we have previously described
(Ferguson et al., 2017). Approximately 100 mg of tissue was minced with a razor blade on a cold
surface. Minced tissue was transferred to a Potter-Elvehjem homogenizer, and then 200 ml of 60%
sucrose was added to the tissue sample and incubated on ice for 10 min. Next, 800 ml of lysis buffer
was added and mixed, and then incubated on ice for 10 min. Samples were homogenized with five
strokes of a Teflon pestle and transferred to a 2 ml centrifuge tube. Lysis buffer (600 ml) was carefully
layered on top of homogenate and centrifuged for 2 hr at 20,000 g at 4˚C. The tube was then frozen
at 80˚C and cut at the 1,000 ml mark. The bottom piece of the centrifuge tube contained the non-
LD fraction, which was allowed to thaw before being transferred to a new tube. The LD fraction was
collected by cutting an ~4–6 mm piece from the top of the ice cylinder and placing it in a new 2 ml
tube. To increase the purity of the LD fraction, this process was repeated once more. Briefly, 200 ml
of 60% sucrose was added to the LD fraction. Next, 800 ml of lysis buffer was added and mixed fol-
lowed by careful layering with 600 ml of lysis buffer and then centrifugation for 2 hr at 20,000 g at 4˚
C. After freezing at 80˚C, the tube was cut and the LD fraction was collected by cutting an ~4–6
mm piece from the top of the ice cylinder and placing it in a new tube. Protein analysis was per-
formed using the modified Lowry assay, as previously described (Ferguson et al., 2017), and West-
ern blotting was performed as described below. MBOAT7 substrate (lysophosphatidylinositol) and
product (phosphatidylinositol) lipids in the LD fraction were extracted and quantified using the tar-
geted LC-MS/MS methods described below.
Quantitation of phosphatidylinositol (PI) and lysophosphatidylinositol

(LPI) lipids
A targeted lipidomic assay for LPI and PI lipids was developed using HPLC on-line electrospray ioni-
zation tandem mass spectrometry (LC/ESI/MS/MS). Plasma and tissues (liver, brain, pancreas) from
mice fed chow or HFD with ASO injections for 20 weeks were analyzed for precise detection of LPI
and PI species (Figure 6; Figure 6—figure supplements 1–4). Moreover, plasma LPI levels were
measured over time after intraperitoneal injections of 18:0 and 18:1 LPI (Figure 8—figure supple-
ment 1). Standard Solutions: The standards used in this assay were all purchased from Avanti Polar
Lipids (LPI-16:0, LPI-18:0, LPI-18:1, LPI-20:4, PI-38:4). Internal standards used for these analyses were
LPI-17:1, PI-34:1-d31; all of which were purchased from Avanti Polar Lipids. Standard LPI and PI spe-
cies at concentrations of 0, 5, 20, 100, 500 and 2000 ng/ml were prepared in 90% methanol contain-
ing two internal standards at the concentration of 500 ng/ml. The volume of 5 ml was injected into
the Shimadzu LCMS-8050 for generating the internal standard calibration curves. HPLC Parameters:
A silica column (2.1 50 mm, Luna Silica, 5 mm, Phenomenex) was used for the separation of PI and
LPI species. Mobile phases were A (water containing 10 mM ammonium acetate) and B (acetonitrile
containing 10 mM ammonium acetate). Mobile phase B at 95% was used from 0 to 2 min at the flow
rate of 0.3 ml/min and then a linear gradient from 95% B to 50% B from 2 to 8 min, kept at 50% B
from 8 to 16 min, 50% B to 95% B from 16 to 16.1 min, kept 95% B from 16.1 to 24 min. Mass Spec-
trometer Parameters: The HPLC eluent was directly injected into a triple quadrupole mass spectrom-
eter (Shimadzu LCMS-8050) and the analytes were ionized (ESI negative mode). Analytes were
quantified using Selected Reaction Monitoring (SRM) and the SRM transitions (m/z) were 571 fi 255
for LPI-16:0, 599 fi 283 for LPI-18:0, 597 fi 281 for LPI-18:1, 619 fi 303 for LPI-20:4, 885 fi 241 for
PI-38:4, 583 fi 267 for internal standard LPI-17:1, and 866 fi 281 for internal standard PI-34:1-d31.
Data Analysis: Software Labsolutions LCMS was used to get the peak area for both the internal
standards and LPI and PI species. The internal standard calibration curves were used to calculate the
concentration of LPI and PI species in the samples. All plasma LPI and PI species were normalized to
the PI-34:1-d31 internal standard, while all tissue LPI species were normalized to the 17–1 LPI inter-
nal standard and all tissue PI species were normalized to the PI-34:1-d31 internal standard.
Shotgun lipidomics to examine alterations in major phospholipid

species
To more broadly examine the molecular lipid species in Mboat7 knockdown livers we utilized a shot-
gun lipidomics method for semi-quantitation of multiple lipid species using a method we have previ-
ously described (Gromovsky et al., 2018). All the internal standards were purchased from Avanti

Polar Lipids, Inc (700 Industrial Park Drive, Alabaster, Alabama 35007, USA). Ten internal standards
(12:0 diacylglycerol, 14:1 monoacylglycerol, 17:0 lysophosphatidylcholine, 17:0 phosphatidylcholine,
17:0 phosphatidic acid; 17:0 phosphatidylethanolamine, 17:0 phosphatidylglycerol, 17:0 sphingo-
myelin, 17:1 lysosphingomyelin, and 17:0 ceramide) were mixed together with the final concentra-
tion of 100 mM each. Total hepatic lipids were extracted using the method of Bligh and Dyer, with
minor modifications. In brief, 50 mL of 100 mM internal standards were added to tissue homogenates
and lipids were extracted by adding by adding MeOH/CHCl3 (v/v, 2/1) in the presence of dibutylhy-
droxytoluene (BHT) to limit oxidation. The CHCl3 layer was collected and dried under N2 flow. The
dried lipid extract was dissolved in 1 ml the MeOH/CHCl3 (v/v, 2/1) containing 5 mM ammonium
acetate for injection. The solution containing the lipid extract was pumped into the TripleTOF 5600
mass spectrometer (AB Sciex LLC, 500 Old Connecticut Path, Framingham, MA 01701, USA) at a
flow rate of 40 mL/min for 2 min for each ionization mode. Lipid extracts were analyzed in both posi-
tive and negative ion modes for complete lipidome coverage using the TripleTOF 5600 System. Infu-
sion MS/MSALL workflow experiments consisted of a TOF MS scan from m/z 200–1200 followed by
a sequential acquisition of 1001 MS/MS spectra acquired from m/z 200 to 1200. The total time
required to obtain a comprehensive profile of the lipidome was approximately 10 min per sample.
The data was acquired with high resolution (>30000) and high mass accuracy (~5 ppm RMS). Data
processing using LipidView Software identified 150–300 lipid species, covering diverse lipids classes
including major glycerophospholipids and sphingolipids. The peak intensities for each identified
lipid, across all samples were normalized against an internal standard from same lipid class for the
semi-quantitation purpose.
Identification and quantification of AA-Derived lipid mediators by LC-

MS/MS
In order to quantitate the abundance of lipid mediators generated from arachidonic acid, livers col-
lected from C57BL/6 mice exposed to each treatment condition were subjected to solid phase
extraction (SPE) and targeted liquid chromatography-tandem mass spectrometry (LC-MS/MS) as pre-
viously described in detail (Dalli et al., 2018) Briefly, tissue was minced in ice-cold methanol contain-
ing internal deuterated standards (d4-LTB4, d4-PGE2 and d5-LXA4) used to assess extraction
recovery. Samples were loaded on C18 SPE cartridges and eluted methyl formate fractions were
concentrated under a gentle stream of N2 gas. Samples were then resuspended in methanol:water
(50:50) and analyzed using a high performance liquid chromatograph (HPLC, Shimadzu) coupled to a
QTrap5500 mass spectrometer (AB Sciex) operating in negative ionization mode. Lipid mediators
were identified using specific multiple reaction monitoring transitions, retention time, and diagnostic
fragmentation spectra as compared with authentic standards. Quantification of lipid mediators was
accomplished using calibration curves constructed with external standards for each mediator.
RNA sequencing and analysis

