Torrent Suite™ Software 5.

18
USER GUIDE
Publication Number MAN0026163
Revision B.0

For Research Use Only. Not for use in diagnostic procedures.

 Life Technologies Holdings Pte Ltd | Block 33 | Marsiling Industrial Estate Road 3 | #07-06, Singapore 739256
For descriptions of symbols on product labels or product documents, go to thermofisher.com/symbols-definition.

Revision history: Pub. No. MAN0026163

Revision Date Description

Correction of minor typos in the topics "Custom BAM recorder tags", " Reads statistics", "Target regions
B 1 March 2023 file", "Create a Planned Run with Sample Sets", "Update Torrent Suite Software", "Example charts
generated by the coverageAnalysis plugin", and "hotspots file".

A 20 April 2022 New user guide for Torrent Suite™ Software 5.18.

The information in this guide is subject to change without notice.

DISCLAIMER: TO THE EXTENT ALLOWED BY LAW, THERMO FISHER SCIENTIFIC INC. AND/OR ITS AFFILIATE(S) WILL NOT BE
LIABLE FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE, OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR
ARISING FROM THIS DOCUMENT, INCLUDING YOUR USE OF IT.
NOTICE TO PURCHASER: DISCLAIMER OF LICENSE: Purchase of this software product alone does not imply any license under any
process, instrument or other apparatus, system, composition, reagent or kit rights under patent claims owned or otherwise controlled by
Thermo Fisher Scientific, either expressly, or by estoppel.
TRADEMARKS: All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. Ubuntu is
a registered trademark of Canonical Limited. Google and Chrome are trademarks of Google, Inc. Microsoft and Excel are registered
trademarks of Microsoft Corporation. Apache and OpenOffice are registered trademarks of The Apache Software Foundation.
©2023 Thermo Fisher Scientific Inc. All rights reserved.
 Contents

■ CHAPTER 1 Introduction to Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . 12

Torrent Suite™ Software product information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12

Operating system compatibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
Browser compatibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
Hardware compatibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Network and password security requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Network configuration and security . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Password security recommendations for Torrent Suite™ Software . . . . . . . . . . . . . . . . 13

■ CHAPTER 2 Get started with Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . 15

Dashboard at a glance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
News screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
User (Staff) versus Administrator (Superuser) roles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Plan a run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Register for a new user account . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Change a password for Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

■ CHAPTER 3 Samples and Sample Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

About samples and Sample Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

Create a Sample Set manually . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
Create a Sample Set by importing samples from a CSV file . . . . . . . . . . . . . . . . . . . . . . . . . . 21
Create a samples file from a template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
Sample information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
View Sample Set attributes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
Add a sample attribute to a sample . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Manage sample attributes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
Sample attributes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Sample Set definitions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
View Ion AmpliSeq™ library preparation on an Ion Chef™ System run . . . . . . . . . . . . . . . . . 30
Find a Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
Sort Sample Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Edit a Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

Torrent Suite™ Software 5.18 User Guide 3

Contents

Delete a Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Create an Ion AmpliSeq™ on Ion Chef™ Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

■ CHAPTER 4 Plan and execute an instrument run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Planned Run templates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Planned Run templates for specific research applications . . . . . . . . . . . . . . . . . . . . . . . 36
Create a custom Planned Run template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Create a Planned Run from a Planned Run template . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
Create a Planned Run without a Planned Run template . . . . . . . . . . . . . . . . . . . . . . . . . 40
Search for a Planned Run template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Export a Planned Run template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
Import a Planned Run template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
Save a Planned Run template to Favorites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
Steps in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
Ion Reporter step in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
Research application step in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Kits step in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Plugins step in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
Projects step in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Plan step in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Review Planned Run settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
Import panel files and parameters from AmpliSeq.com . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
Link your Ion Torrent™ Server account to AmpliSeq.com . . . . . . . . . . . . . . . . . . . . . . . 59
Import Planned Run template parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
Manually upload panel files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
Copy an analysis parameter set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
Create Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
Plan by Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Create a Planned Run for a 2-pool Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Create a Planned Run with Sample Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Create a Planned Run for mixed samples with a Planned Run template . . . . . . . . . . . 68
Create a Planned Run with multiple Ion Reporter™ Software analysis workflows . . . 70
Create multiple Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
Create multiple Planned Runs for non‑barcoded libraries . . . . . . . . . . . . . . . . . . . . . . . 74
Create multiple Planned Runs for barcoded libraries . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
Planned Runs list . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
Manage Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Planned Run status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
Execute a Planned Run on a sequencer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
Transfer a Planned Run to another Ion Torrent™ Server . . . . . . . . . . . . . . . . . . . . . . . . . 83

4 Torrent Suite™ Software 5.18 User Guide

 Contents

■ CHAPTER 5 Monitor runs in progress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85

Monitor a sequencing run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86

Monitor an Ion Chef™ run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
View data for runs in progress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Auto Refresh the Monitor tab . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
Review the Planned Run settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Stop an analysis job . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
View system memory usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91

■ CHAPTER 6 Review and manage run reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

About run reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

Search for a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
Open a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
Review unaligned reads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
Review aligned reads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Run report metrics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
Output files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
Download a run report summary PDF . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
View details about completed runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
View test fragments for a completed run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 110
View consumables used in a completed run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
View the summary for an Ion Chef™ Instrument run . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
View the calibration report for a completed run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112
View analysis details for a completed run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
View software versions used in a run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114
Organize run results with projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114
Search for projects by name . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
Add a project to a Planned Run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
View result sets in a project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
Compare reports of runs in a project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
Manage data for result sets in projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
Combine aligned reads from multiple run reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
Download a CSV file of metrics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 120
Remove a result set from a project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124
Reanalyze a run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124
Change the default alignment reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
Edit a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
Add or change barcoding for a completed run report . . . . . . . . . . . . . . . . . . . . . . . . . . 127
Set the Completed Runs & Reports screen to automatically refresh . . . . . . . . . . . . . . . . . 128

Torrent Suite™ Software 5.18 User Guide 5

Contents

■ CHAPTER 7 Manage plugins for data analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129

Plugin configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129

Configure plugins globally . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130
Configure a plugin to run automatically . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130
Run a plugin manually from the sequencing run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
Download a plugin report PDF . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
View plugin run status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
Stop a plugin run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Open a plugin log . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Delete plugin results from a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Rescan a plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134
Preinstalled plugins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135
ampliSeqRNA plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 136
AssemblerSPAdes plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
coverageAnalysis plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
DataExport plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153
ERCC_Analysis plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 154
FieldSupport plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
FileExporter plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158
FilterDuplicates plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160
immuneResponseRNA plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161
IonReporterUploader plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
molecular Coverage Analysis plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 164
PGxAnalysis plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
RunTransfer plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
sampleID plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
Plugins available on Connect . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174
RNASeqAnalysis plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174
smallRNA plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188

■ CHAPTER 8 Variant calls in Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . 190

About the variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190

Run the variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Configure the variantCaller plugin to run by default after every run . . . . . . . . . . . . . . 191
Configure the variantCaller plugin to run as part of a Planned Run . . . . . . . . . . . . . . 191
Run the variantCaller plugin manually . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 192
variantCaller plugin configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
Create a custom configuration for the variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . 196
Apply configuration settings to specific barcodes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
Create and use a custom parameters setting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199

6 Torrent Suite™ Software 5.18 User Guide

 Contents

Review variantCaller plugin run results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199

Detailed variantCaller plugin report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202
Variant Calls by Allele table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203
View allele annotations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205
View coverage metrics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206
View quality metrics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207
Export variant calls to a file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208
Troubleshoot variantCaller plugin results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209
Save adjusted parameters to a variantCaller plugin configuration . . . . . . . . . . . . . . . . . . . . 214
variantCaller plugin advanced parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
Torrent Variant Caller module advanced settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
FreeBayes module advanced settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 223
Long INDEL Assembler module advanced settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
Advanced argument settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226

■ CHAPTER 9 Integration with Ion Reporter™ Software . . . . . . . . . . . . . . . . . . . . . . . . 227

