Edge RUsers Guide
Edge RUsers Guide
User’s Guide
Yunshun Chen 1,2 , Davis McCarthy 3,4 , Pedro Baldoni 1,2 , Matthew
Ritchie 1,2 , Mark Robinson 5 , and Gordon Smyth 1,6
1
Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia
2
Department of Medical Biology, University of Melbourne, Victoria, Australia
3
St Vincent’s Institute of Medical Research, Fitzroy, Victoria, Australia
4
Melbourne Integrative Genomics, University of Melbourne, Victoria, Australia
5
Institute of Molecular Life Sciences and SIB Swiss Institute of Bioinformatics, University of
Zurich, Zurich, Switzerland
6
School of Mathematics and Statistics, University of Melbourne, Victoria, Australia
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
1.1 Scope . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
1.2 Citation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
2 Overview of capabilities . . . . . . . . . . . . . . . . . . . . . . 12
2.1 Terminology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2.7 Filtering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2.8 Normalization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
2.8.1 Normalization is only necessary for sample-specific effects . . . . 15
2.8.2 Sequencing depth . . . . . . . . . . . . . . . . . . . . . . . . 15
2.8.3 Effective library sizes . . . . . . . . . . . . . . . . . . . . . . . 16
2.8.4 GC content . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.8.5 Gene length . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.8.6 Model-based normalization, not transformation . . . . . . . . . . 17
2.8.7 Pseudo-counts . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2
edgeR User’s Guide
3.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
3
edgeR User’s Guide
4 Case studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
4
edgeR User’s Guide
5
edgeR User’s Guide
6
edgeR User’s Guide
7
Chapter 1
Introduction
1.1 Scope
This guide provides an overview of the Bioconductor package edgeR for differential expres-
sion analyses of read counts arising from RNA-Seq, SAGE or similar technologies [38]. The
package can be applied to any technology that produces read counts for genomic features.
Of particular interest are summaries of short reads from massively parallel sequencing tech-
nologies such as Illumina™, 454 or ABI SOLiD applied to RNA-Seq, SAGE-Seq or ChIP-Seq
experiments, pooled shRNA-seq or CRISPR-Cas9 genetic screens and bisulfite sequencing
for DNA methylation studies. edgeR provides statistical routines for assessing differential
expression in RNA-Seq experiments or differential marking in ChIP-Seq experiments.
The package implements exact statistical methods for multigroup experiments developed by
Robinson and Smyth [40, 41]. It also implements statistical methods based on generalized
linear models (glms), suitable for multifactor experiments of any complexity, developed by
McCarthy et al. [29], Lund et al. [27], Chen et al. [2] and Lun et al. [26]. Sometimes we
refer to the former exact methods as classic edgeR, and the latter as glm edgeR. However
the two sets of methods are complementary and can often be combined in the course of a
data analysis. Most of the glm functions can be identified by the letters “glm” as part of the
function name. The glm functions can test for differential expression using either likelihood
ratio tests[29, 2] or quasi-likelihood F-tests [27, 26].
A particular feature of edgeR functionality, both classic and glm, are empirical Bayes methods
that permit the estimation of gene-specific biological variation, even for experiments with
minimal levels of biological replication.
edgeR can be applied to differential expression at the gene, exon, transcript or tag level. In
fact, read counts can be summarized by any genomic feature. edgeR analyses at the exon level
are easily extended to detect differential splicing or isoform-specific differential expression.
This guide begins with brief overview of some of the key capabilities of package, and then
gives a number of fully worked case studies, from counts to lists of genes.
1.2 Citation
The edgeR package implements statistical methods from the following publications.
8
edgeR User’s Guide
Robinson, MD, and Smyth, GK (2008). Small sample estimation of negative binomial dis-
persion, with applications to SAGE data. Biostatistics 9, 321–332.
Proposed the idea of sharing information between genes by estimating the negative
binomial variance parameter globally across all genes. This made the use of negative
binomial models practical for RNA-Seq and SAGE experiments with small to moderate
numbers of replicates. Introduced the terminology dispersion for the variance parame-
ter. Proposed conditional maximum likelihood for estimating the dispersion, assuming
common dispersion across all genes. Developed an exact test for differential expression
appropriate for the negative binomially distributed counts. Despite the official publica-
tion date, this was the first of the papers to be submitted and accepted for publication.
Robinson, MD, and Smyth, GK (2007). Moderated statistical tests for assessing differences
in tag abundance. Bioinformatics 23, 2881–2887.
Introduced empirical Bayes moderated dispersion parameter estimation. This is a crucial
improvement on the previous idea of estimating the dispersions from a global model, be-
cause it permits gene-specific dispersion estimation to be reliable even for small samples.
Gene-specific dispersion estimation is necessary so that genes that behave consistently
across replicates should rank more highly than genes that do not.
Robinson, MD, McCarthy, DJ, Smyth, GK (2010). edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140.
Announcement of the edgeR software package. Introduced the terminology coefficient
of biological variation.
Robinson, MD, and Oshlack, A (2010). A scaling normalization method for differential
expression analysis of RNA-seq data. Genome Biology 11, R25.
Introduced the idea of model-based library size normalization (aka “scale normaliza-
tion”) for RNA-Seq data. Proposed the TMM normalization method.
McCarthy, DJ, Chen, Y, Smyth, GK (2012). Differential expression analysis of multifactor
RNA-Seq experiments with respect to biological variation. Nucleic Acids Research 40, 4288-
4297.
Extended negative binomial differential expression methods to glms, making the meth-
ods applicable to general experiments. Introduced the use of Cox-Reid approximate
conditional maximum likelihood for estimating the dispersion parameters, and used this
for empirical Bayes moderation. Developed fast algorithms for fitting glms to thousands
of genes in parallel. Gives a more complete explanation of the concept of biological co-
efficient of variation.
Lun, ATL, Chen, Y, and Smyth, GK (2016). It’s DE-licious: a recipe for differential expres-
sion analyses of RNA-seq experiments using quasi-likelihood methods in edgeR. Methods in
Molecular Biology 1418, 391–416.
This book chapter explains the glmQLFit and glmQLFTest functions, which are alterna-
tives to glmFit and glmLRT. They replace the chisquare approximation to the likelihood
ratio statistic with a quasi-likelihood F-test, resulting in more conservative and rigorous
type I error rate control.
Chen, Y, Lun, ATL, and Smyth, GK (2014). Differential expression analysis of complex
RNA-seq experiments using edgeR. In: Statistical Analysis of Next Generation Sequence
Data, Somnath Datta and Daniel S Nettleton (eds), Springer, New York.
This book chapter explains the estimateDisp function and the weighted likelihood em-
pirical Bayes method.
9
edgeR User’s Guide
Chen, Y, Lun, ATL, and Smyth, GK (2016). From reads to genes to pathways: differential
expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood
pipeline. F1000Research 5, 1438.
This paper describes a complete workflow of differential expression and pathway analysis
using the edgeR quasi-likelihood pipeline.
Chen, Y, Pal, B, Visvader, JE, and Smyth, GK (2017). Differential methylation analysis
of reduced representation bisulfite sequencing experiments using edgeR. F1000Research 6,
2055.
This paper explains a novel approach of detecting differentially methylated regions
(DMRs) of reduced representation bisulfite sequencing (RRBS) experiments using edgeR.
10
edgeR User’s Guide
11
Chapter 2
Overview of capabilities
2.1 Terminology
edgeR performs differential abundance analysis for pre-defined genomic features. Although
not strictly necessary, it usually desirable that these genomic features are non-overlapping.
For simplicity, we will hence-forth refer to the genomic features as “genes”, although they
could in principle be transcripts, exons, general genomic intervals or some other type of
feature. For ChIP-seq experiments, abundance might relate to transcription factor binding
or to histone mark occupancy, but we will henceforth refer to abundance as in terms of gene
expression. In other words, the remainder of this guide will use terminology as for a gene-level
analysis of an RNA-seq experiment, although the methodology is more widely applicable than
that.
12
edgeR User’s Guide
Reads can be counted in a number of ways. When conducting gene-level analyses, the counts
could be for reads mapping anywhere in the genomic span of the gene or the counts could be
for exons only. We usually count reads that overlap any exon for the given gene, including
the UTR as part of the first exon [24].
For data from pooled shRNA-seq or CRISPR-Cas9 genetic screens, the processAmplicons
function [9] can be used to obtain counts directly from FASTQ files.
Note that edgeR is designed to work with actual read counts. We not recommend that
predicted transcript abundances are input the edgeR in place of actual counts.
13
edgeR User’s Guide
The main components of an DGEList object are a matrix counts containing the integer counts,
a data.frame samples containing information about the samples or libraries, and a optional
data.frame genes containing annotation for the genes or genomic features. The data.frame
samples contains a column lib.size for the library size or sequencing depth for each sample.
If not specified by the user, the library sizes will be computed from the column sums of
the counts. For classic edgeR the data.frame samples must also contain a column group,
identifying the group membership of each sample.
2.7 Filtering
Genes with very low counts across all libraries provide little evidence for differential expression.
In the biological point of view, a gene must be expressed at some minimal level before it is likely
to be translated into a protein or to be biologically important. In addition, the pronounced
discreteness of these counts interferes with some of the statistical approximations that are
used later in the pipeline. These genes should be filtered out prior to further analysis.
As a rule of thumb, genes are dropped if they can’t possibly be expressed in all the samples
for any of the conditions. Users can set their own definition of genes being expressed. Usually
a gene is required to have a count of 5-10 in a library to be considered expressed in that
library. Users should also filter with count-per-million (CPM) rather than filtering on the
counts directly, as the latter does not account for differences in library sizes between samples.
Here is a simple example. Suppose the sample information of a DGEList object y is shown as
follows:
> y$samples
The filterByExpr function keeps rows that have worthwhile counts in a minumum number
of samples (two samples in this case because the smallest group size is two). The function
accesses the group factor contained in y in order to compute the minimum group size, but
the filtering is performed independently of which sample belongs to which group so that no
bias is introduced. It is recommended to recalculate the library sizes of the DGEList object
after the filtering, although the downstream analysis is robust to whether this is done or not.
The group factor or the experimental design matrix can also be given directly to the filterBy
Expr function by
> keep <- filterByExpr(y, group=group)
if not already set in the DGEList object. More generally, filterByExpr can be used with any
design matrix:
14
edgeR User’s Guide
In this form, the design matrix can be completely general, even including continuous covari-
ates.
The filtering should be based on the grouping factors or treatment factors that will be involved
in the differential expression teststested for, rather than on blocking variables that are not
of scientific interest in themselves. For example, consider a paired comparison experiment in
which the same treatment regimes applied to each of a number of subjects or patients:
> design <- model.matrix(~ Patient + Treatment)
In this design, Patient is included in the design matrix to correct for baseline differences
between the Patients, but we will not be testing for differential expression between the
Patients. The filtering should therefore be based soley Treatment rather than on Patient, i.e.,
rather than
> keep <- filterByExpr(y, design)
2.8 Normalization
2.8.1 Normalization is only necessary for sample-specific effects
edgeR is concerned with differential expression analysis rather than with the quantification of
expression levels. It is concerned with relative changes in expression levels between conditions,
but not directly with estimating absolute expression levels. This greatly simplifies the technical
influences that need to be taken into account, because any technical factor that is unrelated
to the experimental conditions should cancel out of any differential expression analysis. For
example, read counts can generally be expected to be proportional to length as well as to
expression for any transcript, but edgeR does not generally need to adjust for gene length
because gene length has the same relative influence on the read counts for each RNA sample.
For this reason, normalization issues arise only to the extent that technical factors have
sample-specific effects.
15
edgeR User’s Guide
The set of all normalization factors for a DGEList multiply to unity, ensuring that the geomet-
ric mean of the effective library sizes is the same as the geometric mean of the original library
sizes. A normalization factor below one indicates that a small number of high count genes
are monopolizing the sequencing, causing the counts for other genes to be lower than would
be usual given the library size. As a result, the library size will be scaled down, analogous
to scaling the counts upwards in that library. Conversely, a factor above one scales up the
library size, analogous to downscaling the counts.
2.8.4 GC content
The GC-content of each gene does not change from sample to sample, so it can be expected
to have little effect on differential expression analyses to a first approximation. Recent pub-
lications, however, have demonstrated that sample-specific effects for GC-content can be
detected [37, 19]. The EDASeq [37] and cqn [19] packages estimate correction factors that
adjust for sample-specific GC-content effects in a way that is compatible with edgeR. In each
case, the observation-specific correction factors can be input into the glm functions of edgeR
as an offset matrix.