RNA was isolated via RNAeasy lipid tissue mini kit (Qiagen) from livers in which mice were fed a
high-fat diet and treated with ASOs for 20 weeks. RNA samples were checked for quality and quan-
tity using the Bio-analyzer (Agilent). RNA-SEQ libraries were generated using the Illumina mRNA
TruSEQ Directional library kit and sequenced using an Illumina HiSEQ4000 (both according to the
Manufacturer’s instructions). RNA sequencing was performed by the University of Chicago Genomics
Facility. Raw sequence files will be deposited in the Sequence Read Archive before publication
(SRA). Single-ended 50 bp reads were trimmed with Trim Galore (v.0.3.3, http://www.bioinformatics.
babraham.ac.uk/projects/trim_galore) and controlled for quality with FastQC (v0.11.3, http://www.
bioinformatics.bbsrc.ac.uk/projects/fastqc) before alignment to the Mus musculus genome (Mm10
using UCSC transcript annotations downloaded July 2016). Reads were aligned using STAR in sin-
gle-pass mode (v.2.5.2a_modified, https://github.com/alexdobin/STAR) (Dobin et al., 2013) with
standard parameters but specifying ‘–alignIntronMax 100000 –quantMode GeneCounts’. Overall
alignment ranged from 88–99% with 61–75% mapping uniquely. Transcripts with fewer than one
mapped read per million (MMR) in all samples were filtered out before differential expression (DE)
analysis. The filtering step removed 12,692/24,411 transcripts (52%). Raw counts were loaded into R
(http://www.R-project.org/) (R Development Core Team, 2015) and edgeR (Robinson et al., 2010)
was used to perform upper quantile, between-lane normalization, and DE analysis. Values generated

with the cpm function of edgeR, including library size normalization and log2 conversion, were used
in figures. Heat maps were generated using pheatmap (Kolde, 2015). DAVID (v.6.8) (Huang et al.,
2009) was used to identify enriched functional annotations in DE gene ID lists relative to the set of
‘expressed’ genes (defined as having a median count across samples > 1 read per million mapped).
Functional annotation to gene ontology was also performed using Ingenuity-IPA software (Ingenuity
Systems, Inc Redwood City, CA.) as previously described (Thomas and Bonchev, 2010).
Glucose and insulin tolerance tests

Glucose and insulin tolerance tests were conducted as previously described (Warrier et al., 2015;
Brown et al., 2010; Brown et al., 2008a; Brown et al., 2008b; Izem and Morton, 2009;
Helsley et al., 2016) in male mice following 20 weeks of concurrent chow and HFD-feeding with
ASO treatment. During the glucose tolerance test plasma insulin and C-peptide levels were mea-
sured via ELISA following manufacturer’s instructions (Millipore).
Plasma lipid and lipoprotein analyses

Total plasma triacylglycerol levels (L-Type TG M, Wako Diagnostics) and total plasma cholesterol lev-
els were quantified enzymatically (Infinity Cholesterol Reagent, Thermo/Fisher). The distribution of
cholesterol across lipoprotein classes was performed by fast-protein liquid chromatography (FPLC)
using tandem superose-6 HR columns coupled with an online enzymatic cholesterol quantification as
previously described (Warrier et al., 2015; Brown et al., 2010; Brown et al., 2008a; Brown et al.,
2008b; Izem and Morton, 2009; Helsley et al., 2016).
In vivo insulin signaling studies

WT mice were fed a HFD for 20 weeks while injected with control or Mboat7 targeted ASOs. At 20
weeks, mice were fasted overnight (7 p.m. to 7 a.m.) and were injected with saline or 0.35 U/kg insu-
lin into the portal vein for 5 min, as previously described (Lord et al., 2016). After 5 min, mice were
euthanized and tissues were collected for protein isolation and western blot analysis.
Measurement of hepatic Very Low Density Lipoprotein (VLDL)

Triglyceride Secretion in vivo
Control and Mboat7 ASO-treated mice were fasted overnight, and the following morning rec were
injected with 500 mg/kg Triton WR-1339 (tyloxapol, Sigma). and blood was collected every 90 min
thereafter. To measure hepatic VLDL secretion, serum TG levels were measured using enzymatic bio-
chemical assays at each time point as described below.
General biochemical plasma and hepatic lipid analysis

Extraction of liver lipids and quantification of total plasma and hepatic triglycerides, cholesterol, and
cholesterol esters was conducted using enzymatic assays as described previously (Warrier et al.,
2015; Brown et al., 2010; Brown et al., 2008a; Brown et al., 2008b; Izem and Morton, 2009).
Lysophosphatidylinositol acyltransferase biochemical assay

[1-14C]-arachidonyl-CoA was obtained from American Radiolabeled Chemicals. Lysophosphatidylino-
sitol (LPI) substrates (16:0 LPI, 18:0 LPI, and 18:1 LPI) and lipid standards used in the enzyme assays
were obtained from Avanti Polar Lipids. Liver microsomes isolated from Mboat7 ASO and control
ASO treated mice on both chow and high fat diet was used to measure LPIAT activity. The assay
buffer contained 50 mM Tris-HCL (pH 8.0), 150 mM NaCl, 50 mM 18:0-LPI, 20 mM [1-14C]arachidonyl-
CoA (0.025 mCi), and 15 mg of the microsomes in a total volume of 100 mL. Substrate was prepared
in CHAPS (0.01 mM final concentration). The assay mixture was incubated for 30 min at 37˚C, and
the reaction was stopped by the addition of 1:2:1 (v/v/v) chloroform:methanol:2% orthophosphoric
acid. The lipids were extracted and separated on a silica–TLC plate using chloroform/acetone/acetic
acid/methanol/water (50:20:15:10:5, v/v) as the solvent system. The individual lipid molecules were
identified by migration with respect to standards. Enzymatic products were monitored by autoradio-
gram, corresponding spots were scraped from the TLC plate, and the radioactivity was quantified
with a liquid scintillation counter.

Immunoblotting
Whole tissue homogenates were made from tissues in a modified RIPA buffer as previously
described (Warrier et al., 2015; Brown et al., 2010; Brown et al., 2008a; Brown et al., 2008b;
Izem and Morton, 2009), and protein was quantified using the bicinchoninic (BCA) assay (Pierce).
Proteins were separated by 4–12% SDS-PAGE, transferred to polyvinylidene difluoride (PVDF) mem-
branes, and proteins were detected after incubation with specific antibodies as previously described
(Warrier et al., 2015; Brown et al., 2010; Brown et al., 2008a; Brown et al., 2008b; Izem and
Morton, 2009). Quantification of blots was performed using ImageJ software (National Institute of
Health). Information of antibodies is provided in the key resource table.
Real-Time PCR analysis of gene expression

Tissue RNA extraction was performed as previously described for all mRNA analyses (Warrier et al.,
2015; Brown et al., 2010; Brown et al., 2008a; Brown et al., 2008b; Izem and Morton, 2009).
qPCR analyses were conducted as previously described (Warrier et al., 2015; Brown et al., 2010;
Brown et al., 2008a; Brown et al., 2008b), and mRNA expression levels were calculated based on
the DD-CT method. qPCR was conducted using the Applied Biosystems 7500 Real-Time PCR System.
Primers used for qPCR are listed in the Key Resource Table.
Histological analysis
Hematoxylin and eosin (H and E) staining of paraffin-embedded liver sections was performed as pre-
viously described (Warrier et al., 2015; Brown et al., 2010; Brown et al., 2008a; Brown et al.,
2008b; Izem and Morton, 2009). Histopathologic evaluation was scored in a blinded fashion by a
board-certified pathologist with expertise in gastrointestinal/liver pathology (Daniela S. Allende –
Cleveland Clinic).
Quantification of hepatic immune cell populations by flow cytometry