About Ion Reporter™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228

Install the IonReporterUploader plugin on an Ion Torrent™ Server . . . . . . . . . . . . . . . . . . . . 229
Set up an account for IonReporterUploader plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
Automatically transfer Torrent Suite™ Software output to Ion Reporter™ Software . . . . . . 231
Manage the Ion Reporter™ Software analysis workflow list . . . . . . . . . . . . . . . . . . . . . 234
Sample gender . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
Run the IonReporterUploader plugin manually . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
IonReporterUploader plugin configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 236
IonReporterUploader plugin file transfer progress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238
View IonReporterUploader plugin status details . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238
Delete IonReporterUploader plugin report files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 239
Tune IonReporterUploader plugin speed parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
Review IonReporterUploader plugin results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
Torrent Suite™ Software output and Ion Reporter™ Software analysis phases . . . . . 242
IonReporterUploader command-line utility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243
Download IonReporterUploader command-line utility . . . . . . . . . . . . . . . . . . . . . . . . . 244
Run IonReporterUploader command-line utility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244

■ CHAPTER 10 References management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245

About references . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245

Reference sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
hg19 reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
GRCh38 reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Import reference sequence files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 248
View a reference sequence file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
Edit reference sequence file properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 252

Torrent Suite™ Software 5.18 User Guide 7

Contents

Permanently delete a reference sequence file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254

Obsolete reference sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254
Target regions and hotspots files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255
Guidelines for using target regions and hotspots files . . . . . . . . . . . . . . . . . . . . . . . . . 255
View and manage target regions files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 256
View and manage hotspots files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257
Modify a BED file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 258
Upload a target regions file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 259
Upload a hotspots file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 261
BED file formats and examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 262
Test fragments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279
View test fragment details . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279
Add a custom test fragment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279
Edit or delete a custom test fragment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 280
Barcodes and barcode sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 280
View a DNA barcode sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281
Download a DNA barcode set CSV file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282
Add a custom DNA barcode set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282
Delete a custom DNA barcode set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 284
Upload history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 284

■ CHAPTER 11 Data management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 286

View disk usage parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 286

View category statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287
View active data management jobs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287
Error messages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
Disk full message . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
Search for run reports with disk usage status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Keep run report data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Import data for data transfers or restoration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 290
View the data management actions log . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 290

■ CHAPTER 12 Supported software modules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292

Analysis pipeline overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292

BaseCaller module and barcode classification overview . . . . . . . . . . . . . . . . . . . . . . . . . . . 293
Overview of the BaseCaller module functionality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293
Ion Torrent™ BAM format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 295
Custom BAM recorder tags . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 295
BaseCaller module arguments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297

8 Torrent Suite™ Software 5.18 User Guide

 Contents

About barcodes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 303

Troubleshooting barcode classification issues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 303
TMAP modules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Mapping modules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Find the TMAP command for a specific analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 308
TMAP examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 308
Global options used by all TMAP modules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 309
Global pairing options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 309
TMAP map1 options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 309
TMAP map2 options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 311
TMAP map3 options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 312
TMAP map4 options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313
TMAP mapvsw options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 314
TMAP alignment refinement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 314

■ CHAPTER 13 Administer Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . 316

Open the Site Administration screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 316

Install Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 317
Manage Torrent Suite™ Software user accounts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 317
Add customer support contacts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 324
Change the time zone for the Ion Torrent™ Server . . . . . . . . . . . . . . . . . . . . . . . . . . . . 324
Change the displayed server name . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 325
Lock current Torrent Suite™ Software version . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 325
Update Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 326
Update Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 327
Check for off-cycle updates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 328
Enable off-cycle product updates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 329
Install off-cycle bundles without Internet access . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 329
Install or upgrade plugins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 329
Enable an installed plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 330
Configure plugins globally . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331
Update off-cycle release plugins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331
Uninstall a plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331
Manage disk usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332
View disk usage parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332
Ion instrument data types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332
Archive or delete data automatically . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333
Manually export run data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 336
Manually archive run data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 336
Manually delete selected data from a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 337
Increase file storage and available disk space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338
Dataflow file sizes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 344

Torrent Suite™ Software 5.18 User Guide 9

Contents

Set up flexible workflows . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 345

View sequencing runs on multiple sequencers with Ion Mesh . . . . . . . . . . . . . . . . . . 346
Transfer a Planned Run to an Ion Torrent™ Server with Ion Mesh . . . . . . . . . . . . . . . . 347
Track Ion Chef™ Instrument flexible workflows for Ion 550™ chips with Ion Mesh . . 348
Data backup and restore locations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 348
Restore the PostgreSQL Database . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 348
Manage telemetry services . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 349
Axeda™ Remote System Monitoring (RSM) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 350
Deep Laser . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 351
Data automatically collected by the telemetry services . . . . . . . . . . . . . . . . . . . . . . . . 352
Administration with command-line utilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357
Monitor disk space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357
Change the hostname . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358
Change the time zone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358
Add an HTTP proxy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 358
Alternate checks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359

■ CHAPTER 14 Screen descriptions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 360

User and account settings screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 360

Analysis Parameters screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
Configure screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
Ion Reporter™ configuration screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362
Plugins screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362
Updates screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363
References Sequences screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 364
Services screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 364
Planned Runs screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
Samples screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
Templates screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 366
Runs in Progress screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 366
Ion Chef screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 366
Completed Runs & Reports screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
Run Report screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 368
Projects screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 368
Data Management screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 369

■ APPENDIX A Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 370

Troubleshooting resources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 370

Troubleshoot Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 371
Get technical support files for a completed run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 371
Troubleshoot a sequencing run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 371
Customer Support Archive (CSA) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 376

10 Torrent Suite™ Software 5.18 User Guide

 Contents

Troubleshoot IonReporterUploader plugin account setup . . . . . . . . . . . . . . . . . . . . . . 380

Troubleshooting file import/upload errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 381
Troubleshoot Ion Torrent™ Server . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 381
Check crawler and job server status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 382
Verify network connectivity and name resolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 383
Verify the Ion Torrent™ Server IP address . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 384
Troubleshoot and configure the time service . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 385
View system support diagnostics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 385
View instrument diagnostics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 387
Restart services . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 390
Further investigation and problem resolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 390

■ Documentation and support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 391

Customer and technical support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 391

Limited product warranty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 391

Glossary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 392

Torrent Suite™ Software 5.18 User Guide 11

 1 Introduction to Torrent Suite™
Software

■ Torrent Suite™ Software product information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12

■ Operating system compatibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
■ Browser compatibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
■ Hardware compatibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
■ Network and password security requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Torrent Suite™ Software product information

Torrent Suite™ Software is used for sequencing data analysis. The software allows you to plan and
monitor sequencing runs, view sequencer activity, and review sequencing data from a variety of
sequencing instruments.
Torrent Suite™ Software and hardware provide customizable and automated sample analysis and data
storage solutions. You can plan, monitor, and track your sequencing runs within a web interface, while
reviewing the quality and accuracy of your run. In addition, you can perform variant calling and detect
SNPs and INDELs.
The Torrent Suite™ Software 5.18 User Guide (Pub. No. MAN0026163) and the Torrent Suite™ Software
5.18 Help provide information for using Torrent Suite™ Software with Ion S5™, Ion S5™ XL, and Ion
GeneStudio™ S5 Series sequencers, and the Ion Chef™ Instrument.

Operating system compatibility

Torrent Suite™ Software 5.18 is compatible with an Ion Torrent™ Server that uses Ubuntu operating
system 18.04.

Browser compatibility
Torrent Suite™ Software can be operated on all modern web browsers such as Microsoft™ Internet
Explorer™, Microsoft™ Edge, Google™ Chrome™, Safari, and Firefox™.

12 Torrent Suite™ Software 5.18 User Guide

 Chapter 1 Introduction to Torrent Suite™ Software
Hardware compatibility 1

Hardware compatibility
Torrent Suite™ Software 5.18 is supported for use with the following instruments.
• Ion S5™ Sequencer
• Ion S5™ XL Sequencer
• Ion GeneStudio™ S5 Sequencers
• Ion Chef™ Instrument

IMPORTANT! Torrent Suite™ Software 5.14 is the last software release that can be used with an Ion
PGM™ System or Ion Proton™ System. For more information, see “Update Torrent Suite™ Software” on
page 327 or contact your Field Service Engineer or Technical Support representative.