16
edgeR User’s Guide
2.8.7 Pseudo-counts
The classic edgeR functions estimateCommonDisp and exactTest produce a matrix of pseudo-
counts as part of the output object. The pseudo-counts are used internally to speed up
computation of the conditional likelihood used for dispersion estimation and exact tests in the
classic edgeR pipeline. The pseudo-counts represent the equivalent counts would have been
observed had the library sizes all been equal, assuming the fitted model. The pseudo-counts
are computed for a specific purpose, and their computation depends on the experimental
design as well as the library sizes, so users are advised not to interpret the psuedo-counts as
general-purpose normalized counts. They are intended mainly for internal use in the edgeR
pipeline.
Disambiguation. Note that some other software packages use the term pseudo-count to
mean something analogous to prior counts in edgeR, i.e., a starting value that is added to a
zero count to avoid missing values when computing logarithms. In edgeR, a pseudo-count is
a type of normalized count and a prior count is a starting value used to offset small counts.
17
edgeR User’s Guide
The first term 1/µgi is the squared CV for the Poisson distribution and the second is the
squared CV of the unobserved expression values. The total CV2 therefore is the technical
CV2 with which πgi is measuredp plus the biological CV of the true πgi . In this article, we
2
call ϕg the dispersion and ϕg the biological CV although, strictly speaking, it captures
all sources of the inter-library variation between replicates, including perhaps contributions
from technical causes such as library preparation as well as true biological variation between
samples.
Two levels of variation can be distinguished in any RNA-Seq experiment. First, the relative
abundance of each gene will vary between RNA samples, due mainly to biological causes.
Second, there is measurement error, the uncertainty with which the abundance of each gene
in each sample is estimated by the sequencing technology. If aliquots of the same RNA
sample are sequenced, then the read counts for a particular gene should vary according to a
Poisson law [28]. If sequencing variation is Poisson, then it can be shown that the squared
coefficient of variation (CV) of each count between biological replicate libraries is the sum of
the squared CVs for technical and biological variation respectively,
Biological CV (BCV) is the coefficient of variation with which the (unknown) true abundance
of the gene varies between replicate RNA samples. It represents the CV that would remain
between biological replicates if sequencing depth could be increased indefinitely. The technical
18
edgeR User’s Guide
CV decreases as the size of the counts increases. BCV on the other hand does not. BCV
is therefore likely to be the dominant source of uncertainty for high-count genes, so reliable
estimation of BCV is crucial for realistic assessment of differential expression in RNA-Seq
experiments. If the abundance of each gene varies between replicate RNA samples in such
a way that the genewise standard deviations are proportional to the genewise means, a
commonly occurring property of measurements on physical quantities, then it is reasonable
to suppose that BCV is approximately constant across genes. We allow however for the
possibility that BCV might vary between genes and might also show a systematic trend with
respect to gene expression or expected count.
The magnitude of BCV is more important than the exact probabilistic law followed by the true
gene abundances. For mathematical convenience, we assume that the true gene abundances
follow a gamma distributional law between replicate RNA samples. This implies that the read
counts follow a negative binomial probability law.
19
edgeR User’s Guide
20
edgeR User’s Guide
However, the qCML method is only applicable on datasets with a single factor design since it
fails to take into account the effects from multiple factors in a more complicated experiment.
When an experiment has more than one factor involved, we need to seek a new way of
estimating dispersions.
Here is a simple example of estimating dispersions using the qCML method. Given a DGEList
object y, we estimate the dispersions using the following commands.
To estimate common dispersion and tagwise dispersions in one run (recommended):
> y <- estimateDisp(y)
Note that common dispersion needs to be estimated before estimating tagwise dispersions if
they are estimated separately.
21
edgeR User’s Guide
for each gene [29]. Here xi is a vector of covariates that specifies the treatment conditions
applied to RNA sample i, and βg is a vector of regression coefficients by which the covariate
effects are mediated for gene g. The quadratic variance function specifies the negative
binomial GLM distributional family. The use of the negative binomial distribution is equivalent
to treating the πgi as gamma distributed.
Alternatively, one can use the following calling sequence to estimate them one by one. To
estimate common dispersion:
> y <- estimateGLMCommonDisp(y, design)
Note that we need to estimate either common dispersion or trended dispersions prior to
the estimation of tagwise dispersions. When estimating tagwise dispersions, the empirical
Bayes method is applied to squeeze the tagwise dispersions towards a common dispersion or
towards trended dispersions, whichever exists. If both exist, the default is to use the trended
dispersions.
For more detailed examples, see the case study in Section 4.1 (Tuch’s data), Section 4.2
(arabidopsis data), Section 4.3 (Nigerian data) and Section 4.4 (Fu’s data).
22
edgeR User’s Guide
Given raw counts, NB dispersion(s) and a design matrix, glmQLFit() fits the negative binomial
GLM for each tag and produces an object of class DGEGLM with some new components. This
DGEGLM object can then be passed to glmQLFTest() to carry out the QL F-test. User can select
one or more coefficients to drop from the full design matrix. This gives the null model against
which the full model is compared. Tags can then be ranked in order of evidence for differential
expression, based on the p-value computed for each tag.
As a brief example, consider a situation in which are three treatment groups, each with two
replicates, and the researcher wants to make pairwise comparisons between them. A QL
model representing the study design can be fitted to the data with commands such as:
> group <- factor(c(1,1,2,2,3,3))
> design <- model.matrix(~group)
> fit <- glmQLFit(y, design)
The fit has three parameters. The first is the baseline level of group 1. The second and third
are the 2 vs 1 and 3 vs 1 differences.
To compare 2 vs 1:
> qlf.2vs1 <- glmQLFTest(fit, coef=2)
> topTags(qlf.2vs1)
To compare 3 vs 1:
> qlf.3vs1 <- glmQLFTest(fit, coef=3)
To compare 3 vs 2:
> qlf.3vs2 <- glmQLFTest(fit, contrast=c(0,-1,1))
The contrast argument in this case requests a statistical test of the null hypothesis that
coefficient3−coefficient2 is equal to zero.
To find genes different between any of the three groups:
> qlf <- glmQLFTest(fit, coef=2:3)
> topTags(qlf)
For more detailed examples, see the case study in Section 4.2 (arabidopsis data), Section 4.3
(Nigerian data) and Section 4.4 (Fu’s data).
Alternatively, one can perform likelihood ratio test to test for differential expression. The
testing can be done by using the functions glmFit() and glmLRT(). To apply the likelihood
ratio test to the above example and compare 2 vs 1:
23
edgeR User’s Guide
Note that the p-values obtained and the number of significant genes will be very sensi-
tive to the dispersion value chosen, and be aware that less well controlled datasets, with
unaccounted-for batch effects and so on, could have in reality much larger dispersions
than are suggested here. Nevertheless, choosing a nominal dispersion value may be
more realistic than ignoring biological variation entirely.
3. Remove one or more explanatory factors from the linear model in order to create
some residual degrees of freedom. Ideally, this means removing the factors that are
least important but, if there is only one factor and only two groups, this may mean
removing the entire design matrix or reducing it to a single column for the intercept.
If your experiment has several explanatory factors, you could remove the factor with
smallest fold changes. If your experiment has several treatment conditions, you could
try treating the two most similar conditions as replicates. Estimate the dispersion from
this reduced model, then insert these dispersions into the data object containing the
full design matrix, then proceed to model fitting and testing with glmFit and glmLRT.
This approach will only be successful if the number of DE genes is relatively small.
In conjunction with this reduced design matrix, you could try estimateGLMCommonDisp
with method="deviance", robust=TRUE and subset=NULL. This is our current best attempt
at an automatic method to estimate dispersion without replicates, although it will only
24
edgeR User’s Guide
give good results when the counts are not too small and the DE genes are a small
proportion of the whole. Please understand that this is only our best attempt to return
something useable. Reliable estimation of dispersion generally requires replicates.
4. If there exist a sizeable number of control transcripts that should not be DE, then the
dispersion could be estimated from them. For example, suppose that housekeeping is
an index variable identifying housekeeping genes that do not respond to the treatment
used in the experiment. First create a copy of the data object with only one treatment
group:
> y1 <- y
> y1$samples$group <- 1
Then estimate the common dispersion from the housekeeping genes and all the libraries
as one group:
> y0 <- estimateDisp(y1[housekeeping,], trend="none", tagwise=FALSE)
Then insert this into the full data object and proceed:
> y$common.dispersion <- y0$common.dispersion
> fit <- glmFit(y, design)
> lrt <- glmLRT(fit)
and so on. A reasonably large number of control transcripts is required, at least a few
dozen and ideally hundreds.
25
edgeR User’s Guide
Note that the fold-change threshold in glmTreat() is not the minimum value of the fold-change
expected to see from the testing results. Genes will need to exceed this threshold by some
way before being declared statistically significant. It is better to interpret the threshold as
“the fold-change below which we are definitely not interested in the gene" rather than “the
fold-change above which we are interested in the gene". In the presence of a huge number
of DE genes, a relatively large fold-change threshold may be appropriate to narrow down the
search to genes of interest. In the lack of DE genes, on the other hand, a small or even no
fold-change threshold shall be used.
For more detailed examples, see the case study in Section 4.4 (Fu’s data).
For more detailed examples, see the case study in Section 4.1 (Tuch’s data) and Section 4.4
(Fu’s data).
26
edgeR User’s Guide
The roast() function performs ROAST gene set tests [48]. It is a self-contained gene set
test. Given a gene set, it tests whether the majority of the genes in the set are DE across
the comparison of interest.
The mroast() function does ROAST tests for multiple sets, including adjustment for multiple
testing.
The fry() function is a fast version of mroast(). It assumes all the genes in a set have equal
variances. Since edgeR uses the z-score equivalents of NB random deviates for the gene set
tests, the above assumption is always met. Hence, fry() is recommended over roast() and
mroast() in edgeR. It gives the same result as mroast() with an infinite number of rotations.
The camera() function performs a competitive gene set test accounting for inter-gene corre-
lation. It tests whether a set of genes is highly ranked relative to other genes in terms of
differential expression [49].
The romer() function performs a gene set enrichment analysis. It implements a GSEA ap-
proach [46] based on rotation instead of permutation.
Unlike goana() and kegga(), the gene set tests are not limited to GO terms or KEGG pathways.
Any pre-defined gene set can be used, for example MSigDB gene sets. A common application
is to use a set of DE genes that was defined from an analysis of an independent data set.
For more detailed examples, see the case study in Section 4.3 (Nigerian’s data) and Section 4.4
(Fu’s data).
where y is the normalized DGEList object. This produces a matrix of log2 counts-per-million
(logCPM), with undefined values avoided and the poorly defined log-fold-changes for low
counts shrunk towards zero. Larger values for prior.count produce stronger moderation of
the values for low counts and more shrinkage of the corresponding log-fold-changes. The
logCPM values can optionally be converted to RPKM or FPKM by subtracting log2 of gene
length, see rpkm().
27
edgeR User’s Guide
28
edgeR User’s Guide
of both methylated and unmethylated CpG’s across all the samples. Extra coefficients are
added to the design matrix to represent the methylation levels and the differences of the
methylation levels betweeen groups.
See the case study in Section 4.8 (Bisulfite sequencing of mouse oocytes) for a detailed
worked example of a differential methylation analysis. Another example workflow is given by
Chen et al [4].
29
Chapter 3
3.1 Introduction
In this chapter, we outline the principles for setting up the design matrix and forming contrasts
for some typical experimental designs.
Throughout this chapter we will assume that the read alignment, normalization and dispersion
estimation steps described in the previous chapter have already been completed. We will
assume that a DGEList object y has been created containing the read counts, library sizes,
normalization factors and dispersion estimates.
Note that it is not necessary to have multiple replicates for all the conditions, although it
is usually desirable to do so. By default, the conditions will be listed in alphabetical order,
regardless of the order that the data were read:
> levels(y$samples$group)
30
edgeR User’s Guide
for C vs A, or
> et <- exactTest(y, pair=c("C","B"))
for B vs C.
Alternatively, the conditions to be compared can be specified by number, so that
> et <- exactTest(y, pair=c(3,2))
is equivalent to pair=c("C","B"), given that the second and third levels of group are B and C
respectively.
Note that the levels of group are in alphabetical order by default, but can be easily changed.
Suppose for example that C is a control or reference level to which conditions A and B are
to be compared. Then one might redefine the group levels, in a new data object, so that C
is the first level:
> y2 <- y
> y2$samples$group <- relevel(y2$samples$group, ref="C")
> levels(y2$samples$group)
Now
> et <- exactTest(y2, pair=c("A","B"))
compares B to A, whereas
> et <- exactTest(y2)
compares A to C.