After 20 weeks of HFD-feeding and ASO injections, livers were excised, washed with 1X PBS, and
immediately placed into RPMI with Type IV Collagenase (Sigma Aldrich, St. Louis, Missouri, Lot#
087K8630) and DNase I (Roche, Mannheim, German) for 45 min at 37˚ C. Digested clumps of liver
were pressed through a 70 um strainer and washed with RPMI with 10% FBS. Cells were centrifuged
at 50 g for 10 min; supernatant was then centrifuged at 50 g for 7 min. To pellet the NPC fraction,
cells were centrifuged at 300 g for 7 min. Cells were resuspended in BD Pharm Lyse (BD Biosciences,
San Jose, California) for 5 min on ice. Cells were washed with RPMI with 10% FBS and centrifuged at
300 g for 10 min. (Gibbons MA, American Journal of Respiratory and Critical Care Medicine, 184,
2011). For flow cytometry, cells were resuspended in FACS buffer (1x PBS, 1% BSA, 0.05% sodium
azide). Cells were aliquoted into 96 well plates at a concentration of ~1106 cells/mL. Cells were
centrifuged at 830 x g for 4 min, resuspended in 50 ml FACS buffer containing 0.5 ug of Fcg Block
(clone 93, eBioscience, San Diego, California), and incubated for 15 min at room temperature. After
blocking, cells were stained with a fluorochrome-conjugated antibody panel CD206, Ly6c, CD3,
CD4, CD8, CD11b, and CD11c. – all described in the Key Resource Table) for 30 min at 4˚ C in the
dark. Cells were washed and centrifuged at 830 x g for 4 min twice with FACS buffer. Stained cells
are resuspended in 200 ml of 1% paraformaldehyde and kept in the dark at 4˚C overnight. Stained
cells were centrifuged at 830 x g for 5 min. Stained cells were resuspended in 300 ml of FACS buffer,
and data were collected on a LSRII flow cytometer (Becton Dickinson Immunocytometry systems,
Mountain View, CA). Data collected on the LSRII were analyzed using FlowJo software (Tree Star,
Inc, Ashland Oregon).
Cell culture and generation of MBOAT7-Deficient Hepatoma Cells

Mycoplasma-tested hepatocellular carcinoma cells (Huh7) were cultured under standard conditions
in Dulbecco-modified Eagle’s minimum essential medium (D-MEM) (GIBCO, Life Technologies,
Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS, GIBCO), 1% l-glutamine, 1% penicil-
lin-streptomycin and 1% nonessential amino acids in a 5% CO2-humidified chamber at 37˚C.
CRISPR-Cas9 genome editing was accomplished using methods previously described (Ran et al.,
2013). MBOAT7 sgRNAs were designed by an online tool (https://www.benchling.com/) and cloned
into the Lenti-CRISPER v2 vector (Addgene (Ran et al., 2013) with D10A nickase version of Cas9

(Cas9n)). Primers used in this study are listed in Supplementary Table X. MBOAT7 KO cell lines were
generated following lentiviral transduction of the Lenti-CRISPER v2-Cas9 D10A- MBOAT7 sgRNA in
Huh7 cells. MBOAT7 KO single cell clones were isolated and expanded following FACS sorting.
MBOAT7 KO cells were validated by analyzing the expression of MBOAT7 by real-time PCR and
Western blot. Primers used for gene editing are shown in the key resource table with the following
primer names: MBOAT7-E5-Nick-5F, MBOAT7-E5-Nick-5R, MBOAT7-E5-Nick-3F, MBOAT7-E5-Nick-
3R.
Measurement of fatty acid oxidation rates in wild type and

MBOAT7D Huh7 cells
Complete fatty acid oxidation to CO2 was measured using methods we have previously described
(Brown et al., 2003). In brief control and MBOAT7D HUH7 cells were grown to a confluency of 70–
80% in DMEM. Upon reaching confluence, one million cells were seeded for both WT-HUH7 and
MBOAT7D (n = 3) for 24 hr. After 24 hr the medium was replaced with fresh serum free DMEM
medium with 0.4 mci of [1-14C]-palmitic acid in 0.3% BSA/100 mM cold palmitate to each plate, and
the plate was quickly placed in an airtight CO2 collection chamber (60 ml Nalgene jar with a fitted
rubber stopper, and hanging center-well collection bucket containing What-man filter paper soaked
with 50 ml benzothonium hydroxide). Substrate incubation was carried out with different time points
(0 min, 30 min, 60 min and 120 min) at 37˚C. Following each incubation, the reaction was terminated
by the addition of 100 mL of 0.5 M H2SO4 to the cells using syringe injection. Liberation of [14C]-CO2
was allowed to proceed for an additional 30 min, and then the center-well collection bucket was cut
out of the collection chamber and delivered to a liquid scintillation vial. Production of [14C]-CO2
from [14C]-palmitic acid was determined by liquid scintillation counter. Radiation count was normal-
ized to amount of protein, as quantified by BCA assay (Pierce).
Measurement of triacylglycerol and cholesterol ester hydrolysis rates in

cells
Measurement of neutral lipid mobilization was accomplished using a pulse-chase approach essen-
tially as described previously (Brasaemle et al., 2000). Both control and MBOAT7D Huh7 cells were
grown till 80% confluent, one million cells were seeded in 6-well plates (WT-Huh7 and MBOAT7 KO,
the next day fresh DMEM medium was added and the cells were incubated with 100 mM cold oleate
complexed to bovine serum albumin + 1 mCi [3H]-cholesterol + 0.5 mCi [14C]-oleate for 24 hr. After
24 hr of pulse labeling-cells to reach steady state, cells were chased for different time points (0, 1 hr,
2 hr, 4 hr, 8 hr, 24, 48 hr) in media containing 6 mM triacsin C (from 1 mg/ml stock in Me2SO) without
supplemental fatty acids to examine turnover without the re-esterification (triacsin C blocks acyl-CoA
synthetase activity). Cells were rinsed with phosphate buffered saline and harvested by scraping at
various times; lipids were extracted as previously described and separated by thin layer chromatog-
raphy using hexane:diethyl ether:acetic acid (80:20:1) as a solvent system. Triacylglycerol (TAG) and
cholesterol ester spots were scraped off the plate, and the incorporation of radioactivity into TAG
was determined by liquid scintillation counter. Radiation count was normalized to amount of protein,
as quantified by BCA assay (Pierce).
Measurement of de novo Lipogenesis in Cells

Measurement of de novo lipogenesis rates was accomplished by tracing [14C]-acetate into [14C]-tria-
cylglycerol essentially as described previously (Brasaemle et al., 2000). Confluent cells of both wild
type and MBOAT7D Huh7 cells were maintained in DMEM medium, from these 1 million cells of
both WT and MBOAT7D were seeded to 6-well plates for 12 hr, after 12 hr the medium was
replaced by serum free DMEM. To measure triacylglycerol synthesis, without the complication of
parallel triacylglycerol hydrolysis, cells were treated with lipase inhibitors of triacylglycerol and cho-
lesterol ester such as diethyl-p-nitrophenyl phosphate (E-600, 500 mM) and diethylumelliferyl phos-
phate (DEUP, 0.35 mM) for 1 hr. After 1 hr of lipase inhibitor treatment, the cells were incubated
with human recombinant insulin (100 nM) as a stimulator for de novo lipogenesis for 30 min. After 30
min of insulin stimulation, the cells were incubated with 1 mCi [14C]acetate and cells were harvested
at various time points (30 min, 60 min, 120 min and 240 min) post substrate addition. From each
time point cells were rinsed with PBS (twice), lipids were extracted as described above and

separated by thin layer chromatography using using hexane:diethyl ether:acetic acid (80:20:1) as a
solvent system. Triacylglycerol (TAG) spot was scraped off of the plate, and the incorporation of
[14C]-acetate into [14C]-triacylglycerol was determined by liquid scintillation counter. Radiation count
was normalized to amount of protein, as quantified by BCA assay (Pierce).
Fluorescence microscopy
In preparation for fluorescence microscopy, 5 104 cells of WT and MBOAT7D were plated onto 22
mm square glass coverslips in 4-well cell culture chamber slide containing growth media supple-
mented with 400 mM oleic acid. After 24 hr, medium was removed, washed with PBS (twice) and cells
were fixed in 4% paraformaldehyde for 30 min. After 30 min of incubation, fixed cells were washed
two times with PBS and then BODIPY (1 mg/mL) was added incubated for additional 30 min in dark.
After incubation the cells were washed with PBS (twice) followed by mounting the slides with Pro-
Long Gold antifade reagent with DAPI (40 ,6- Diamidine-20 -phenylindole dihydrochloride). Images
were acquired using a Leica DMIRB upright microscope (Leica Microsystems, GmbH, Wetzlar, Ger-
many) equipped with a Retiga SRV camera and QCapture Pro software (QImaging, Surrey, BC,
Canada).
Western blot analysis