Network and password security requirements

Network configuration and security
The network configuration and security settings of your laboratory or facility (such as firewalls, anti-
virus software, network passwords) are the sole responsibility of your facility administrator, IT, and
security personnel. This product does not provide any network or security configuration files, utilities, or
instructions.
If external or network drives are connected to the software, it is the responsibility of your IT personnel
to ensure that such drives are configured and secured correctly to prevent data corruption or loss. It
is the responsibility of your facility administrator, IT, and security personnel to prevent the use of any
unsecured ports (such as USB, Ethernet) and ensure that the system security is maintained.

Password security recommendations for Torrent Suite™ Software

Thermo Fisher Scientific strongly recommends that you maintain unique passwords for all accounts in
use on this product. All passwords should be reset upon first sign in to the product. Change passwords
according to your organization's password policy.
It is the sole responsibility of your IT personnel to develop and enforce secure use of passwords.
When using passwords for Torrent Suite™ Software, Thermo Fisher Scientific strongly recommends that
passwords meet the following security policies.
• Passwords should be at least 10 characters in length for user accounts and administrator accounts.
• Passwords should not contain any keywords that are related to the associated username, device
name or serial number.
• Passwords should contain both upper and lowercase alphabetic characters (A-Z, a-z).
• Passwords should include at least one numerical character (For example, 0-9).
• Passwords should include at least one special character. For example,@, #, $, %, ^, &, *, (, ), _, -,
+, ; and !.
• The last used password should not be reused.

Torrent Suite™ Software 5.18 User Guide 13

 Chapter 1 Introduction to Torrent Suite™ Software
1 Network and password security requirements

Torrent Suite™ Software software checks each password when it is created to ensure that the password
meets the Torrent Suite™ Software recommendations for password security. If any recommendations
are not met, the user who created the password receives a notification in the Dashboard screen with
details about how to create a stronger password. Notifications are not generated for passwords that
meet the recommendations.
For more information, see “Change a password for Torrent Suite™ Software” on page 18.

14 Torrent Suite™ Software 5.18 User Guide

 2 Get started with Torrent Suite™
Software

■ Dashboard at a glance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
■ News screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
■ User (Staff) versus Administrator (Superuser) roles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
■ Plan a run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
■ Register for a new user account . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
■ Change a password for Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

Dashboard at a glance
Use the Dashboard to see active and recent sequencing runs. The Dashboard provides an overview
of activity on all connected sequencers. To view the Dashboard, click the Home tab, then click
Dashboard.

Torrent Suite™ Software 5.18 User Guide 15

 Chapter 2 Get started with Torrent Suite™ Software
2 Dashboard at a glance

The Summary section includes:

• The Software column shows information and messages about the software. The software version
link opens the Releases screen, where you can click Update to update your software when new
versions are released, and scroll down to a list of links that contain support information. A message
is shown with a link to change the password, if the password for the user account does not meet
the recommended security policy.
• Instruments column—Shows the number of instruments that are connected or offline, and those
that have alerts.
• Services links—Report statuses, such as services that are running, nodes that are down, and
Redundant Array of Independent Disks (RAID) storage statuses. Click a link to see details on the
Services screen.
• Data Management links—Reports disk usage and data management activity. Click a link to see
details on the Data Management screen.
• Stop Refresh stops the auto refresh function, which occurs every 30 seconds by default. Stop the
auto refresh function to review the screen without interruption from the refresh cycle.

The Runs section shows information that is available through the Data, Plan, and Monitor tabs;
however, it is a subset of only the most recent information. The Runs section includes:
• Run Name link—Takes you to the name of the run or the run report.
The link is not functional until the run report is completed.
• Samples information icon—Shows names of and information about barcodes for samples.
• The third column shows the stage of the run, with the date that the run information was either last
updated or completed.
• The fourth column shows the progress of sequencing runs and plugin use. Blue circles denote
normal progress and red circles denote sequencing or plugin errors.
• The fifth column provides links to thumbnail reports and run reports. If an error appears in red
under a run report, see “Troubleshoot Torrent Suite™ Software” on page 371 or contact Technical
Support.
– The Run Report links to completed run reports for the time interval selected. The link becomes
active when the run report is complete.
– The Thumbnail Report is an early run report that helps you determine the quality of a run that
is in progress.
• The Activity list allows you to select a time interval for viewing sequencer activity. Choices include:
Last Hour, Today, Last 24 Hours, and Last 7 days.

The Instruments section shows the instruments that are connected to the system and their operational
status, which may include:
• Connected—Instruments that are connected but status is unknown.
• Analyzing—Instruments that are currently in use.
• Cleaning—Instruments that are currently undergoing a cleaning process.
• Idle—Instruments that are connected, but not currently in use.
• Offline—Instruments that are no longer connected. These instruments are shown when run reports
for runs on these instruments exist in Torrent Suite™ Software.

If an instrument has an operational error, hover over the Alert to see details. Then, resolve the issue
on the sequencer.

16 Torrent Suite™ Software 5.18 User Guide

 Chapter 2 Get started with Torrent Suite™ Software
News screen 2

News screen
Use the News screen to see Thermo Fisher Scientific announcements about new products, software
releases, and other news. To view the News screen, click the Home tab, then click News.

User (Staff) versus Administrator (Superuser) roles

In Torrent Suite™ Software, the User (Staff) role allows the creation and execution of Planned Runs on a
sequencing instrument.
The Administrator (Superuser) role also allows the creation and execution of Planned Runs,
server configuration, user configuration, base caller configuration, reference management, and data
management. For more information on Administrator functions, see Chapter 13, “Administer Torrent
Suite™ Software”.

Plan a run
The following steps describe how to use Planned Run templates and Planned Runs that fit into your
sequencing workflows.

1. Decide on your sequencing application and sequencing product (such as an Ion AmpliSeq™ panel).

2. Select a preinstalled Planned Run template with defaults for your application and sequencing
product, or create a custom Planned Run template from scratch to customize your Planned Run.

3. Create new Planned Runs from Planned Run templates, adding the names of the samples to be
sequenced.
Use Planned Run templates and Planned Runs to enter run information through Torrent Suite™
Software instead of directly on the sequencing instrument. The use of Planned Run templates
and Planned Runs reduces the chance of errors and wasted runs, reduces setup time on the
sequencing instrument, and increases instrument throughput.

4. Start the run on the sequencer.

On the sequencer, information for a Planned Run is applied to the current Run Info screen
automatically, or by selecting the Planned Run from a list of Planned Runs. You can also overwrite
(change) Planned Run information directly on the sequencer.

Register for a new user account

When you sign in to Torrent Suite™ Software for the first time, you request a new user account. The
request is sent to the administrator for approval. An account is not active until approval is granted.

1. On the sign in screen for Torrent Suite™ Software, click Register.

2. Enter the new user information, then click Submit.

Upon the approval by an administrator, the new account is created.

Torrent Suite™ Software 5.18 User Guide 17

 Chapter 2 Get started with Torrent Suite™ Software
2 Change a password for Torrent Suite™ Software

Change a password for Torrent Suite™ Software

If you receive a notification to update your password, you can change a Torrent Suite™ Software
password in the User Profile / Account Information screen.
When using passwords for Torrent Suite™ Software, Thermo Fisher Scientific strongly recommends that
passwords meet the following security policies.
• Passwords should be at least 10 characters in length for user accounts and administrator accounts.
• Passwords should not contain any keywords that are related to the associated username, device
name or serial number.
• Passwords should contain both upper and lowercase alphabetic characters (A-Z, a-z).
• Passwords should include at least one numerical character (For example, 0-9).
• Passwords should include at least one special character. For example,@, #, $, %, ^, &, *, (, ), _, -,
+, ; and !.
• The last used password should not be reused.

1. In the notification to update your password, click the link in the notification.
The User Profile / Account Information opens when you click the link in the notification.

2. In the User Profile / Account Information screen, enter the new password in the Password field.

3. Re-enter the password in the Password Confirm field.

4. Click Save to save the new password.

The user account is modified.

18 Torrent Suite™ Software 5.18 User Guide

 3 Samples and Sample Sets

■ About samples and Sample Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

■ Create a Sample Set manually . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
■ Create a Sample Set by importing samples from a CSV file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
■ Create a samples file from a template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
■ Sample information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
■ View Ion AmpliSeq™ library preparation on an Ion Chef™ System run . . . . . . . . . . . . . . . . . . . . . . . 30
■ Find a Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
■ Sort Sample Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
■ Edit a Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
■ Delete a Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
■ Create an Ion AmpliSeq™ on Ion Chef™ Sample Set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Torrent Suite™ Software uses samples and Sample Sets that sequencing instruments use to process the
genetic material during instrument runs.