31
edgeR User’s Guide
A B C
Sample1 1 0 0
Sample2 1 0 0
Sample3 0 1 0
Sample4 0 1 0
Sample5 0 0 1
attr(,"assign")
[1] 1 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "contr.treatment"
Here, the 0+ in the model formula is an instruction not to include an intercept column and
instead to include a column for each group.
One can compare any of the treatment groups using the contrast argument of the glmQLFTest
or glmLRT function. For example,
> fit <- glmQLFit(y, design)
> qlf <- glmQLFTest(fit, contrast=c(-1,1,0))
> topTags(qlf)
will compare B to A. The meaning of the contrast is to make the comparison -1*A + 1*B +
0*C, which is of course is simply B-A.
The contrast vector can be constructed using makeContrasts if that is convenient. The above
comparison could have been made by
> BvsA <- makeContrasts(B-A, levels=design)
> qlf <- glmQLFTest(fit, contrast=BvsA)
32
edgeR User’s Guide
would compare C to the average of A and B. Alternatively, this same contrast could have
been specified by
> my.contrast <- makeContrasts(C-(A+B)/2, levels=design)
> qlf <- glmQLFTest(fit, contrast=my.contrast)
33
edgeR User’s Guide
Or we want to assert that the difference between Furry over Smooth is much the same
regardless of color. In that case you need to show that the contrast (B+D)/2-(A+C)/2 (the
average Furry effect) is significant for many genes but that (D-C)-(B-A) (the interaction) is
not.
Now the first coefficient will measure the baseline logCPM expression level in the first treat-
ment condition (here group A), and the second and third columns are relative to the baseline.
Here the second and third coefficients represent B vs A and C vs A respectively. In other
words, coef=2 now means B-A and coef=3 means C-A, so
> fit <- glmQLFit(y, design)
> qlf <- glmQLFTest(fit, coef=2)
34
edgeR User’s Guide
Sample5 1 0 0
attr(,"assign")
[1] 0 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "contr.treatment"
Now
> fit2 <- glmQLFit(y, design2)
> qlf <- glmQLFTest(fit2, coef=2)
compares A to C, and
> qlf <- glmQLFTest(fit2, coef=3)
Note that
> qlf <- glmQLFTest(fit2, coef=1)
should not be used. It would test whether the first coefficient is zero, but it is not meaningful
to compare the logCPM in group A to zero.
will find any genes that differ between any of the treatment conditions A, B or C. Technically,
this procedure tests whether either of the contrasts B-A or C-A are non-zero. Since at least
one of these must be non-zero when differences exist, the test will detect any differences. To
have this effect, the coef argument should specify all the coefficients except the intercept.
Note that this approach does not depend on how the group factor was defined, or how the
design matrix was formed, as long as there is an intercept column. For example
> qlf <- glmQLFTest(fit2, coef=2:3)
gives exactly the same results, even though fit2 and fit were computed using different design
matrices. Here fit2 is as defined in the previous section.
35
edgeR User’s Guide
Treat Time
Sample1 Placebo 0h
Sample2 Placebo 0h
Sample3 Placebo 1h
Sample4 Placebo 1h
Sample5 Placebo 2h
Sample6 Placebo 2h
Sample7 Drug 0h
Sample8 Drug 0h
Sample9 Drug 1h
Sample10 Drug 1h
Sample11 Drug 2h
Sample12 Drug 2h
As always, there are many ways to setup a design matrix. A simple, multi-purpose approach
is to combine all the experimental factors into one combined factor:
> Group <- factor(paste(targets$Treat,targets$Time,sep="."))
> cbind(targets,Group=Group)
Then we can take the same approach as in the previous section on two or more groups. Each
treatment time for each treatment drug is a group:
> design <- model.matrix(~0+Group)
> colnames(design) <- levels(Group)
36
edgeR User’s Guide
Then we can make any comparisons we wish. For example, we might wish to make the
following contrasts:
> my.contrasts <- makeContrasts(
+ Drug.1vs0 = Drug.1h-Drug.0h,
+ Drug.2vs0 = Drug.2h-Drug.0h,
+ Placebo.1vs0 = Placebo.1h-Placebo.0h,
+ Placebo.2vs0 = Placebo.2h-Placebo.0h,
+ DrugvsPlacebo.0h = Drug.0h-Placebo.0h,
+ DrugvsPlacebo.1h = (Drug.1h-Drug.0h)-(Placebo.1h-Placebo.0h),
+ DrugvsPlacebo.2h = (Drug.2h-Drug.0h)-(Placebo.2h-Placebo.0h),
+ levels=design)
or at 2 hours:
> qlf <- glmQLFTest(fit, contrast=my.contrasts[,"Drug.2vs0"])
To find genes with baseline differences between the drug and the placebo at 0 hours:
> qlf <- glmQLFTest(fit, contrast=my.contrasts[,"DrugvsPlacebo.0h"])
To find genes that have responded differently to the drug and the placebo at 2 hours:
> qlf <- glmQLFTest(fit, contrast=my.contrasts[,"DrugvsPlacebo.2h"])
Of course, it is not compulsory to use makeContrasts to form the contrasts. The coefficients
are the following:
> colnames(fit)
so
> qlf <- glmQLFTest(fit, contrast=c(-1,0,1,0,0,0))
37
edgeR User’s Guide
The meaning of this formula is to consider all the levels of time for each treatment drug
separately. The second term is a nested interaction, the interaction of Time within Treat.
The coefficient names are:
> colnames(fit)
finds genes that respond to the treatment at either 1 hour or 2 hours versus the 0 hour
baseline. This is analogous to an ANOVA F -test for a normal linear model.
which is equivalent to
38
edgeR User’s Guide
While the factorial model has a long history in statistics, the coefficients are more difficult
to interpret than for the design matrices in Sections 3.3.1 or 3.3.2 and the coefficients are
generally less biologically meaningful.
In the factorial model, the coefficient names are:
> colnames(design)
Now
> qlf <- glmQLFTest(fit, coef=2)
and
> qlf <- glmQLFTest(fit, coef=4)
are the effects of the reference drug, i.e., the effects of the placebo at 1 hour and 2 hours.
In most experimental studies, none of the above three tests are would be of any particular
scientific interest.
The factorial formula is primarily useful as a way to conduct an overall test for interaction. The
last two coefficients correspond to the interaction contrasts (Drug.1h-Placebo.1h)-(Drug.0h-
Placebo.0h) and (Drug.2h-Placebo.2h)-(Drug.0h-Placebo.0h) respectively, which are the same
as the contrasts DrugvsPlacebo.1h and DrugvsPlacbo.2h defined in Section 3.3.1. Hence
> qlf <- glmQLFTest(fit, coef=5:6)
is useful because it detects genes that respond differently to the drug, relative to the placebo,
at either of the times. In other words, specifying coef=5:6 in the GLM test is a way to test
for interaction between treatment without having to form the interaction contrasts explicitly.
The results will be the same as if we had specified
> qlf <- glmQLFTest(fit, contrast=my.contrasts[,"DrugvsPlacebo.1h","DrugvsPlacebo.2h"])
in Section 3.3.1.
39
edgeR User’s Guide
The omission of an interaction term is characteristic of paired designs. We are not interested
in the effect of the treatment on an individual patient (which is what an interaction term
would examine). Rather we are interested in the average effect of the treatment over a
population of patients.
As always, the dispersion has to be estimated:
> y <- estimateDisp(y,design)
We proceed to fit a linear model and test for the treatment effect. Note that we can omit
the coef argument to glmQLFTest because the treatment effect is the last coefficient in the
model.
> fit <- glmQLFit(y, design)
> qlf <- glmQLFTest(fit)
> topTags(qlf)
This test detects genes that are differentially expressed in response to the active treatment
compared to the control, adjusting for baseline differences between the patients. This test
can be viewed as a generalization of a paired t-test.
See the oral carcinomas case study of Section 4.1 for a fully worked analysis with paired
samples.
40
edgeR User’s Guide
3.4.2 Blocking
Paired samples are a simple example of what is called “blocking” in experimental design. The
idea of blocking is to compare treatments using experimental subjects that are as similar as
possible, so that the treatment difference stands out as clearly as possible.
Suppose for example that we wish to compare three treatments A, B and C using experimental
animals. Suppose that animals from the same litter are appreciably more similar than animals
from different litters. This might lead to an experimental setup like:
FileName Litter Treatment
File1 1 A
File2 1 B
File3 1 C
File4 2 B
File5 2 A
File6 2 C
File7 3 C
File8 3 B
File9 3 A
Here it is the differences between the treatments that are of interest. The differences between
the litters are not of primary interest, nor are we interested in a treatment effect that occurs
for in only one litter, because that would not be reproducible.
We can compare the three treatments adjusting for any baseline differences between the
litters by fitting an additive model:
> Litter <- factor(targets$Litter)
> Treatment <- factor(targets$Treatment)
> design <- model.matrix(~Litter+Treatment)
This creates a design matrix with five columns: three for the litters and two more for the
differences between the treatments.
If fit is the fitted model with this design matrix, then we may proceed as follows. To detect
genes that are differentially expressed between any of the three treatments, adjusting for litter
differences:
> qlf <- glmQLFTest(fit, coef=4:5)
> topTags(qlf)
41
edgeR User’s Guide
The advantage of using litter as a blocking variable in the analysis is that this will make the
comparison between the treatments more precise, if litter-mates are more alike than animals
from different litters. On the other hand, if litter-mates are no more alike than animals
from different litters, which might be so for genetically identical inbred laboratory animals,
then the above analysis is somewhat inefficient because the litter effects are being estimated
unnecessarily. In that case, it would be better to omit litter from the model formula.
In this type of analysis, the treatments are compared only within each batch. The analysis is
corrected for baseline differences between the batches.
The Arabidopsis case study in Section 4.2 gives a fully worked example with batch effects.
42
edgeR User’s Guide
If all the RNA samples were collected from independent subjects, then this would be a
nested factorial experiment, from which we would want to estimate the treatment effect for
each disease group. As it is, however, we have a paired comparison experiment for each
disease group. The feature that makes this experiment complex is that some comparisons
(those between the diseases) are made between patients while other comparisons (hormone
treatment vs no treatment) are made within patients.
This type of experiment is sometimes called a multilevel design or a repeated measures
design. The repeated measures refer to the multiple measurements made on each patient.
The experiment is multilevel in the sense that there are two error levels, one between patients
and one for the repeat measurements within patients. The repeated measurements made on
each patient will typically be more similar to each other than measurements made on different
patients. Hence the variability within patients is typically lower than that between patients.
The easiest way to approach this design is to view it as three paired-comparison experiments,
one for each disease group. We can compare the hormone treatment to the control treatment
separately for each disease group, then contrast how effect the hormone is between the three
disease groups.
For we define the experimental factors:
> Patient <- factor(targets$Patient)
> Disease <- factor(targets$Disease, levels=c("Healthy","Disease1","Disease2"))
> Treatment <- factor(targets$Treatment, levels=c("None","Hormone"))
We need to adjust for baseline differences between the patients, so the first step is to initialize
the design matrix with patient effects:
> design <- model.matrix(~Patient)
Then we define disease-specific treatment effects and append them to the design matrix:
> Healthy.Hormone <- Disease== "Healthy" & Treatment=="Hormone"
> Disease1.Hormone <- Disease=="Disease1" & Treatment=="Hormone"
> Disease2.Hormone <- Disease=="Disease2" & Treatment=="Hormone"
> design <- cbind(design, Healthy.Hormone, Disease1.Hormone, Disease2.Hormone)
After estimating the dispersions (code not shown), we can fit a linear model:
> fit <- glmQLFit(y, design)
43
edgeR User’s Guide
To find genes that respond differently to the hormone in Disease1 vs Healthy patients:
> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0,0,0,0,0,0,-1,1,0))
> topTags(qlf)
To find genes that respond differently to the hormone in Disease2 vs Healthy patients:
> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0,0,0,0,0,0,-1,0,1))
> topTags(qlf)
To find genes that respond differently to the hormone in Disease2 vs Disease1 patients:
> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0,0,0,0,0,0,0,-1,1))
> topTags(qlf)
44
Chapter 4
Case studies
> head(rawdata)
45
edgeR User’s Guide
> library(edgeR)
> y <- DGEList(counts=rawdata[,4:9], genes=rawdata[,1:3])
4.1.3 Annotation
The study by Tuch et al. [47] was undertaken a few years ago, so not all of the RefSeq IDs
provided by match RefSeq IDs currently in use. We retain only those transcripts with IDs in
the current NCBI annotation, which is provided by the org.HS.eg.db package:
> library(org.Hs.eg.db)
> idfound <- y$genes$RefSeqID %in% mappedRkeys(org.Hs.egREFSEQ)
> y <- y[idfound,]
> dim(y)
[1] 15534 6
gene_id accession
1 1 NM_130786
2 1 NP_570602
3 2 NM_000014
4 2 NM_001347423
5 2 NM_001347424
6 2 NM_001347425
Now use the Entrez Gene IDs to update the gene symbols:
> egSYMBOL <- toTable(org.Hs.egSYMBOL)
> head(egSYMBOL)
gene_id symbol
1 1 A1BG
2 2 A2M
3 3 A2MP1
4 9 NAT1
5 10 NAT2
6 11 NATP
46
edgeR User’s Guide
[1] 10510
Normally we would also filter lowly expressed genes. For this data, all transcripts already
have at least 50 reads for all samples of at least one of the tissues types.
Recompute the library sizes:
> y$samples$lib.size <- colSums(y$counts)
TMM normalization is applied to this dataset to account for compositional difference between
the libraries.
> y <- normLibSizes(y)
> y$samples
47
edgeR User’s Guide
2.0
51T
1.5
Leading logFC dim 2 (18%)
1.0
0.5
0.0 51N
8T
8N
−1.0
33T
33N
−3 −2 −1 0 1 2
In the plot, dimension 1 separates the tumor from the normal samples, while dimension 2
roughly corresponds to patient number. This confirms the paired nature of the samples. The
tumor samples appear more heterogeneous than the normal samples.
48
edgeR User’s Guide
attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Patient
[1] "contr.treatment"
attr(,"contrasts")$Tissue
[1] "contr.treatment"
This sort of additive model is appropriate for paired designs, or experiments with batch effects.
[1] 0.159
The square root of the common dispersion gives the coefficient of variation of biological
variation. Here the common dispersion is found to be 0.159, so the coefficient of biological
variation is around 0.4.
The dispersion estimates can be viewed in a BCV plot:
> plotBCV(y)
49
edgeR User’s Guide
Conduct likelihood ratio tests for tumour vs normal tissue differences and show the top genes:
Coefficient: TissueT
RefSeqID Symbol NbrOfExons logFC logCPM LR PValue FDR
5737 NM_001039585 PTGFR 4 -5.18 4.74 98.7 2.98e-23 3.13e-19
5744 NM_002820 PTHLH 4 3.97 6.21 92.1 8.12e-22 4.27e-18
3479 NM_001111283 IGF1 5 -3.99 5.72 86.5 1.39e-20 4.86e-17
1288 NM_033641 COL4A6 45 3.66 5.72 77.5 1.32e-18 3.46e-15
10351 NM_007168 ABCA8 38 -3.98 4.94 75.9 2.98e-18 6.27e-15
5837 NM_005609 PYGM 20 -5.48 5.99 75.4 3.93e-18 6.89e-15
487 NM_004320 ATP2A1 23 -4.62 5.96 74.8 5.20e-18 7.81e-15
27179 NM_014440 IL36A 4 -6.17 5.40 72.2 1.95e-17 2.56e-14
196374 NM_173352 KRT78 9 -4.25 7.61 70.8 3.95e-17 4.61e-14
83699 NM_031469 SH3BGRL2 4 -3.93 5.54 67.8 1.84e-16 1.93e-13
Note that glmLRT has conducted a test for the last coefficient in the linear model, which we
can see is the tumor vs normal tissue effect:
> colnames(design)
The genewise tests are for tumor vs normal differential expression, adjusting for baseline
differences between the three patients. The tests can be viewed as analogous to paired
t-tests. The top DE tags have tiny p-values and FDR values, as well as large fold changes.
Here’s a closer look at the counts-per-million in individual samples for the top genes:
> o <- order(lrt$table$PValue)
> cpm(y)[o[1:10],]
We see that all the top genes have consistent tumour vs normal changes for the three patients.
The total number of differentially expressed genes at 5% FDR is given by:
> summary(decideTests(lrt))
50
edgeR User’s Guide
TissueT
Down 938
NotSig 9241
Up 331
Plot log-fold change against log-counts per million, with DE genes highlighted:
> plotMD(lrt)
> abline(h=c(-1, 1), col="blue")
51
edgeR User’s Guide
4.1.10 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
52
edgeR User’s Guide
53
edgeR User’s Guide
There are two experimental factors, treatment (hrcc vs mock) and the time that each replicate
was conducted:
> Treat <- factor(substring(colnames(arab),1,4))
> Treat <- relevel(Treat, ref="mock")
> Time <- factor(substring(colnames(arab),5,5))
keep
FALSE TRUE
12292 13930
54
edgeR User’s Guide
mock2
1.5
Leading logFC dim 2 (29%)
1.0
0.5 mock1
mock3
−0.5 0.0
hrcc2
hrcc1
−1.5
hrcc3
The logFC at the three times are positively correlated with one another, as we would hope:
> cor(logFC[,4:6])
55
edgeR User’s Guide
attr(,"contrasts")$Treat
[1] "contr.treatment"
[1] 0.0638
> plotBCV(y)
The square root of dispersion is the coefficient of biological variation (BCV). The common
BCV is on the high side, considering that this is a designed experiment using genetically
identical plants. The trended dispersion shows a decreasing trend with expression level. At
low logCPM, the dispersions are very large indeed.
56
edgeR User’s Guide
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
The QL dispersions can be estimated using the glmQLFit function, and then be visualized with
the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)
57
edgeR User’s Guide
[1] 1370
Now conduct QL F-tests for the pathogen effect and show the top genes. By default, the
test is for the last coefficient in the design matrix, which in this case is the treatment effect:
Coefficient: Treathrcc
logFC logCPM F PValue FDR
AT2G19190 4.48 7.38 308 4.22e-10 5.20e-06
AT2G39530 4.32 6.71 280 7.46e-10 5.20e-06
AT2G39380 4.93 5.77 249 1.51e-09 5.97e-06
AT3G46280 4.77 8.10 243 1.72e-09 5.97e-06
AT1G51800 3.95 7.71 232 2.25e-09 6.28e-06
AT1G51850 5.30 5.42 208 4.29e-09 8.31e-06
AT2G44370 5.40 5.20 200 5.42e-09 8.31e-06
AT3G55150 5.76 4.91 198 5.78e-09 8.31e-06
AT1G51820 4.32 6.38 197 5.89e-09 8.31e-06
AT5G48430 6.30 6.74 197 5.97e-09 8.31e-06
Here’s a closer look at the individual counts-per-million for the top genes. The top genes are
very consistent across the three replicates:
> top <- rownames(topTags(qlf))
> cpm(y)[top,]
Treathrcc
Down 919
NotSig 12125
Up 886
We can plot all the logFCs against average count size, highlighting the DE genes:
> plotMD(qlf)
> abline(h=c(-1,1), col="blue")
58
edgeR User’s Guide
4.2.9 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
59
edgeR User’s Guide
[1] 38415 69
> Counts[1:5,1:5]
Gender
female male
40 29
> rm(pickrell1.eset)
Annotation for each Ensemble gene is also available from the tweeDEseqCountData package:
> data(annotEnsembl63)
> annot <- annotEnsembl63[,c("Symbol","Chr")]
> annot[1:5,]
Symbol Chr
ENSG00000252775 U7 5
60
edgeR User’s Guide
ENSG00000207459 U6 5
ENSG00000252899 U7 5
ENSG00000201298 U6 5
ENSG00000222266 U6 5
> rm(annotEnsembl63)
isexpr
FALSE TRUE
20226 18189
Keep only genes with defined annotation, and recompute library sizes:
> hasannot <- rowSums(is.na(y$genes))==0
> y <- y[isexpr & hasannot, , keep.lib.sizes=FALSE]
> dim(y)
[1] 17517 69
8 12
4
0
1 3 5 7 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69
61
edgeR User’s Guide
We then estimate the QL dispersions around the dispersion trend using glmQLFit. The large
number of cases and the high variability means that the QL dispersions are not squeezed very
heavily from the raw values:
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)
62
edgeR User’s Guide
Coefficient: Gendermale
Symbol Chr logFC logCPM F PValue FDR
ENSG00000229807 XIST X -9.48 7.249 1209 1.11e-46 1.95e-42
ENSG00000099749 CYorf15A Y 4.28 1.757 858 1.10e-41 9.62e-38
ENSG00000131002 CYorf15B Y 5.63 2.056 584 3.13e-36 1.83e-32
ENSG00000157828 RPS4Y2 Y 3.17 4.208 577 4.65e-36 2.04e-32
ENSG00000233864 TTTY15 Y 4.84 1.254 536 4.71e-35 1.65e-31
ENSG00000198692 EIF1AY Y 2.36 3.247 376 2.84e-30 8.30e-27
ENSG00000165246 NLGN4Y Y 5.09 1.675 305 1.38e-27 3.45e-24
ENSG00000183878 UTY Y 1.86 3.137 254 2.60e-25 5.68e-22
ENSG00000243209 AC010889.1 Y 2.66 0.797 231 3.86e-24 7.51e-21
ENSG00000129824 RPS4Y1 Y 2.53 5.401 229 5.20e-24 9.11e-21
ENSG00000012817 KDM5D Y 1.47 4.949 226 6.64e-24 1.06e-20
ENSG00000213318 RP11-331F4.1 16 3.67 3.688 214 3.71e-23 5.41e-20
ENSG00000067048 DDX3Y Y 1.62 5.621 183 1.89e-21 2.55e-18
ENSG00000146938 NLGN4X X 3.94 1.047 140 1.52e-18 1.90e-15
ENSG00000232928 RP13-204A15.4 X 1.44 3.558 112 2.46e-16 2.87e-13
> summary(decideTests(qlf))
Gendermale
Down 46
NotSig 17450
Up 21
63
edgeR User’s Guide
Roast gene set tests by fry() confirm that the male-specific genes are significantly up as a
group in our comparison of males with females, whereas the X genes are significantly down
as a group [48].
> index <- list(Y=Ymale, X=Xescape)
> fry(y, index=index, design=design)
A barcode plot can be produced to visualize the results. Genes are ranked from left to right
by increasing log-fold-change in the background of the barcode plot. Genes in the set of
msYgenes are represented by red bars whereas genes in the set of XiEgenes are represented by
blue bars. The line above the barcode shows the relative local enrichment of the vertical
bars in each part of the plot. This particular plot suggests that the male-specific genes tend
to have large positive log-fold-changes, whereas the X genes tend to have large negative
log-fold-changes.
> barcodeplot(qlf$table$logFC, index[[1]], index[[2]])
0 Enrichment6.6
Down
Up
3.6Enrichment 0
−9.484
−0.206
−0.120
−0.065
−0.026
0.009
0.042
0.078
0.122
0.195
5.625
Statistic
The results from competitive camera gene sets tests are even more convincing [49]. The
positive intergene correlations here show that the genes in each set tend to be biologically
correlated:
64
edgeR User’s Guide
4.3.7 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
65
edgeR User’s Guide
> targets
The name of the file containing the read sequences for each library is also shown. Each file
is downloaded from the Sequence Read Archive and has an accession number starting with
SRR, e.g., SRR1552450 for the first library in targets.
66
edgeR User’s Guide
This produces a set of BAM files, where each file contains the read alignments for each library.
The mapped reads can be counted into mouse genes by using the featureCounts function. It
uses the exon intervals defined in the NCBI annotation of the mm10 genome.
> fc <- featureCounts(output.files, annot.inbuilt="mm10")
> colnames(fc$counts) <- 1:12
> head(fc$counts)
1 2 3 4 5 6 7 8 9 10 11 12
497097 438 300 65 237 354 287 0 0 0 0 0 0
100503874 1 0 1 1 0 4 0 0 0 0 0 0
100038431 0 0 0 0 0 0 0 0 0 0 0 0
19888 1 1 0 0 0 0 10 3 10 2 0 0
20671 106 182 82 105 43 82 16 25 18 8 3 10
27395 309 234 337 300 290 270 560 464 489 328 307 342
The row names of the matrix represent the Entrez gene identifiers for each gene. In the
output from featureCounts, the column names of fc$counts are the output file names from
align. Here, we simplify them for brevity.
Human-readable gene symbols can also be added to complement the Entrez identifiers for
each gene, using the annotation in the org.Mm.eg.db package.
> require(org.Mm.eg.db)
> Symbol <- mapIds(org.Mm.eg.db, keys=rownames(y), keytype="ENTREZID",
+ column="SYMBOL")
> y$genes <- data.frame(Symbol=Symbol)
67
edgeR User’s Guide
The performance of the TMM normalization procedure can be examined using mean-difference
(MD) plots. This visualizes the library size-adjusted log-fold change between two libraries
(the difference) against the average log-expression across those libraries (the mean). The fol-
lowing MD plot is generated by comparing sample 1 against an artificial library constructed
from the average of all other samples.
> plotMD(cpm(y, log=TRUE), column=1)
> abline(h=0, col="red", lty=2, lwd=2)
68
edgeR User’s Guide
Ideally, the bulk of genes should be centred at a log-fold change of zero. This indicates that
any composition bias between libraries has been successfully removed. This quality check
should be repeated by constructing a MD plot for each sample.
B.lactate L.lactate
B.pregnant L.pregnant
B.virgin L.virgin
Leading logFC dim 2 (17%)
2
1
0
−1
−2
−3 −2 −1 0 1 2 3
69
edgeR User’s Guide
Replicate samples from the same group cluster together in the plot, while samples from
different groups form separate clusters. This indicates that the differences between groups
are larger than those within groups, i.e., differential expression is greater than the variance
and can be detected. The distance between basal samples on the left and luminal cells on
the right is about 6 units, corresponding to a leading fold change of about 64-fold (26 = 64)
between basal and luminal. The expression differences between virgin, pregnant and lactating
are greater for luminal cells than for basal.
[1] 0.0134
> plotBCV(y)
70
edgeR User’s Guide
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
For the QL dispersions, estimation can be performed using the glmQLFit function. This returns
a DGEGLM object containing the estimated values of the GLM coefficients for each gene, as well
as the fitted mean-QL dispersion trend, the squeezed QL estimates and the prior degrees of
freedom (df). These can be visualized with the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> head(fit$coefficients)
> plotQLDisp(fit)
71
edgeR User’s Guide
The top set of most significant genes can be examined with topTags. Here, a positive log-fold
change represents genes that are up in B.pregnant over B.lactate. Multiplicity correction is
performed by applying the Benjamini-Hochberg method on the p-values, to control the false
discovery rate (FDR).
> topTags(qlf)
72
edgeR User’s Guide
The top gene Csn1s2b has a large negative log2-fold-change, showing that it is far more
highly expressed in lactating than pregnant mice. This gene is known to be a major source
of protein in milk.
The total number of DE genes in each direction at a FDR of 5% can be examined with de
cideTests. There are in fact nearly 4500 DE genes an FDR cut-off of 5% in this comparison:
> summary(decideTests(qlf))
-1*B.lactate 1*B.pregnant
Down 2509
NotSig 10694
Up 2766
The differential expression test results can be visualized using an MD plot. The log-fold
change for each gene is plotted against the average abundance, i.e., logCPM in the result table
above. Significantly DE genes at a FDR of 5% are highlighted.
> plotMD(qlf)
We use glmTreat to narrow down the list of DE genes and focus on genes that are more
biologically meaningful. We test whether the differential expression is significantly above a
log2-fold-change of log2 1.2, i.e., a fold-change of 1.2.
> tr <- glmTreat(fit, contrast=con, lfc=log2(1.2))
> topTags(tr)
73
edgeR User’s Guide
Around 3000 genes are detected as DE with fold-change significantly above 1.2 at an FDR
cut-off of 5%.
> summary(decideTests(tr))
-1*B.lactate 1*B.pregnant
Down 1434
NotSig 12728
Up 1807
The test results are visualized in the following smear plot. Genes that are significantly DE
above a fold-change of 1.2 at an FDR of 5% are highlighted in red.
> plotMD(tr)
74
edgeR User’s Guide
The QL F-test is then applied to identify genes that are DE among the three groups. This
combines the three pairwise comparisons into a single F-statistic and p-value. The top set of
significant genes can be displayed with topTags.
> anov <- glmQLFTest(fit, contrast=con)
> topTags(anov)
Note that the three contrasts of pairwise comparisons are linearly dependent. Constructing
the contrast matrix with any two of the contrasts would be sufficient to specify an ANOVA
test. For instance, the contrast matrix shown below produces the same test results but with
a different column of log-fold changes.
> con <- makeContrasts(
+ L.PvsL = L.pregnant - L.lactate,
+ L.VvsP = L.virgin - L.pregnant, levels=design)
75
edgeR User’s Guide
The row names of the output are the universal identifiers of the GO terms, with one term per
row. The Term column gives the names of the GO terms. These terms cover three domains
- biological process (BP), cellular component (CC) and molecular function (MF), as shown
in the Ont column. The N column represents the total number of genes that are annotated
with each GO term. The Up and Down columns represent the number of genes with the GO
term that are significantly up- and down-regulated in this differential expression comparison,
respectively. The P.Up and P.Down columns contain the p-values for over-representation of the
GO term across the set of up- and down-regulated genes, respectively. The output table is
sorted by the minimum of P.Up and P.Down by default.
The goana function uses the NCBI RefSeq annotation. Therefore, the Entrez Gene identifier
(ID) should be supplied for each gene as the row names of qlf.
76
edgeR User’s Guide
GOID TERM
1 GO:0032465 regulation of cytokinesis
2 GO:0000281 mitotic cytokinesis
We construct a list of two components, each of which is a vector of Entrez Gene IDs for all
genes annotated with one of the GO terms. We then convert the Gene IDs into row indices
of the fit object using the function ids2indices.
> Rkeys(org.Mm.egGO2ALLEGS) <- cyt.go
> ind <- ids2indices(as.list(org.Mm.egGO2ALLEGS), row.names(fit))
We proceed to run ROAST on the defined gene sets for the contrast of interest. Suppose
the comparison of interest is between the virgin and lactating groups in the basal population.
We use fry to test for multiple gene sets.
> con <- makeContrasts(B.virgin-B.lactate, levels=design)
> fr <- fry(y, index=ind, design=design, contrast=con)
> fr
Each row corresponds to a single gene set, i.e., GO term. The NGenes column gives the
number of genes in each set. The net direction of change is determined from the significance
of changes in each direction, and is shown in the Direction column. The PValue provides
evidence for whether the majority of genes in the set are DE in the specified direction, whereas
the PValue.Mixed tests for differential expression in any direction. FDRs are computed from
the corresponding p-values across all sets.
A barcode plot can be produced with the barcodeplot function to visualize the results for any
particular set. In this case, visualization is performed for the gene set defined by GO:0032465.
Here, genes are represented by bars and are ranked from left to right by increasing log-fold
change. This forms the barcode-like pattern. The line above the barcode shows the relative
local enrichment of the vertical bars in each part of the plot. This particular plot suggests
that most genes in this set are up-regulated in the virgin group compared to the lactating
group.
77
edgeR User’s Guide
GO:0032465
0 Enrichment 1.9
Down
Up
−8.885
−0.987
−0.579
−0.340
−0.163
−0.001
0.167
0.387
0.695
1.281
10.561
Statistic
4.4.12 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC_MONETARY=English_Australia.utf8 LC_NUMERIC=C
[5] LC_TIME=English_Australia.utf8
78
edgeR User’s Guide
The RNA-Seq data of the 12 samples are available on the GEO repository as series GSE118617.
Each combination of cell type (basal and luminal) and genotype (control and Foxp1 knock-
out) comprises of three biological samples. The details of the samples are shown in the target
file below.
> targets <- read.delim("targets.txt", header=TRUE)
> targets
79
edgeR User’s Guide
Next we counted the number of reads overlapping each annotated exon of each gene. We
use featureCounts in Rsubread with the mouse mm39 inbuilt annotation.
> Foxp1 <- featureCounts(bam, isPairedEnd=FALSE, annot.inbuilt="mm39",
+ useMetaFeatures=FALSE, allowMultiOverlap=TRUE)
[1] 285931 12
> head(y$genes)
The annotation includes Entrez ID and the length, chromosome and start and stop position
of each exon. Mouse gene symbols were added to the exon annotation, using the annotation
in the org.Mm.eg.db package.
> require(org.Mm.eg.db)
> Symbol <- mapIds(org.Mm.eg.db, keys=rownames(y), keytype="ENTREZID",
+ column="SYMBOL")
> y$genes$Symbol <- Symbol
> head(y$genes)
80
edgeR User’s Guide
keep
FALSE TRUE
179116 106815
81
edgeR User’s Guide
Lum−KO−3
2
Lum−KO−2
Leading logFC dim 2 (14%)
Lum−KO−1
1
Basal−KO−3
Basal−KO−1
Basal−KO−2
Basal−CT−3
0
Basal−CT−1
Lum−CT−3
−1
Basal−CT−2
−2
Lum−CT−1
Lum−CT−2
−3 −2 −1 0 1 2 3
The MDS plot shows the basal and luminal samples are well separated in the first dimension,
whereas the control and Foxp1 knock-out samples are separated in the second dimension.
82
edgeR User’s Guide
[1] 0.0776
> plotBCV(y)
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
For the QL dispersions, estimation can be performed using the glmQLFit function. The results
can be visualized with the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)
83
edgeR User’s Guide
The top set of most significant exons can be examined with topTags. Here, a positive log-fold
change represents exons that are up in Foxp1-KO over control. Multiplicity correction is
performed by applying the Benjamini-Hochberg method on the p-values, to control the false
discovery rate (FDR).
> topTags(qlf)
84
edgeR User’s Guide
The total number of DE exons in each direction at a FDR of 5% can be examined with
decideTests.
-1*Lum_CT 1*Lum_KO
Down 257
NotSig 105412
Up 1146
85
edgeR User’s Guide
The successful elimination of the two targeted exons is demonstrated by the fact that the
two specific exons of the Foxp1 gene rank as the top two exons with the greatest difference
in usage.
Two different methods can be used to examine the differential splicing results at the gene
level: the Simes’ method and the gene-level F-test. The Simes’ method is likely to be more
powerful when only a minority of the exons for a gene are differentially spliced. The F-tests
are likely to be powerful for genes in which several exons are differentially spliced.
The top spliced genes under the Simes’ method are shown below:
> topSpliceDGE(sp, test="Simes")
As expected, the Foxp1 gene appears as the top gene under both gene-level tests.
We plot all the exons for the top two most differentially spliced genes. Exons that are
individually significant are highlighted.
> par(mfrow=c(1,2))
> plotSpliceDGE(sp, geneid="Foxp1", genecol="Symbol")
> plotSpliceDGE(sp, geneid="Tor1aip1", genecol="Symbol")
86
edgeR User’s Guide
Foxp1 Tor1aip1
0.5
5
0.0
logFC (this exon vs the average)
4
−1.0
3
2
−2.0
1
0
−3.0
98902303
98912235
98916680
98918497
98921580
98922308
98922495
98931282
98942988
98955094
98980161
98986865
98992385
98993489
99052815
99139800
99237306
99285305
99412177
99497558
155880345
155889064
155893257
155893964
155895714
155898046
155898895
155906133
155907160
155909472
155911504
Exon Start Exon Start
We can see that the two Foxp1 exons with start positions of 98921580 and 98922308 are
significantly down in the Foxp1 KO samples compared to the control.
4.5.10 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
87
edgeR User’s Guide
> targets
88
edgeR User’s Guide
> library(edgeR)
> quant <- dirname(list.files(".","quant.sf",recursive = TRUE,full.names = TRUE))
> catch <- catchSalmon(paths = quant)
[1] 227063 6
> head(y$genes)
For the Ensembl-oriented GENCODE annotation, information about the transcripts can be
easily obtained from the AnnotationHub package and added to the DGEList object. Transcript
information might include the transcript biotype as well as the associated gene symbol. The
relevant AnnotationHub ID for the specific GENCODE annotation version 33 used in this case
study is AH78783 (Ensembl annotation version 99) and used below.
> require(AnnotationHub)
> ah <- AnnotationHub()
> edb <- ah[['AH78783']]
> edb.info <- select(edb,keys(edb),c("TXIDVERSION","TXBIOTYPE","SYMBOL"))
> edb.info <- edb.info[match(rownames(y),edb.info$TXIDVERSION),]
>
> y$genes <- cbind(y$genes,edb.info[,-c(1,2)])
> head(y$genes)
89
edgeR User’s Guide
TXBIOTYPE SYMBOL
ENST00000456328.2 processed_transcript DDX11L1
ENST00000450305.2 transcribed unprocessed_pseudogene
_ DDX11L1
ENST00000488147.1 unprocessed_pseudogene WASH7P
ENST00000619216.1 miRNA MIR6859-1
ENST00000473358.1 lncRNA MIR1302-2HG
ENST00000469289.1 lncRNA MIR1302-2HG
keep
FALSE TRUE
196325 30738
After scaling counts by the estimated mapping ambiguity overdispersion, scaling factors can
computed using the TMM method to convert the resulting library sizes to effective library
sizes.
> y <- calcNormFactors(y)
> y$samples
90
edgeR User’s Guide
HCC827.3
1.0
Leading logFC dim 2 (4%)
0.5
0.0
H1975.3
H1975.1
H1975.2
−0.5
HCC827.2
−1.0
HCC827.1
−4 −2 0 2 4
The MDS plot shows that cell lines are well separated in the first dimension.
H1975 HCC827
GSM5255695 1 0
GSM5255696 1 0
GSM5255697 1 0
GSM5255704 0 1
GSM5255705 0 1
GSM5255706 0 1
attr(,"assign")
[1] 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "contr.treatment"
[1] 0.0147
91
edgeR User’s Guide
> plotBCV(y)
For DTE analyses, we still recommend using the quasi-likelihood (QL) pipeline for stricter
error rate control by accounting for the uncertainty associated with the dispersion estimation.
To this end, we estimate QL dispersions via glmQLFit and visualize the estimated values with
plotQLDisp.
92
edgeR User’s Guide
The total number of DE transcripts up- and down-regulated at a FDR of 5% can be examined
with decideTests. We use the default Benjamini-Hochberg method to adjust p-values for
multiple testing.
> is.de <- decideTests(qlf, p.value=0.05)
> summary(is.de)
-1*H1975 1*HCC827
Down 10945
NotSig 9644
Up 10149
The top set of most significant differentially expressed transcripts can be examined with top
Tags,with a positive log-fold change representing up-regulation in expression levels in HCC827
over H1975.
> tt <- topTags(qlf,n = Inf)
> head(tt)
We can see that the top set of most significant DE transcripts includes several transcripts
with associated protein-coding biotype.
In addition, our DE analysis at the transcript-level reveals several interesting genes with con-
trasting up- and down-regulation of their associated transcripts between cell lines. Such genes
include the BCL2L1 gene, for which one of its protein-coding transcripts (ENST00000376062.6)
is down-regulated in contrast to the remaining up-regulated transcripts in the HCC827 cell
line.
> tt$table[tt$table$SYMBOL == 'BCL2L1',]
93
edgeR User’s Guide
4.6.9 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC_MONETARY=English_Australia.utf8 LC_NUMERIC=C
[5] LC_TIME=English_Australia.utf8
94
edgeR User’s Guide
95
edgeR User’s Guide
a dual indexing strategy where the first 8 bases from each pair of reads contained an index
sequence that uniquely identifies which sample a particular sgRNA sequence originated from.
Matches between sample indexes and sgRNAs listed in the files Samples4.txt and sgRNAs4.txt
are identified by processAmplicons to produce a DGEList of counts.
> library(edgeR)
> sampleanno <- read.table("Samples4.txt", header=TRUE, sep="\t")
> sgseqs <- read.table("sgRNAs4.txt", header=TRUE, sep="\t")
> x <- processAmplicons("screen4_R1.fastq", readfile2="screen4_R2.fastq",
+ barcodefile="Samples4.txt", hairpinfile="sgRNAs4.txt",
+ verbose=TRUE)
Note that this dual indexing strategy requires an additional column named ‘SequencesRev’ in
the file that contains the sample annotation information. Also, readFile2 must be specified.
The output DGEList is available here.
Drug NoDrug
40 32
We plot number of sgRNAs that could be matched per sample and total for each sgRNA
across all samples .
> cols <- as.numeric(x$samples$group)+2
> par(mfrow=c(2,1))
> barplot(colSums(x$counts), las=2, main="Counts per index",
+ col=cols, cex.names=0.5, cex.axis=0.8)
> legend("topright", legend=c("Control", "Drug"), col=c(3,4), pch=15)
> barplot(rowSums(x$counts), las=2, main="Counts per sgRNA",
+ axisnames=FALSE, cex.axis=0.8)
96
edgeR User’s Guide
A multidimensional scaling plot was generated to assess the consistency between replicate
samples. There is a clear separation between the two infections, indicating the need to
incorporate an effect for this in the GLM.
> cols2 <- x$samples$Infection
> par(mfrow=c(1,2))
> plotMDS(x, col=cols, main="MDS Plot: drug treatment colours")
> legend("topleft", legend=c("Control", "Drug"), col=c(3,4), pch=15)
> plotMDS(x, col=cols2, main="MDS Plot: infection colours")
> legend("topleft", legend=c("Inf#1", "Inf#2"), col=c(1,2), pch=15)
97
edgeR User’s Guide
[1] 0.258
98
edgeR User’s Guide
Coefficient: Drug
ID Sequences Gene logFC logCPM LR PValue
sgRNA816 sgRNA816 TCCGAACTCCCCCTTCCCGA 269 4.36 7.32 699 4.54e-154
sgRNA4070 sgRNA4070 GTTGTGCTCAGTACTGACTT 1252 2.94 8.00 659 2.14e-145
sgRNA6351 sgRNA6351 AAAAACGTATCTATTTTTAC 1957 3.37 6.34 422 8.56e-94
sgRNA12880 sgRNA12880 CTGCACCGAAGAGAGCTGCT 3979 2.83 7.04 322 5.45e-72
sgRNA23015 sgRNA23015 CAATTTGATCTCTTCTACTG 6714 3.16 4.83 233 1.35e-52
sgRNA62532 sgRNA62532 AAACACGTCCAGTGCAGCCC 19612 2.79 4.91 216 6.18e-49
sgRNA38819 sgRNA38819 TACGTTGTCGGGCGCCGCCA 11531 2.42 6.54 204 2.96e-46
sgRNA3887 sgRNA3887 AACGCTGGACTCGAATGGCC 1194 2.28 5.33 203 4.05e-46
sgRNA19299 sgRNA19299 GGGGTCTTACCCGAGGCTCC 5732 1.94 5.63 202 7.67e-46
sgRNA52924 sgRNA52924 CCACCGCGTTCCACTTCTTG 16395 2.87 6.64 193 5.54e-44
FDR
sgRNA816 2.56e-149
sgRNA4070 6.04e-141
sgRNA6351 1.61e-89
sgRNA12880 7.68e-68
sgRNA23015 1.52e-48
sgRNA62532 5.81e-45
sgRNA38819 2.38e-42
sgRNA3887 2.85e-42
sgRNA19299 4.80e-42
sgRNA52924 3.12e-40
sgRNAs with FDR < 0.0001 [1] and log-fold-change ≥ 1 are highlighted on a plot of log-
fold-change versus log-counts-per-millions by the plotSmear function. Since this is a positive
screen, we highlight over-represented sgRNAs (i.e. those with positive log-fold-changes) as
the model is parameterized to compare drug treatment versus control (coefficient 2 in the
design matrix).
> thresh <- 0.0001
> lfc <- 1
> top4 <- topTags(lrt, n=Inf)
> top4ids <- top4$table[top4$table$FDR<thresh & top4$table$logFC>=lfc,1]
> plotSmear(lrt, de.tags=top4ids, pch=20, cex=0.6,
+ main="Drug treatment vs Control")
> abline(h=c(-1, 0, 1), col=c("dodgerblue","yellow","dodgerblue"), lty=2)
99
edgeR User’s Guide
100
edgeR User’s Guide
We make a barcode plot for an example (Gene 11531) that ranks highly.
> barcodeplot(lrt$table$logFC,index=genesymbollist[[11531]],
+ main="Barcodeplot for Gene 11531",
+ labels=c("Negative logFC", "Positive logFC"),
+ quantile=c(-0.5,0.5))
Negative logFC
Positive logFC
−2.34
−0.47
−0.30
−0.19
−0.10
−0.02
0.06
0.15
0.26
0.43
4.36
Statistic
The raw data from this example and several other case studies for this technology can be
found at http://bioinf.wehi.edu.au/shRNAseq/.
4.7.8 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
101
edgeR User’s Guide
4.7.9 Acknowledgements
Thanks to Dr Sam Wormald from the WEHI for providing the data set used in this case
study.
> targets
102
edgeR User’s Guide
> s1
V1 V2 V3 V4 V5 V6
1 6 3121266 3121266 0.00 0 17
2 6 3121296 3121296 0.00 0 17
3 6 3179319 3179319 1.28 1 77
4 6 3180316 3180316 4.55 1 21
5 6 3182928 3182928 4.33 22 486
6 6 3182937 3182937 5.37 61 1074
The six columns (from left to right) represent: chromosome, start position, end posi-
tion, methylation proportion in percentage, number of methylated C’s and number of un-
methylated C’s. Since the start and end positions of a CpG site from Bismark are the same,
we can keep only one of them. The last two columns of counts are we will use for the analysis.
We read in the coverage files of all six samples using readBismark2DGE. A DGEList object
is created using the count table, and the chromosome number and positions are used for
annotation.
> files <- targets$File
> yall <- readBismark2DGE(files, sample.names=targets$Sample)
The edgeRpackage stores the counts and associated annotation in a DGEList object. There
is a row for each CpG locus found in any of the files. There are columns of methylated and
unmethylated counts for each sample. The chromosomes and genomic loci are stored in the
genes component.
> yall
$samples
group lib.size norm.factors
103
edgeR User’s Guide
40-45um-A-Me 1 1231757 1
40-45um-A-Un 1 36263318 1
40-45um-B-Me 1 1719267 1
40-45um-B-Un 1 55600556 1
50-55um-A-Me 1 2691638 1
7 more rows ...
$genes
Chr Locus
6-3121266 6 3121266
6-3121296 6 3121296
6-3179319 6 3179319
6-3180316 6 3180316
6-3182928 6 3182928
2271667 more rows ...
> dim(yall)
[1] 2271672 12
6 9 17 1 3 13 10 2 4 5 11
111377 120649 101606 140819 108466 95196 116980 173357 157628 159979 161754
18 16 7 8 14 19 X 12 15 Y MT
71737 70964 140225 130786 84974 70614 58361 95580 99646 662 312
For convenience, we sort the DGEList so that all loci are in genomic order, from chromosome
1 to chromosome Y.
> ChrNames <- c(1:19,"X","Y")
> yall$genes$Chr <- factor(yall$genes$Chr, levels=ChrNames)
> o <- order(yall$genes$Chr, yall$genes$Locus)
> yall <- yall[o,]
We now annotate the CpG loci with the identity of the nearest gene. We search for the gene
transcriptional start site (TSS) closest to each our CpGs:
> TSS <- nearestTSS(yall$genes$Chr, yall$genes$Locus, species="Mm")
> yall$genes$EntrezID <- TSS$gene_id
> yall$genes$Symbol <- TSS$symbol
> yall$genes$Strand <- TSS$strand
> yall$genes$Distance <- TSS$distance
> yall$genes$Width <- TSS$width
> head(yall$genes)
104
edgeR User’s Guide
Here EntrezID, Symbol, Strand and Width are the Entrez Gene ID, symbol, strand and width of
the nearest gene. Distance is the genomic distance from the CpG to the TSS. Positive values
means the TSS is downstream of the CpG and negative values means the TSS is upstream.
As a conservative rule of thumb, we require a CpG site to have a total count (both methylated
and unmethylated) of at least 8 in every sample before it is considered in the study.
> HasCoverage <- rowSums(Coverage >= 8) == 6
This filtering criterion could be relaxed somewhat in principle but the number of CpGs kept
in the analysis is large enough for our purposes.
We also filter out CpGs that are never methylated or always methylated as they provide no
information about differential methylation:
> HasBoth <- rowSums(Me) > 0 & rowSums(Un) > 0
> table(HasCoverage, HasBoth)
HasBoth
105
edgeR User’s Guide
A key difference between BS-seq and other sequencing data is that the pair of libraries
holding the methylated and unmethylated reads for a particular sample are treated as a unit.
To ensure that the methylated and unmethylated reads for the same sample are treated on
the same scale, we need to set the library sizes to be equal for each pair of libraries. We set
the library sizes for each sample to be the average of the total read counts for the methylated
and unmethylated libraries:
> TotalLibSize <- y$samples$lib.size[Methylation=="Me"] +
+ y$samples$lib.size[Methylation=="Un"]
> y$samples$lib.size <- rep(TotalLibSize, each=2)
> y$samples
Other normalization methods developed for RNA-seq data are not required for BS-seq data.
Here M contains the empirical logit methylation level for each CpG site in each sample. We
have used a prior count of 2 to avoid logarithms of zero.
106
edgeR User’s Guide
Now we can generate a multi-dimensional scaling (MDS) plot to explore the overall differences
between the methylation levels of the different samples.
> plotMDS(M, col=rep(1:3, each=2), main="M-values")
M−values
2
50−55um−A
1
40−45um−A 60−65um−B
60−65um−A
Leading logFC dim 2 (20%)
40−45um−B
0
−1
−2
−3
−4
50−55um−B
−4 −2 0 2 4
Replicate samples cluster together within the 40-45 and 60-65µm categories but are far apart
in the 50-55µm group. The plot also indicates a huge difference in methylation level between
the 40-45 and 60-65µm groups.
The we expand this to the full design matrix modeling the sample and methylation effects:
107
edgeR User’s Guide
The first six columns represent the sample coverage effects. The last three columns represent
the methylation levels (in logit units) in the three groups.
We estimate the NB dispersion for each CpG site using the estimateDisp function. The
mean-dispersion relationship of BS-seq data has been studied in the past and no apparent
mean-dispersion trend was observed [13]. Therefore, we would not consider a mean-dependent
dispersion trend for BS-seq methylation data.
> y1 <- estimateDisp(y1, design=design, trend="none")
> y1$common.dispersion
[1] 0.384
> summary(y1$prior.df)
108
edgeR User’s Guide
The estimated prior degrees of freedom are infinite for all the CpGs, which implies all the
CpG-wise dispersions are exactly the same as the common dispersion. A BCV plot is often
useful to visualize the dispersion estimates, but it is not informative in this case.
We identify differentially methylated CpG loci between the 40-45 and 60-65µm group using
the likelihood-ratio test. The contrast corresponding to this comparison is constructed using
the makeContrasts function.
> contr <- makeContrasts(
+ Group60vs40 = Group60um - Group40um, levels=design)
> lrt <- glmLRT(fit, contrast=contr)
The top set of most significant DMRs can be examined with topTags. Here, positive log-fold
changes represent CpG sites that have higher methylation level in the 60-65µm group com-
pared to the 40-45µm group. Multiplicity correction is performed by applying the Benjamini-
Hochberg method on the p-values, to control the false discovery rate (FDR).
> topTags(lrt)
109
edgeR User’s Guide
The total number of DMRs in each direction at a FDR of 5% can be examined with decide
Tests.
> summary(decideTests(lrt))
-1*Group40um 1*Group60um
Down 24
NotSig 12473
Up 1738
The differential methylation results can be visualized using an MD plot. The difference of
the M-value for each CpG site is plotted against the average abundance of that CpG site.
Significantly DMRs at a FDR of 5% are highlighted.
> plotMD(lrt)
It can be seen that most of the DMRs have higher methylation levels in 60-65µm group
compared to the 40-45µm group. This is consistent with the findings in Gahurova et al. [17].
110
edgeR User’s Guide
The integer matrix ypr$counts contains the total numbers of methylated and unmethylated
CpGs observed within the promoter of each gene.
Filtering is performed in the same way as before. We sum up the read counts of both
methylated and unmethylated Cs at each gene promoter within each sample.
> Mepr <- ypr$counts[,Methylation=="Me"]
> Unpr <- ypr$counts[,Methylation=="Un"]
> Coveragepr <- Mepr + Unpr
Since each row represents a 3,000-bps-wide promoter region that contains multiple CpG sites,
we would expect less filtering than before.
> HasCoveragepr <- rowSums(Coveragepr >= 8) == 6
> HasBothpr <- rowSums(Mepr) > 0 & rowSums(Unpr) > 0
> table(HasCoveragepr, HasBothpr)
HasBothpr
HasCoveragepr FALSE TRUE
FALSE 3656 3053
TRUE 85 15044
Same as before, we do not perform normalization but set the library sizes for each sample to
be the average of the total read counts for the methylated and unmethylated libraries.
> TotalLibSizepr <- 0.5*ypr$samples$lib.size[Methylation=="Me"] +
+ 0.5*ypr$samples$lib.size[Methylation=="Un"]
> ypr$samples$lib.size <- rep(TotalLibSizepr, each=2)
> ypr$samples
111
edgeR User’s Guide
[1] 0.243
> ypr$prior.df
[1] 10.4
Then we can proceed to testing for differential methylation in gene promoter regions between
different populations. Suppose the comparison of interest is the same as before. The same
contrast can be used for the testing.
> lrtpr <- glmLRT(fitpr, contrast=contr)
The top set of most differentially methylated gene promoters can be viewed with topTags:
The total number of DM gene promoters identified at an FDR of 5% can be shown with
decideTests.
> summary(decideTests(lrtpr))
-1*Group40um 1*Group60um
Down 15
NotSig 14332
Up 697
112
edgeR User’s Guide
> plotMD(lrtpr)
4.8.10 Setup
This analysis was conducted on:
> sessionInfo()
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
113
edgeR User’s Guide
114
edgeR User’s Guide
The data has 127 columns of counts but only 30 biologically independent samples:
> dim(Counts)
We therefore sum the technical replicates to get total genewise read counts for each biological
sample:
> PooledCounts <- sumTechReps(Counts, ID=Samples$stage)
> dim(PooledCounts)
[1] 14869 30
> colnames(PooledCounts)
Symbol
FBgn0000003 7SLRNA:CR32864
FBgn0000008 a
FBgn0000014 abd-A
FBgn0000015 Abd-B
115
edgeR User’s Guide
FBgn0000017 Abl
FBgn0000018 abo
keep
FALSE TRUE
2597 10995
116
edgeR User’s Guide
3
4
Leading logFC dim 2 (19%)
2
24
22
6
1
20
0
8
−1
10
18
−2
12
16
−3
14
−4 −2 0 2 4
(Intercept) X1 X2 X3
1 1 -0.4599 0.50183 -0.4599
2 1 -0.3763 0.22810 0.0418
3 1 -0.2927 0.00912 0.2927
4 1 -0.2091 -0.15511 0.3484
5 1 -0.1254 -0.26460 0.2648
6 1 -0.0418 -0.31935 0.0976
7 1 0.0418 -0.31935 -0.0976
8 1 0.1254 -0.26460 -0.2648
9 1 0.2091 -0.15511 -0.3484
10 1 0.2927 0.00912 -0.2927
11 1 0.3763 0.22810 -0.0418
12 1 0.4599 0.50183 0.4599
attr(,"assign")
[1] 0 1 1 1
Then the coefficients X1, X2 and X3 represent the linear, quadratic and cubic time effect,
respectively. Hypotheses can be tested for each one of the coefficients.
117
edgeR User’s Guide
To use a cubic regression spline curve with, say 3 degrees of freedom, a design matrix can
be constructed as follows.
> library(splines)
> X <- ns(Hours, df=3)
> design <- model.matrix(~ X)
> design
(Intercept) X1 X2 X3
1 1 0.0000 0.000 0.000
2 1 -0.0643 0.203 -0.135
3 1 -0.0995 0.380 -0.253
4 1 -0.0764 0.503 -0.335
5 1 0.0334 0.547 -0.365
6 1 0.2199 0.512 -0.333
7 1 0.4134 0.435 -0.247
8 1 0.5391 0.359 -0.114
9 1 0.5281 0.323 0.058
10 1 0.3806 0.332 0.260
11 1 0.1417 0.373 0.482
12 1 -0.1429 0.429 0.714
attr(,"assign")
[1] 0 1 1 1
Here the three coefficients do not have any particular meaning. Hypothesis testing would only
make sense if the three coefficients are assessed together. The advantage of using a cubic
spline curve is that it provides more stable fit at the end points compared to a polynomial.
The spline curve with 3 degrees of freedonm has 2 knots where cubic polynomials are splined
together. In general, choosing a number of degrees of freedom to be in range of 3-5 is
reasonable. Setting the degrees of freedom equal to 1 would be equivalent to simple linear
regression, i.e., a straight line trend.
[1] 0.446
> plotBCV(y)
118
edgeR User’s Guide
For the QL dispersions, estimation can be performed using the glmQLFit function. This returns
a DGEGLM object containing the estimated values of the GLM coefficients for each gene, as well
as the fitted mean-QL dispersion trend, the squeezed QL estimates and the prior degrees of
freedom (df). These can be visualized with the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)
119
edgeR User’s Guide
The topTags function lists the top set of genes with most significant time effects.
> tab <- as.data.frame(topTags(fit, n=30))
> tab
The total number of genes with significant (5% FDR) changes at different time points can
be examined with decideTests.
> summary(decideTests(fit))
X3-X2-X1
NotSig 1850
Sig 9145
Note that all three spline coefficients should be tested together in this way. It is not meaningful
to replace the F-tests with t-tests for the individual coefficients, and similarly thelogFC columns
of the top table do not have any interpretable meaning. The trends should instead be
interpreted by way of trend plots, as we show now.
120
edgeR User’s Guide
Finally, we visualize the fitted spline curves for the top four genes. We start by computing
the observed and fitted log-CPM values for each gene:
> logCPM.obs <- cpm(y, log=TRUE, prior.count=fit$prior.count)
> logCPM.fit <- cpm(fit, log=TRUE)
We then loop through the first four genes in the topTags table, plotting the observed and
fitted values for each gene:
> par(mfrow=c(2,2))
> for(i in 1:4) {
+ FlybaseID <- row.names(tab)[i]
+ Symbol <- tab$Symbol[i]
+ logCPM.obs.i <- logCPM.obs[FlybaseID,]
+ logCPM.fit.i <- logCPM.fit[FlybaseID,]
+ plot(Hours, logCPM.obs.i, ylab="log-CPM", main=Symbol, pch=16)
+ lines(Hours, logCPM.fit.i, col="red", lwd=2)
+ }
121
edgeR User’s Guide
amon CG4301
6
6
4
4
log−CPM
log−CPM
2
2
0
0
−2
−2
5 10 15 20 5 10 15 20
Hours Hours
up Mlc2
12
12
10
10
log−CPM
log−CPM
8
8
6
6
4
5 10 15 20 5 10 15 20
Hours Hours
> par(mfrow=c(1,1))
In each plot, the red curve shows the fitted log2-CPM for that genes while the black dots
show the observed log-CPM values. All four of the genes show increased expression during
embryo development, with an up trend especially during the period from 6hrs to 20hrs.
4.9.9 Setup
This analysis was conducted using the following software setup:
> sessionInfo()
122
edgeR User’s Guide
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
123
edgeR User’s Guide
The Seurat object contains single cell RNA-seq profiles of 24,751 cells from 13 individual
healthy donors.
> library(Seurat)
Attaching SeuratObject
> so
The t-SNE visualization of the integrated data is shown below. Cells are coloured by cluster
on the left and by donor on the right.
> p1 <- Seurat::DimPlot(so, reduction="tsne", cols=2:8)
> p2 <- Seurat::DimPlot(so, reduction="tsne", group.by="group")
> p1 | p2
124
edgeR User’s Guide
[1] 13527 89
125
edgeR User’s Guide
keep.samples
FALSE TRUE
21 68
keep.genes
FALSE TRUE
4561 8966
> summary(y$samples$norm.factors)
126
edgeR User’s Guide
MDS
2
Leading logFC dim 2 (12%)
1
0
cluster0
−1
cluster1
cluster2
cluster3
cluster4
−2
cluster5
cluster6
−1 0 1 2 3
127
edgeR User’s Guide
4 0 0 0 0 0
5 0 0 0 0 0
6 0 0 0 0 0
N_0230.17_total N_0233_total N_0275_total N_0288_total N_0342_total
1 0 0 0 0 0
2 0 0 0 0 0
3 0 0 0 0 0
4 0 0 0 0 0
5 0 0 0 0 0
6 0 0 0 0 0
N_0372_total
1 0
2 0
3 0
4 0
5 0
6 0
> dim(design)
[1] 68 19
[1] 0.0627
> plotBCV(y)
128
edgeR User’s Guide
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
The QL dispersions can be estimated using the glmQLFit function and visualized with plotQLD
isp.
129
edgeR User’s Guide
We then perform quasi-likelihood F-test for each testing contrast. The results are stored as
a list of DGELRT objects, one for each comparison.
> qlf <- list()
> for(i in 1:ncls){
+ qlf[[i]] <- glmQLFTest(fit, contrast=contr[,i])
+ qlf[[i]]$comparison <- paste0("cluster", levels(cluster)[i], "_vs_others")
+ }
The top most significant DE genes of cluster 0 vs other clusters can be examined with topTags.
Coefficient: cluster0_vs_others
gene logFC logCPM F PValue FDR
SRPX SRPX 4.09 6.47 700 3.12e-35 2.79e-31
LRP1 LRP1 4.54 5.41 630 1.64e-33 7.35e-30
SERPING1 SERPING1 3.44 7.02 563 8.98e-33 2.68e-29
PCOLCE PCOLCE 4.38 6.09 623 1.82e-32 4.09e-29
GAL GAL 4.16 6.89 609 2.97e-32 5.33e-29
FBLN1 FBLN1 5.90 6.64 663 1.20e-31 1.65e-28
CFH CFH 4.03 5.56 537 1.29e-31 1.65e-28
UAP1 UAP1 2.70 7.68 500 2.25e-31 2.52e-28
MXRA8 MXRA8 4.34 4.57 518 3.33e-31 3.31e-28
MRC2 MRC2 4.89 4.29 532 6.53e-31 5.60e-28
130
edgeR User’s Guide
cluster6_vs_others
Down 2010
NotSig 4822
Up 2134
A heat map is produced to visualize the top marker genes across all the pseudo-bulk samples.
131
edgeR User’s Guide
2 cluster
cluster
EBI3
ATP6V0B cluster 0
GPAT3
SEMA6B
FAM49B cluster 1
RHBDF2 1
TPP1
FERMT3 cluster 2
PDE4A
RAB20
PID1 cluster 3
EMP3
ALCAM
GK 0 cluster 4
ACSL1
RNF13
ARPC5
AKR1B1
cluster 5
RPS27
FYN
CHST12
cluster 6
EVL −1
CXCR4
CRYBG1
AKNA
STK4
CDC42SE2
RCAN3
SARAF
LEPROTL1 −2
KIAA1551
CNOT6L
RNF19A
CLEC2D
SMCHD1
PARP8
PIK3IP1
SC5D
FLT1
ACKR1
SOX17
MECOM
PCDH1
PIK3R3
CLIC4
SNAI1
TSC22D1
TIFA
ADGRL4
TIE1
CLEC14A
INHBB
FAM84B
HOXB9
VWF
SLCO2A1
ZNF706
GABARAPL2
BMX
ANGPT2
CALCRL
C2CD4B
DSP
ADGRG1
MEF2A
WNK1
NT5DC3
LAMA3
ACTG2
ELF3
KRT6B
EPCAM
S100A2
WFDC2
DMKN
KRT5
S100A14
SFN
KRT7
KRT8
TACSTD2
VEGFA
CTSL
TYMP
LDHB
RARRES2
FRMD6
TPBG
PDLIM4
SFRP1
IRX2
FHL2
WNT2
CLMP
EVA1A
CNIH3
ECM1
SLIT2
EGFR
SERPINF1
WISP2
CREB3L1
SVEP1
FAP
MXRA8
SFRP2
PCOLCE
PDGFRL
MCAM
PLN
NDUFS2
TPM2
MYL9
EFHD1
CYCS
FXYD1
SOD3
CPE
VASN
CRISPLD2
AGTR1
ENPEP
ZNF704
DTX1
PDPN
TGFB2
RAI2
RHEB
CPNE8
NUPR1
WWTR1
PHLDB2
COL18A1
ADAMTS4
COL4A2
COL4A1
CALD1
SELENOM
MAP1B
4.10.8 Setup
This analysis was conducted using the following software setup:
> sessionInfo()
132
edgeR User’s Guide
locale:
[1] LC_COLLATE=English_Australia.utf8 LC_CTYPE=English_Australia.utf8
[3] LC MONETARY=English Australia.utf8 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.utf8
133
edgeR User’s Guide
134
Bibliography
135
edgeR User’s Guide
12. Dunn, P.K. and Smyth, G.K. (2018). Generalized Linear Models With Examples in R.
Springer-Verlag, New York.
13. Feng, H., Conneely, K.N., and Wu, H. (2014). A Bayesian hierarchical model to detect
differentially methylated loci from single nucleotide resolution sequencing data. Nucleic
Acids Research 42, e69–e69.
14. Frazee, A.C., Langmead, B., and Leek, J.T. (2011). ReCount: a multi-experiment
resource of analysis-ready RNA-seq gene count datasets. BMC Bioinformatics 12, 449.
15. Fu, N.Y., Pal, B., Chen, Y., Jackling, F., Milevskiy, M., Vaillant, F., Capaldo, B., Guo,
F., Liu, K.H., Rios, A.C., Lim, N., Kueh, A.J., Virshup, D.M., Herold, M.J., Tucker,
H.O., Smyth, G.K., Lindeman, G.J., and Visvader, J.E. (2018). Foxp1 is indispensable
for ductal morphogenesis and controlling the exit of mammary stem cells from
quiescence. Genes and Development page Accepted 1 October 2018.
16. Fu, N.Y., Rios, A., Pal, B., Soetanto, R., Lun, A.T.L., Liu, K., Beck, T., Best, S.,
Vaillant, F., Bouillet, P., Strasser, A., Preiss, T., Smyth, G.K., Lindeman, G., , and
Visvader, J. (2015). EGF-mediated induction of Mcl-1 at the switch to lactation is
essential for alveolar cell survival. Nature Cell Biology 17, 365–375.
17. Gahurova, L., Tomizawa, S.i., Smallwood, S.A., Stewart-Morgan, K.R., Saadeh, H.,
Kim, J., Andrews, S.R., Chen, T., and Kelsey, G. (2017). Transcription and chromatin
determinants of de novo DNA methylation timing in oocytes. Epigenetics & chromatin
10, 25.
18. Graveley, B.R., Brooks, N., Carlson, J.W., Duff, M.O., Landolin, J.M., Yang, L.,
Artieri, G., van Baren, M.J., Boley, N., Booth, B.W., Brown, J.B., Cherbas, L., Davis,
C.A., Dobin, A., Li, R., Lin, W., Malone, J.H., Mattiuzzo, N.R., Miller, D., Sturgill, D.,
Tuch, B.B., Zaleski, C., Zhang, D., Blanchette, M., and Dudoit, S. (2011). The
developmental transcriptome of drosophila melanogaster. Nature 471, 473–479.
19. Hansen, K.D., Irizarry, R.A., and Zhijin, W. (2012). Removing technical variability in
RNA-seq data using conditional quantile normalization. Biostatistics 13, 204–216.
20. International HapMap Consortium, T. (2005). A haplotype map of the human genome.
Nature 437, 1299–1320.
21. Krueger, F. and Andrews, S.R. (2011). Bismark: a flexible aligner and methylation
caller for Bisulfite-Seq applications. bioinformatics 27, 1571–1572.
22. Law, C.W., Chen, Y., Shi, W., and Smyth, G.K. (2014). Voom: precision weights
unlock linear model analysis tools for RNA-seq read counts. Genome Biology 15, R29.
23. Liao, Y., Smyth, G.K., and Shi, W. (2013). The Subread aligner: fast, accurate and
scalable read mapping by seed-and-vote. Nucleic Acids Research 41, e108.
24. Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general-purpose
read summarization program. Bioinformatics 30, 923–930.
25. Liao, Y., Smyth, G.K., and Shi, W. (2019). The R package Rsubread is easier, faster,
cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic
Acids Research 47, e47.
26. Lun, A.T.L., Chen, Y., and Smyth, G.K. (2016). It’s DE-licious: a recipe for differential
expression analyses of RNA-seq experiments using quasi-likelihood methods in edgeR.
Methods in Molecular Biology 1418, 391–416.
136
edgeR User’s Guide
27. Lund, S., Nettleton, D., McCarthy, D., and Smyth, G. (2012). Detecting differential
expression in RNA-sequence data using quasi-likelihood with shrunken dispersion
estimates. Statistical Applications in Genetics and Molecular Biology 11, Article
Number 8.
28. Marioni, J.C., Mason, C.E., Mane, S.M., Stephens, M., and Gilad, Y. (2008). RNA-seq:
An assessment of technical reproducibility and comparison with gene expression arrays.
Genome Res 18, 1509–1517.
29. McCarthy, D.J., Chen, Y., and Smyth, G.K. (2012). Differential expression analysis of
multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids
Research 40, 4288–4297.
30. McCarthy, D.J. and Smyth, G.K. (2009). Testing significance relative to a fold-change
threshold is a TREAT. Bioinformatics 25, 765–771.
31. Meissner, A., Gnirke, A., Bell, G.W., Ramsahoye, B., Lander, E.S., and Jaenisch, R.
(2005). Reduced representation bisulfite sequencing for comparative high-resolution
DNA methylation analysis. Nucleic acids research 33, 5868–5877.
32. Pal, B., Chen, Y., Vaillant, F., Capaldo, B.D., Joyce, R., Song, X., Bryant, V.,
Penington, J.S., Di-Stefano, L., Ribera, N.T., Wilcox, S., Mann, G.B., kConFab,
Papenfuss, A.T., Lindeman, G.J., Smyth, G.K., and Visvader, J.E. (2021). A single-cell
RNA atlas of human breast spanning normal, preneoplastic and tumorigenic states.
EMBO Journal 40, e107333.
33. Patro, R., Duggal, G., Love, M.I., Irizarry, R.A., and Kingsford, C. (2017). Salmon
provides fast and bias-aware quantification of transcript expression. Nature Methods
14, 417.
34. Phipson, B., Lee, S., Majewski, I.J., Alexander, W.S., and Smyth, G.K. (2016). Robust
hyperparameter estimation protects against hypervariable genes and improves power to
detect differential expression. Annals of Applied Statistics 10, 946–963.
35. Pickrell, J.K., Marioni, J.C., Pai, A.A., Degner, J.F., Engelhardt, B.E., Nkadori, E.,
Veyrieras, J.B., Stephens, M., Gilad, Y., and Pritchard, J.K. (2010). Understanding
mechanisms underlying human gene expression variation with RNA sequencing. Nature
464, 768–772.
36. Pickrell, J.K., Pai, A.A., Gilad, Y., and Pritchard, J.K. (2010). Noisy splicing drives
mRNA isoform diversity in human cells. PLoS Genetics 6, e1001236.
37. Risso, D., Schwartz, K., Sherlock, G., and Dudoit, S. (2011). GC-content normalization
for RNA-Seq data. BMC Bioinformatics 12, 480.
38. Robinson, M., McCarthy, D., and Smyth, G. (2010). edgeR: a Bioconductor package
for differential expression analysis of digital gene expression data. Bioinformatics 26,
139–140.
39. Robinson, M.D. and Oshlack, A. (2010). A scaling normalization method for
differential expression analysis of RNA-seq data. Genome Biology 11, R25.
40. Robinson, M.D. and Smyth, G.K. (2007). Moderated statistical tests for assessing
differences in tag abundance. Bioinformatics 23, 2881–2887.
41. Robinson, M.D. and Smyth, G.K. (2008). Small-sample estimation of negative binomial
dispersion, with applications to SAGE data. Biostatistics 9, 321–332.
137
edgeR User’s Guide
42. Schübeler, D. (2015). Function and information content of DNA methylation. Nature
517, 321–326.
43. Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl,
D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014). Genome-scale
CRISPR-Cas9 knockout screening in human cells. Science 343, 84–7.
44. Smyth, G.K. (2004). Linear models and empirical Bayes methods for assessing
differential expression in microarray experiments. Statistical Applications in Genetics
and Molecular Biology 3, Article 3.
45. Stuart, T., Butler, A., Hoffman, P., Hafemeister, C., Papalexi, E., Mauck III, W.M.,
Hao, Y., Stoeckius, M., Smibert, P., and Satija, R. (2019). Comprehensive integration
of single-cell data. Cell 177, 1888–1902.
46. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette,
M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and Mesirov, J.P.
(2005). Gene set enrichment analysis: a knowledge-based approach for interpreting
genome-wide expression profiles. Proc Natl Acad Sci USA 102, 15545–50.
47. Tuch, B.B., Laborde, R.R., Xu, X., Gu, J., Chung, C.B., Monighetti, C.K., Stanley, S.J.,
Olsen, K.D., Kasperbauer, J.L., Moore, E.J., Broomer, A.J., Tan, R., Brzoska, P.M.,
Muller, M.W., Siddiqui, A.S., Asmann, Y.W., Sun, Y., Kuersten, S., Barker, M.A.,
Vega, F.M.D.L., and Smith, D.I. (2010). Tumor transcriptome sequencing reveals allelic
expression imbalances associated with copy number alterations. PLoS ONE 5, e9317.
48. Wu, D., Lim, E., Vaillant, F., Asselin-Labat, M., Visvader, J., and Smyth, G. (2010).
ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics 26,
2176–2182.
49. Wu, D. and Smyth, G. (2012). Camera: a competitive gene set test accounting for
inter-gene correlation. Nucleic Acids Research 40, e133.
138