Microsome were isolated from single clones of MBOAT7 D and WT-HUH7 cells using microsome iso-
lation kit from Abcam. Proteins were quantified from isolated microsome using BCA method, 30 mg
of protein were loaded on SDA-PAGE gels, the expression of MBOAT7 is confirmed by using
MBOAT7-rat primary antibody (1:1000) and anti-rat secondary antibody (1:5000).
Statistical analysis
All experiments consisted of a minimum of three replicates and data are presented as mean ± SD.
GraphPad Prism 8.1.1 was used for data analysis. Two-way ANOVAs with Bonferroni’s multiple com-
parison tests were used to determine significant differences (p-value<0.0002(***),<0.0001(****).
Statistical analysis
Human data analyses were performed using R 3.1.0 (Vienna, Austria) and p<0.05 was considered sta-
tistically significant. All mouse data were analyzed using either one-way or two-way analysis of vari-
ance (ANOVA) where appropriate, followed by either a Tukey’s or Student’s t tests for post hoc
analysis. Differences were considered significant at p<0.05. All mouse data analyses were performed
using Graphpad Prism 6 (La Jolla, CA) software.
Acknowledgements
This work is dedicated in loving memory to the late Dr. Lawrence ‘Larry’ Rudel, who passed away
during the revision of this work (deceased, August 29th, 2019). Larry’s passion for science inspired
many in the field of lipid and lipoprotein metabolism. We sincerely thank Dr. Hiroyuki Arai (University
of Tokyo) for generously providing the MBOAT7 antibody used in this work. This work was sup-
ported by National Institutes of Health grants R01 HL122283 (JMB), R01 DK120679 (JMB), P50
AA024333 (JMB, DSA), P01 HL49373 (LLR), P01 HL30568 (AJL), U01 DK061732-15 (DSA), U01
AA021893-05 (DSA), P01 HL029582 (PLF), R00HL12172 (MC), R01 DK103637 (DSA), R01 HL106173
(MS), P01 GM095467 (MS), F32 HL136044 (BES), R21 AR067477 (JPK), and the American Heart Asso-
ciation (Postdoctoral Fellowships 17POST3285000 to RNH,15POST2535000 to RCS, and
19POST34380725 to IR). Development of lipid mass spectrometry methods reported here were sup-
ported by generous pilot grants from the Clinical and Translational Science Collaborative of Cleve-
land (4UL1TR000439) from the National Center for Advancing Translational Sciences (NCATS)
component of NIH and the NIH Roadmap for Medical Research, the Case Comprehensive Cancer
Center (P30 CA043703), the VeloSano Foundation, and a Cleveland Clinic Research Center of Excel-
lence Award.

Additional information
Competing interests
Richard G Lee, Rosanne M Crooke, Mark J Graham: employee at Ionis Pharmaceuticals, Inc. The
other authors declare that no competing interests exist.
Funding
Funder Grant reference number Author
National Heart, Lung, and R01-HL122283 Jonathan Mark Brown
Blood Institute
National Institute of Diabetes R01-DK120679 Jonathan Mark Brown
and Digestive and Kidney Dis-
eases
National Institute on Alcohol P50-AA-024333 Daniela S Allende
Abuse and Alcoholism Jonathan Mark Brown
National Heart, Lung, and P01 HL029582 Paul L Fox
Blood Institute
National Institute on Alcohol U01-AA021893 Daniela S Allende
Abuse and Alcoholism
National Institute of Diabetes U01-DK061732 Daniela S Allende
eases
National Institute of Diabetes R01-DK103637 Daniela S Allende
eases
National Heart, Lung, and P01-HL49373 Lawrence L Rudel
Blood Institute
National Heart, Lung, and P01-HL30568 Aldons J Lusis
Blood Institute
National Heart, Lung, and R00-HL12172 Mete Civelek
Blood Institute
National Heart, Lung, and R01-HL106173 Matthew Spite
Blood Institute
National Heart, Lung, and F32-HL136044 Brian E Sansbury
Blood Institute
All coauthors are responsible for the content of this work, and different aspects of
this work was funded by the National Institutes of Health (NIH) and the American
Heart Association (AHA).
Author contributions
Robert N Helsley, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing—
original draft, Writing—review and editing; Venkateshwari Varadharajan, Amanda L Brown, Anthony
D Gromovsky, Rebecca C Schugar, Rakhee Banerjee, Data curation, Formal analysis, Investigation,
Methodology, Writing—original draft, Writing—review and editing; Iyappan Ramachandiran, Kevin
Fung, Investigation, Methodology; Mohammad Nasser Kabbany, Chelsea Finney, Preeti Pathak,
Danny Orabi, Lucas J Osborn, William Massey, Renliang Zhang, Investigation, Methodology,
Writing—original draft, Writing—review and editing; Chase K Neumann, Data curation,
Investigation, Methodology, Writing—original draft, Writing—review and editing; Anagha Kadam,
Investigation; Brian E Sansbury, Methodology, Writing—original draft, Writing—review and editing;
Calvin Pan, Daniela S Allende, Mete Civelek, Aldons J Lusis, Data curation, Formal analysis,
Methodology, Writing—original draft, Writing—review and editing; Jessica Sacks, Investigation,
Writing—original draft, Writing—review and editing; Richard G Lee, Rosanne M Crooke, Mark J
Graham, Resources, Methodology, Writing—original draft, Writing—review and editing; Madeleine
E Lemieux, Data curation, Formal analysis; Valentin Gogonea, Data curation, Formal analysis,

Methodology, Writing—review and editing; John P Kirwan, Data curation, Methodology, Writing—
original draft; Paul L Fox, Supervision, Investigation, Methodology; Lawrence L Rudel, Data curation,
Formal analysis, Investigation, Methodology, Writing—original draft; Matthew Spite, Formal analysis,
Investigation, Methodology, Writing—original draft, Writing—review and editing; J Mark Brown,
Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition,
Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration,
Writing—review and editing
Author ORCIDs
Robert N Helsley https://orcid.org/0000-0001-5000-3187
J Mark Brown https://orcid.org/0000-0003-2708-7487
Ethics
Human subjects: Human MBOAT7 Expression Levels in Lean and Obese Subjects The majority of
subjects recruited to examine MBOAT7 expression levels were morbidly obese bariatric surgery
patients, but we were able to obtain liver biopsies from 10 subjects with a BMI under 30 as normal
weight controls. For recruitment, adult patients undergoing gastric bypass surgery at Wake Forest
School of Medicine were consented via written consent and enrolled by a member of the study staff
following institutionally approved IRB protocols as previously described41. Exclusion criteria
included: positive hepatitis C antibody, positive hepatitis B surface antigen, history of liver disease
other than NAFLD, Childs A, B, or C cirrhosis, past or present diagnosis/treatment of malignancy
other than non-melanocytic skin cancer, INR greater than 1.8 at baseline or need for chronic anticoa-
gulation with warfarin or heparin products, use of immunomodulation for or history of inflammatory
diseases including but not limited to malignancy, rheumatoid arthritis, psoriasis, lupus, sarcoidosis
and inflammatory bowel disease, and greater or equal to 7 alcohol drinks per week or 3 alcoholic
drinks in a given day each week. In addition to bariatric surgery patients, a small number of non-
obese subjects (body mass index <30.0) consented to liver biopsy during elective gall bladder
removal surgery (n=10). Each subject was assigned a unique identifier which was used throughout
the study and did not include any identifiable information about the patient such as name, address,
telephone number, social security number, medical record number or any of the identifiers outlined
in the HIPAA Privacy Rule regulations. Only the principal investigator had access to the code linking
the unique identifier to the study subject. Basic clinical information was obtained via self-reporting
and a 15 ml baseline blood sample was obtained at the time of enrollment. A subset of this cohort
has been previously described20,41. At the time of surgery, the surgeon collected a roughly 1-gram
sample from the lateral left lobe. Wedge biopsies were rinsed with saline and immediately snap fro-
zen in liquid nitrogen in the operating room before subsequent storage at -80˚C. For data shown in
Figure 7 showing levels of MBOAT7 substrate and product lipids, de-identified patient samples from
the Cleveland Clinic hepatology clinic (IRB # 10-947) were analyzed. These patients had biopsy
proven Ishak fibrosis scores42 of 0 (normal) or 4 (advanced fibrosis). For analysis of hepatic MBOAT7
expression, RNA isolated from liver biopsies were used for quantitative real time PCR (qPCR) as
described below.
Animal experimentation: Rat Studies of Diet-Induced Obesity Sprague Dawley Rats were received at
12 weeks of age and were housed in individual cages, kept at a constant temperature and ambient
humidity in a 12-hlight/dark cycle. Animals were then randomly assigned to either a standard chow
diet or a high-fat diet (D12492, 60% fat, Research Diets, New Brunswick, NJ, USA) ad libitum to
establish diet-induced obesity as previously described20. After 6 months of HFD-feeding, livers were
excised for standard qPCR analysis of Mboat7 expression. Hybrid Mouse Diversity Panel 92 inbred
strains of 8-week-old male mice (180 individual mice) were fed a high fat, high sucrose diet
(D12266B, Research Diets, New Brunswick, NJ) for 8 weeks before tissue collection44. Gene expres-
sion of Mboat7 in white adipose tissue and liver were measured and correlated with obesity related
traits using biweight midcorrelation analysis as previously described4. Mouse Studies of Mboat7
Loss of Function To explore the role of Mboat7 in diet-induced obesity, NAFLD progression, and
insulin resistance, we utilized an in vivo knockdown approach in 8-week old adult mice. Selective
knockdown of Mboat7 was accomplished using 2’-O-ethyl (cET) modified antisense oligonucleotides
(ASO). All ASOs used in this work were synthesized, screened, and purified as described previ-
ously45 by Ionis Pharmaceuticals, Inc (Carlsbad, CA). For Mboat7 knockdown studies, adult (8 week

old) male C57BL/6 mice were purchased from Jackson Labs (Bar Harbor, ME USA), and maintained
on either a standard rodent chow diet or a high fat diet (HFD, D12492 from Research Diets Inc) and
injected intraperitoneally biweekly with 12.5 mg/kg of either non-targeting control ASO or one of
two independent ASOs directed against murine Mboat7 for a period of 20 weeks. Similar results
were seen with two independent ASOs targeting different regions of the Mboat7 mRNA, hence key
data using one Mboat7 ASO are shown. All rodents were maintained in an Association for the
Assessment and Accreditation of Laboratory Animal Care, International-approved animal facility, and
all experimental protocols were approved by the Institutional Animal Care and use Committee of
the Cleveland Clinic (IACUC protocols # 2015-1519 and # 2018-2053).
Decision letter and Author response

Decision letter https://doi.org/10.7554/eLife.49882.036
Author response https://doi.org/10.7554/eLife.49882.037
Additional files
Supplementary files
. Transparent reporting form DOI: https://doi.org/10.7554/eLife.49882.028
Data availability
Dataset are available through NCBI: Accession numbers GSE138945, GSE138946, and GSE138947.
The following datasets were generated:

Database and
Author(s) Year Dataset title Dataset URL Identifier
Robert N Helsley, 2019 Obesity-linked suppression of https://www.ncbi.nlm. NCBI Gene
Venkateshwari Var- MBOAT7 promotes liver injury nih.gov/geo/query/acc. Expression Omnibus,
adharajan, Amanda cgi?acc=GSE138947 GSE138947
L Brown, Anthony D
Gromovsky, Rebec-
ca C Schugar,
Iyappan Ramachan-
diran, Kevin Fung,
Mohammad Nasser
Kabbany, Rakhee
Banerjee, Chase
Neumann, Chelsea
Finney, Preeti
Pathak, Danny Or-
abi, Lucas J Os-
born, William
Massey, Renliang
Zhang, Anagha Ka-
dam, Brian E Sans-
bury, Calvin Pan,
Jessica Sacks, Ri-
chard G Lee, Ro-
sanne M Crooke,
Mark J Graham,
Madeleine E Le-
mieux, Valentin
Gogonea, John P
Kirwan, Daniela S
Allende, Mete Ci-
velek, Paul L Fox,
Lawrence L Rudel,
Aldons J Lusis,
Matthew Spite, J
Mark Brown
Robert N Helsley, 2019 MBOAT7’s role in progression of https://www.ncbi.nlm. NCBI Gene
Venkateshwari Var- Non-Alcoholic Fatty Liver Disease nih.gov/geo/query/acc. Expression Omnibus,
adharajan, Amanda (NAFLD) and Non-Alcoholic cgi?acc=GSE138945 GSE138945
L Brown, Anthony D Steatohepatitis (NASH)
Gromovsky, Rebec-

ca C Schugar,
Iyappan Ramachan-
diran, Kevin Fung,
Mohammad Nasser
Kabbany, Rakhee
Banerjee, Chase
Neumann, Chelsea
Finney, Preeti
Pathak, Danny Or-
abi, Lucas J Os-
born, William
Massey, Renliang
Zhang, Anagha Ka-
dam, Brian E Sans-
bury, Calvin Pan,
Jessica Sacks, Ri-
chard G Lee, Ro-
sanne M Crooke,
Mark J Graham,
Madeleine E Le-
mieux, Valentin
Gogonea, John P
Kirwan, Daniela S
Allende, Mete Ci-
velek, Paul L Fox,
Lawrence L Rudel,
Aldons J Lusis,
Matthew Spite, J
Mark Brown
Robert N Helsley, 2019 LPI’s role in progression of Non- https://www.ncbi.nlm. NCBI Gene
Venkateshwari Var- Alcoholic Fatty Liver Disease nih.gov/geo/query/acc. Expression Omnibus,
adharajan, Amanda (NAFLD) and Non-Alcoholic cgi?acc=GSE138946 GSE138946
L Brown, Anthony D Steatohepatitis (NASH)
Gromovsky, Rebec-
ca C Schugar,
Iyappan Ramachan-
diran, Kevin Fung,
Mohammad Nasser
Kabbany, Rakhee
Banerjee, Chase
Neumann, Chelsea
Finney, Preeti
Pathak, Danny Or-
abi, Lucas J Os-
born, William
Massey, Renliang
Zhang, Anagha Ka-
dam, Brian E Sans-
bury, Calvin Pan,
Jessica Sacks, Ri-
chard G Lee, Ro-
sanne M Crooke,
Mark J Graham,
Madeleine E Le-
mieux, Valentin
Gogonea, John P
Kirwan, Daniela S
Allende, Mete Ci-
velek, Paul L Fox,
Lawrence L Rudel,
Aldons J Lusis,
Matthew Spite, J
Mark Brown
References
Anderson KE, Kielkowska A, Durrant TN, Juvin V, Clark J, Stephens LR, Hawkins PT. 2013.
Lysophosphatidylinositol-acyltransferase-1 (LPIAT1) is required to maintain physiological levels of PtdIns and
PtdInsP(2) in the mouse. PLOS ONE 8:e58425. DOI: https://doi.org/10.1371/journal.pone.0058425,
PMID: 23472195

BasuRay S, Smagris E, Cohen JC, Hobbs HH. 2017. The PNPLA3 variant associated with fatty liver disease
(I148M) accumulates on lipid droplets by evading ubiquitylation. Hepatology 66:1111–1124. DOI: https://doi.
org/10.1002/hep.29273, PMID: 28520213
BasuRay S, Wang Y, Smagris E, Cohen JC, Hobbs HH. 2019. Accumulation of PNPLA3 on lipid droplets is the
basis of associated hepatic steatosis. PNAS 116:9521–9526. DOI: https://doi.org/10.1073/pnas.1901974116,
PMID: 31019090
Brasaemle DL, Rubin B, Harten IA, Gruia-Gray J, Kimmel AR, Londos C. 2000. Perilipin A increases triacylglycerol
storage by decreasing the rate of triacylglycerol hydrolysis. Journal of Biological Chemistry 275:38486–38493.
DOI: https://doi.org/10.1074/jbc.M007322200, PMID: 10948207
Brown JM, Boysen MS, Jensen SS, Morrison RF, Storkson J, Lea-Currie R, Pariza M, Mandrup S, McIntosh MK.
2003. Isomer-specific regulation of metabolism and PPARgamma signaling by CLA in human preadipocytes.
Journal of Lipid Research 44:1287–1300. DOI: https://doi.org/10.1194/jlr.M300001-JLR200, PMID: 12730300
Brown JM, Chung S, Sawyer JK, Degirolamo C, Alger HM, Nguyen T, Zhu X, Duong MN, Wibley AL, Shah R,
Davis MA, Kelley K, Wilson MD, Kent C, Parks JS, Rudel LL. 2008a. Inhibition of stearoyl-coenzyme A
desaturase 1 dissociates insulin resistance and obesity from atherosclerosis. Circulation 118:1467–1475.
DOI: https://doi.org/10.1161/CIRCULATIONAHA.108.793182, PMID: 18794388
Brown JM, Bell TA, Alger HM, Sawyer JK, Smith TL, Kelley K, Shah R, Wilson MD, Davis MA, Lee RG, Graham
MJ, Crooke RM, Rudel LL. 2008b. Targeted depletion of hepatic ACAT2-driven cholesterol esterification
reveals a non-biliary route for fecal neutral sterol loss. Journal of Biological Chemistry 283:10522–10534.
DOI: https://doi.org/10.1074/jbc.M707659200, PMID: 18281279
Brown JM, Betters JL, Lord C, Ma Y, Han X, Yang K, Alger HM, Melchior J, Sawyer J, Shah R, Wilson MD, Liu X,
Graham MJ, Lee R, Crooke R, Shulman GI, Xue B, Shi H, Yu L. 2010. CGI-58 knockdown in mice causes hepatic
steatosis but prevents diet-induced obesity and glucose intolerance. Journal of Lipid Research 51:3306–3315.
DOI: https://doi.org/10.1194/jlr.M010256
Buch S, Stickel F, Trépo E, Way M, Herrmann A, Nischalke HD, Brosch M, Rosendahl J, Berg T, Ridinger M,
Rietschel M, McQuillin A, Frank J, Kiefer F, Schreiber S, Lieb W, Soyka M, Semmo N, Aigner E, Datz C, et al.
2015. A genome-wide association study confirms PNPLA3 and identifies TM6SF2 and MBOAT7 as risk loci for
alcohol-related cirrhosis. Nature Genetics 47:1443–1448. DOI: https://doi.org/10.1038/ng.3417, PMID: 26482
880
Cohen JC, Horton JD, Hobbs HH. 2011. Human fatty liver disease: old questions and new insights. Science 332:
1519–1523. DOI: https://doi.org/10.1126/science.1204265, PMID: 21700865
Crooke RM, Graham MJ, Lemonidis KM, Whipple CP, Koo S, Perera RJ. 2005. An apolipoprotein B antisense
oligonucleotide lowers LDL cholesterol in hyperlipidemic mice without causing hepatic steatosis. Journal of
Lipid Research 46:872–884. DOI: https://doi.org/10.1194/jlr.M400492-JLR200, PMID: 15716585
Dalli J, Colas RA, Walker ME, Serhan CN. 2018. Lipid mediator metabolomics via LC-MS/MS profiling and
analysis. Methods in Molecular Biology 1730:59–72. DOI: https://doi.org/10.1007/978-1-4939-7592-1_4,
PMID: 29363065
Darnell JC, Osterman DG, Saltiel AR. 1991. Synthesis of phosphatidylinositol in rat liver microsomes is
accompanied by the rapid formation of lysophosphatidylinositol. Biochimica Et Biophysica Acta (BBA) - Lipids
and Lipid Metabolism 1084:269–278. DOI: https://doi.org/10.1016/0005-2760(91)90069-T
Darnell JC, Saltiel AR. 1991. Coenzyme A-dependent, ATP-independent acylation of 2-acyl
lysophosphatidylinositol in rat liver microsomes. Biochimica Et Biophysica Acta (BBA) - Lipids and Lipid
Metabolism 1084:292–299. DOI: https://doi.org/10.1016/0005-2760(91)90071-O
Dennis EA, Norris PC. 2015. Eicosanoid storm in infection and inflammation. Nature Reviews Immunology 15:
511–523. DOI: https://doi.org/10.1038/nri3859, PMID: 26139350
Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. 2013. STAR:
ultrafast universal RNA-seq aligner. Bioinformatics 29:15–21. DOI: https://doi.org/10.1093/bioinformatics/
bts635, PMID: 23104886
Ferguson D, Zhang J, Davis MA, Helsley RN, Vedin LL, Lee RG, Crooke RM, Graham MJ, Allende DS, Parini P,
Brown JM. 2017. The lipid droplet-associated protein perilipin 3 facilitates hepatitis C virus-driven hepatic
steatosis. Journal of Lipid Research 58:420–432. DOI: https://doi.org/10.1194/jlr.M073734, PMID: 27941027
Ghazalpour A, Rau CD, Farber CR, Bennett BJ, Orozco LD, van Nas A, Pan C, Allayee H, Beaven SW, Civelek M,
Davis RC, Drake TA, Friedman RA, Furlotte N, Hui ST, Jentsch JD, Kostem E, Kang HM, Kang EY, Joo JW, et al.
2012. Hybrid mouse diversity panel: a panel of inbred mouse strains suitable for analysis of complex genetic
traits. Mammalian Genome 23:680–692. DOI: https://doi.org/10.1007/s00335-012-9411-5, PMID: 22892838
Gijón MA, Riekhof WR, Zarini S, Murphy RC, Voelker DR. 2008. Lysophospholipid acyltransferases and
arachidonate recycling in human neutrophils. Journal of Biological Chemistry 283:30235–30245. DOI: https://
doi.org/10.1074/jbc.M806194200, PMID: 18772128
Gromovsky AD, Schugar RC, Brown AL, Helsley RN, Burrows AC, Ferguson D, Zhang R, Sansbury BE, Lee RG,
Morton RE, Allende DS, Parks JS, Spite M, Brown JM. 2018. D-5 fatty acid desaturase FADS1 Impacts
Metabolic Disease by Balancing Proinflammatory and Proresolving Lipid Mediators. Arteriosclerosis,
Thrombosis, and Vascular Biology 38:218–231. DOI: https://doi.org/10.1161/ATVBAHA.117.309660, PMID: 2
9074585
Guo Y, Walther TC, Rao M, Stuurman N, Goshima G, Terayama K, Wong JS, Vale RD, Walter P, Farese RV. 2008.
Functional genomic screen reveals genes involved in lipid-droplet formation and utilization. Nature 453:657–
661. DOI: https://doi.org/10.1038/nature06928, PMID: 18408709

Harayama T, Eto M, Shindou H, Kita Y, Otsubo E, Hishikawa D, Ishii S, Sakimura K, Mishina M, Shimizu T. 2014.
Lysophospholipid acyltransferases mediate phosphatidylcholine diversification to achieve the physical
properties required in vivo. Cell Metabolism 20:295–305. DOI: https://doi.org/10.1016/j.cmet.2014.05.019,
PMID: 24981836
Helsley RN, Sui Y, Park SH, Liu Z, Lee RG, Zhu B, Kern PA, Zhou C. 2016. Targeting ikb kinase b in adipocyte
lineage cells for treatment of obesity and metabolic dysfunctions. Stem Cells 34:1883–1895. DOI: https://doi.
org/10.1002/stem.2358, PMID: 26991836
Hess CN, Low Wang CC, Hiatt WR. 2018. PCSK9 inhibitors: mechanisms of action, metabolic effects, and clinical
outcomes. Annual Review of Medicine 69:133–145. DOI: https://doi.org/10.1146/annurev-med-042716-091351,
PMID: 29095667
Huang DW, Sherman BT, Lempicki RA. 2009. Systematic and integrative analysis of large gene lists using DAVID
bioinformatics resources. Nature Protocols 4:44–57. DOI: https://doi.org/10.1038/nprot.2008.211
International Liver Disease Genetics Consortium, Thabet K, Asimakopoulos A, Shojaei M, Romero-Gomez M,
Mangia A, Irving WL, Berg T, Dore GJ, Grønbæk H, Sheridan D, Abate ML, Bugianesi E, Weltman M, Mollison
L, Cheng W, Riordan S, Fischer J, Spengler U, Nattermann J, Wahid A, et al. 2016. MBOAT7 rs641738
increases risk of liver inflammation and transition to fibrosis in chronic hepatitis C. Nature Communications 7:
12657. DOI: https://doi.org/10.1038/ncomms12757, PMID: 27630043
Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudat F, Denk H, Desmet V, Korb G, MacSween RN. 1995.
Histological grading and staging of chronic hepatitis. Journal of Hepatology 22:696–699. DOI: https://doi.org/
10.1016/0168-8278(95)80226-6, PMID: 7560864
Izem L, Morton RE. 2009. Molecular cloning of hamster lipid transfer inhibitor protein (apolipoprotein F) and
regulation of its expression by hyperlipidemia. Journal of Lipid Research 50:676–684. DOI: https://doi.org/10.
1194/jlr.M800429-JLR200, PMID: 19008550
Jackson SK, Parton J. 2004. Lysophospholipid acyltransferases in monocyte inflammatory responses and sepsis.
Immunobiology 209:31–38. DOI: https://doi.org/10.1016/j.imbio.2004.04.006
Kolde R. 2015. pheatma: Pretty Heatmaps. R Package Version. http://CRAN.R-project.org/package=pheatmap
Krahmer N, Guo Y, Wilfling F, Hilger M, Lingrell S, Heger K, Newman HW, Schmidt-Supprian M, Vance DE,
Mann M, Farese RV, Walther TC. 2011. Phosphatidylcholine synthesis for lipid droplet expansion is mediated
by localized activation of CTP:phosphocholine cytidylyltransferase. Cell Metabolism 14:504–515. DOI: https://
doi.org/10.1016/j.cmet.2011.07.013, PMID: 21982710
Krawczyk M, Rau M, Schattenberg JM, Bantel H, Pathil A, Demir M, Kluwe J, Boettler T, Lammert F, Geier A,
NAFLD Clinical Study Group. 2017. Combined effects of the PNPLA3 rs738409, TM6SF2 rs58542926, and
MBOAT7 rs641738 variants on NAFLD severity: a multicenter biopsy-based study. Journal of Lipid Research 58:
247–255. DOI: https://doi.org/10.1194/jlr.P067454, PMID: 27836992
Lee HC, Inoue T, Sasaki J, Kubo T, Matsuda S, Nakasaki Y, Hattori M, Tanaka F, Udagawa O, Kono N, Itoh T,
Ogiso H, Taguchi R, Arita M, Sasaki T, Arai H. 2012. LPIAT1 regulates arachidonic acid content in
Phosphatidylinositol and is required for cortical lamination in mice. Molecular Biology of the Cell 23:4689–4700.
DOI: https://doi.org/10.1091/mbc.e12-09-0673, PMID: 23097495
Lord CC, Ferguson D, Thomas G, Brown AL, Schugar RC, Burrows A, Gromovsky AD, Betters J, Neumann C,
Sacks J, Marshall S, Watts R, Schweiger M, Lee RG, Crooke RM, Graham MJ, Lathia JD, Sakaguchi TF, Lehner
R, Haemmerle G, et al. 2016. Regulation of hepatic triacylglycerol metabolism by CGI-58 does not require
ATGL Co-activation. Cell Reports 16:939–949. DOI: https://doi.org/10.1016/j.celrep.2016.06.049, PMID: 273
96333
Luukkonen PK, Zhou Y, Hyötyläinen T, Leivonen M, Arola J, Orho-Melander M, Orešič M, Yki-Järvinen H. 2016.
The MBOAT7 variant rs641738 alters hepatic phosphatidylinositols and increases severity of non-alcoholic fatty
liver disease in humans. Journal of Hepatology 65:1263–1265. DOI: https://doi.org/10.1016/j.jhep.2016.07.045,
PMID: 27520876
Machado MV, Diehl AM. 2016. Pathogenesis of nonalcoholic steatohepatitis. Gastroenterology 150:1769–1777.
DOI: https://doi.org/10.1053/j.gastro.2016.02.066, PMID: 26928243
Mancina RM, Dongiovanni P, Petta S, Pingitore P, Meroni M, Rametta R, Borén J, Montalcini T, Pujia A, Wiklund
O, Hindy G, Spagnuolo R, Motta BM, Pipitone RM, Craxı̀ A, Fargion S, Nobili V, Käkelä P, Kärjä V, Männistö V,
et al. 2016. The MBOAT7-TMC4 variant rs641738 increases risk of nonalcoholic fatty liver disease in individuals
of european descent. Gastroenterology 150:1219–1230. DOI: https://doi.org/10.1053/j.gastro.2016.01.032,
PMID: 26850495
Metz SA. 1986. Lysophosphatidylinositol, but not lysophosphatidic acid, stimulates insulin release. Biochemical
and Biophysical Research Communications 138:720–727. DOI: https://doi.org/10.1016/S0006-291X(86)80556-3
Metz SA. 1988. Mobilization of cellular Ca2+ by lysophospholipids in rat islets of langerhans. Biochimica Et
Biophysica Acta (BBA) - Molecular Cell Research 968:239–252. DOI: https://doi.org/10.1016/0167-4889(88)
90013-4
Mitsche MA, Hobbs HH, Cohen JC. 2018. Patatin-like phospholipase domain–containing protein 3 promotes
transfer of essential fatty acids from triglycerides to phospholipids in hepatic lipid droplets. Journal of
Biological Chemistry 293:6958–6968. DOI: https://doi.org/10.1074/jbc.RA118.002333, PMID: 29555681
Parks BW, Nam E, Org E, Kostem E, Norheim F, Hui ST, Pan C, Civelek M, Rau CD, Bennett BJ, Mehrabian M,
Ursell LK, He A, Castellani LW, Zinker B, Kirby M, Drake TA, Drevon CA, Knight R, Gargalovic P, et al. 2013.
Genetic control of obesity and gut Microbiota composition in response to high-fat, high-sucrose diet in mice.
Cell Metabolism 17:141–152. DOI: https://doi.org/10.1016/j.cmet.2012.12.007, PMID: 23312289

R Development Core Team. 2015. R: A Language and Environment for Statistical Computing. R Foundation for
Statistical Computing. Vienna, Austria: http://www.r-project.org
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9
system. Nature Protocols 8:2281–2308. DOI: https://doi.org/10.1038/nprot.2013.143, PMID: 24157548
Rinella ME, Sanyal AJ. 2016. Management of NAFLD: a stage-based approach. Nature Reviews
Gastroenterology & Hepatology 13:196–205. DOI: https://doi.org/10.1038/nrgastro.2016.3, PMID: 26907882
Robinson MD, McCarthy DJ, Smyth GK. 2010. edgeR: a bioconductor package for differential expression analysis
of digital gene expression data. Bioinformatics 26:139–140. DOI: https://doi.org/10.1093/bioinformatics/
btp616, PMID: 19910308
Rong X, Albert CJ, Hong C, Duerr MA, Chamberlain BT, Tarling EJ, Ito A, Gao J, Wang B, Edwards PA, Jung
ME, Ford DA, Tontonoz P. 2013. LXRs regulate ER stress and inflammation through dynamic modulation of
membrane phospholipid composition. Cell Metabolism 18:685–697. DOI: https://doi.org/10.1016/j.cmet.2013.
10.002, PMID: 24206663
Samuel VT, Shulman GI. 2018. Nonalcoholic fatty liver disease as a nexus of metabolic and hepatic diseases. Cell
Metabolism 27:22–41. DOI: https://doi.org/10.1016/j.cmet.2017.08.002, PMID: 28867301
Schugar RC, Shih DM, Warrier M, Helsley RN, Burrows A, Ferguson D, Brown AL, Gromovsky AD, Heine M,
Chatterjee A, Li L, Li XS, Wang Z, Willard B, Meng Y, Kim H, Che N, Pan C, Lee RG, Crooke RM, et al. 2017.
The TMAO-Producing enzyme Flavin-Containing monooxygenase 3 regulates obesity and the beiging of white
adipose tissue. Cell Reports 19:2451–2461. DOI: https://doi.org/10.1016/j.celrep.2017.05.077, PMID: 28636
934
Serhan CN, Chiang N, Dalli J, Levy BD. 2015. Lipid mediators in the resolution of inflammation. Cold Spring
Harbor Perspectives in Biology 7:a016311. DOI: https://doi.org/10.1101/cshperspect.a016311
Shindou H, Hishikawa D, Harayama T, Yuki K, Shimizu T. 2009. Recent progress on acyl CoA: lysophospholipid
acyltransferase research. Journal of Lipid Research 50:S46–S51. DOI: https://doi.org/10.1194/jlr.R800035-
JLR200
Shindou H, Shimizu T. 2009. Acyl-CoA:lysophospholipid acyltransferases. Journal of Biological Chemistry 284:1–
5. DOI: https://doi.org/10.1074/jbc.R800046200, PMID: 18718904
Shores NJ, Link K, Fernandez A, Geisinger KR, Davis M, Nguyen T, Sawyer J, Rudel L. 2011. Non-contrasted
computed tomography for the accurate measurement of liver steatosis in obese patients. Digestive Diseases
and Sciences 56:2145–2151. DOI: https://doi.org/10.1007/s10620-011-1602-5, PMID: 21318585
Thabet K, Chan HLY, Petta S, Mangia A, Berg T, Boonstra A, Brouwer WP, Abate ML, Wong VW, Nazmy M,
Fischer J, Liddle C, George J, Eslam M. 2017. The membrane-bound O-acyltransferase domain-containing 7
variant rs641738 increases inflammation and fibrosis in chronic hepatitis B. Hepatology 65:1840–1850.
DOI: https://doi.org/10.1002/hep.29064, PMID: 28109005
Thomas S, Bonchev D. 2010. A survey of current software for network analysis in molecular biology. Human
Genomics 4:353–360. DOI: https://doi.org/10.1186/1479-7364-4-5-353, PMID: 20650822
Unger RH, Scherer PE. 2010. Gluttony, sloth and the metabolic syndrome: a roadmap to lipotoxicity. Trends in
Endocrinology & Metabolism 21:345–352. DOI: https://doi.org/10.1016/j.tem.2010.01.009, PMID: 20223680
Viitasalo A, Eloranta A-M, Atalay M, Romeo S, Pihlajamäki J, Lakka TA. 2016. Association of MBOAT7 gene
variant with plasma ALT levels in children: the PANIC study. Pediatric Research 80:651–655. DOI: https://doi.
org/10.1038/pr.2016.139
Wang Y, Kory N, BasuRay S, Cohen JC, Hobbs HH. 2019. PNPLA3, CGI-58, and inhibition of hepatic triglyceride
hydrolysis in mice. Hepatology 69:2427–2441. DOI: https://doi.org/10.1002/hep.30583, PMID: 30802989
Warrier M, Shih DM, Burrows AC, Ferguson D, Gromovsky AD, Brown AL, Marshall S, McDaniel A, Schugar RC,
Wang Z, Sacks J, Rong X, Vallim TA, Chou J, Ivanova PT, Myers DS, Brown HA, Lee RG, Crooke RM, Graham
MJ, et al. 2015. The TMAO-Generating enzyme flavin monooxygenase 3 is a central regulator of cholesterol
balance. Cell Reports 10:326–338. DOI: https://doi.org/10.1016/j.celrep.2014.12.036, PMID: 25600868
Wilfling F, Wang H, Haas JT, Krahmer N, Gould TJ, Uchida A, Cheng J-X, Graham M, Christiano R, Fröhlich F,
Liu X, Buhman KK, Coleman RA, Bewersdorf J, Farese RV, Walther TC. 2013. Triacylglycerol synthesis enzymes
mediate lipid droplet growth by relocalizing from the ER to lipid droplets. Developmental Cell 24:384–399.
DOI: https://doi.org/10.1016/j.devcel.2013.01.013
Wree A, Broderick L, Canbay A, Hoffman HM, Feldstein AE. 2013. From NAFLD to NASH to cirrhosis-new
insights into disease mechanisms. Nature Reviews Gastroenterology & Hepatology 10:627–636. DOI: https://
doi.org/10.1038/nrgastro.2013.149, PMID: 23958599
Younossi Z, Anstee QM, Marietti M, Hardy T, Henry L, Eslam M, George J, Bugianesi E. 2018. Global burden of
NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology &
Hepatology 15:11–20. DOI: https://doi.org/10.1038/nrgastro.2017.109, PMID: 28930295
Zarini S, Hankin JA, Murphy RC, Gijón MA. 2014. Lysophospholipid acyltransferases and eicosanoid biosynthesis
in zebrafish myeloid cells. Prostaglandins & Other Lipid Mediators 113-115:52–61. DOI: https://doi.org/10.
1016/j.prostaglandins.2014.08.003, PMID: 25175316

Elife 49882 v2

Uploaded by

Copyright:

Available Formats

Elife 49882 v2

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Elife 49882 v2

Uploaded by

Copyright:

Available Formats

RESEARCH ARTICLE

Obesity-linked suppression of membrane-

Received: 03 July 2019

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 1 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 2 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 3 of 36

Mboat7 loss of function in mice is sufficient to promote NAFLD

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 4 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 5 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 6 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 7 of 36

Genetic deletion of Tmc4 does not result in hepatic steatosis

Mboat7 knockdown promotes profound hyperinsulinemia and impairs

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 8 of 36

ASO-mediated knockdown of Mboat7 results in tissue-specific

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 9 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 10 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 11 of 36

LPI lipids increase hepatic inflammatory and fibrotic gene expression in

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 12 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 13 of 36

Steatosis Seen with Mboat7 Knockdown is Associated with

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 14 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 15 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 16 of 36

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 17 of 36

Materials and methods

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 18 of 36

Reagent type Additional

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 19 of 36

Reagent type Additional

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 20 of 36

Reagent type Additional

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 21 of 36

Reagent type Additional

Human MBOAT7 expression levels in lean and obese subjects

Rat studies of diet-induced obesity

Hybrid Mouse Diversity Panel

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 22 of 36

Mouse studies of Mboat7 loss of function

Studies in global Tmc4 knockout mice

Standardized necropsy conditions

Plasma ALT and AST analysis

In vivo measurement of adiposity and lean mass

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 23 of 36

Isolation and characterization of lipid droplets from mouse liver

Quantitation of phosphatidylinositol (PI) and lysophosphatidylinositol

Shotgun lipidomics to examine alterations in major phospholipid

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 24 of 36

Identification and quantification of AA-Derived lipid mediators by LC-

RNA sequencing and analysis

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 25 of 36

Glucose and insulin tolerance tests

Plasma lipid and lipoprotein analyses

In vivo insulin signaling studies

Measurement of hepatic Very Low Density Lipoprotein (VLDL)

General biochemical plasma and hepatic lipid analysis

Lysophosphatidylinositol acyltransferase biochemical assay

Helsley et al. eLife 2019;8:e49882. DOI: https://doi.org/10.7554/eLife.49882 26 of 36