About samples and Sample Sets

Samples in Torrent Suite™ Software are the information and attributes that characterize the data.
Samples contain information, or attributes, that sequencing instruments use to process the genetic
material during instrument runs. After sample sequencing is complete, software programs, such as Ion
Reporter™ Software, use sample information for data analyses.
Sample information can be transferred to Ion Reporter™ Software from the sequencer through Torrent
Suite™ Software with the IonReporterUploader plugin or imported as individual BAM or VCF files. When
an Ion Reporter™ Software analysis workflow is used to analyze a sample, the output in Ion Reporter™
Software is a set of analysis results.
You can preselect the attributes that you want to associate with each sample before you start to plan
your templating and sequencing runs. Then you can organize the samples into Sample Sets that you
can reuse when you create Planned Runs. Using Sample Sets can save data entry time and reduce the
likelihood of errors when you plan your instrument runs by entering the information for the Sample Set
only once, then reusing the Sample Set for other runs.
Grouping samples into Sample Sets is also helpful for using barcodes that have attributes that are
assigned to each individual barcode. If you create Sample Sets before planning the run, you can enter
barcodes and the barcode attributes only once in the Sample Sets. Then you can select one or more
Sample Sets to reuse these barcodes when you create a Planned Run.

Torrent Suite™ Software 5.18 User Guide 19

 Chapter 3 Samples and Sample Sets
3 Create a Sample Set manually

You can set up samples in Torrent Suite™ Software in two ways. You can manually enter sample
information for each sample or import sample information from a CSV file that contains the sample
information.
You can search for and find samples in the software, add Sample Sets to your Planned Runs, and
view details about how the sample libraries were prepared if the run uses an Ion AmpliSeq™ library
preparation kit. To change the sample files, you can also edit information in the samples, update
Sample Sets, and delete samples and Sample Sets.

Create a Sample Set manually

Create a Sample Set manually by entering sample information into the Torrent Suite™ Software without
the use of an external CSV file. This method of entering sample information is useful for creating small
Samples Sets.
To create a Sample Set manually, enter individual samples into the software, then create a new Sample
Set and add your samples to it. Alternatively, you can add your new samples to an existing Sample Set.
For Sample Sets that contain numerous samples, you can import samples using a CSV file. For more
information, see “Create a Sample Set by importing samples from a CSV file” on page 21.

1. In the Plan tab, click Samples, then click Add or Update Sample Set/Samples.

2. Click Enter New Sample.

a. Complete the Add Sample dialog box. For information about defining the samples, see
“Sample attributes” on page 25.

b. Click Done.
Your new samples and sample attributes appear in the Enter Samples list.

c. Enter additional samples if needed.

3. Add the samples to a sample set. Do one of the following:

• Click Add to existing Sample Set, then select an existing Sample Set to contain the samples.
• Click Create Sample Set. For information about defining the Sample Set, see “Sample Set
definitions” on page 29.

4. Click Save Sample Set.

The set name appears in the Sample Sets list.

You can use the Sample Set to create a Planned Run. The information from the Sample Set and
individual samples within the Sample Set are prepopulated in the Planned Run workflow bar steps and
Planned Run template. For more information, see “Plan by Sample Set” on page 63.

20 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Create a Sample Set by importing samples from a CSV file 3

Create a Sample Set by importing samples from a CSV file

If you have many samples, you can import new samples into Torrent Suite™ Software, or update existing
samples, using a CSV file that contains sample information. If you do not yet have a samples file, you
can create one from an available CSV template that is available in Torrent Suite™ Software. During this
process, you can also create a new Sample Set for the new samples.

1. In the Plan tab, click Samples, then click Import Samples from File.

If you do not yet have a samples file, create a new samples file from an available samples CSV file.
For more information, see “Create a samples file from a template” on page 21.

2. Upload the samples file, and optionally add a new Sample Set to receive the samples.
a. In the Import Samples section, click Select file, then navigate to sample import file, then
upload the sample import file.

b. Select a Sample Set CSV file, then click Open.

c. Select a Sample Set to receive the samples.

(Optional) To add a new Sample Set to receive the samples, click Add Sample Set, then
complete the Sample Set information.
For information about how to define a Sample Set, see “Sample Set definitions” on page 29.

3. Click Save & Finish.

The system loads, parses, and validates the file, then, if no errors are found, saves the samples
and Sample Sets.

Create a samples file from a template

If you do not already have a samples file on your computer to use to import samples from a CSV file,
then you can download a samples template and use it to create a samples file.

1. In the Plan tab, click Samples, then click Import Samples from File.

Torrent Suite™ Software 5.18 User Guide 21

 Chapter 3 Samples and Sample Sets
3 Sample information

2. In step 1 of the Import Samples section, click Sample File Format to download a sample CSV
template.
The sample file format CSV contains the version of the CSV file in the top row, and sample
attributes in separate columns.

3. To create a new CSV file, copy and paste the contents of your existing sample CSV file into the
new file format.

4. Open the CSV template and enter sample information into the cells.
For information on how to define the samples, see “Sample attributes” on page 25.

5. Save the file to your computer so that is available for use to create a Sample Set.

Sample information
When you add a sample to a Sample Set in Torrent Suite™ Software, you enter information to describe
and identify each sample, with characteristics such as gender, sample type (RNA or DNA, for example),
or relationship group. This sample information is referred to as sample attributes. You can add user-
defined attributes to the sample attributes that are available in the software. Each attribute that you add
appears in:
• Lists of samples and Sample Sets on the Ion Torrent™ Server.
• The Add Sample dialog box in the software.
• The CSV file that is used to import sample information.

A sample attribute can be made mandatory, in which case you are required to enter the attribute
information for each new sample. After the attribute is added to the Sample Attributes list, you can edit
or delete user-defined attributes. You can also choose whether the attribute is displayed or hidden from
the sample listings and the Add Sample dialog box.
The attributes that you create are applied to individual samples and not to the Sample Sets.

View Sample Set attributes

You can view details about a Sample Set and review sample attributes for each sample that is in a
Sample Set.
Some sample attributes are passed from Torrent Suite™ Software for use in Ion Reporter™ Software. Trio
is an example of a Sample Set grouping that is used in an Ion Reporter™ Software analysis workflow.
If you select the Trio Sample Set grouping, Torrent Suite™ Software automatically selects a Trio Ion
Reporter™ Software analysis workflow when you create a Planned Run.
In a Trio Sample Set, you can view attributes that include:
• Gender—the gender of the sample.
• Type—the Torrent Suite™ Software relationship type used for Example Sample Set.
• Group—the number is the Sample Set mechanism to mark the samples as related. Related means
that in the eventual Ion Reporter™ Software analysis, these samples are analyzed in one analysis
with a defined relationship between the samples, such as Tumor and Normal.

22 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Sample information 3

1. In the Plan tab, click Samples.

2. In the Sample Sets table, find a sample set that you want to view.
For more information on locating your sample set, see “Find a Sample Set” on page 30 and “Sort
Sample Sets” on page 31.
In this example, a Trio Sample Set named Example Sample Set is shown

Each column in the Sample Sets table lists a specific attribute for that Sample Set.

3. Click the arrow in the row of the Sample Set to expand the table and view all samples within the
Sample Set.

Each column in the expanded table lists a specific attribute for each sample within the selected
Sample Set.

Add a sample attribute to a sample

1. In the Plan tab, click Samples, then click Sample Attributes4Add.

Torrent Suite™ Software 5.18 User Guide 23

 Chapter 3 Samples and Sample Sets
3 Sample information

2. In the Add Attribute dialog box, enter the following:

• Attribute Name
• Attribute Type
If the Attribute Type is set to Integer, you can enter only numeric characters (whole numbers)
for this attribute.
• (Optional) Description

3. (Optional) Select the Is Mandatory checkbox if you want the attribute to be required for every
sample.

4. Click Save.

Manage sample attributes

If you add user-defined sample attributes to the Ion Torrent™ Server, you can:
• Edit sample attributes.
• Choose whether the attributes are shown or hidden from the list of samples, Sample Sets, and Add
Sample dialog box.
• Delete sample attributes.

1. In the Plan tab, click Samples, then click Sample Attributes4Manage.

24 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Sample information 3

2. In the Sample Attributes list, click (Actions) in the row of the attribute that you want to
manage, then complete the selections for the following options.
Option Description
Edit • In the Edit Attribute dialog box, edit one or all of the following:
a. Attribute Name
b. Attribute Type
c. Attribute Description
• You can also change whether the attribute is required or optional by selecting or
deselecting the Is Mandatory checkbox.
The attribute that is mandatory is designated by the selected checkbox in the
Required column of the Sample Attributes table. The absence of the selected
checkbox designates the attribute as optional.

Show/Hide You can hide a user-defined attribute from view without deleting it by using these options.
• If you hide an attribute, that attribute no longer appears in the list of samples,
Sample Sets, and Add Sample dialog box.
The attribute that is shown is designated by the selected checkbox in the To Show
column of the Sample Attributes table. The absence of the checkbox designates
the attribute as hidden.
• If you hide a mandatory attribute, that attribute is no longer mandatory.

Delete Deleting a sample attribute permanently deletes that attribute from the Ion Torrent™
Server.

Sample attributes
When you create a Sample Set, you can enter sample attributes into Torrent Suite™ Software manually
or import samples with a CSV file. Most of the sample information is optional except for Sample
Name. However, some information is required if you transfer data to Ion Reporter™ Software, and those
attributes required by Ion Reporter™ Software are indicated in the following table.

Attribute Description

Sample Name The unique name of the sample.

(Required) Use any combination of alphanumeric characters, plus spaces, periods (.),
hyphens (-), and underscores (_).
This attribute is used by Ion Reporter™ Software.
A 255‑character limit must be followed for Ion Reporter™ Software name
validation. If you are using Ion Reporter™ Software, and the actual sample name
already exists in that software, a string such as _v1 or _v2, and so on, is added to
the sample name.

Sample External ID (Optional) If you manage samples in an external system, for example, a
Laboratory Information Management System (LIMS), enter the identifier from that
system.

Torrent Suite™ Software 5.18 User Guide 25

 Chapter 3 Samples and Sample Sets
3 Sample information

(continued)

Attribute Description

PCR Plate Position A unique identifier for the 96-well plate used for library preparation and
templating.
• Select a plate position of A to H.

Barcode Kit The name of the barcode kit used to make a library from the sample. The same
barcode kit must be used for all samples in a Sample Set.

Barcode The name of the specific barcode in the selected barcode kit. Assign a unique
barcode to each sample in a Sample Set.

Sample ID A unique identification code (SampleID) for each barcode in a sample. This
helps to track samples or possibly identify misassignment between samples
and barcodes in a sequencing run. The SampleID is passed to Ion Reporter™
Software.
If you manage samples in an external system (for example, a LIMS), you can use
the identifier from that system.
This attribute cannot be changed.
Note: This attribute is optional in Torrent Suite™ Software. However, this value
can be required for planned runs that include automatic upload of data to Ion
Reporter™ Software.

Control Type The control type used when preparing the sample. If a value is selected, the
sample is identified as a control sample.
• MSI On-Chip Control
• No Template Control

Basic Annotations

Description Typically, one or two sentences that describe the sample.

Nucleotide Type The nucleic acid type or RNA variant type that is associated with the sample:
• Unspecified
• DNA
• RNA
• TNA
• Fusions

Sample Source The source from which the sample is extracted.

• Blood
• FFPE
• Other

26 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Sample information 3

(continued)

Attribute Description

Panel Pool Type The type of pool that is used by the assay.
• Dual Pool
• Single Pool

Gender The biological gender of the sample.

This attribute is used by Ion Reporter™ Software.
• Female
• Male
• Unknown

IMPORTANT! If you are using Ion Reporter™ Software, do not leave this
blank. Select Unknown if the gender is not known. Several analysis workflows
in Ion Reporter™ Software, for example, copy number variation detection and
genetic disease research, are limited when the gender is not known. The
analysis workflows can return unexpected results when the gender is incorrectly
specified for a sample.

Type The relationship type for this sample. Type is used in conjunction with
Relationship Group, described below. For example, a relationship group can
contain two samples, one with a type Tumor and another with a type Normal.
The following sample relationships are supported by Ion Reporter™ Software:
• Control
• Father
• Mother
• Normal
• Sample
• Self—Use Self for both a single sample and for the proband sample in a trio.
A single sample is not related to other samples and is analyzed by itself.
• Tumor

Relationship Group Use Relationship Group to designate a group of multiple related samples within
the same Sample Set. For example, DNA and RNA samples from the same
sample would have the same Relationship Group number.
Use a whole number to define a sample as part of a relationship group. It is used
in conjunction with Type. For example, a Sample Set can contain 6 samples,
consisting of 3 groups of 2 related samples each (of types Tumor and Normal). In
this case, you would designate the two samples in each group as part of group
1, 2, or 3. This is identical to the Set ID in the IonReporterUploader plugin.

Extra Annotations (used for specialized applications, such as preimplantation genetic screening (PGS)
research or oncology research)

Sample Collection Date The date that the blood sample was drawn.

Torrent Suite™ Software 5.18 User Guide 27

 Chapter 3 Samples and Sample Sets
3 Sample information

(continued)

Attribute Description

Sample Receipt Date The date that the laboratory received the blood sample.

Cancer Type The type of cancer that is present in the sample.

Population The super population code assignment for a sample, as defined by the
human 1000 genomes project ( www.internationalgenome.org/faq/which-
populations-are-part-your-study/). The population is relevant to the analysis
of samples by the TCRB-LR assay workflow in Ion Reporter™ Software. The
TCRB-LR analysis workflow produces a haplotype group assignment for samples
having a population attribute of "European".

Mouse Strains The name of a mouse strain. Choose from a select number of the most common
strains. In Ion Reporter™ Software 5.12, the selected mouse strain will not affect
Ion Reporter™ Software analysis workflows.

Cellularity % The percentage of tumor cells in the sample. This is a whole number between 1
and 100.

Biopsy Days The post-fertilization time at which the biopsy was taken from an embryo. This is
a whole number.

Cell Number The cell count of the biopsied material.

Couple ID An identifier for the couple. For use with the Reproductive research application.

Embryo ID An identifier for the embryo. For use with the Reproductive research application.

User-defined Attributes

<user defined> If you create additional sample attributes, each attribute is listed here and in
the CSV file. Attributes that are marked as mandatory must be entered for each
sample. If you create an attribute of type integer, only numeric characters (whole
numbers) can be entered for that attribute.

28 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Sample information 3

Sample Set definitions

Item Description

Sample Set Name Enter a name for this Sample Set.

(Required) Use any combination of alphanumeric characters, plus spaces, periods
(.), hyphens (-), and underscores (_).

Group Type Select the Group Type that describes this Sample Set.
Valid options are:
• DNA Fusions
• Other
• Sample_Control
• Self
• Single Fusions
• Trio
• Tumor_Normal

PCR Plate Serial Number Enter the serial number for the PCR plate used for this Sample Set.

Description Provide a unique description for this Sample Set.

The description is limited to 1,024 characters. Use any combination
of alphanumeric characters, plus spaces, periods (.), hyphens (-), and
underscores (_).

Library Prep Type Specify how your library is prepared for use with this Sample Set.
Valid options are:
• Manual
• AmpliSeq on Chef

Library Prep Kit Select the library preparation kit that is used to prepare your library for
this Sample Set.
Valid options are:
• Ion AmpliSeq Kit for Chef DL8
• Precision ID Chef DL8
• Ion Ampliseq HD DL8

Library Prep Protocol Select the library preparation protocol that is used to prepare your
library for this Sample Set.
• Myeloid
• 2 Library Pools - OCA Plus

Torrent Suite™ Software 5.18 User Guide 29

 Chapter 3 Samples and Sample Sets
3 View Ion AmpliSeq™ library preparation on an Ion Chef™ System run

View Ion AmpliSeq™ library preparation on an Ion Chef™

System run
You can view a summary of details about how the libraries were prepared for a completed run on an
Ion Chef™ Instrument that used an Ion AmpliSeq™ library preparation kit. Knowing this information can
be useful for troubleshooting an Ion Chef™ Instrument run.
This information is not available if a library preparation kit is not selected when the sample is created, or
if the run did not use an Ion AmpliSeq™ library preparation kit.

1. In the Plan tab, click Samples.

2. In the row that contains the Sample Set of interest, click (Actions)4Library Prep Summary.

3. In the Library Prep Summary screen, view the information that is listed for the Sample Set. This
information is provided by the Ion Chef™ Instrument; some items may be blank.
• Library Prep Type • Reagent Lot Number
• PCR Plate Type • Reagent Part Number
• PCR Plate Serial Number • Reagent Expiration
• Combined Library Tube Label • Solution Lot Number
• Chef Last Updated • Solution Part Number
• Chef Instrument Name • Solution Expiration
• Tip Rack Barcode • Chef Script Version
• Library Kit Type • Chef Package Version
The Chef Script Version lists the version of the software script for the Ion Chef™ Instrument, and
the Chef Package Version lists the software package that is used by the Ion Torrent™ Server. The
release version for these scripts can differ if Torrent Suite™ Software was updated with an off-cycle
release.

Find a Sample Set

1. In the Plan tab, click Samples.

2. In the search box, enter a search term for the Sample Set name, or a Combined Tube Label
(Sample Tube Label).
The search term is not case sensitive. You do not need to know the exact name because a partial
name still returns results.

3. Click (Search) to filter the search, then select Sample set name or Combined library tube
label.

30 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Sort Sample Sets 3

4. Click Go.
The results of the search appear.

5. Click Clear All to return to the complete list of Sample Sets.

Sort Sample Sets

1. In the Plan tab, click Samples.

2. In the Samples Sets table, click any column header to sort the sample rows alphabetically or
numerically.

3. Click the column header again to reverse the order of the column contents.

4. Click Clear to undo the sort.

Edit a Sample Set

1. In the Plan tab, click Samples.

2. In the row of the Sample Set that you want to edit,

click (Actions)4Edit Sample Set.

3. In the Edit Sample Set dialog box, make any desired

changes, then click Done.

4. To edit an individual sample within a Sample Set:

a. Click the triangle to the left of the Sample Set
name to expand the Sample Set, then click
(Actions)4Edit Sample in Set in the row of
the sample that you want to edit.

b. Complete the Edit Sample dialog box, if needed,

then click Done.

c. To delete a sample from a set, click

(Actions)4Remove Sample from Set in the
row of the sample that you want to delete, then click Yes, Delete!.

Torrent Suite™ Software 5.18 User Guide 31

 Chapter 3 Samples and Sample Sets
3 Delete a Sample Set

Delete a Sample Set

1. In the Plan tab, click Samples.

2. Click (Actions)4Delete Set in the row of the Sample Set that you want to delete.

3. Click Yes, Delete!.

To delete a sample from a Sample Set, see “Edit a Sample Set”

Create an Ion AmpliSeq™ on Ion Chef™ Sample Set

Samples that are in the Ion AmpliSeq™ on Ion Chef™ Sample Set samples can be automatically
tracked in Torrent Suite™ Software from library preparation through sequencing and data analysis. First
create a Sample Set in the software, then use it to set up a library preparation run on the Ion Chef™
Instrument. Sample information is then automatically transferred to the Planned Run when templating
and sequencing the combined library.
To create an Ion AmpliSeq™ on Ion Chef™ Sample Set, you can either import samples from a CSV file, or
enter them manually. The following is an example of importing samples from a CSV file.

1. In the Plan tab, click Samples, then click Import Samples from File.

2. In the Import Samples screen, click Sample File Format.

A CSV template file downloads to your computer in the Downloads folder.

3. Open the CSV template file, then enter the sample names, PCR plate positions, and barcodes
used. Save the file to your computer with a new name.
You can also enter sample names in the CSV file, then supply the plate position, barcode, and
other information later by editing the Sample Set in the Sample Sets screen. For more information,
see “Edit a Sample Set” on page 31.

4. Click Select File, select your new CSV file, then click Open.

5. Click Add Sample Set.

6. Complete the Add Sample Set dialog box.

a. Enter a Sample Set name.

b. Select the appropriate Group Type.

c. Set Library Prep Type to AmpliSeq on Chef.

d. Set Library Prep Kit to Ion AmpliSeq Kit on Chef DL8.

e. Type or scan the PCR plate serial number.

32 Torrent Suite™ Software 5.18 User Guide

 Chapter 3 Samples and Sample Sets
Create an Ion AmpliSeq™ on Ion Chef™ Sample Set 3

f. In Description, enter additional information.

g. Click Save & Finish

A new Sample Set is created.

7. In the Plan tab, click Samples.

The Sample Sets table lists the Sample Set run status in the Status column, indicating whether
the Sample Set is ready for a library preparation run, a library preparation run with the Sample Set
is currently running, or the combined library is ready for a template run.

Status Indication
libPrep_pending The new Sample Set is ready for a library preparation run.
libPrep_reserved The Sample Set is currently running on an Ion Chef™
Instrument. You can monitor the run status at Monitor4Ion
Chef.
libPrep_done The Ion Chef™ Instrument has finished the library preparation
run, and the combined library is ready for a template run.

Torrent Suite™ Software 5.18 User Guide 33

 Chapter 3 Samples and Sample Sets
3 Create an Ion AmpliSeq™ on Ion Chef™ Sample Set

8. When the status of your Sample Set shows

libPrep_done, in the row of the Sample Set, click
(Actions), then select Plan Run.

9. In the next dialog box, select an existing Planned Run

template, or create a new template by selecting Add
new template.
The sample information in the Sample Set
automatically populates your new Planned Run.

For further information on how to create or edit a Planned Run template, see Chapter 4, “Plan and
execute an instrument run”.

34 Torrent Suite™ Software 5.18 User Guide

 4 Plan and execute an instrument run

■ Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
■ Planned Run templates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
■ Steps in the workflow bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
■ Review Planned Run settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
■ Import panel files and parameters from AmpliSeq.com . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
■ Create Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
■ Create multiple Planned Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
■ Planned Runs list . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78

Planned Runs
Planned Runs are the digital instructions for the sequencing instrument that contain specifications
for sample preparation, sequencing, data export, and post-sequencing data analysis. A Planned
Run contains all settings that are used in a sequencing run. A Planned Run tracks samples, chips,
and reagents throughout the sequencing workflow, from library preparation through subsequent data
analysis.
The details that you specify for items depend on the assay and the sequencing instrument that you use.
For example, the Plan Run template specifies a default chip type, but you can change the chip based
on your throughput needs. Changing the chip triggers changes in the sequencing kit and template kits.
For more information, see the user guides for the specific assays and sequencing instrument that you
plan to use.

Planned Run templates

A Planned Run template is a reusable experimental design that can be saved and used to create
many Planned Runs. Planned Run templates play an important role in enabling rapid throughput across
your sequencing instrument. Planned Run templates also help reduce the chances of errors, because
information is stored and then applied to Planned Runs, instead of entered manually for each run.
When planning a run, you can use a system Planned Run template that is preloaded in Torrent Suite™
Software and is suitable for use with specific types of research applications. If a preinstalled Planned
Run template does not meet your needs, you can create your own unique Planned Run template.

Torrent Suite™ Software 5.18 User Guide 35

 Chapter 4 Plan and execute an instrument run
4 Planned Run templates

Planned Run templates for specific research applications

Torrent Suite™ Software is preloaded with many Planned Run templates that contain predefined settings
for common sequencing applications. These system-installed Planned Run templates are categorized
into research applications that describe the sequencing techniques, or specialized products, for which
each system Planned Run template is used.
If a preinstalled Planned Run template does not meet your needs, you can download a template from
AmpliSeq.com, or you can create your own unique Planned Run template. Custom templates are for
advanced users. For assistance, contact your local Field Service Engineer.
Planned Run templates are available for use on the Plan tab under Templates. On this screen, the
following categories of research applications filter the list of Planned Run templates that are available
for use. Templates may be available in multiple research application category.

Research application Description

AmpliSeqDNA Ion AmpliSeq™ research applications (DNA and exome),

including the Ion AmpliSeq™ On‑Demand Panels, and Ion
AmpliSeq™ Made-to-Order and Community Panels.

AmpliSeqRNA Ion AmpliSeq™ research applications (RNA), including the

Oncomine™ Immune Response Research Assay.

AmpliSeq HD Ion AmpliSeq™ HD libraries (DNA and RNA).

DNA and Fusions Ion AmpliSeq™ research applications such as Oncomine® Focus
Fusions, Oncomine® Focus DNA & Fusions, Colon and Lung
Research Panel v2.

Generic Sequencing Research applications that do not fit in the other categories.
Use this research application to provide all choices for the
experiment. The choices are not restricted based on a common
application workflow.

Human Identification Applied Biosystems™ Human Identification panels.

Immune Repertoire Ion AmpliSeq™ Immune Repertoire Research Assay.

Inherited Disease Ion AmpliSeq™ Inherited Disease Panel and Oncomine™ BRCA
research panels.

Mutation Load Oncomine™ Tumor Mutation Load Assay.

Oncology – HemeOnc All blood-related oncology research applications. For example,

Oncomine™ Myeloid Research Assay.

Oncology – ImmunoOncology All ImmunoOncology research applications. For example,

Oncomine™ Immune Response Research Assay.

Oncology – Liquid Biopsy Liquid biopsy oncology research assays.

Oncology – Solid Tumor Solid tumor oncology research assays.

Pharmacogenomics Ion AmpliSeq™ Pharmacogenomics Research Panel that is

imported from AmpliSeq.com.

36 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Run templates 4

(continued)

Research application Description

Reproductive Ion ReproSeq™ PGS kits for Aneuploidy Detection.

RNA Seq RNA sequencing research assays.

TargetSeq TargetSeq™ research applications, with parameters optimized

for hybridization-based target enrichment.

Whole Genome Whole genome sequencing research applications, such as Ion

ReproSeq™ Aneuploidy, which do not assume enrichment and
do not require a target regions file.

16S rRNA Sequencing Ion 16S™ Metagenomics Kit.

16S Target Sequencing Ion 16S™ Metagenomics Kit.

Carrier Seq Expanded carrier screening (ECS) applications, including Ion

Torrent™ Ion CarrierSeq™ ECS Kits and Ion AmpliSeq™ Ion
CarrierSeq™ ECS Panel.

Create a custom Planned Run template

Create a custom Planned Run template for reuse when the same conditions can be used for multiple
runs. To create a custom Planned Run template, copy an existing preinstalled Planned Run template,
then edit the settings to meet the requirements for your Planned Run.

IMPORTANT! Before you create a custom Planned Run template, ensure that the most current
reference sequences and the target regions and hotspots BED files are on the Ion Torrent™ Server.
For more information about installing these files, see Chapter 10, “References management”. Contact
your local Field Service Engineer to obtain the most current BED files.

1. In the Plan tab, click Templates, then select the desired type of research application from the left
navigation menu.

2. In the list of templates, find the system Planned Run template from which you want to create your
custom Planned Run, then click (Actions)4Copy.
The Copy Template workflow bar opens to the Save step.

3. Enter or select the required information in the Save step.

As you make your selections, your settings are updated in the Summary pane.

Item Description
Template Name Enter a name for your custom Planned Run template.
(Required)
Set as Favorite Select the Set as Favorite checkbox to add your custom template
to the Favorites list.

Torrent Suite™ Software 5.18 User Guide 37

 Chapter 4 Plan and execute an instrument run
4 Planned Run templates

(continued)
Item Description
Analysis Parameters Select Default to accept default analysis parameter settings
(recommended). Advanced users can customize analysis
parameters by selecting Custom and editing appropriate analysis
information.
For more information, see “Copy an analysis parameter set” on
page 61.
Reference Library Select the reference library file appropriate for your sample.
Depending on your application, you might have to select separate
DNA, RNA, and fusions reference library files.
Target Regions Select the target regions BED file appropriate for your sample.
Depending on your application, you might have to select separate
DNA Target Regions and Fusions Target Regions files.
Check with your local Field Service Engineer for updates to ensure
that the most current files are being used.
For BED file installation instructions, see “Upload a target regions
file” on page 259.
Hotspots Select the hotspots (BED or VCF) file appropriate for your sample.
For BED file installation instructions, see “Upload a hotspots file” on
page 261.

4. In the Copy Template workflow bar, click the Ion Reporter step, then set up the transfer of the
completed run results to a specified Ion Reporter™ Server.

For more information, see “Ion Reporter step in the workflow bar” on page 44.

5. Click Next.

6. In the Research Application step, ensure that the correct Research Application and Target
Technique are selected, then click Next.
For more information, see “Research application step in the workflow bar” on page 47.

7. In the Kits step, enter or select the required information, then click Next.
For more information, see “Kits step in the workflow bar” on page 49.

8. In the Plugins step, select from the available plugins, then configure the selected plugins as
required, then click Next.
For more information on configuring plugins, see “Plugin configuration” on page 129.
For more information on the Plugins step, see “Plugins step in the workflow bar” on page 52.

38 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Run templates 4

9. In the Projects step, select the project or projects to receive data from the runs that use this
template, then click Next.
For more information, see “Projects step in the workflow bar” on page 53.

10. In the Save step, click Copy Template to save the new Planned Run template.

The customized template is now available in the Templates screen in the Research Application group
from which you copied the preinstalled Planned Run template. If you selected the Set as Favorite
option, the custom template also appears in the Favorites list. The Planned Run can be used in an
instrument run.

Create a Planned Run from a Planned Run template

You can create Planned Runs from a preinstalled or custom Planned Run template that contains run
settings. The preinstalled Planned Run templates are included in the software for standard research
applications and kits, such as Ion AmpliSeq™ or Oncomine™ workflows. Custom Planned Run templates
can be created as described in “Create a custom Planned Run template” on page 37
When creating a Planned Run from a preinstalled Planned Run template, some settings are predefined
by the template and some remain to be selected or completed. The predefined settings can vary
between Planned Run templates. You can change any of the settings to create your Planned Run, even
those settings that are predefined in the Planned Run template.
Most Planned Run templates have a corresponding Ion AmpliSeq™ or Oncomine™ panel. When you
create a Planned Run from a Planned Run template, the Create Plan workflow bar opens to the Plan
step, which is the final step in the Planned Run creation process. You can accept all Planned Run
template settings if you enter only a run plan name and sample names then save a Planned Run from
the template. Or, you can further customize the Planned Run if you open other steps and change
information in the Planned Run wizard.

1. In the Plan tab, click Templates, then select the desired research application from the left
navigation menu.

2. In the Template Name column of the templates table, click the template name. Alternatively, you
can click Favorites, then click the template name, if the template is in the favorites list.

The Create Plan workflow bar opens to the Plan step.

3. The Run Plan Name is prepopulated with the template name. Enter new text to create a unique
Planned Run name.

Torrent Suite™ Software 5.18 User Guide 39

 Chapter 4 Plan and execute an instrument run
4 Planned Run templates

4. Complete additional settings in the Plan step if needed. For more information about the individual
settings, see “Plan step in the workflow bar” on page 53.
As you make selections, the settings are updated in the Summary pane. You can also use the
information in this pane to review the settings that are predefined by the template.

5. Click other steps in the workflow bar to enter or change settings if needed. For more information,
see “Steps in the workflow bar” on page 44.

6. When you have completed your selections, review the settings in the Summary pane, then
click Plan Run at the bottom of the Plan step.
The Planned Run is added to the Planned Runs table and can be used in an instrument run.

Create a Planned Run without a Planned Run template

If you do not create a Planned Run from a preinstalled or custom Planned Run template, you can create
a Planned Run without a Planned Run template and predefined settings.
Best practice is to create a Planned Run from preinstalled or custom Planned Run templates. Planned
Run templates contain predefined settings for preparing multiple runs of the same type (for example, if
you are performing the same type of sequencing analysis using the same instruments and reagents on
multiple samples). For more information, see “Create a custom Planned Run template” on page 37 and
“Create a Planned Run from a Planned Run template” on page 39.

1. In the Plan tab, in the Templates screen, click Plan New Run.

The Create Plan wizard opens to the Ion Reporter step.

2. In the Ion Reporter step, set up the transfer of the completed run results to a specified Ion
Reporter™ Server. As you make your selections, your settings are updated in the Summary pane.
For more information, see “Ion Reporter step in the workflow bar” on page 44.

3. Click Next.

4. In the Research Application step, ensure that the correct Research Application and Target
Technique are selected, then click Next.
For more information, see “Research application step in the workflow bar” on page 47.

5. In the Kits step, enter or select the required information, then click Next.
For more information, see “Kits step in the workflow bar” on page 49.

6. In the Plugins step, select from the available plugins, then configure the selected plugins as
required, then click Next.
For more information on configuring plugins, see “Plugin configuration” on page 129.
For more information on the Plugins step, see “Plugins step in the workflow bar” on page 52.

40 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Run templates 4

7. In the Projects step, select the project or projects that receive data from the runs that use this
template, then click Next.
For more information, see “Projects step in the workflow bar” on page 53.

8. In the Plan step, enter a name for the plan in Run Plan Name, specify the reference and BED files,
then enter or upload your sample information.
For more information about the individual settings, see “Plan step in the workflow bar” on
page 53.

9. When you have completed your selections, review the settings in the Summary pane, then
click Plan Run at the bottom of the Plan step.
The Planned Run is added to the list on the Planned Runs screen.

Search for a Planned Run template

You can search, sort, or filter the Templates list to find a Planned Run template of interest.

1. In the Plan tab, click Templates, then complete the selections for the following options.
Option Selection
Search the list 1. Click All in the research applications menu on the left to search all templates.
Alternatively, select a research application from the menu to search for
templates within a specific research application.
2. In Search by Template Name, enter a search term, then click Go.
The templates that contain your search term in the template name are listed.

Sort the list Click any bolded column header in the list of templates to sort the order in which the
templates appear. Click the column header a second time to reverse the sort order.
Limit the list to In Date, select a preset range, or click Date Range, then select the start and end
recent runs dates.
Filter the list Select from one or more filters to limit the list of templates. Click More Filters to
see all available filters. Within a filter, enter text into Find to limit the filter choices. To
remove a filter, remove the filter choice or click Clear in the filter list.
In some cases, you can select more than one choice within a single filter category.

2. Click Clear All to remove filters and restore all results.

Torrent Suite™ Software 5.18 User Guide 41

 Chapter 4 Plan and execute an instrument run
4 Planned Run templates

Export a Planned Run template

You can export the settings from a Planned Run template to a CSV file. You can then transfer the file to
a different Ion Torrent™ Server and import the template into Torrent Suite™ Software on that server. For
more information, see “Import a Planned Run template” on page 42.
You can also open the file in a spreadsheet application such as Microsoft™ Excel™ and edit the settings
before import. You must preserve the column headings and layout to ensure that the template file is
correct.

1. On the Templates screen, on the Plan tab, locate the template that you want to export.

2. Click (Actions) in the row of the template, then select Export.

Depending on your browser settings, the CSV file may be created and downloaded automatically,
or you may be prompted to save the file.
Exported Planned Run templates have "exported" appended to the front of the original template
name, unless you edit the name in the CSV file.

Import a Planned Run template

You can import Planned Run template settings that have been exported to a CSV file. Use this
procedure for transferring settings between different Ion Torrent™ Servers. You can change the settings
in an exported CSV file and then import the Planned Run template. You must preserve the column
headings and layout to ensure that the template file is correct.
To export Planned Run template settings to a CSV file, see “Export a Planned Run template” on
page 42.

1. In the Plan tab, in the Templates screen, select the research application group that you want to
import the template into.

2. Click Upload4Upload Template.

42 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Run templates 4

3. In the Import Plan Template dialog box, click Choose File, select the CSV file to import, then
click Load.
The template is listed in the application group. Exported Planned Run templates have "exported"
appended to the front of the original template name, unless the name has been edited in the CSV
file.

4. (Optional) Edit the template name, by clicking (Actions)4Edit.

Save a Planned Run template to Favorites

You can save Planned Run templates to Favorites to make it easier to find your frequently used
templates within Torrent Suite™ Software.

1. In the Plan tab, click Templates, then search for a template that you want to add to Favorites.
For more information, see “Search for a Planned Run template” on page 41.

2. In the row of the template, click (Actions)4Set as Favorite to add your Planned Run template
to the Favorites list.

3. To see the list of saved favorites, in the Plan tab, click Templates, then click Favorites at the top
of the research applications list.

Torrent Suite™ Software 5.18 User Guide 43

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

Steps in the workflow bar

Torrent Suite™ Software guides you through steps to provide the information that is required to create
Planned Runs and Planned Run templates, and then execute a Planned Run. You can work through the
steps in workflow order, or you can use only the steps that you need.
Use the steps in the Create Plan workflow bar to:

• Create a Planned Run that is based on a predefined Planned Run template that is prepopulated
with information specific for your instrument run. For more information, see “Create a Planned Run
from a Planned Run template” on page 39.

Use the steps in the Create Template workflow bar to:

• Create custom Planned Run templates that fit your sequencing needs and save the custom
Planned Run templates to reuse for future Planned Run creation. For more information, see “Create
a custom Planned Run template” on page 37.
• Create a unique Planned Run that is not based on a Planned Run template. For more information,
see “Create a Planned Run without a Planned Run template” on page 40.

After a Planned Run is created in Torrent Suite™ Software, the Planned Run is sent to the Ion Torrent™
sequencer to be executed.
You can also download a CSV file and customize it to create multiple Planned Runs without using the
workflow bar. For more information, see “Create multiple Planned Runs” on page 74.

Ion Reporter step in the workflow bar

If you are an Ion Reporter™ Software user, when you create a Planned Run or a Planned Run template,
use this step to add settings to transfer automatically run results to Ion Reporter™ Software for further
analysis and visualization.
You can directly transfer results in one of the following ways:
• On the Ion Reporter step in the workflow bar, if you select an Ion Reporter™ Software account and
an analysis workflow, then also select the option to upload files automatically after run completion,
an Ion Reporter™ Software analysis is launched immediately after the run. Successful analyses are
then available in Ion Reporter™ Software when you sign in to the selected account.
• You can also transfer the output files (BAM files and VCF files) from the run to Ion Reporter™
Software without selecting an Ion Reporter™ Software analysis workflow. In this case, you can
launch the analysis manually in Ion Reporter™ Software. This approach is commonly used to
annotate the VCF files by using the Annotation-only analysis workflow in Ion Reporter™ Software.
For details, see Ion Reporter™ Software 5.18 User Guide (Pub. No. MAN0024776).

In the Ion Reporter step in the workflow bar, you select the Ion Reporter™ Software account to receive
data from the completed run. If you are creating a Planned Run template, select the account to receive
data from every run that is created from this Planned Run template.

44 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Steps in the workflow bar 4

Selections in the Ion Reporter step apply only to Ion Reporter™ Software users. The Ion Reporter™
Software is not included with Torrent Suite™ Software and is available under separate license. For
details, see Chapter 9, “Integration with Ion Reporter™ Software”.
Use the plan by Sample Set feature when you configure Ion Reporter™ Software in the Planned Run or
template. For details, see “Plan by Sample Set” on page 63.

1. In the Ion Reporter step in the workflow bar, select the Ion Reporter™ Software account that you
want to transfer output files to for analysis.
The selected account is the one to use to view and further analyze the files in Ion Reporter™
Software.
If the Ion Reporter™ Software account is not configured, click Configure to add another account.
For more information, see “Set up an account for IonReporterUploader plugin” on page 229.

2. Select a Sample Grouping that corresponds to the sample relationship in Ion Reporter™ Software.
When you select a Sample Grouping, the workflow bar in Ion Reporter™ Software shows only the
analysis workflows that are appropriate for the sample.

3. Select an Existing Workflow option.

Option Description
Upload Only Use this option to transfer only the output files from the sequencing run to Ion
Reporter™ Software. If you use this option, you can access the samples in Ion
Reporter™ Software. VCF files are also available if you run the variantCaller plugin.
Ion Reporter The analysis workflow is automatically launched in Ion Reporter™ Software with
workflow for your the sample data from the run. Successful analyses are available in Ion Reporter™
sample type Software with the account and organization that you selected.

4. (Optional) To create a new analysis workflow, click Create New Workflow to open Ion Reporter™
Software in a new browser window. In Ion Reporter™ Software, create a new analysis workflow,
then save it. When you return to Torrent Suite™ Software, refresh the browser. You can then select
the newly created analysis workflow in the Existing Workflow list.

Torrent Suite™ Software 5.18 User Guide 45

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

5. