10

Science
Quarter 3 - Module 2:
Reproductive System

AIRs - LM
Science
Quarter 3 – Week 2 - Module 2: Reproductive System
Edition, 2021

Copyright © 2021
La Union Schools Division
Region I

All rights reserved. No part of this module may be reproduced in any form
without written permission from the copyright owners.

Development Team of the Module

Author: Harvey R. Asis T-III

Editor: SDO La Union, Learning Resource Quality Assurance Team
Illustrator: Ernesto F. Ramos, Jr., P II

Management Team:

Atty. Donato D. Balderas, Jr.

Schools Division Superintendent

Vivian Luz S. Pagatpatan, Ph.D

Assistant Schools Division Superintendent

German E. Flora, Ph.D, CID Chief

Virgilio C. Boado, Ph.D, EPS in Charge of LRMS

Rominel S. Sobremonte, Ed.D, EPS in Charge of Science

Michael Jason D. Morales, PDO II

Claire P. Toluyen, Librarian II

 Target

In this module, you will understand that human reproductive system and
the effect of hormones. Going through this module will make you understand what
is happening in female reproductive system during menstruation.

For most living creatures, reproduction is basically a normal process

controlled by hormones. Even though human reproduction is also controlled by
hormones, the process is rather more complicated. Unlike other organisms such as
plants and animals, you can make decisions about reproduction. What influence
these decisions are your values, emotions, expectations, and goals. However, like any
other living things, humans depend on reproduction for the survival of the species.
If people stop to reproduce, the human species would become extinct.

After going through this module, you are expected to attain the following objectives:

Learning Competency

• Describe the feedback mechanism involved in regulating processes in female

reproductive system (e.g., menstrual cycle) (S10LT-IIIc-35)

Subtasks:

1. Identify the different parts and functions of the male and female reproductive
system.

2. Explain the role of hormones in female and male reproductive system.

3. Explain the feedback mechanisms involved in regulating process in the

female reproductive system;
Pre-test
A. Choose the letter of the best answer. Write the chosen letter on a separate sheet
of paper.
1. What happens when the penis or clitoris filling with blood and getting harder
and larger?
A. Ejaculation B. Erection C. Imagination D. Reproduction

2. What do you call to the outside parts of the male's or female's reproductive
system?
A. Genitals B. Gonads C. Urethra D. Uterus

3. What is ejaculation during sleep means?

A. Nocturnal Dreaming B. Nocturnal Emission
C. Night Sweats D. Night Concepcion

4. What is the process of fertilization and implantation?

A. Concepcion B. Fertilization C. Implantation D. Reproduction

5. This is known as a cell from a woman’s body that can start pregnancy.
A. Ovary B. Ovum C. Sperm D. Zygote

B. Matching Type. Match the definition on column A to the correct terminologies on

column B. Write in a separate sheet of paper the correct letter of your answer.

____1. A cell from a man's body that can start a

A. circumcision
pregnancy
____2. An operation to remove the foreskin from the penis B. ejaculation
____3. The meeting of the sperm and ovum
____4. The penis being inside the vagina C. fertilization
____5. The gland in the brain that triggers puberty D. implantation
____6. A ripe ovum coming out of the ovary
____7. Semen coming out of the penis E. intercourse
____8. The nesting of a fertilized egg in the wall of the F. menstruation
uterus
____9. The body beginning to change from a child's into G. ovulation
an adult's H. pituitary
____ 10. The liquid that carries sperm
I. puberty
J. semen
K. sperm
 REPRODUCTIVE SYSTEM
Q

The system involved in sexual reproduction is called the reproductive system. There
is a striking difference between the male and the female reproductive systems, although
they also share a number of similarities. For example, the reproductive organs of the
male and female are developed from the same embryological structures, and some
hormones are commonly found in both male and female, in varying quantities and
produce different responses.

Jumpstart

Activity 1
Loop the word.
Direction: Encircle the word in the given puzzle that are arranged diagonally, horizontally
and vertically. Refer to the word related to the parts of male and female reproductive organ
that is shown inside the box.

Cervix Epididymis Hormone Labia Menstruation

Ovaries Progesterone Scrotum Testicles Testis
Urethra Uterus Vagina Vas Deferens Vulva
 Discover

The Reproductive System

The system involved in sexual reproduction is called the reproductive system.

There is a striking difference between the male and the female reproductive systems,
although they also share a Number of similarities. For example, the reproductive
organs of the male and female are enveloped from the same embryological structures,
and some hormones are commonly found in both male and female, in varying quantities
and produce different responses

Fig. 1 Parts of Male Reproductive System

https://media.springernature.com/original/springer-static/image/chp%3A10.1007%2F978-981-10-4017-
7_1/MediaObjects/421031_1_En_1_Fig5_HTML.gif

Examine the diagram of the male reproductive system. Figure 8 shows the main
parts of the male reproductive system. The cross-sectional side view of the reproductive
system shows that certain parts of the male reproductive system are also part of the
excretory system.

Part Function Part Function

Testis Produces sperm cells
Scrotum Sac of skin that holds the testis
Penis Deposits sperms into the vagina during mating
Vas deferens (Tube) Carries sperm from testes to urethra
Urethra Carries sperm and urine out of the body
Glands Provide liquid in which sperm can swim
a. seminal vesicle - Secretes a fluid that makes up most of the
components of the semen
b. prostate gland - Secretes a slightly alkaline milky fluid that is
discharged as part of the semen
c. bulbourethral gland - Secretes a thick and clear mucus that lubricates
and neutralizes the any trace of acidic urine in the
urethra
The Female Reproductive System

The female reproductive system has the following functions:

1. Produces female sex cells
2. Receives sperm cells from the male
3. Nurtures the development of and provides nourishment for the new individual

Examine the diagram on Figure 2 and 3 which shows the side view and internal
view of the female reproductive system. The female reproductive system consists of the
ovaries, oviducts (Fallopian tubes), uterus, vagina, and external genitalia. The internal
reproductive organs of the female are located within the pelvis, between the urinary
bladder and rectum. The uterus and the vagina are in the middle part, with an ovary
on each side of the uterus.

Figure 2. Parts of the Female Reproductive System

https://www.accessscience.com/media/EST/media/581500FG0020.jpg

Figure 3. Parts of the Female Reproductive System

https://www.slideteam.net/media/catalog/product/cache/960x720/0/5/0514_female_reproductive_sy
stem_medical_images_for_powerpoint_Slide01_1.jpg
Now, study the function of each part.
Part Function
Ovary produces egg cells
Oviduct serves as passageway of eggs from the
ovary to the uterus; site of egg
fertilization
Uterus serves as site of egg implantation; is
where the fertilized egg develops
Vagina receives the penis of male during mating

Puberty involves the onset of sexual maturity and the ability to reproduce. When
a female reaches puberty, egg cells start to develop in her ovaries that produce the sex
cells. It is also the time when the body develops the capacity to conceive.

The Role of Hormones in Female and Male Reproductive Systems

The male reproductive system also has prostate glands. Chemicals from these
glands nourish the sperm cells and help them mature. The production of sperm cells
and the release of semen can be regulated by hormones or special chemicals that
come from the testis, the brain and the pituitary gland (refer to Figure 4). These
hormones keep the reproductive system properly functioning.

Figure 4. Pituitary gland controls the function of the testes.

Source: https://www.khanacademy.org/science/reproductivesystem

The female reproductive system, just like the male reproductive system, is also
regulated by hormones. The follicles produce hormones that control the growth and
release of eggs from the ovaries. While other hormones prepare the uterus so a baby
can grow in it, other hormones still control the stretching of the uterus during
pregnancy.

Figure 5. Pituitary gland controls the function of the ovaries.

Source: https://www.khanacademy.org/science/reproductivesystem
 Feedback Mechanisms Involved in Regulating Processes in the Female
Reproductive System

The Menstrual Cycle

We have learned that, on average, an ovary releases only one egg every 28 days.
Now, what controls this timing? Hormones control many of the changes in the
reproductive system. Remember that hormones are chemicals that affect certain body
organs. The monthly changes that take place in the female reproductive system are
called menstruation. This cycle occurs every month from the first onset which could
happen when a female is between 10 to 13 years old. The monthly cycle continues for
about 40 years. Refer to Figure 6 for a clearer explanation of the different events that
take place in the cycle. Just follow numbers 1-10 in proper order.

Figure 6. The menstrual cycle

Source: https://www.khanacademy.org/science/reproductivesystem

To summarize, the important events during the menstrual cycle are as follows:

1. The pituitary gland controls and starts the cycle.

2. The pituitary gland releases hormones that cause the egg in the ovary to mature.
The luteinizing hormone (LH) initiates the maturation of the follicles, converts
ruptured follicles into corpus luteum and causes the secretion of progesterone. The
follicle stimulating hormone (FSH) assists in the maturation of the follicles and
causes the secretion of estrogen from the follicles.
 Explore
As you perform Activity 2, you’ll be able to understand the feedback
mechanisms in the female reproductive system.

Activity 2: Mark My Calendar!

Objective:
Describe the feedback mechanisms involved in regulating processes in the female
reproductive system

Materials:
• 2 calendar charts • scissors
• diagrams of the male and female reproductive system • tape or glue

Procedure:
Part A - For no fertilization:
1. Get a calendar, with an approximate size of 8 x 11 inches. It must be marked by
the day-to-day changes in the menstrual cycle.
2. Note that certain events are marked on certain days.
3. Make a copy of the diagrams of the menstrual cycle like in Figure 6. Some of the
diagrams will show events in the ovary, and some will show events in the uterus. They
are not in proper order. Cut out each square.

Figure 6. Unsequenced events in the menstrual cycle

Source: https://www.khanacademy.org/science/reproductivesystem

4. Place the diagram in the space to the right of the corresponding description.
5. Tape or glue your diagrams in right places/dates where they occur.
6. Make sure that they are correctly placed.

Part B – With fertilization of the egg

1. Get another calendar marked by the day-to-day changes in the menstrual cycle.
2. You will be given a set of diagrams to place on the calendar. The diagrams will not
be in proper order. You may not need all the diagrams that show the uterus.
Guide Questions:
Q1. How long does a regular menstrual cycle last?
Q2. Describe what happens to an egg during the first 14 days of the cycle in Part A.
Q3. Describe what happens to the egg if fertilization occurs.
Q4. Explain what takes place in the uterus after fertilization.
Q5. Why is it important to study the menstrual cycle?

Deepen

Activity 3: Contraceptive Measures

Goal: Your objective is to present information to the public about the common and
effective contraceptive measures used in family planning, in line with the Reproductive
Health Law. The video that you will create must be in persuasive form. The challenge
is how you will be able to convince people about the benefits of various contraceptive
measures using gathered facts and scientific evidences.

Role: Assume the role of a professional video production team. You are tasked to
produce a promotional video that will be used in campaign advertising about various
contraceptive measures used in family planning.

Audience: Your voice, as part of the youth, will be heard through your campaign
advertising. After that, you may also opt to use social media advertising to let other
people view your multimedia presentation. It is important to clearly communicate your
purpose from the beginning of the video.

Situation: Campaign advertising is often accomplished by combining a short message

with a catchy tune that people are likely to remember. Since one of the most powerful
means of communicating information today is through music, you may persuasively
share your thoughts and ideas on the topic using a chosen melody. After studying the
coordinated functions of the reproductive, endocrine, and nervous systems, you will be
able to use scientific and logical explanations in promoting various contraceptive
measures. There are challenges to overcome in accomplishing the task such as the
conflicting judgments of people on the issue that may cause various controversies.
Therefore, it is important to be objective in presenting ideas rather than being
subjective.

Product/Performance: Produce a campaign advertising video that presents common

and effective contraceptive measures used in family planning. The maximum video
duration is three (3) minutes. You may seek assistance from your teacher in MAPEH
regarding the tune, rhythm and beats of the music. For the rhyme and wordplay to be
used, you may consult your teacher in English.
Rubrics: Contraceptive Measures

CATEGORY 4 3 2 1
The video The video does
The video
The video clearly communicates not
indirectly
communicates the some of the sufficiently
communicates
Presentation main idea, important communicate
the idea, and
and is strongly ideas, and any idea that
is hardly
persuasive is slightly can persuade
persuasive
persuasive the audience
All the wordings All the The wordings
and melody reflect wordings and and melody
The wordings
an melody reflectwere made by
and melody
Creativity and exceptional degree an the student
were not
Originality of exceptional but were
made by the
students’ degree of copied from
students’ student.
ingenuity in their the ideas of
ingenuity in creation.
their creation others.
Most of the Some The contents of
The contents of the contents of contents in the video are
Accuracy and
video are accurate the video are the video are neither
Relevance of
and accurate and accurate and accurate nor
the Content
related to the topic. related to the related to the related to the
topic. topic. topic.
The campaign
Required
advertising
Elements All required Few required Required
includes all
(persuasiveness, elements are elements are elements are
required
musicality, included. included. missing.
elements as well as
language, etc.)
additional details.
 Gauge

Direction: Choose the letter of the best answer. Write the chosen letter on a separate
sheet of paper.
1. Where does the sperm production begin?
A. Ejaculatory duct B. Epididymis
C. Seminiferous tubules D. Vas Deferens

2. What do you call the cell produced by fertilization?

A. Embryo B. Fetus C. Gamete D. Zygote

3. What stimulates the production of testosterone in the interstitial cells?

A. Follicle Stimulating Hormone B. Inhibin
C. Luteinizing Hormone D. Progesterone

4. Where does sperm maturation occur?

A. Epididymis B. Seminiferous tubules
C. Urethra D. Vas Deferens

5. What do you call the layer of the uterine wall that is shed during
menstruation?
A. Endometrium B. Epimetrium
C. Myometrium D. None of the above

6. What do you call the collective external genitalia of the female?

A. Clitoris B. Labia C. Mons pubis D. Vulva

7. What hormone works with estrogen to prepare the endometrium

for implantation of fertilized egg?
A. ADH B. FSH C. LH D. Progesterone

8. What is the average menstrual cycle?

A. 14 days B. 18 days C. 28 days D. 30 days

9. What structure can be seen between the uterus and the vagina?
A. Cervix B. Hymen C. Uterine tube D. Vulva

10. What hormone stimulates uterine contractions?

A. Estrogen B. Granular cell carcinoma
C. Oxytocin D. Progesterone

11. What is the function of urethra?

A. carry only urine
B. carry only semen
C. carry a mixture of urine and semen
D. carry both semen and urine but not at the same time
12. What other causes of female infertility besides hormonal problems,
blocked at fallopian tube?
A. A cold B. Lack of appetite
C. STD’s D. Irregular menstrual cycle

13. What is the other external male reproductive organ other than the
penis?
A. Urethra B. Prostate C. Scrotum D. Seminal Vesicle

14. What are the external female reproductive organs

A. The labia majora, labia minora and the mons pubis
B. The hymen, vaginal opening and the uterus
C. The vaginal opening, the labia majora and the clitoris
D. The hymen, clitoris and the ovaries.

15. What is the result of menstrual cycle?

A. The female body preparing to give birth
B. The female body is preparing to produce milk
C. The female body is preparing for pregnancy
D. The female body is preparing for old age.
Learner’s Copy (Detach from the module)

NAME:_____________________________________
GRADE AND SECTION: ______________________________
QUARTER 3 MODULE 2

Activity 1
Loop the word.
Direction: Encircle the word in the given puzzle that are arranged diagonally, horizontally
and vertically. Refer to the word related to the parts of male and female reproductive organ
that is shown inside the box.

Cervix Epididymis Hormone Labia Menstruation

Ovaries Progesterone Scrotum Testicles Testis
Urethra Uterus Vagina Vas Deferens Vulva
NAME:_____________________________________
GRADE AND SECTION: ______________________________
QUARTER 3 MODULE 2
10

Science
Quarter 3 – Week 3 - Module: 3
NERVOUS SYSTEM: The Control
System of the Body

AIRs - LM
Science 10
Quarter 3 – Week 3 - Module 3: Nervous System: The Control
System of the Body

First Edition, 2021

Copyright © 2021
La Union Schools Division
Region I

All rights reserved. No part of this module may be reproduced in any form
without written permission from the copyright owners.

Development Team of the Module

Author: Louie Jacob

Editor: SDO La Union, Learning Resource Quality Assurance Team
Illustrator: Ernesto F. Ramos, Jr., P II

Management Team:

Atty. Donato D. Balderas, Jr.

Schools Division Superintendent

Vivian Luz S. Pagatpatan, Ph.D

Assistant Schools Division Superintendent

German E. Flora, Ph.D, CID Chief

Virgilio C. Boado, Ph.D, EPS in Charge of LRMS

Rominel S. Sobremonte, Ed.D, EPS in Charge of Science

Michael Jason D. Morales, PDO II

Claire P. Toluyen, Librarian II

 Target
Everything in the body is controlled by the nervous system, whether it be a
conscious or unconscious action, reaction, or event. This complex system is
composed of nerve cells or neurons, and functions to receive information from the
environment and other parts of the body, to interpret the information, and to make
the body respond to such stimulus.

Take note that our body is made up of different systems that coordinate with one
another in order to perform their functions well; if any part of these organ systems
malfunctions, the body will become unbalanced.

This learning material will enable you to show understanding of the organisms
as having feedback mechanisms, which are coordinated by the nervous system. You
will also understand how these feedback mechanisms help the organism maintain
homeostasis.

After going through this learning material, you are expected to attain the
following objectives:
1. Describe how the nervous system coordinates and regulates these feedback
mechanisms to maintain homeostasis (S10LT-IIIc-36);
2. Describe the parts of the nervous system and their functions; and
3. Describe how the nervous system coordinates and regulates feedback
mechanisms to maintain homeostasis.
Before going on, check how much you know about this topic. Answer the
pretest on the next page in a separate sheet of paper.

Pre-Test
Directions: Read each item carefully. Choose the letter of the
best answer.

1. What organs make up the Central Nervous System (CNS)?

A. Brain and heat
B. Brain and spinal cord
C. Heart and Spinal cord
D. Spinal cord and lungs

2. Which division of the nervous system contains all the nerves outside the brain
and spinal cord?
A. Appendicular Nervous system
B. Axial Nervous System
C. Central Nervous System
D. Peripheral Nervous System

3. Which branch of the nervous system receives sensory information and

controls muscle movements?
A. Autonomic
B. Central
C. Sensory motor
D. Somatic
4. The autonomic nervous system is a subdivision of the _____.
A. central nervous system
B. parasympathetic nervous system
C. peripheral nervous system
D. sympathetic nervous system

5. What type of nerve cells detect the conditions in the body’s environment?
A. Sensors
B. Neurons
C. Synapses
D. Receptors

6. The nerve cells that relay signals from the central nervous system to the other
parts of the body are _____.
A. sensory neurons
B. interneurons
C. motor neurons
D. messenger neurons

7. Which part of a nerve cell transmits signals from the body of the cell to other
nerve cells?
A. Axon
B. Dendrite
C. Ganglion
D. Synapse

8. The nerves that branch directly from the brain stem and transmit nerve
signals to and from the eyes, ears, mouth, face, and scalp are the ____.
A. cerebral ganglia
B. cranial nerves
C. meninges
D. spinal nerves

9. Which part of the brain controls breathing and hear beat?

A. Brain stem
B. Cerebellum
C. Cerebrum
D. Medulla oblongata

10. Which part of the brain where most thoughts, memories, voluntary actions,
and intelligence occur?
A. Brain stem
B. Cerebellum
C. Cerebrum
D. Medulla oblongata
11. Mario went home drunk from a party, which part of his brain controls his
motion, balance, and coordination?
A. Cerebellum
B. Cerebrum
C. Diencephalon
D. Medulla oblongata

12. Carl Accidentally touched a hot iron. Upon touching the iron, he pulled his
arm right away. Which of the following best explains this situation?
A. Carl was aware that the iron was hot.
B. Carl’s reflex action caused him to pull his arm quickly.
C. Carl’s brain sent a message to his arm that the iron is hot.
D. Carl is intelligent enough to pull his arm from the iron.

13. Which of the following is/are the correct descriptions of nerve impulse?
I. A neve impulse is a flow of electricity
II. A nerve impulse can jump from one neuron to another
III. A nerve impulse is combination of an electrical charge and chemical
reaction
IV. A nerve impulse from one neuron is stimulated in the next dendrite
because of neurotransmitter that crosses the synapse

A. I and II
B. II and III
C. III and IV
D. II and IV

14. A nerve impulse is a high – speed signal that passes along the axon. Which
part of the neuron is the point of entry of a nerve impulse?
A. Axon terminal
B. Dendrite
C. Nucleus
D. Schwann cell

15. Cerebral palsy affects neurons in which part of the body?

A. Brian
B. Spinal cord
C. Muscle
D. Nerve
 Jumpstart

Activity 1: Word Search

Direction: Below is a word search puzzle. Find the words related to Nervous System
listed below by encircling the words. The words may be written horizontally, vertically

Great job! As you continue with

the lesson, you will see if your
answers are correct!

Axon Cell body Nerves Spinal Nerves

Brain Cranial Nerves Nervous System Stimulus
Brainstem Dendrites Neurons Synapse
Cerebellum Interneuron Sensory Neurons
Cerebrum Motor Neuron Spinal cord

Notes to the Teacher

Please provide an extra copy of this page for students’ use.
 Discover
The Nervous System controls and coordinates all essential functions of the
body. It sends special signals to and receives responses from every organ and tissue
of the body and allowing the body to maintain homeostasis or its delicate balance.
This system makes it possible for you to process information discussed by your
teacher, raise your hands, or simply avoid getting burned.

Functions of the Nervous System

1. Gathers information from both inside and outside the body- Sensory Function
2. Transmits information to the processing areas of the brain and spine
3. Processes the information in the brain and spine – Integration Function
4. Sends information to the muscles, glands, and organs so they can respond
appropriately – Motor Function

The Nervous System is divided into two main divisions: Central Nervous
System (CNS) and the Peripheral Nervous System (PNS)

1. Central Nervous System (CNS) - the central nervous system serves as the
main processing center for the entire nervous system. It consists of two
components:
a. Brain – acts as the control center of the body. It is connected with sensors
that detects changes in our environment. The three main parts of the brain
are:
Cerebrum – the largest part of the brain is the cerebrum. It receives, stores
and recalls all the information the body picks up. Cognitive processes such
as thinking, memorizing and decision making occur in the outer gray part
of the cerebrum, which is called the cerebral cortex. Cortex means
“covering.” The inner white part of the cerebrum relays electrical signals to
other parts of the brain

Cerebellum – the cerebellum is a highly folded mass of nerve tissue located

just below the cerebrum. It controls muscle coordination and balance.
When you play basketball, the cerebellum helps you in making your
moves. Imagine a drunken man walking. He sways in an unbalanced,
uncoordinated way. That is how you would be if your cerebellum were not
working

Brain stem – The brainstem is the hind part of the brain. It holds the
medulla oblongata and the pons. The medulla oblongata or medulla
transmits signals between the spinal cord and the brain. It also controls
autonomic or involuntary functions such as heartbeat and breathing. The
pons is partly made up of tracts that connect the spinal cord with higher
brain levels. It also contains cell groups that transfer information from the
cerebrum to the cerebellum.
 https://www.nbia.ca/brain-structure-function/

b. Spinal cord – link between the brain and the nerves in the rest of the body.
It also controls basic musculoskeletal reflexes without input coming from
the brain. Without the spinal cord, the brain could not receive nor send
information. Without the spinal cord, the brain would lose its ability to
control the body

https://www.seattlecca.org/diseases/brain-spinal-cord-cancers/facts

2. Peripheral Nervous System (PNS) – the peripheral nervous system is a

collection of nerves that connect the brain and spinal cord to other parts of
the body and the external environment. It is subdivided into the somatic
nervous system and the autonomic nervous system.
a. Somatic Nervous System – responsible for carrying motor and sensory
information (voluntary movements). It is made up of nerves that connect
to the skin, sensory organ, and skeletal muscles.
 Spinal Nerves – (12 pairs) the nerves that carry motor and sensory signals
between the spinal cord and the body.

Cranial Nerves – (31 pairs) the nerve fibers that carry information into and
out of the brain stem.

b. Autonomic nervous System – works on an involuntary control of body

movements. It has two divisions:
Sympathetic Nervous System – impulses propagated in this system
prepare the body for an emergency. (increased heart rate and breathing,
dilation of pupil, sweating)

Parasympathetic Nervous System – impulses in this system return the

body to normal or relax mode after an emergency has occurred.

https://my.clevelandclinic.org/health/diseases/14737-neuropathy

The Nerve Cell (Neuron)

The basic unit of the nervous system. Neurons have the special ability to carry
signals or impulses. Cell body, dendrites and axon are the basic parts of a neuron.
The dendrites carry impulses towards the cell body while the axon carries
impulses away from the cell body.

The fibers that branch out from the nerve cell are the dendrites. These fibers
pick up information from the receptors. (Receptors are parts of the body, either
nerves or sense organs, that can pick up stimuli from the environment or from within
the body).
 The information received by the dendrites is then carried to the cell body or
soma in the form of an electrical signal. The cell body contains the nucleus of the cell
as well as other structures that help keep the cell alive.

https://www.sciencefacts.net/parts-of-a-neuron.html

A nerve impulse is an electrochemical signal moving along a neuron. The space

between neurons is called synapse. A stimulus is any factor in the environment that
influences behavior. A response is a reaction to a condition or stimulus. An organism
must be able to respond to a stimulus in order to survive. Reaction time is the length
of time between application of a stimulus and detection of a response.

The electrical signal continues along the cell body and moves to a single, long
fiber called an axon. From the axon, the electrical signal is transmitted to another
nerve cell. Between the axon of one cell and the dendrite of another is a small gap
called synapse. When the electrical signal reaches the tip of the axon of one cell, a
chemical spill into the synapse. This chemical receives and carries the electrical
signal to the dendrite of the next nerve cell.

https://www.researchgate.net/figure/A-diagram-showing-a-neuron-making-a-
synaptic-connection-with-another-neuron_fig1_258023902
 When a receptor such as an organ perceives a stimulus, the impulse is sent to
the brain by the sensory neurons, which then transmit information from one nerve
cell to another. As the message reaches the brain, it processes the information and
commands an effector such as a muscle or an organ to respond. The message
coming from the brain is sent through the motor neurons.

Three Types of Neurons

1. Sensory neurons - These are the type of neurons that are activated by external
physical or chemical stimuli. This, therefore, involves sensory activation of
any of the five senses (feel, smell, sound, sight, hear).

2. Motor Neurons - Motor neurons are the type of neurons in the spinal cord that
connects the organs, muscles and different types of glands in the body. As
such, they function to transmit impulses from the Central Nervous System to
the organs, glands, and muscles. This, in turn, controls the movement of
different types of muscles as well as the activity of organs and glands in the
body. Motor neurons are composed of multipolar neurons.

3. Intermediate neurons - These are the type of neurons that connect the motor
neurons to the sensory neurons thus allowing for signals to be transmitted
between the two. Like motor neurons, this system is composed of multipolar
neurons.
 Explore
Enrichment Activity 1: The Nervous Break Down!
Directions: Using the given graphic organizer, fill in the missing parts to complete
the entire concept showing the structure of the nervous system.

(Adapted from DepEd Project EASE, Module 9: Life Support Systems, pp. 4-6)

Guide Questions:
1. How will you differentiate the Central Nervous System (CNS) and the Peripheral
Nervous System (PNS) in terms of their functions?

2. What might happen to the human body if one part of the nervous system fails to
carry out its function properly?
Enrichment Activity 2: One for all, All for One
Direction: Number the comic strips from 1-8 to complete the pathway of the nerve
impulse.

A big snake is moving Yes, I see it too. I’ll inform

towards me! Oh no! (__) the rest. (__)

Hey, miss spinal

cord! My brother
says eye sees a
snake moving
towards him! (__)

Snake? Uhuh?
Really?! One moment
please and I’ll pass the
message to Ms. Brain.
Thanks Brain! Hey motor (__)
neurons! Can you please do
a favor for me? Please tell
the “legs” to run away.
Thank you! (__)

Sure, sister spinal cord…

at your service anytime.
(__)

W hat's your message

spinal cord? (“eye” sees a
big snake”) Okay,
okay...calm down...tell
the “legs” to run away.
( __)

...as the motor neurons

followed the request,
the “legs” ran away
(__)

LR Portal. (n.d.). Deped LR Portal. Retrieved December 18, 2020, from

https://lrmds.deped.gov.ph/detail/6400
 Deepen

At this point you are now ready for your last activity. Remember the things that
you learned in this lesson. Good luck!!!

Direction: Discuss each of the following questions briefly.

Scoring Rubrics

2 Discussions are conceptually complete

1 Discussions are conceptually incomplete
0 There were no discussions shown

1. What is the function of the spinal cord?

___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

2. How does the Central Nervous System (CNS) function similarly to the Central
Processing Unit (CPU) of a computer?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

3. What will likely to happen if one of the neurons will not pass on the message?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

4. Summarize the events involved in the synaptic transmission of a nerve

impulse.
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
 Gauge

Directions: Read each item carefully. Choose the letter of the best answer.

1. Which is NOT a part of the central nervous system?

A. Cranial nerves
B. Hypothalamus
C. Spinal cord
D. Thalamus

2. Which of the following can conduct impulses away from the neuron’s cell body
or toward it?
A. Axon
B. Dendrite
C. Both A and B
D. Neither A or B

3. Jonathan is playing chess with Jan Lloyd. Which part of his brain is working
while thinking of his next move?
A. Cerebellum
B. Cerebrum
C. Diencephalon
D. Medulla Oblongata

4. Which part of the brain control the involuntary physiologic activities such as
digestion, breathing, and heart beat?
A. Cerebellum
B. Cerebrum
C. Diencephalon
D. Medulla Oblongata

5. Mario went home drunk from a party, which part of his brain controls his
motion, balance, and coordination?
A. Cerebellum
B. Cerebrum
C. Diencephalon
D. Medulla Oblongata

6. In which direction does an impulse travel along a neuron?

A. From an axon to a dendrite
B. From a dendrite to another dendrite
C. From an axon to another axon
D. From a dendrite to an axon
7. A reflex arc is usually consists of _____.
A. sensory neurons only
B. motor neurons only
C. sensory and motor neurons only
D. sensory neurons, moor neurons, and their synapse in the spinal cord

8. Which of the following is/are the correct descriptions of nerve impulse?

I. A nerve impulse is a flow of electricity
II. A nerve impulse can jump from one neuron to another.
III. A nerve impulse is combination of an electrical charge and chemical
reaction.
IV. A nerve impulse from one neuron is stimulated in the next dendrite
because of neurotransmitter that crosses the synapse.
A. I and II
B. II and III
C. III and IV
D. II and IV

9. Marianne accidentally touched a hot iron. Upon touching the iron, she pulled
her arm right away. Which of the following best explains this situation?
A. Marianne was aware that the iron was hot.
B. Marianne’s reflex action caused him to pull his arm quickly.
C. Marianne’s brain sent a message to his arm that the iron is hot.
D. Marianne is intelligent enough to pull his arm from the iron.

10. Which of the following divisions generally acts to conserve energy?

A. Parasympathetic nervous system
B. Peripheral nervous system
C. Somatic nervous system
D. Parasympathetic nervous system

11. Which of the following statements best describe the function of the autonomic
nervous system?
A. Autonomic nervous system enables to act on the external environment.
B. Autonomic nervous system is located within the brain,
C. Autonomic nervous system regulates the internal environment.
D. Autonomic nervous system transmits motor information to the brain.

12. The “fight or flight” response is the term used to describe the action of the
_____.
A. central nervous system
B. parasympathetic division
C. somatic nervous system
D. sympathetic division
13. If the sympathetic nerve widens the pupil of the eye, the parasympathetic
nerve functions to _____.
a. narrows the pupil of the eye
b. maintains the widening of the pupil of the eye
c. receives impulses from the pupil to the eye
d. sends messages from the eye to the brain

14. The structures that receive messages from the central nervous system and
carry them to an area of the body are called _____.
a. dura mater
b. effectors
c. pia mater
d. receptors

15. An impulse travel by chemical messenger across the small space between
two neurons are called _____.
a. axon terminal
b. cell body
c. myelin sheath
d. synapse
10

Science 10
Quarter 3 – Week 4 - Module 4:
Protein Synthesis and Mutation

AIRs - LM
Science 10
Quarter 3 – Week 4 - Module 4: Protein Synthesis and Mutation
First Edition, 2021

Copyright @ 2021
La Union Schools Division
Region I

All rights reserved. No part of this module may be reproduced in any form
without written permission from the copyright owners.

Development Team of the Module

Author: Luzviminda V. Dulay

Editor: SDO La Union, Learning Resource Quality Assurance Team

Illustrator: Ernesto F. Ramos, Jr., P II

Management Team

Atty. Donato D. Balderas, Jr., Schools Division Superintendent

Vivian Luz S. Pagatpatan, Ph.D, Assistant Schools Division Superintendent

German E. Flora, Ph.D,, CID Chief

Virgilio C. Boado, Ph.D,, EPS in Charge of LRMS

Rominel S. Sobremonte, Ed.D,, EPS in Charge of Science

Michael Jason D. Morales, PDO II

Claire P. Toluyen, Librarian II

 Target
You learned in Grade 9 to describe the structure of the DNA and make models of
DNA molecule. You also learned how the genes in your deoxyribonucleic acid (DNA)
influence your characteristics.
Now, you will work on activities to assess your understanding on the structure
of the DNA, explain how DNA replication takes place, how ribonucleic acid (RNA) is
made using the information from DNA, how information in some genes is translated
into proteins, and explain how mutations may cause changes in the structure and
function of a protein.

At the end of this module, you are expected to:

1. Explain how protein is made using information from DNA (S10LT-IIId-37)
2. Explain how mutations may cause changes in the structure and function of a
protein (S10LT-IIIe-38)

Specifically, you should be able to:

1. compare the structures of the DNA and RNA molecule
2. identify the role of DNA and RNA in protein synthesis
3. describe DNA replication
4. describe transcription and translation
5. compare the different types of mutations and their possible results.

Pre-Test
Directions: Read each item carefully. Select the letter of the best answer and write
it on a separate sheet of paper.

1. DNA has a ______ strand; RNA has a ______ strand.

A. double/double B. double/triple C. double/single D. single/single

2. What enzyme initiates DNA replication?

A. DNA polymerase B. mRNA C. RNA polymerase D. tRNA

3. Transcription is the production of ___ from ___.

A. DNA, RNA B. DNA, protein C. Protein, RNA D. RNA, DNA

4. Identify the complementary DNA strand: ATTACGAT.

A. GAAGTGCA B. TAATGCTA C. TCTUCAAA D. CGGCACG

5. In RNA, the nitrogen base____ replaces ____ that was present in DNA.
A. A, U (adenine, uracil) B. U, T (uracil, thymine)
C. C, G (cytosine, guanine) D. U, A (uracil, adenine)
6. What is the transcribed mRNA strand for CATTAA?
A. GUAAUU B. GTAATT C. AUGGUU D. CATTAA
7. The "central dogma" states that genetic information flows from
A. Protein-->mRNA-->DNA B. mRNA-->DNA-->Protein
C. Protein-->DNA-->mRNA D. DNA-->mRNA-->Protein

8. Transcribe the following sequence of DNA into RNA: AAG CTT TGC
A. TTC GAA ACG B. UUC GAA ACG
C. TTC GUU UCG D. UUC GUU UCG

9. Which form of RNA carries amino acids from the cytoplasm to the ribosome?
A. amino RNA B. messenger RNA C. ribosomal RNA D. transfer RNA

10. What is the difference between DNA and RNA?

A. DNA has uracil and RNA has thymine
B. DNA is involved in transcription and RNA is involved in translation
C. DNA contains thymine and RNA contains uracil
D. DNA is made of nucleotides and RNA is not

11. What is the correct codon for the DNA strand: CGA?
A. CGA B. CGT C. GCU D. CGU

12. Which enzyme unwinds DNA to be replicated?

A. DNA Polymerase B. Helicase C. Ligase D. RNA Polymerase

13. What term names the process during which DNA is copied prior to cell
division?
A. DNA polymerase B. DNA replication
C. DNA regneration D. DNA redistribution

14. Original DNA: CAT GAT

New DNA: CAT AT
What mutation occurred?
A. Deletion B. invertion C. substitution D. tranverse

15. What is the definition of translocation?

A. an exchange of chromosome parts
B. a change in the dna
C. addition of of a single base to DNA
D. moving things around
 LESSON Protein Synthesis
1

Jumpstart
Your DNA, or deoxyribonucleic acid, contains the genes that determine who you
are. How can this organic molecule control your characteristics? DNA contains
instructions for all the proteins your body makes. Proteins, in turn, determine the
structure and function of all your cells. What determines a protein’s structure? It
begins with the sequence of amino acids that make up the protein. Instructions for
making proteins with the correct sequence of amino acids are encoded in DNA.
How is DNA different from RNA?
What nitrogen bases are found in DNA and RNA?
How is the information contained in DNA processed and translated into specific
characteristics or traits?
Let us find out the answers!

Discover
DNA and RNA Structures
The DNA molecule is composed of three types of component molecule:
Phosphate group, the sugar deoxyribose, and the bases adenine, thymine, cytosine,
guanine (A, T, C, G). There are three molecules that form the basic building block of
DNA, the nucleotides. Each nucleotide is composed of one phosphate group, one
sugar molecule, and one of the four bases – in the example. Across the strands of the
helix, A always pairs with T, and G with C.

Nucleotide
Source: https://byjus.com/biology/dna-structure/
Figure 1. DNA Structure
 Ribonucleic Acid, like DNA, is a nucleic acid. However, RNA structure differs from
DNA structure in three ways, shown in Figure 2. First, RNA is single stranded –
whereas DNA is double stranded. Second, the sugar in RNA is ribose; DNA has
deoxyribose. Finally, both DNA and RNA contain four nitrogenous bases, but instead
of thymine, RNA contains a similar base called uracil (U). The uracil pairs with
adenine. The major types of RNA include messenger RNA (mRNA), ribosomal RNA
(rRNA), and transfer RNA (tRNA).

Source: https://www.slideshare.net/YESANNA/nucleic-acid-chemistry-40334502
Figure 2. RNA Structure

The central dogma of the transfer of genetic information is shown below.

Transcription

DNA RNA Protein

Replication Translation
Figure 3. Central Dogma of Molecular Biology

REPLICATION

Deoxyribonucleic acid is copied during interphase prior to mitosis and meiosis.

It is important that new copies are exactly like the original molecule. The structure
of the DNA provides a mechanism for making accurate copies of the molecule. The
process of making copies of DNA is called replication. When DNA replicates, two
identical copies of DNA molecules are produced, which are the same as the original.

The following are the events while DNA copies itself:

• Step 1. An enzyme called helicase breaks the bond between nitrogenous bases.
The two strands of DNA split.

• Step 2. The bases attached to each strand then pair up with the free nucleotides
found in the cytoplasm.

• Step 3. The complementary nucleotides are added to each strand by DNA

polymerase to form new strands. Two new DNA molecules, each with a parent strand
and each with a new strand are formed. The DNA replication is known as semi-
conservative replication, becauseone of the old strands is conserved in each new
molecule. Figure 4 illustrates the semi-conservative replication of DNA.

1 2 3

Source: https://microbenotes.com/prokaryotic-dna-replication-enzymes-steps-and-significance/
Figure 4. DNA Replication
Three Types of RNA

1. Messenger RNA (mRNA) brings information from the DNA in the nucleus to
the protein manufacturing area, the cytoplasm. In the cytoplasm, the mRNA
becomes the template of information to make proteins.

2. Ribosomes, made of ribosomal RNA (rRNA), and ribosomal proteins hold

tightly into the mRNA using its information to assemble the amino acids in
correct order.

3. Transfer RNA (tRNA) supplies amino acids to the ribosome to be assembled as

protein.

Source: https://ib.bioninja.com.au/standard-level/topic-2-molecular-biology/
26-structure-of-dna-and-rna/types-of-rna.html
Figure 5. Types of RNA

TRANSCRIPTION

Transcription is the process of making an RNA copy of a gene sequence. This

copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus, and enters
the cytoplasm, where it directs the synthesis of the protein, which it encodes.

The following events can help you understand the process of transcription:

• Step 1. Ribonucleic Acid polymerase enzyme binds and opens the DNA molecule
that will be transcribed.
 • Step 2. As the DNA molecule opens, the RNA polymerase slides along the DNA
strand and links free RNA nucleotides that pair with the nitrogenous bases of the
complementary DNA strand. Hence, if the sequence of bases on the DNA strand were
CCG TTA CAT, the sequence of bases on the RNA strand would be GGC AAU GUA.

• Step 3. When the process of base-pairing is completed, the RNA molecule

breaks away as the DNA strands rejoin. The RNA leaves the nucleus and goes to the
cytoplasm. Figure 6 shows the transcription process.

Source: https://www.utsouthwestern.edu/labs/bioinformatics-lab/analysis/rna-seq/
Figure 6. Transcription

TRANSLATION

Translation is the process of translating the sequence of a messenger RNA

(mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic
code describes the relationship between the sequence of base pairs in a gene and the
corresponding amino acid sequence that it encodes. In the cell cytoplasm, the
ribosome reads the sequence of the mRNA in groups of three bases to assemble the
protein.

In translation, each set of three nucleotides in an mRNA molecule codes for one
amino acid in a protein. This explains why each set of three nucleotides in the mRNA
is called a codon. Each codon specifies a particular amino acid. For example, the
first codon which is, cytosine-guanine-uracil (CGU), instructs the ribosome to put
the amino acid arg (arginine) in the protein. The sequence of codons in the mRNA
determines the sequence of amino acids in the protein.

The following events in translation can help you understand the process:

• Step 1. As translation begins, mRNA binds to a ribosome. Then, tRNA

molecules, each carrying a specific amino acid, approach the ribosome. The tRNA
anticodon pairs with the first mRNA (start) codon argenine-uracil-guanine (AUG), to
form the initiation complex. The two
molecules temporarily join together.

• Step 2. Usually, the first codon on mRNA is AUG, which codes for the amino
acid methionine. AUG signals the start of protein synthesis. Then, the ribosome
slides along the mRNA to the next codon.

• Step 3. A new tRNA molecule carrying an amino acid pairs with the second
mRNA codon.
 • Step 4. When the first and second amino acids are in place, an enzyme joins
them by forming a peptide bond between them.

• Step 5. As the process continues, a chain of amino acids is formed until the
ribosome reaches a stop codon (e.g., UAA, UAG, UGA) on the mRNA strand. The
polypeptide chain is released. Protein synthesis is complete. Figure 7 summarizes
the translation process.

Source: https://www.quizbiology.com/2013/10/translation-transcription-quiz.html#.X-X2otgzY2w
Figure 7. Translation

Proteins such as enzymes are mostly amino acids chained together in a certain
order. Each group of three nucleotide bases represents a codon in a DNA or mRNA
that corresponds to a specific amino acid or a start/ stop signal. This code is picked
up by the mRNA and is carried from the nucleus to the cytoplasm. The codon has its
complement anticodon in tRNA.
Each amino acid that will form the protein molecule to be synthesized is determined
by the triplet code or codon on the mRNA.

THE GENETIC CODE

As we already know DNA is made up from four different bases: A, C, G and T.
The sequence of these bases is what defines the genetic code.

We also know that genes code for proteins. Proteins are long compounds that
have many different functions within organisms. Proteins are made up from smaller
units called amino acids.

There are around 20 different types of amino acids. Each amino acid has a code
within the DNA. The code consists of three bases, we call these "base triplet codes".
You can see in the table below that the different triplet codes correspond to different
amino acids.
ird letter
Source: http://www.scienceblitz.net/gene-expression-transcription-and-translation
Figure 8. Genetic Code Table
 Explore
ACTIVITY 1 DNA VS RNA

Objective: Compare and contrast the structures of the DNA and RNA molecule

Direction: Complete the venn diagram to compare DNA and RNA using all the words
below.

Nitrogen Base Uracil Deoxyribonucleic Acid Double Helix

Double Stranded Deoxyribose Sugar 1 Type
Nitrogen Base Thymine Ribose Sugar Located in
Nucleus Located in Cytoplasm Nucleotides
5-Carbon Sugar Single Helix 3 Types
Phosphate Group Ribonucleic Acid Guanine, Adenine, Cytosine
Single Strand Genetic Information

DNA RNA

BOTH

Guide Questions:

1. What are the components of the DNA and RNA molecule?

2. What are the two differences that can be found in a DNA and RNA nucleotide?

3. What nitrogenous base is found in RNA but not in DNA?

ACTIVITY 2 DNA MAKES DNA
Objectives:
1. Identify the role of DNA in protein synthesis
2. Describe DNA replication
Direction: Answer the following questions.
1. In relation to the pictures below, explain the three main steps in the process
of DNA replication. Name the enzymes that go with each step.

Step 1.

Step 2.

Step 3.

2. How many strands are created after the process and are they identical or
different?
3. How do the nucleotides in DNA pair?
4. Explain why DNA must be replicated.
5. Provide the correct base pair on the columns provided.
Split DNA New DNA Split DNA New DNA
(old strand) strand (old strand) strand
A T
T A
T A
A T
G C
G C
C G
A T
T A
G C
C G
A T
T A
T A
G C
ACTIVITY 3 WHAT’S THE MESSAGE

Objectives:

1. Differentiate the three types of RNA

2. Identify the role of RNA in protein synthesis
3. Describe transcription process

Directions: Answer what is required in each item.

A. Complete the graphic organizer to show the difference of the three types of
RNA.

RNA

mRNA rRNA tRNA

Name: Name: Name:

__________________ __________________ __________________

Location in the cell: Location in the cell: Location in the cell:

__________________ __________________ __________________

Function: Function: Function:

__________________ __________________ __________________
__________________ __________________ __________________
__________________ __________________ __________________
__________________ __________________ __________________
__________________ __________________ __________________
__________________ __________________ __________________
__________________ __________________ __________________
__________________ __________________ __________________
B. Place the following sequence of steps in transcription in the correct order.

• mRNA separates from the DNA template

• hydrogen bonds reform between the two strands of the DNA molecule
• free-floating mRNA nucleotides match up with their complementary
nucleotide on the DNA strand
• DNA helix unwinds and and hydrogen bonds between nitrogen bases break
at the gene location
• mRNA moves into the cytoplasm and DNA strands reform and rewind

C. Given the following DNA strands, transcribe the DNA code into the mRNA
codon.

DNA T A C A C C G T A T G C C A T A T T
mRNA

DNA T A C A G C A C A C G G C C C A C T
mRNA

D. Answer the following guide questions:

1. Based on your answers in part C, does the mRNA closely resemble the DNA
strand from which it was transcribed?
________________________________________________________

2. How many strands of mRNA are transcribed from the two “unzipped”
strands of DNA?
_________________________________________________________

3. Why is RNA important to the cell?

_________________________________________________________
ACTIVITY 4 RELAY THE MESSAGE

Objectives: Describe translation

Determine the amino acid coded for by the mRNA codon using the Genetic
Code Table

Direction: Answer what is required in each item.

A. Arrange the following steps in translation in the correct order.

_____ as each codon of mRNA moves through the ribosome, the proper amino
acid is brought to the robosome by tRNA
_____ mRNA moves to the cytoplasm and attaches to a ribosome at the start
codon
_____ the ribosome reaches the stop codon and releases the polypeptide
_____ the ribosome joins each amino acid in a protein chain called polypeptide

B. Answer the following questions:

1. Which type of RNA is responsible for carrying information from the DNA in
the nucleus out to the ribosome to make a protein?
2. Which type of RNA brings amino acids to the ribosome and “reads” the
information in mRNA?
3. What is a codon? What is anticodon?
4. Each codon matches with an __________________ found on a tRNA
molecule.
5. What is the role of tRNA in protein synthesis?

C. Use the DNA code to create mRNA code.

Use the mRNA code to create tRNA code.
Use the mRNA code and Genetic Code to determine the amino acid.
1.

DNA

mRNA

tRNA

amino
acids
 2.
DNA

mRNA
tRNA

amino
acids

ACTIVITY 5 PROTEIN SYNTHESIS…SUM IT UP!

Objective: Explain how protein is made using information from DNA

Direction: Fill in the flow chart below, using the following words: Amino acids,
mRNA, codon, nucleus, peptide bonds, ribosome, transcription, translation.
The first part of protein synthesis is

takes place where DNA is

in the decoded into
1. 2. 3.

goes to a
the second part of
tRNA where protein synthesis
anticodos 5. 4.
bond with

then creates
6. rRNA 7.

between

creating a
PROTEIN 8
 Deepen

SAY IT WITH DNA: Protein Synthesis Activity

Having studied the process by which DNA directs the synthesis of proteins, you
should be ready to decode some DNA "secret" messages. To do this, you must follow
the procedure of protein synthesis as this is taking place right now in your cells, no
short cuts!
STEP 1: "Build" the mRNA molecule, matching the RNA nucleotides to the DNA
nucleotides properly, letter by letter.
STEP 2: Figure out the tRNA triplets (codons) that would fit the mRNA triplets
(letter by letter).
STEP 3: Look up each tRNA codon in the tRNA Dictionary (below) and find the
corresponding symbol and amino acid abbreviation for that codon. Record that one-
letter symbol (and its amino acid) below each codon. "Spc" = "space". If you have done
this correctly, the symbols should spell out a meaningful message in English.
Remember, C always pairs with G, G always pairs with C, A pairs with T or T
pairs with A (in DNA). In RNA, C always pairs with G, G always pairs with C, A pairs
with U or U pairs with A. Clues: C & G are curved letters; A & T are angular; U is
used in RNA in place of T.

1. CTA TTA CGA ACT TAG AGC ATT GAA TAG AAA CTT ATC
Message: ________________________________________________________

2. GAT TAA AAA CTC ACT TAG AGC ATT AGT GGG CTT ACA TAA CGG GAA
ATC
Message: ________________________________________________________

3. AAT CTC CGA GCT TTG TAG TTA CCC ATT TAG AGT ATC TAG TTG TGT
CTC GCT CTC AGG TGC TAT TTG CCT ACT
Message: ________________________________________________________
 Gauge

Directions: Answer the following:

A. Complete each statement by writing the correct word/s in the blank.
1. DNA molecules are double-stranded, and RNA molecules are
_________________.
2. DNA is only found in the ________ of a cell.
3. The sugar in the nucleotide of RNA is _________.
4. In complementary base pairing, ____ bonds with U and C bonds with _____.
5. Making a messenger RNA using DNA as a template is called _________.
6. In the cytoplasm, mRNA delivers the code to the __________.
7. tRNA carry __________ from the cytoplasm to the ribosomes.
8. A polypeptide is a sequence of __________.
9. The bases on the mRNA strand are called _________.
10. The start codon is __________.
B. Fill in the missing information.

DNA mRNA tRNA Amino Acid

TAC

GUA
TGC
Histidine
 LESSON MUTATION
2

Jumpstart

When you copy from the blackboard, sometimes you may make mistakes. In a similar
way, mistakes may occur when DNA is replicated. Changes in the DNA sequence may delete
such protein or change its structure.
Consider what might happen if an incorrect amino acid was inserted in a growing protein
chain during the process of translation. Do you think this will affect the structure of the entire
molecule?
Read the two sentences below. What happens when a single letter in the first sentence is
changed?
THE DOG BIT THE CAT.
THE DOG BIT THE CAR.
Did you see that changing a single letter also changes the meaning of the sentence?

Discover

MUTATION: CHANGES IN THE GENETIC CODE

A mutation is a change that occurs in the DNA sequence. Changes in the DNA
sequence may delete such protein or change its structure. When the code in a gene
is changed, a different message may result. Any change in the sequence of
nitrogenous bases in the DNA,any mistake in the transcription of genetic information
from DNA to RNA or pairing of the codon and anticodon, may cause changes in the
kind, sequence, and number of amino acids of proteins synthesized by cells.

Changes in the genes can occur for a variety of reasons. Mutation may be induced
by factors called mutagens. Mutagens are commonly in the form of toxic chemicals,
and harmful radiation. Sometimes, mistakes occur in DNA replication, mitosis, and
meiosis. All of these can alter the DNA sequence and length.

Mutations can occur in two different types of cells: reproductive cells and body
cells. Only mutations in sex cells pass on to offspring. There are two types of
mutations that can occur in gamete cells:

1. Gene mutation is a permanent change in the DNA sequence that makes up a

gene.

2. Chromosomal mutation occurs at the chromosome level resulting in gene

deletion, duplication or rearrangement that may occur during the cell cycle
 and meiosis. It maybe caused by parts of chromosomes breaking off or
rejoining incorrectly.

KINDS OF CHROMOSOMAL MUTATIONS

1. Translocation
2.
Translocation is a type of chromosomal abnormality in which a
chromosome breaks and a portion of it reattaches to a different chromosome.

Source: https://www.expii.com/t/inversion-chromosome-mutation-definition-examples-10189

3. Deletion
Deletion is a type of mutation involving the loss of genetic material. It can
be small, involving a single missing DNA base pair, or large, involving a piece
of a chromosome.

https://www.expii.com/t/inversion-chromosome-mutation-definition-examples-10189

4. Inversion
Inversion occurs when a part of the chromosome breaks off, flips around,
and becomes reattached. So, the order of the genes becomes reversed
from what it was. A trick to remember this is that inverse sounds
like reverse.
 https://www.expii.com/t/inversion-chromosome-mutation-definition-examples-10189

GENETIC DISORDERS

1. “Cri du chat” is caused by the deletion of part of the short arm of chromosome
5. “Cri du chat” is French, and the condition is so named because affected
babies make high-pitched cries that sound like a cat. Affected individuals have
wide-set eyes, a small head and jaw, are moderately to severely mentally
retarded, and very short.

Source: https://dentistryexplorer.com/cri-du-chat-syndrome-details/
Figure 9. Cri du chat

2. Down’s syndrome is usually caused by an extra copy of chromosome

21(trisomy 21). Characteristics include decreased muscle tone, stockier build,
asymmetrical skull, slanting eyes and mild to moderate mental retardation.

Flattened nose and face,

upward slanting eyes

single palmer crease, short

fifth finger that curves inward widely seperated first and
second toes and
increased skin creases

Source: https://mapmygenome.in/blog/extra-chromosome-trisomy-21-downs-syndrome/
Figure 10. Down’s Syndrome

3. Edwards syndrome, which is the second most common trisomy after Down’s
syndrome, is a trisomy of chromosome 18. Symptoms include mental and
motor retardation and numerous congenital anomalies causing serious health
problems. About 99% die in infancy. However, those who live past their first
 birthday, usually are quite healthy thereafter. They have a characteristic hand
appearance with clenched hands and overlapping fingers.

Source: https://www.pinterest.ph/pin/8585055516222861/
Figure 11. Edward Syndrome

4. Jacobsen syndrome is also called terminal 11q deletion disorder. This is a very
rare disorder. Those affected have normal intelligence or mild mental
retardation, with poor or excessive language skills. Most have a bleeding
disorder called Paris-Trousseau syndrome.

5. Klinefelter’s syndrome (XXY). Men with this condition are usually sterile and
tend to have longer arms and legs and to be taller than their peers. They are
often shy and quiet and have a higher incidence of speech delay.

6. Turner’s syndrome (X instead of XX or XY). Female sexual characteristics are

present but underdeveloped. They often have a short stature, low hairline,
abnormal eye features and bone development and a “caved-in” appearance to
the chest.
 Source: http://chengmoh.blogspot. com/2012/08/genetic-diseases.html
Figure 12. Klinefelter’s syndrome and Turner’s syndrome
 Explore

ACTIVITY 1 CHROMIE CHANGE…1

Objective: Differentiate the kinds of chromosomal mutations

Direction: Complete the table below and answer the guide questions.

Chromosomal Mutations
Translocation Deletion Inversion
1. Number of
chromosomes
involved
2. Condition which
results to
change/s of
chromosome
material (use
the words loss,
gain, either loss
or gain of
genetic material)

3. Brief description

1. What condition results to gain of chromosome material?

_________________________________________________________

2. What condition results to loss of chromosome material?

_________________________________________________________

3. What are some possible effects of these chromosomal mutations?

_________________________________________________________
ACTIVITY 2 CHROMIE CHANGE…2

Objective: Compare the different types of mutations and their possible results
Direction:
A. For each diagram below, indicate what type of chromosome mutation is
illustrated.
Choose from: Deletion, Inversion or Translocation.

1. ____________________

2. ____________________

3. ____________________

B. Match the chromosome mutation with its description.

A. A portion of the chromosome is missing or

deleted. Known disorders in humans include Cri
____1. du chat syndrome which is due to a partial
deletion of the short arm of chromosome number
Translocation 5.

B. When a portion of one chromosome is

____2. Inversion transferred to another chromosome. Sometimes,
parts of different chromosomes switch places
(reciprocal exchange).
____3. Deletion

C. A portion of the chromosome has broken off,

turned upside down and reattached, therefore
the genetic material is backward.

C. Answer the following questions.

1. What are the two types of mutation?

2. Look at the following sequence: THE FAT CAT ATE THE RAT.
(a) Delete the first H and regroup the letters in groups of three (write out
the new groups of three).
(b) Does the sentence still make sense?
(c) What type of mutation is this?
 Deepen

Sickle cell anemia is the result of a type of mutation in the gene that codes for
part of the hemoglobin molecule. Recall that hemoglobin carries oxygen in your red
bloods cells. The mutation causes the red blood cells to become stiff and sickle-
shaped when they release their oxygen. The sickled cells tend to get stuck in blood
vessels, causing pain and increased risk of stroke, blindness, damage to the heart
and lungs, and other conditions.

Analyze the DNA strands below to determine what amino acid is changed and
what type of mutation occurred.

Normal hemoglobin DNA CACGTGGACTGAGGACTCCTC

Normal hemoglobin mRNA _________________________________________

Normal hemoglobin A.A. sequence __________________________________________

__________________________________________

Sickle cell hemoglobin DNA CACGTGGACTGAGGACACCTC

Sickle cell hemoglobin mRNA _______________________________________

Sickle cell hemoglobin A.A. sequence ________________________________________

_______________________________________
 Gauge

MATCHING TYPE. Match the descriptions in column A to the word/s in column B.

Column A Column B
1. change that occurs in the DNA sequence A.chromosomal mutation
2. changes in the chromosome where parts of the B. cri du chat
chromosomes are broken and lost during mitosis C. deletion
3. permanent change in the DNA sequence D. Down’s syndrome
4. involves the loss of genetic material E. Edward’s syndrome
5. a part of the chromosome breaks off, flips around, F. gene mutation
and becomes reattached G. inversion
6. a chromosome breaks and a portion of it reattaches H. Jacobsen syndrome
to a different chromosome I. Klinefelter’s syndrome
7. trisomy of chromosome 18 J. mutation
8. deletion of part of the short arm of chromosome 5 K. translocation
9. terminal 11q deletion disorder
10. caused by an extra copy of chromosome 21

POST-TEST
Directions: Read each item carefully. Select the letter of the best answer and wite it
on a separate sheet of paper.
1. The central dogma of protein synthesis can be summed up as
A. DNA transcription RNA translation
B. DNA translation RNA transcription
C. DNA RNA transcription translation
D. DNA RNA translation transcription

2. Which is NOT a component of a DNA nucleotide?

A. base B. phosphate C. RNA D. sugar

3. What nitrogenous base is found in RNA but NOT in DNA?

A. adenine B. cytosine C. guanine D. uracil

4. What is the process of copying DNA sequence into RNA called?

A. replication B. transcription C. translation D. mutation

5. What is the basic role of mRNA?

A. transfer the amino acids to the ribosome
B. transfer the amino acids to the nucleus
C. transfer the DNA message to the ribosome
D. transfer the mRNA message to the nucleus
6. What is the role of the ribosome in protein synthesis?
A. it is where mRNA synthesis occurs
B. it is where DNA synthesis occurs
C. it is where protein synthesis occurs
D. it is where gene synthesis occurs
7. If the DNA coding strand is ACAGTCGAT, the complementary strand will be
A. ACAGTCGAT B. TGTCAGCTA C. UGUCAGCUA D.
TUTCGACUT
8. If the DNA coding strand is ACAGTCGAT, the mRNA strand will be
A. ACAGTCGAT B. TGTCAGCTA C. UGUCAGCUA D. TUTCGACUT
9. Choose the correct sequence of steps in protein synthesis.
1. transcription
2. tRNA – amino acid units link to mRNA
3. amino acid separates from tRNA
4. polypeptide chain assembled
5. mRNA links to ribosome
6. stop codon encountered in mRNA

A. 1,3,5,2,4,6 B. 1,3,4,5,2,6 C. 1,4,3,2,6,5 D. 1,2,3,4,5,6

10. Which of the following statements explains DNA mutation?
A. It is a mistake or change in the nucleolus.
B. It is a mistake or change in the ribosomes.
C. It is a mistake or change in the RNA sequence.
D. It is a mistake or change in the DNA sequence.
11. What genetic disorder is usually caused by an extra copy of chromosome 21?
A. Cri du chat B. Down’s syndrome
C. Edward’s syndrome D. Turner’s syndrome
12. Which of the following defines translocation?
A. breaking a piece of a chromosome and adding it to another chromosome
B. the addition of a single base to DNA
C. the deletion of a single base from DNA
D. the failure of the homologous chromosome to separate properly
13. DNA molecule segment is: TTA CGC AAG
The mutated DNA segment is TTCGCAAG. What type of mutation is this?
A. deletion B. insertion C. inversion D. translocation
14. What situation causes a deletion?
A. Part of the chromosome is missing
B. Part of the chromosome is attached backwards
C. Part of the chromosome breaks off and attaches to a different chromosome
D. Part of a chromosome is duplicated
15. The chromosomal mutation shown in the image is a
A. deletion
B. duplication
C. inversion
D. translocation
10

Science
Quarter 3 – Week 5 - Module 5
BIODIVERSITY AND EVOLUTION
(Evidences for Evolution)

AIRs - LM
Science 10
Quarter 3 - Module 5: Biodiversity and Evolution
First Edition, 2021

Copyright © 2021
La Union Schools Division
Region I

All rights reserved. No part of this module may be reproduced in

any form without written permission from the copyright owners.

Development Team of the Module

Author: Ariel L. Alva

Editor: SDO La Union, Learning Resource Quality Assurance
Team
Illustrator: Ernesto F. Ramos, Jr., P II

Management Team:

Atty. Donato D. Balderas, Jr.

Schools Division Superintendent

Vivian Luz S. Pagatpatan, Ph.D

Assistant Schools Division Superintendent

German E. Flora, Ph.D, CID Chief

Virgilio C. Boado, Ph.D, EPS in Charge of LRMS

Rominel S. Sobremonte, Ed.D, EPS in Charge of Science

Michael Jason D. Morales, PDO II

Claire P. Toluyen, Librarian II

 Target

The Earth is approximately 4.6 billion years old. Modern humans have only been
around for .0002 percent of that time, and recorded history covers only a fraction of
that. How do we know what the early Earth looked like? How do we know how living
things evolve?
The evolution of complex organisms, such as humans, is so gradual that no one
can watch it. But evolution does leave evidence. Scientists search for clues embedded
in rock, encoded in DNA, and in the shape and structure of living things. In these
activities, you will learn how scientists collect evidence for evolution.
This learning material will explain how the different sources of possible evidence
for evolution such as fossil records, comparative anatomy and genetic information
which give way to the different concepts about the origin of life.
After going through this learning material, you are expected to attain the
following objectives:
Most Essential Learning Competency:
• Explain how fossil records, comparative anatomy and genetic
information provide evidence for evolution. (S10LT-IIIf-39)

Subtasks:
1. Understand how evolution is being studied from the fossil record.
2. Determine the age of fossil.
3. Distinguish homologous structure from analogous structure.
4. Explain the relevance of comparative anatomy as an evidence of evolution.
5. Infer the evolutionary relationship of the organisms from the differences in amino
acid sequence.

Before going on, check how much you know about this topic. Answer
the pre-test in a separate sheet of paper..

PRE-TEST

Direction: Read each item carefully. Choose the letter of the best answer.
1. Where can most of the fossils be found?
A. Black Soil B. Granite Rock
C. Metamorphic Rock D. Sedimentary Rock

2. Which of the following best describes a fossil?

A. Laboratory preserved animal B. Dead animal of the past
C. Organic relic of the past D. Stuffed animal

3. Why do flippers of penguin and dolphin are considered analogous structure?

A. Absent of certain bones
B. Development from different lineages
C. Structural differences
 D. Functional differences

4. Which of the following period is a part of the Paleozoic Era?

A. Carboniferous B. Cretaceous C. Jurassic D. Triassic

5. Which of the following pairs do NOT matched?

A. Cenozoic : Tertiary B. Mesozoic : Triassic
C. Paleozoic : Ordovician D. Paleozoic : Cretaceous

6. In what era can you possibly find the most recent fossil?
A. Cenozoic B. Mesozoic C. Paleozoic D. Pre-cambrian

7. Which of the following is least related to human?

A. Chimpanzee B. Gorilla C. Kangaroo D. Rhesus Monkey

8. Which of the following statements best explains about analogous structures in

animals?
A. Have different functions and different origin.
B. Have different functions but same origin.
C. Have similar functions and similar origin.
D. Have similar functions but different origin.

9. Which of the following statements best explains about homologous structures in

animals?
A. Have different functions and different origin.
B. Have different functions but same origin.
C. Have similar functions and similar origin.
D. Have similar functions but different origin.

10. Which of the following pair is an example of homologous structure?

I. Bat wing and Butterfly wing
II. Bird wing and Bat wing
III. Human arm and Whale flipper
A. I only
B. II only
C. I and II
D. II and III

11. What is the strongest evidence for change over a long period of time?
A. DNA B. fossils C. embryo studies D. direct observation of living species

12. Which of the following method is used to determine the age of the rocks by
comparing them with the rocks in the other layers?
A. Absolute Dating B. Comparative Anatomy
C. Embryonic Development D. Relative Dating

13. Which of the following is an example of convergent evolution?

A. A species regains a trait that an ancestor had previously lost
B. Two species merge together to form a single species
C. Two different species independently gain the ability to fly
D. Two populations living in the same geographic region acquire enough
differences to diverge into two separate species
14. Which of the following pairs of structures is least likely to represent homology?
A. the wings of a bat and the arms of a human
B. the hemoglobin of a baboon and that of a gorilla
C. the wings of a bird and those of an insect
D. the brain of a cat and that of a dog

15. Why do organisms with close biochemical similarities show stronger evolutionary
relationships?
A. They have varied and different ancestry.
B. They have similar pattern during their early stage of development.
C. They have a common ancestor and have the same kind of proteins.
D. They possess same vestigial structure that made their evolutionary
relationship closer.
 Jumpstart

Activity 1: Word Puzzle.

Direction: Find and encircle all the words that are hidden that are related to
Evidences for Evolution.

A G C E V O L U T I O N D E F
S G H I J P K L M N O P E R A
U O Y R S T E U V J X Y Z A M
O B R R C D E R F G G H I J I
G K T L A M N O I E P Q A R N
O S S T U T V W X O Y Z N A O
L B E C D E N F G L D H A I A
O J C K L M N E O O P Q L R C
M S N T U V W X M G Y Z O A I
O B A D A P T A T I O N G C D
H D E F G H I J K C D L O M N
O P Q R S T U V W T X E U Y Z
Q Y P U J M N R V I F G S H J
P L M N A X C T Y M I O R J B
L O S S I F Y E W E S C Q Z A

1._________________________ 6._________________________
2._________________________ 7._________________________
3._________________________ 8._________________________
4._________________________ 9._________________________
5._________________________ 10._________________________
 Discover

SOURCES OF EVIDENCE FOR EVOLUTION

Organisms inhabiting the earth have changed overtime, their structures,

traits, and abilities allowed them to adapt and survive in their environment. Data
from fossil records, anatomy and morphology, embryonic development and
biochemistry could be analyzed to demonstrate if evolution of life on earth has
taken place.

A. Evidence from Fossil Records

What are fossils?
Fossils are preserved remains or traces of animals, plants, and other
organisms from the past. Fossils are examples of evidences that paleontologists use
in studying evolution. They are remains such as bones, shells, teeth, and also feces
embedded in rocks, peat, resin and ice.

TYPES OF FOSSILS

1. Mold fossil – is a fossilized imprint made in the substrate. The substrate is the
rock or sediment on which a fossil makes its mark. Unlike cast fossils, mold fossil
are hollow. Due to the way this type of fossil is formed, the resulting image is a
negative image of the part of the organism’s body that made the impression.
Common mold fossils include skin, leaves, teeth, claws and embryos.

2. Cast fossils – are like mold fossils in that they formed, at least in part, with an
imprint made in a rock or sediment. However, cast fossils go one step further. Once
the hollow mold is present, they are subsequently filled in with minerals that later
harden for form solid rock. In other words, mold fossils take up negative space and
cast fossils take up positive space.

3. Trace fossils –also called ichnofossils, do not contain information about the
organism itself. Rather, they contain information on traces left by the organism.
Common examples of trace fossils include burrows, nests, footprints, dung and
tooth marks.
4. True form fossils –are large body parts of an organism that has been replaced
by minerals. True form fossils are formed by a process called petrification.
Common examples of these fossils include limbs, torsos, fingers, and heads. The
part of the organism is displaced by minerals that harden to become rock.

1. Mold Fossil 2. Cast Fossil 3.Trace Fossil 4.True Form Fossil

SOURCES: https://nayturr.com/wp-content/uploads/2020/06/mold-fossils-june042020-min.jpg
https://3c1703fe8d.site.internapcdn.net/newman/gfx/news/2016/flawedanalys.jpg
https://res.cloudinary.com/dk-find-out/image/upload/q_80,w_1440,f_auto/DCTM_Penguin_UK_DK_AL576615_ev1vhr.jpg
http://ichef.bbci.co.uk/naturelibrary/images/ic/credit/640x395/t/tr/trace_fossil/trace_fossil_1.jpg
GEOLOGIC TIME SCALE

Source: https://image.slideserve.com/468267/geologic-time-scale-l.jpg

The geologic time scale is the calendar for events in Earth history. It subdivides all
time into name units of abstract time called Eons, Eras, Periods, Epochs, and ages.
Era is the largest division of Geologic Time Scale, namely Late Proterozoic,
Paleozoic, Mesozoic, and Cenozoic. Each Era is also divided into Period.
Determining the age of fossils
Many fossils have no living representatives today. By comparing the
fossils in the different rock layers, scientists were able to infer the changes that
occurred in the characteristics of various organisms and to reconstruct the order of
changes that these generations of organisms have undergone.
The period at which the various fossilized organisms existed on Earth
can be estimated.
Absolute Dating- method used in analyzing the age of rocks where fossils are
found using radioactive elements or radioisotopes to determine the rate of decay of
certain radioactive isotopes.
Relative Dating – method used to determine the age of the rocks by comparing
them with the rocks in the other layers. The younger rock is found on the top layer
and the older rock is found in the bottom layer.

Source: https://pixfeeds.com/images/32/608610/1200-608610-relative-vs-absolute-dating.jpg

B. Hint of Evolution from COMPARATIVE ANATOMY

Another evidence of evolution is from comparative anatomy. Structures
can be homologous or analogous.

Homologous structures may perform different functions in the species living in

the different environment, or it may have the same origin but different functions.
Examples of homologous structures are shown below: mouse forelimb, bat wing,
human arm, which are structurally the same, but functionally different.

Source:https://s3.amazonaws.com/classconnection/580/flashcards/21337580/jpg/large_485979_g4bby4mdenq
3ttk5q5xqtclyp-17058C2C45D0B2E64AD-thumb400.jpg

Analogous structures have similar function but different origin. Structures of

unrelated species may evolve to look alike, because the structure is adapted to
similar function.
Examples of analogous structures are shown below: bat wing, butterfly wing, bird
wing.

Source:https://s3.amazonaws.com/classconnection/580/flashcards/21337580/jpg/large_485979_g4bby4mdenq
3ttk5q5xqtclyp-17058C2C45D0B2E64AD-thumb400.jpg
Table 1.Differences between Convergent and Divergent Evolution
CONVERGENT EVOLUTION DIVERGENT EVOLUTION
DEFINITION An evolution type describing A type of evolution describing
how phylogenetically how phylogenetically related
unrelated species show species show different traits.
similar traits when they live
adapting to a similar
environment.

SUPPORTED BY Supported by analogous Supported by the

structures homologous structures
ANCESTOR Not share a common ancestor Share common ancestor
PHYLOGENETIC Occurs in organisms, which Occurs in phylogenetically
RELATIONSHIP are not phylogenetically related organisms
BETWEEN ORGANISMS related
LIVING ENVIRONMENT Species live in a similar Species live in different
environment environment
EXAMPLES Common Ancestor: PLIOHIPPUS

http://image1.slideserve.com/1779223/convergent- http://streetwitnessing.org/wp-
evolution1-n.jpg content/uploads/2013/04/Evo-BioM-Fig11-Horse-
400x300.jpg

Source: https://www.differencebetween.com/difference-between-convergent-and-vs-divergent-evolution/

C. Evidence from Embryonic Development

An embryo is an early stage of development in organisms. Embryonic
development include stages such as blastula, gastrula and organogenesis. The
embryo of fishes, salamanders, lizards, birds, cats and humans are similar during
the first stage of their embryonic development; and have several homologous
structures that are not present when organisms are adults.
Species that are closely related exhibit similar embryonic development
although in the adult stage the organisms are quite different.

Source: https://rationalconclusions.com/images/citations/Science%20of%20Evolution%20-%20109.jpg
D. Evidence from Amino Acid Sequence
Another area of study in the evidence of evolutionary concept is provided
by protein and DNA Sequences. All living cells have the same basic DNA structure
and use the same genetic code. Proteins produced from genes all come from the same
set of amino acids.
Comparing sections of DNA in difference species has shown that even
organisms that seem to be different, actually have large sections of identical DNA.
Organisms that seem fairly similar on the basis of comparative anatomy,
show more genes in common than organisms that aren’t much alike. For example,
96% of the genes in humans and chimpanzees are identical. That two species and
their common ancestor have similar DNA is strong evidence supporting evolution.
Protein amino acid sequences can also be used to compare similarities
between species. Proteins are made from amino acids and the sequence of these
amino acids is controlled by genes. Comparing how many of the amino acids are in
the same positions on the protein chain can provide some idea of how closely related
two species are.
For example, humans and chimpanzees only have one position where they
are different on the amino chain, while humans and moths have 31 different
positions.

To understand the lesson well, do the following activity on this learning material.
Enjoy learning!!!
 Explore
A=1 F=6 K=11 P=16 U=21
B=2 G=7 L=12 Q=17 V=22
Activity 2: DECODE C=3 H=8 M=13 R=18 W=23
D=4 I=9 N=14 S=19 X=24
Direction: Look for the number that E=5 J=10 O=15 T=20 Y=25
correspond to the code to decode. Z=26

1. Shallow external molds left by animal or plant tissues

9 13 16 18 5 19 19 9 15 14

2. Process where true form fossils are formed

16 5 20 18 9 6 9 3 1 20 9 15 14

3. Largest era in evolutionary time

16 1 12 5 15 26 15 9 3

4. Preserved remains or traces of organisms from the past

6 15 19 19 9 12

5. First vertebrate found in evolution

6 9 19 8

6. Period where dinosaurs or giant reptiles ruled the earth

10 21 18 1 19 19 9 3

7. Era where the evolution of humans appear

3 5 14 15 26 15 9 3
8. Calendar for events in Earth history

7 5 15 12 15 7 9 3 20 9 13 5 19 3 1 12 5

9. Imprint made in a rock or sediment that represent positive image

3 1 19 20 6 15 19 19 9 12

10. Period where first vascular land plants appear

19 9 12 21 18 9 1 14
Activity 3: What’s my Age?
Direction: Determine the relative age of the cross section by arranging each
rock unit in the order in which it occurred or was deposited.

Youngest________
________

________
________
________
________

________
________
Oldest________

Source: https://www.peekskillcsd.org/cms/lib/NY01913880/Centricity/Domain/827/Evidence-for-
evolution-factsheet1.pdf

Activity 4: ANALOGOUS OR HOMOLOGOUS!

Direction: Classify the structures whether Homologous or Analogous.
STRUCTURE CLASSIFICATION

1. Human arm Whale flipper

2. Human arm Alligator forelimb

3. Bat wing Butterfly wing

4. Bird wing Butterfly wing

5. Bird wing Human arm

Source: https://www.shareyouressays.com/knowledge/biology-question-bank-99-mcqs-on-evolution-
answered/114607
Activity 5: Who’s my Relative!
Direction: Study and compare the stages of embryonic development of the different
vertebrates.

Stage
1

Stage
2

Stage
3

Source: https://www.pbs.org/wgbh/evolution/educators/lessons/lesson3/index.html

Q1. In what stages of development of the organisms above show similarities?

Q2. Identify the structure, how and where are they similar?

Q3. In stage 3, identify the structures that made the organisms different from each
other?

Q4. Can embryonic development be an evidence that evolution took place? Explain

Deepen
At this point you are now ready for your last activity.

Activity 6: Let’s Compare!

Problem: How do amino acid sequences provide evidence for evolution?

Procedure: Comparing Amino Acid Sequences

A. Examine Figure 1, which compares corresponding portions of hemoglobin
molecules in humans and five other vertebrate animals. Hemoglobin, a protein
composed of several long chains of amino acids, is the oxygen-carrying molecule
in red blood cells. The sequence shown is only a portion of a chain made up of
146 amino acids. The numbers in Figure 1 indicate the position of a particular
amino acid in the chain.
B. In Data Table 1, notice that the abbreviated names of the amino acids in human
hemoglobin are printed.
C. In the appropriate spaces in Data Table 1, write the abbreviated name of each
amino acid in chimpanzee hemoglobin that is different from that in human
hemoglobin. If there are no differences, leave the spaces blank.
D. For the remaining organisms, write the abbreviated names of the amino acids
that do not correspond to those in human hemoglobin.
NOTE: Always be sure that you compare the amino acid sequence of each organism
with that of the human and not the organism on the line above.
E. Use Figure 1 to complete Data Table 1 and 2.

FIGURE 1

Data Table 1: Comparing Hemoglobin of Six Animals

 Table 2
ORGANISM Number of amino
acid differences

Human and
Chimpanzee

Human and
Gorilla

Human and
Rhesus
Monkey
Human and
Horse

Human and
Kangaroo

Q1. Based on the activity, which organism is closely related to humans?

Q2. Which organism is least related to humans?

Q3. If the amino acid sequence of the two organisms are similar, would their DNA
be also similar? Why?

Let’s check how much have you learned in this module.

God bless!!!
 Gauge

Direction: Read each item carefully. Choose the letter of the best answer.
1. Which of the following period is a part of the Paleozoic Era?
A. Carboniferous B. Cretaceous C. Jurassic D. Triassic

2. What is the strongest evidence for change over a long period of time?
A. DNA B. fossils C. embryo studies D. direct observation of living species

3. Which of the following is a fossilized imprint made in the substrate?

A. Cast Fossil B. Mold Fossil C. Trace Fossil D. True Form Fossil

4. Which of the following method is used to determine the age of the rocks by
comparing them with the rocks in the other layers?
A. Absolute Dating B. Comparative Anatomy
C. Embryonic Development D. Relative Dating

5. Which of the following pairs do NOT matched?

A. Cenozoic : Tertiary B. Mesozoic : Triassic
C. Paleozoic : Ordovician D. Paleozoic : Cretaceous

6. In terms of amino acid similarities in the beta hemoglobin chain, which two
organisms would most likely be closely related?
A. Human and Chimpanzee B. Human and Gorilla
C. Human and Horse D. Human and Kangaroo

7. Where can most of the fossils be found?

A. Black Soil B. Granite Rock
C. Metamorphic Rock D. Sedimentary Rock

8. Which of the following statements best explains about analogous structures in

animals?
A. Have different functions and different origin.
B. Have different functions but same origin.
C. Have similar functions and similar origin.
D. Have similar functions but different origin.

9. Why do organisms with close biochemical similarities show stronger evolutionary

relationships?
A. They have varied and different ancestry.
B. They have similar pattern during their early stage of development.
C. They have a common ancestor and have the same kind of proteins.
D. They possess same vestigial structure that made their evolutionary
relationship closer.
10. Which of the following pair is an example of homologous structure?
I. Bat wing and Butterfly wing
II. Bird wing and Bat wing
III. Human arm and Whale flipper
A. I only
B. II only
C. I and II
D. II and III

11. Which of the following best describes a fossil?

A. Laboratory preserved animal B. Dead animal of the past
C. Organic relic of the past D. Stuffed animal

12. What kind of evidence suggested that man is more closely related with
chimpanzee than with other hominoid apes?
A. evidence from DNA extracted from sex chromosomes only
B. comparison of chromosomes morphology only
C. evidence from fossil remains, and the fossil mitochondrial DNA alone
D. evidence from DNA extracted from sex chromosomes, autosomes.

13. Which of the following is an example of convergent evolution?

A. A species regains a trait that an ancestor had previously lost
B. Two species merge together to form a single species
C. Two different species independently gain the ability to fly
D. Two populations living in the same geographic region acquire enough
differences to diverge into two separate species

14. Which of the following pairs of structures is least likely to represent homology?
A. the wings of a bat and the arms of a human
B. the hemoglobin of a baboon and that of a gorilla
C. the wings of a bird and those of an insect
D. the brain of a cat and that of a dog

15. Why do flippers of penguin and dolphin are considered analogous structure?
A. Absent of certain bones
B. Development from different lineages
C. Structural differences
D. Functional differences
10

Science
Quarter 3- Week 6
Module No 6
BIODIVERSITY AND EVOLUTION
(Theories of Evolution)

AIRs - LM
Science 10
Quarter No 3 - Module 6:BIODIVERSITY AND EVOLUTION (Theories of
Evolution)
First Edition, 2021

Copyright © 2021
La Union Schools Division
Region I

All rights reserved. No part of this module may be reproduced in any form
without written permission from the copyright owners.

Development Team of the Module

Author: Maricris A. Oñas, TIII

Editor: SDO La Union, Learning Resource Quality Assurance Team
Illustrator: Ernesto F. Ramos, Jr., P II

Management Team:

Atty. Donato D. Balderas, Jr.

Schools Division Superintendent

Vivian Luz S. Pagatpatan, Ph.D

Assistant Schools Division Superintendent

German E. Flora, Ph.D, CID Chief

Virgilio C. Boado, Ph.D, EPS in Charge of LRMS

Rominel Sobremonte, Ed.D, EPS in Charge of Science

Michael Jason D. Morales, PDO II

Claire P. Toluyen, Librarian II

 Target

Do you know why dinosaurs no longer exist today? Why some animals before
are very different from the animals we have now? From Grade 7 to
Grade 9 you have learned that organisms are grouped into Kingdom, Phylum,
Class, Order, Family, Genus, and Species. You also learned that organisms
possess unique characteristics. Some organisms may look the same but have
distinct differences from each other, others may not be related to one another
but they have similar functional features and characteristics. You may also
wonder why some animals that are present before are no longer existing today.
Such extinction of organisms was caused by various environmental factors
and human activities.

This module will give you an idea that maintaining individual differences and
variety of characteristics are important to ensure the survival of species. This module
will also discuss the different sources of possible evidence
for evolution such as fossil records, and developmental and molecular biology
which gave way to the different concepts about the origin of life. It will also
provide a variety of activities to help you understand the processes and
mechanism of evolution.

Through this module, it is hoped that you will be encouraged to further

take care of and protect our environment (e.g. natural resources), to ensure the
survival of species and conservation of our biodiversity.

Most Essential Learning Competency

• explain the occurrence of evolution (S10LT-IIIg-40)

Objectives
• explain why reproduction, variation, and adaptation are necessary for the
survival of species; and
• discuss how natural selection promotes expression and propagation of traits
and species that adapt with the changing environment.
Pre-Test
Multiple Choice. Read the following questions and write the letter of your answer
on a separate sheet of paper. Label your paper Quarter 3 Module
6 Pre-test.
______1. What do you call the process by which all the different kinds of living
things have changed over time?
A. biology B. evolution C. homeostasis D. parasitism

______2. What do you call the inherited trait that makes an individual different
from other members of a species?
A. adaptation B. hibernation C. mutation D. variation

______3. What is most likely to happen to a species that is NOT suited to its
environment?
A. It will survive and produce many offspring.
B. It will get bored and leave.
C. It will not survive to reproduce.
D. It will change all its previous behaviors.

______4. In the theory of natural selection, what species are most likely to survive?
A. Organisms with inherited acquired traits.
B. Organisms with variations that make them adapted to their
environment.
C. Organisms that overproduce.
D. Organisms that were isolated.

______5. Individuals within a population have slightly different traits, or variations.

How do variations improve the likelihood that a population will survive?
A. Variation enables individuals to produce offspring that will survive into
adulthood.
B. Variation enables the population to acquire traits, which help
individuals survive.
C. Variation provides the raw material (pool of genes) upon which natural
selection acts in a population.
D. Variation enables individuals who are very different from the rest of the
population to reproduce more successfully.

______6. Which of the following statements DOES NOT describe evolution?

A. Evolution is continuous.
B. Evolution refers to change.
C. The world is stable and unchanging.
D. If there is mutation, there is evolution

______7. Which of the following statements BEST explains the Theory of Natural
Selection?
A. Organs that are not used may disappear while organs that are
constantly used may develop.
B. In nature, the organisms with desirable characteristics may survive
while those with weaker traits may not.
C. Organisms develop desirable structures to survive in a given
environment.
D. Acquired characteristics of parents can be passed on to offspring.
______8. Which of the following statement explains Lamarck’s Theory of Use and
Disuse? Body structures develop because ______.
A. they are used extensively B. they are not in use
C. of competition D. of mutation

______9. Which of the following was NOT supported by Jean-Baptiste Larmarck?

A. Inheritance of acquired traits B. Natural Selection
C. The changes of species overtime D. Use and disuse

_____10. The finches on the Galapagos island were similar in form except for
variations of their beaks. What significant observation did Darwin
observe regarding the usefulness of these variations of finches’ beaks?
A. attracting a mate B. building nests
C. defending territory D. gathering food

_____11. What is another name for natural selection?

A. survival of the biggest C. survival of the fastest
C. survival of the fittest D. survival of the smartest

_____12. What is innate to species for them to undergo evolution?

A. Adaptation, Genetic make-up, Selection, and Variations
B. Acquired traits, Genetic make-up, Selection, and Variations
C. Adaptation, Need to Survive, Selection, and Variations
D. Acquired traits, Genetic make-up, Need to survive and Selection

_____13. Several individuals in a population of green beetles acquire a mutation

that makes them blue and toxic to their primary predatory bird species.
What do you expect will happen to this population over time?
A. The poisonous ones have higher fitness, and natural selection will lead
to more blue and toxic individuals and fewer green beetles over time.
B. The poisonous ones have higher fitness, and stabilizing selection will
lead to the population of beetles to be compared of mainly blue and
toxic individuals over time.
C. The poisonous ones have lower fitness, and natural selection will lead
to the population of beetles to stay green
D. The poisonous ones have no survival advantage, and the population
will be a mix of green and blue individuals over time

_____14. Why are black peppered moths less likely to be seen in the polluted city
parks?
A. Birds cannot see them as clearly on tree barks filled with sooth and
dust.
B. Birds prefer to eat white moths.
C. Black peppered moths prefer sooty trees.
D. White peppered moths prefer the countryside.

_____15. Why do modern scientists discredit Lamarck's theory of evolution?

A. It suggested that evolution happened according to a plan.
B. It suggested that changes come from what a species want or need.
C. It suggested that acquired characteristics do not have a genetic basis.
D. It believed that there was no extinction among species.
 Lesson
Lesson
1 Theories of Evolution

For you to understand the lesson well, do the following activities. Have fun and
good luck! Are you ready? Let’s start!

Jumpstart

Activity 1: Uncover the secret words of Evolution!

Directions: Fill in the crossword puzzle with words commonly used in studying
evolution from based on the guide sentences below. Match the number
of the sentence to the boxes placed across or down the grid.

Biodiversity and Evolution Crossword Puzzle

V E
A T A T T
V V A V V
A
V V

V V
E E E T
A A V

TV V
A T
V V V
T
A
V
T T E T
V V V

E V T
V
ACROSS
1. The number of organisms of the same species that live in a
particular geographic area at the same time, with the capability
of interbreeding.
3. The term used to refer to members of a species that are best suited to their
environment therefore be able to reproduce.
4. The state or fact of continuing to live or exist, typically despite of an accident,
ordeal, or difficult circumstances.
5. A change of characteristics within a population overtime.
8. The sum of all biological processes by which particular characteristics are
transmitted from parents to their offspring.
10. These are specific characteristics of an organism that can be determined by
genes or the environment, or more commonly by interactions between them.

DOWN
2. It is a trait or behavior that helps an organism to survive and reproduce.
6. These are changes in the genes among members of the same species.
7. This is a change in a DNA sequence that can result from DNA copying mistakes
made during cell division, exposure to ionizing radiation, exposure to
chemicals called mutagens, or infection by viruses.
9. These are organisms that in nature can breed and produce fertile offspring.

That’s indeed a good start! Congratulations!

Discover

Evolution is the process by which nature selects, from the genetic diversity of
a population, those traits that would make an individual more likely to survive and
reproduce in a continuously changing environment.

Where does life’s diversity come from? Where do new species come from? Why
do some species go extinct? These are just a few of the questions that can be
answered by an understanding of evolution, genetics, and biodiversity. These
disciplines explain the mechanisms that shape how organisms interact with their
environment and, in turn, how the environment shapes organisms over many
generations. The terms adaptation, variation, and fittest will guide in our basic
understanding of evolution.

Adaptation is a trait or behavior that helps an organism survive and

reproduce. These traits are genetic differences that occur in species. Organisms of a
species differ from one another in many of their traits. Variations are changes in
the genes among members of the same species. These variations can occur randomly
and as result of a trait being more fir for an environment. Fittest refer to members
of a species that are best suited to their environment. An organism's evolutionary
 fitness does not indicate its health, but rather its ability to get its genes into the next
generation. The more fertile offspring an organism leaves in the next generation, the
fitter it is.

To further understand the occurrence of evolution, let us explore the theories

that made a big impact in the study of evolution.

THEORIES OF EVOLUTION

Jean Baptiste LAMARCK

1744 – 1829

He was the first evolutionist to believe that organisms change

over time. Using fossil records as a guide, Lamarck was able
to develop three theories; one is The Theory of Need which
states that organisms change in response to their
environment. Their ability to survive helped them develop
characteristics necessary for them to adapt in a given
Source: environment.
http://evolution.berkele
y.edu/
Next is The Theory of Use and Disuse; which according
to Lamarck,
organs not in use will disappear while organs in use will develop. Lamarck
believed that giraffes before have short necks, but because of the need to
survive and in order to reach tall trees for food, they kept stretching their
necks until these became longer and able to reach taller trees. These acquired
characteristics were believed to be inherited by their offspring and propagated
by the next generation of giraffes. Lamarck called it as The Theory of Acquired
Characteristics.
If you change the color of your hair from black to blond, do you think
your child can inherit the blond color of your hair? A young lady keeps on using
whitening soap and becomes fair? Can her child inherit her acquired fairness?
Many scientists rejected the theories of Lamarck. They understood that
if there were changes in cell or body structure, there could be changes in the
genetic information of the species.

Darwinian Theory

Charles Darwin (1809-1882)

The more popular Theory of Evolution proposed by
Charles Darwin based on natural selection is different from
the theories of Lamarck. According to Darwin, giraffe species
originally had varying neck lengths but natural selection
favored the survival of giraffes with longer necks that could
feed on taller trees that were available. Giraffes with short
neck were eliminated due to lack of accessible food supply.
Fifty years after Lamarck’s Theory of Use and Disuse, Charles
Darwin suggested the Theory of Natural Selection,
http://evolution.berkeley.edu/ after his voyage to the Galapagos Island in HMS
Beagle. He was fascinated by the diversity of organisms he found along the journey.
In Galapagos Island, he observed that finch species have different beaks structures
for different food types.

The abundance of certain finch species in an island was somehow related to

the type of available food for these birds.

Source: http://evolution.berkeley.edu/

Darwin suggested that selection also takes place in nature. In selective

breeding, farmer identifies and selects the best and desirable trait to propagate.
In natural selection, environmental factors promote the survival of the fittest
and eliminates the less fit.

Natural Selection is primarily about reproduction. It is naturally results from

genetic variation in a population and the fact that some of those variations may be
able to leave more offspring in the next generation.

Based on 4 statements
1. Organisms produce many offspring and have potential to grow
unchecked.
2. Variations exist within a species (mutations and genetic recombination.
3. Competition for limited resources (struggle for existence).
4. Environment selects organisms with favorable traits (Survival of the
fittest)

Source: https://www.khanacademy.org/science/ap-biology/natural-selection/natural-selection-
ap/a/darwin-evolution-natural-selection
 Requirements:
➢ Lamarck’s Theory: There is a required adaptation to create new
variations. It is followed by the inheritance of these
characteristics.
➢ Darwin’s Theory: Requires random hereditary variation first followed by
the selection of variations.

Explore

To master these concepts, here are some enrichment

activities prepared for you! Keep going!

Activity 1: “Excavating the Mystery of Golden Kuhol!”

Objective:

Explain the Theory of Natural Selection.

Materials:

pen scissors bond paper paste

Procedures:

1. Analyze the given pictures of Apple Snail or also known as the Golden
Kuhol of the Philippines.
2. Trace the historical journey of Golden Kuhol as depicted by Natural Selection.
3. Use the short bond paper for this activity entitled: “Excavating the Mystery
of Golden Kuhol!”.
4. Using the concept on the Theory of Natural Selection, make a prediction in
each picture depicting the different events that may occur to the population
of Golden Kuhol over many years and many generations.
Limit your predictions from two to three sentences per pictures.
 Natural Selection and Golden Kuhol

Overproduction Variations

__ __

Birds Human Rats

Competition and Predation Selection

__

__
 Photo Analysis Rubric

Criteria Distinguished Proficient Apprentice Novice

4 3 2 1
Analysis of the Analysis of the Analysis of the Analysis of the
piece piece piece piece
demonstrated demonstrated demonstrated demonstrated
thorough considerable some little
Knowledge/ understanding understanding understanding understanding
Understandin of the of the of the of the
g principles, principles, principles, principles,
concepts, and concepts, and concepts, and concepts, and
relationships. relationships. relationships. relationships.
(Natural (Natural (Natural (Natural
Selection) Selection) Selection) Selection)

Analysis and Analysis and Analysis and Analysis and

Thinking/ interpretation interpretation interpretation interpretation
Inquiry of images is of images is of images is of images is
strong. sound. satisfactory weak.
Students Students Students Students
description of description of description of description of
the images the images the images the images
was extremely was extremely was extremely was extremely
thorough and thorough and thorough and thorough and
Application
was was was was
communicate communicate communicate communicate
d with great d with some d with d with limited
degree of effectiveness. effectiveness. effectiveness.
effectiveness.
Ability to make Ability to make Ability to make Ability to make
and express and express and express and express
judgements, judgements, judgements, judgements,
conclusion conclusion conclusion conclusion
Application and and and and
predictions predictions predictions predictions
was insightful was was was limited in
and effective. considerably moderately effectiveness.
effective. effective.

Sources: pkrathwellphotography.weebly.com/uploads/5/1/5/1/51516645/photoanalyisisrubric.pdf
 Deepen

Based from what you have learned in this module, evolution is continuous
process and it is affected by many factors one of which is mutation. Mutations in
genes can lead to the changes in the species appearance, body processes and more.
One contributory of mutation is pollution. To further deepen your understanding
evolution and our contribution to evolution, let us try to do this activity.

Enrichment Activity: “Oplan Rescue our Philippine Species”

Background

“Polluting events can change community structure and ecosystem

functioning. Selection of genetically inherited tolerance on exposed
populations, here referred as micro-evolution due to pollution, has been
recognized as one of the causes of these changes.”

ADAPTED: “Micro-evolution due to pollution: possible consequences for ecosystem responses to

toxic stress.” (Medina M., Correa J., Barata C. National Center for Biotechnology Information. January 30,
2017.

9
Goal: To create a tri-fold brochure that would help spread awareness on the
negative impact of pollution on our native species (plants and animals)
here in the Philippines. Moreover, it should contain some tips on how
Filipino youth like you can help.
Role: Spoke person of the “Greenpeace Philippines”, an organization in the
Philippines that helps spread awareness of protecting the environment
from total devastation and strives for sustainable development.
Audience: The target Audience are Junior High School Students.
Situation: First, You need to discuss through the use and words, the impact
of pollution in our environment specifically on the Micro-evolution due
to pollution (extinction of some species) and to suggest simple activities
that Filipino Family can do to help save our native species.
Product: Tri-fold Brochure

Note:
1. Use any paper of your choice the size must be the same with the size of a
long bong paper (8.5 by 13 inches).
2. Text can be written or encoded or both.
3. Pictures and images can be printed, cut out, or drawn personally.
4. Those students who choose to use computer to create their brochure may
do so.
 Tri-fold Brochure Analysis Rubric

Criteria Distinguished Proficient Apprentice Novice

4 3 2 1
Organization of Each section 75% or more 60% of the Less than half
Information in the sections of sections of of the sections
presented brochure has the brochure the brochure of the
a clear have a clear have a clear brochure have
beginning, beginning, beginning, a clear
middle, and middle, and middle, and beginning,
end. end. end. middle, and
end.
All facts in the 99%-90% of 89%-90% of Fewer than
brochure are the facts in the facts in 80% of the
Content accurate and the brochure the brochure facts in the
match cited are accurate. are accurate brochure are
resources. accurate.
No spelling No more than
No more More than 3
errors and all 1 spelling
than 3 spelling
sections of the and/or spelling and/or writing
Spelling and
brochure are writing and/or errors are
Mechanics
free of writing errors are
writing present.
errors. present. errors are
present.
The brochure The brochure The The
has has brochure brochure’s
exceptionally attractive has well- formatting
Attractiveness attractive formatting organized and
and Organization formatting and well- information organization of
and well- organized but not both material is
organized information. confusing to
information. the reader.
Graphics Graphics go Graphics go Graphics do
match the well with the well with the no with the
topic and text text, but text, but accompanying
in section there are so there are too text or appear
where placed. many (more few less than to be
Each section than two per three randomly
Graphics/pictures has no more section) that graphics for chosen.
than two they distract entire
graphics and from the text. brochure)
there are at and the
least a total of brochure
three graphics seems “text-
used. heavy”
Sources: http://mshartman.weebly.com/uploads/2/3/4/3/2343373/tri-fold_brochure_rubric.pdf

You are really doing great! That’s amazing!

 Gauge

Multiple Choice. Read the following questions and write the letter of your answer
on a separate sheet of paper. Label your paper Quarter 3 Module
6 Gauge.

______1. Who among the scientists proposed that evolution is the result of acquired
characteristic?
A. Charles Darwin B. Gregor Mendel
C. Jean Baptiste de Lamarck D. Thomas Malthus

______2. What is the term for a feature that allows an organism to survive better
in its environment?
A. adaptation B. homologous structure
C. variation D. vestigial structure

______3. What do you call the organisms that breed with each other and produce
fertile offspring in the natural environment?
A. gene pool B. niche C. population D. species

______4. What happens to the survival and reproduction of individuals that are
well adapted to their environment?
A. better traits B. fewer mutations
C. more offspring D. stronger genes

______5. According to Darwin’s theory of natural selection, What do organisms

needed to possess to survive?
A. characteristics their parents acquired by use and disuse.
B. characteristics that plant and animal breeders’ value.
C. the greatest number of offspring.
D. variations best suited to environmental conditions.

______6. Which is a major concept included in Lamarck’s theory of evolution?

A. Change is the result of survival of the fittest.
B. Body structures can change according to the actions of the organism.
C. Population size decreases the rate of evolution.
D. Artificial selection is the basis of evolution.

______7. Which statement about the members of a population that live long enough
to reproduce is consistent with the theory of natural selection?
A. They transmit characteristics acquired by use and disuse to their
offspring.
B. They tend to produce fewer offspring than others in the population.
C. They are the ones that are best adapted to survive in their environment.
D. They will perpetuate unfavorable changes in the species.
______8. In each generation, the wings of experimental fruit flies were clipped short
for fifty generations. The fifty-first generation emerged with normal-length
wings. What idea is disprove based on the given observations?
A. inheritance of acquired characteristics
B. inheritance of natural variations
C. natural selection
D. survival of the fittest

______9. According to Darwin’s Theory of natural selection, individuals who survive

are the ones best adapted to their environment. What is the reason for the
survival of species?
A. possession of adaptations developed through use
B. possession of inherited adaptations that maximize fitness
C. lack of competition within the species
D. choices made by plants and animal breeders

_____10. Why do modern scientists discredit Lamarck's theory of evolution?

A. It suggested that evolution happened according to a plan.
B. It suggested that changes come from what a species want or need.
C. It suggested that acquired characteristics do not have a genetic basis.
D. It believed that there was no extinction among species.

_____11. Which of the following statements does NOT support Charles Darwin
Theory of Evolution?
A. Darwin observed variation within the finches of the Galapagos Islands.
B. Darwin proposed natural selection as the mechanism for species
change over time.
C. Darwin used DNA evidence to support the process of Natural selection.
D. Darwin wrote the book Origin of Species by Natural Selection.

_____12. Which of the following phases best describes the results of natural
selection?
A. the natural variation found in all populations
B. unrelated but similar species living in different locations
C. the changes in the acquired characteristics of a population
D. the struggle for existence undergone by all living things

_____13. Bacteria adapt more quickly than elephants to environmental changes.

Which BEST explains this difference?
A. Bacteria reproduce more rapidly
B. Bacteria populations are more isolated.
C. Individual bacteria grow more steadily.
D. Individual bacteria have more genes.
_____14. Several individuals in a population of green beetles acquire a mutation
that makes them blue and toxic to their primary predatory bird species.
What do you expect will happen to this population over time?
A. The poisonous ones have higher fitness, and natural selection will lead
to more blue and toxic individuals and fewer green beetles over time.
B. The poisonous ones have higher fitness, and stabilizing selection will
lead to the population of beetles to be compared of mainly blue and
toxic individuals over time.
C. The poisonous ones have lower fitness, and natural selection will lead
to the population of beetles to stay green
D. The poisonous ones have no survival advantage, and the population
will be a mix of green and blue individuals over time

_____15. Some areas of a forest contain rich soil, while in other areas the soil is
poor. Plants of a certain species grow taller in the rich soil than in the
poor soil. The taller plants receive more sunlight and can produce more
offspring than the shorter plants. If these offspring grow in rich soil, they
are tall, but if they grow in poor soil, they are short. Which of the following
statements best explains why this situation is not an example of evolution
by natural selection?
A. The observed differences in plant height are not due to genetics.
B. The differences in soil conditions do not affect all plants equally.
C. The short plants and tall plants are not isolated enough from each
other.
D. The short plants are not accumulating gene mutations as quickly as
the tall plants.

Congratulations!!! You did very well in this module!!!

10

Science
Quarter 3 - Week 7
Module 7: Ecosystem:
Biodiversity

AIRs - LM
Science 10
Quarter 3 - Week 7 - Module 7: Ecosystem: Biodiversity
First Edition, 2021

Copyright © 2021
La Union Schools Division
Region I

All rights reserved. No part of this module may be reproduced in any

form without written permission from the copyright owners.

Development Team of the Module

Author: Anacleto L. Arquero

Editor: SDO La Union, Learning Resource Quality Assurance Team

Illustrator: Ernesto F. Ramos, Jr., P II

Management Team:

Atty. Donato D. Balderas, Jr.

Schools Division Superintendent
Vivian Luz S. Pagatpatan, Ph.D
Assistant Schools Division Superintendent

German E. Flora, Ph.D, CID Chief

Virgilio C. Boado, Ph.D, EPS in Charge of LRMS

Rominel S. Sobremonte, Ed.D, EPS in Charge of Science

Michael Jason D. Morales, PDO II

Claire P. Toluyen, Librarian II

 Target

In the previous module you have learned about how fossil records,
comparative anatomy, and genetic information provide evidence for evolution. Also,
you learned how evolution through natural selection can result in biodiversity.

In this module, you will learn how biodiversity can influence the stability of
an ecosystem and the relationship between population growth and carrying capacity
of a specific environment.

After going through this module, you are expected to:

1. Explain how species diversity increases the probability of adaptation
and
survival of organisms in changing environment (S10LT-IIIh-41); and
2. Explain the relationship between population growth and carrying
capacity (S10LT-IIIi-42)
Specifically, you should be able to answer the following questions:
1. What is biodiversity?
2. What are the levels of biodiversity?
3. How does biodiversity affect the stability of an ecosystem?
4. What are the limiting factors that affect population growth?
5. How does population growth affect the carrying capacity of an ecosystem?
6. How do human activities affect the environment?

Pre-Test
Multiple Choice. Read and analyze each question then select the letter of the best
answer from among the given choices. Write your answer on the space provided.

1. What do you call a discrete group of organisms of the same kind?

A. Column B. Community C. Genes D. Species

2. What is the significance of species diversity?

A. Species never interact with the environment
B. Species interact with their environment and thus perform certain functions
C. Though species interact with the environment they DO NOT perform any
functions
D. Species minimize interaction with their environment and thus perform
certain
functions

3. What is the definition of biodiversity?

A. the study of biology in the jungles
B. the study of biology in a university
C. biochemicals in the field of science
D. the variety of species in the environment
4. What type of population growth is shown in the graph?
A. exponential growth B. initiation growth
C. logistic growth D. normal growth

5. Which ecosystem is richest in biodiversity?

A. desert B. temperate forest
C. temperate grassland D. tropical rainforest

6. What are three levels of biodiversity?

A. genes, cells, traits
B. mutation, disorder, regression
C. species, genetic, and ecosystem
D. water, land, mountains

7. Which is NOT a potential threat or danger to biodiversity?

A. exotic species B. gene pool diversity
C. habitat destruction D. pollution

8. What is the correct term used when there is declining number and variety of the
species in an area?
A. developed nation B. loss of biodiversity
C. supply and demand D. sustainability

9. What are two human actions that adversely affect life and biodiversity?
A. deforestation and pollution
B. farming and working in the factories
C. raising animals on farms and eating them
D. weather and natural disasters

10. What is a mass extinction?

A. benefit to the environment
B. disappearance of many species
C. rapid increase in biodiversity
D. result of an exotic species

11. A certain town reached the maximum number of squirrels that its environment
can sustain. What is that number called?
A. Carrying capacity
B. Environmental capacity
C. Full capacity
D. Half capacity

12. What is the carrying capacity of the graph?

A. Less than 500
B. Around 500
C. More than 500
D. Around 600
13. Which is a biotic factor that affects consumers in an ocean ecosystem?
A. number of autotrophs B. temperature variation
C. salt content D. pH of water

14. In December 2004, a tsunami destroyed many of the marine organisms along the
coast of the Indian Ocean. What can be expected to happen to the ecosystem that
was severely hit by the tsunami?
A. The organisms in the ecosystem will become extinct.
B. Ecological succession will no longer occur in this marine ecosystem
C. The ecosystem will change until a new stable community is established.
D. Succession will continue in the ecosystem until one species of marine
organism is established.

15. Which graph represents a population that grew and is maintained at the
carrying capacity of its ecosystem?

A. B.

C. D.
 Lesson Biodiversity
1

Jumpstart

Activity 1.1 Pick and Bind

Objective: Construct a sentence to define biodiversity

Direction: Pick at least four words from the box below which you think
related to biodiversity and form them into complete sentence.
Underline those words in your sentence.

Ecosystem Plants Animals Living

Environment Nature Ocean Nonliving

Organisms Varied Species Terrestrial

Genetic Adaptation` Location Aquatic

Living Non-living Earth Area

Biome Biosphere Biotic Abiotic

Write the sentence in the box below.

 Discover
Biodiversity

Source: https://nature.ca/education/_doc/biodiversite-fiche_eleve_e.pdf

The term biodiversity comes from the words biological and diversity, and
it means "the variety of life on Earth". It describes how varied living things are in a
specific area. Biodiversity is the variability among living organisms from all sources
including terrestrial and aquatic systems and the ecological complexes of which they
are a part; diversity within species, among species, and of ecosystems; interactions
at all levels among organisms. It also refers to the interrelatedness of genes, species,
and ecosystems and in turn, their interactions with the environment.

There are three levels of biodiversity, Genetic diversity, Species diversity and
Ecosystem diversity. Genetic diversity refers to the variation of genes within the
species. Species means a group of individuals that can breed with one another, give
birth to fertile offspring and which cannot breed within other groups. For example,
a “Bulldog” and a “German Shepherd” are dogs that belong to the same species, they
can breed with each other and produce an offspring. Whereas dogs can NOT breed
with cats because they are of two different species.
Species diversity refers to the number of different species present in a specific
location and the relative proportions of the species present. For example, all species
of animals, plants, microorganisms, fungi etc. found in the forest.
Ecosystem diversity refers to all the different habitats, biological communities,
and ecological processes, as well as variation within individual ecosystems. For
example, the different interacting ecosystems.

Figure 1.1 Three levels of biodiversity

Source: https://www.slideshare.net/vjcummins/measuring-biodiversity-53714954
 This Lecture of Kim Preshoff at TED-Ed shows a thorough idea about the
meaning, processes, cause and effect, and importance of biodiversity. Read and
understand the text.

“Our planet’s diverse,

thriving ecosystem may seem like
permanent fixtures, but they are
actually vulnerable to collapse.
Jungles can become deserts and
reefs can become lifeless rocks.
What makes one ecosystem strong
and another one weak in the face of
change? The answer to a large
extent is biodiversity.

Source: https://www.slideshare.net/vjcummins/measuring-biodiversity-53714954

Biodiversity is built into three intertwined features – Ecosystem diversity,

Species diversity and Genetic diversity. The more intertwined there is among these
features, the denser and more resilient the web becomes.

The amazon rainforest is one of the most biodiverse regions on earth due to
its complex ecosystems, huge mix of species and the genetic variety among those
species.

Let us visualize the flow of energy in a rainforest. An entangled vine crawl up

from the forest floor to the canopy, intertwining with treetops and growing thick, with
stems that support these towering trees. Help along by the vines, trees provide the
fruits, seeds and leaves to herbivores that disperse their seeds throughout the forest
so that they can grow. Leftovers are consumed by millions of insects that decompose
and recycle nutrients to create rich soil. …..

The rain forest is a huge system filled with many small systems. Each packed
with interconnected species. Every link provides stability to the next, strengthening
biodiversity’s web, that web is further reinforced by the genetic diversity of the
individual species which allows them to cope with changes. Species that lack genetic
diversity due to isolation or low population number are much more vulnerable to
fluctuations caused by climate change, disease, or habitat fragmentation. Whenever
a species disappears because of weakened gene pool, a knot is untied, and parts of
the net disintegrate.

So, what if we were to remove one species from one rain forest, will the system
fall apart? Probably NOT, the volume of species, their genetic diversity and the
complexity of the ecosystem form such rich biodiversity in the forest, that one species
gap in the web will not cause it to unravel. The forest can stay resilient and recover
from change because of adaptation.

But that is NOT true in every case, in some environment, taking away just one
important component can undermine the entire ecosystem. Take coral reefs for
instance, many organisms in a reef are dependent on the coral, it provides key
microhabitat, shelter, and breeding ground for thousands of species of fish,
crustaceans, and mollusks. Corals also form interdependent relationships with fungi
and bacteria. The coral itself is a loom that allows the tangled net of biodiversity to
be woven, that makes coral a keystone organism, one that many others depend on
for survival.

So, what happens when destructive fishing practices, pollution and ocean
acidification weaken coral or even kill it altogether? ---- Exactly what you might
think, the lost of these keystone species leads its dependents at a lost too,
threatening the entire fabric of the reef. Ecosystem, Species and Genetic diversity
together form the complex tangled web of biodiversity that is vital for the survival of
organisms on earth.

We humans are into this biodiversity too. When just a few strands are lost,
our own well being is threatened. Cut too many links and we risk unraveling it all.
What the future brings is unpredictable, but biodiversity can give us insurance
policy, Earth’s own safety net to safeguard our survival. “

Explore

Here are some enrichment activities for you to work on to

master and strengthen the basic concepts you have learned
from this lesson.

The following are measures used to determine biodiversity, also known as

Biodiversity Indices
Species Richness refers to the number of species in a particular place.
Species Evenness refers to the extent to which individuals are distributed
evenly among species.
Relative Abundance refers to the number of individuals in a species divided
by the total number of all species.
Simpson’s Index combines measures of species richness and species
evenness.

Activity 1.2 Which Ecosystem is More Diverse?

Objective: Measure the richness, evenness, and relative abundance of species in a

community.
Calculating Biodiversity Indices
Ecologists use biodiversity indices to determine if a community or ecosystem is
diverse viz; species richness, relative abundance, Shannon-Weiner Index, species
evenness, and Simpson Index. Ecologists will use more than one index to calculate
the level of diversity. In this activity, we will use species richness and relative
abundance.

Example
Community 1:
Species Richness = 4
Relative Abundance of Species A = 5/20 = 25%
Relative Abundance of Species B = 5/20 = 25%
Relative Abundance of Species C = 5/20 = 25%
Relative Abundance of Species D = 5/20 = 25% Figure 1.3
Community 2:
Species Richness = 4
Relative Abundance of Species A = 16/20 = 80%
Relative Abundance of Species B = 1/20 = 5%
Relative Abundance of Species C = 1/20 = 5%
Relative Abundance of Species D = 2/20 = 10%
Figure 1.4
1. Calculate the species richness and relative abundance for each of the following
communities.

Community A
Species Name Number of Individuals Relative Abundance
Acacia 300
Narra 298
Yakal 350
Total # of Species = Species Richness =

Community B
Species Name Number of Individuals Relative Abundance
Acacia 35
Apitong 12
Narra 309
Yakal 78
Total # of Species = Species Richness =

Community C
Species Name Number of Individuals Relative Abundance
Acacia 450
Apitong 475
Balete 402
Narra 423
Yakal 435
Total # of Species = Species Richness =
2. Rank each of the communities in order of least to greatest Species Richness.
Rank Community
1
2
3

3. Rank each of the communities in order of least to greatest Relative Abundance in

relation to the other communities.
Rank Community
1
2
Guiding Question: Which community is most diverse?
3
Claim: Community _______ is most diverse because

Evidence: Reasoning:

3. Rank each of the communities in order of least to greatest Species Evenness.

Rank Community
1
2
3

4. Develop a CER (Claim, Evidence, and Reasoning) to determine which community

is most diverse.
 Deepen

Activity 1.3 Understanding Biodiversity

Objective: Correctly explain biodiversity

1. What do you understand about biodiversity based on the lecture of Kim

Preshoff?

2. What is the best measure of biodiversity? Underline your answer

Is it
• the total number of species in an area
• the even distribution of species across that area
• whether or not rare species are present
• whether or not the species have different “functions” in the ecosystem

3. What happens when people use dynamite-fishing in the ocean?

4. Are Rare species more important to conserve than common ones?

 Gauge

Direction: Answer the question below based on science. Make it short but complete
and correct.
Explain how species diversity increases the probability of adaptation and survival of
organisms in changing environment.
 Lesson Population and Carrying Capacity
2
Jumpstart

Activity 2.1 Population Growth

Objective: To study and analyze a given graph and answer related questions.
Rapid population growth is one of the key features of the modern world and
provides key evidence for the idea of acceleration. In this activity, you will study and
analyze the nature and patterns of human population growth over the last 10,000
years. This will help you understand the differences between population growth
before and after the Modern Revolution.

Figure 2.1

Carefully study the population chart in figure 2.1 then answer the following
questions

1. How would you describe human population growth in the first 5,000 years?

2. How would you describe human population growth in the next 5,000 years?

3. When did the most dramatic rise in human population begin and how does this
population rise compare to earlier ones?
 Discover
Population

Population (N) is a group of individuals of the same species, occupying a

defined area, and usually isolated to some degree from other similar groups . There
are factors that cause population to change such as Birth Rate (BR) - the number of
births, Death Rate (DR) – the number of deaths, Immigration (I) - the movement into
a population, and Emigration (E) – the movement out of a population. These factors
may either increase or decrease the population. If BR and I are greater than DR and
E, then the population will increase, conversely, if BR and I are lesser than DR and
E, then the population will decrease.

There are factors which limit population growth such as, Competition,
Predation, Parasitism & Disease, Natural Disaster and Usual Weather. They can be
classified as Density-Dependent Factor (DDF) or Density-Independent Factor (DIF).
DDF depends on population size, the denser the population is, the greater the
occurrence of competition, predation, parasitism and disease. DIF on the other hand
affects all populations regardless of population size and density. Whether the
population is dense or NOT, when natural disaster or unusual weather comes, the
population is affected or reduced. It does NOT depend on the size of the population.

Population size

Can be limited by

Competition Natural Disaster

Predation Unusual Weather

Parasitism and
Disease

Density-Dependent Factor Density-Independent Factor

DDF DIF

Figure 2.2

Carrying Capacity
 Carrying Capacity (K) refers to the maximum number of individuals of a
particular species that the environment can support for an extended period. It
represents the population number of individuals the environment can support.
Carrying capacity may be stable for a certain period, however the K for many species
is always changing due to various factors. These factors can be the number of
resources available in the ecosystem; size of the population; and number of resources
everyone is consuming.

Carrying capacity can also have a broader meaning. It can be defined as the
number of living things (plants and animals) any area of land or water can support
at any one time. Different organisms will have different carrying capacities in the
same area. Thus, the carrying capacity of an ecosystem affects everything that lives
in it.
The populations of most living things tend to fluctuate naturally around a
certain level. That level is the carrying capacity. The following is a graph of a
population at the carrying capacity of its ecosystem.

Logistic Growth
Carrying Capacity
(K)
Population
Size (N) Decline
Exponential Growth

Initial Growth Extinction

Time
Figure 2.3

In figure 2.3, The graph shows the movement of the Population (N), which is
represented by the curve line in relation to carrying capacity of a certain area. If
resources are high and population is low then from the initial growth, the population
increases rapidly it will undergo exponential growth this forms a J-shaped curve.
When it approaches K, resources start to deplete, and population exhibits logistic
growth. In logistic growth, population expansion decreases as resources become
scarce, leveling off when the carrying capacity of the environment is reached,
resulting in an S-shaped curve. The curve line may even go beyond the carrying
capacity, but it does NOT go any further, then it starts to fluctuate around K due to
depletion of resources. Depletion of resources is caused by limiting factors such as
competition, predation, disease plus natural calamities. In some locations where
resources are rapidly decreasing then N starts to decline and if resources are
completely depleted it may lead to Extinction of species.
 Explore

In figure 2.4, What is the approximate carrying capacity between 1978 and
1993? What about between 1993 to 2001? How do we determine from the graph the
value of K?
Recall that carrying capacity is the maximum population size a certain
environment can support for an extended period. In the graph, the carrying
capacity is represented by the horizontal broken arrow. There are two carrying
capacities, one is between 1978 and 1993, the other is between 1993 and 2001. Take
note that the K is approximately located at the middle of fluctuations NOT at the
peak of the curve line. So, to determine the approximate location of the K, draw a
horizontal line across the midpoint of the “distinct” fluctuations between the time
frames. The value of carrying capacity differs from one timeframe to another.

This is NOT the K

K1 for 1978 to 1993

Approximately
equal to 180,000

K2 for 1993 to 2001

Approximately
equal to 110,000

Figure 2.4

Activity 2.2 Describing Carrying Capacity

Objectives: Describe the carrying capacity of an ecosystem

Figure 2.5
For Graph A

1. What is the carrying capacity (approximate)?

2. Approximately during which year did this population reach the carrying capacity
of its ecosystem?

3) About how many years did it stay at the carrying capacity?

FOR GRAPH B:

4) What are the carrying capacities of this graph?

5) How many years did this population spend at the first carrying capacity?

6) During which year did it reach the next carrying capacity?

7) Which carrying capacity is more stable? Why do you think so?

Deepen

Activity 2.3 Interpreting Carrying Capacity

Assuming you are a park ecologist who has just received environmental
monitoring data in the form of graphs from your field technician. You now have to
determine what is happening to the populations of a number of species in your park.
Look at each of the following graphs and see if you can describe the story they
are telling. What is happening to the populations and carrying capacity for each?
Confer with your fellow ecologist and brainstorm to come up with reasons behind the
story of the graph. Be ready to share and defend your reasons with all the other
ecologists in the park.

Graph 1

Figure 2.6
Write your answer in the box.

Graph 2

Figure 2.7
Write your answer in the bo
 Gauge

Direction: Answer the question below based on science. Make it short but
complete and correct.

Explain the relationship between population growth and carrying capacity.

Post Test
Multiple Choice. Read and analyze each question then select the letter of the best
answer from among the given choices. Write your answer on the space provided.
1. What do you call a discrete group of organisms of the same kind?
A. Column B. Community C. Genes D. Species

2. What is the significance of species diversity?

A. Species never interact with the environment
B. Species interact with their environment and thus perform certain functions
C. Though species interact with the environment they DO NOT perform any
functions
D. Species minimize interaction with their environment and thus perform
certain functions

3. What is the definition of biodiversity?

A. the study of biology in the jungles
B. the study of biology in a university
C. biochemicals in the field of science
D. the variety of species in the environment

4. What type of population growth is shown in the graph?

A. exponential growth
B. initiation growth
C. logistic growth
D. normal growth
5. Which ecosystem is richest in biodiversity?
A. Desert B. temperate forest
C. temperate grassland D. tropical rainforest

6. What are three levels of biodiversity?

A. genes, cells, traits B. mutation, disorder, regression
C. species, genetic, and ecosystem D. water, land, mountains

7. Which is NOT a potential threat or danger to biodiversity?

A. exotic species B. gene pool diversity
C. habitat destruction D. pollution

8. What is the correct term used when there is declining number and variety of the
species in an area?
A. developed nation B. loss of biodiversity
C. supply and demand D. sustainability

9. What are two human actions that adversely affect life and biodiversity?
A. deforestation and pollution
B. farming and working in the factories
C. raising animals on farms and eating them
D. weather and natural disasters

10. What is a mass extinction?

A. benefit to the environment
B. disappearance of many species
C. rapid increase in biodiversity
D. result of an exotic species

11. A certain town reached the maximum number of squirrels that its environment
can sustain. What is that number called?
A. Carrying capacity
B. Environmental capacity
C. Full capacity
D. Half capacity

12. What is the carrying capacity of the graph?

A. Less than 500
B. Around 500
C. More than 500
D. Around 600
13. Which is a biotic factor that affects consumers in an ocean ecosystem?
A. number of autotrophs
B. temperature variation
C. salt content
D. pH of water

14. In December 2004, a tsunami destroyed many of the marine organisms along the
coast of the Indian Ocean. What can be expected to happen to the ecosystem that
was severely hit by the tsunami?
A. The organisms in the ecosystem will become extinct.
B. Ecological succession will no longer occur in this marine ecosystem
C. The ecosystem will change until a new stable community is established.
D. Succession will continue in the ecosystem until one species of marine
organism
is established.
15. Which graph represents a population that grew and is maintained at the
carrying
capacity of its ecosystem?

A. B.

C. D.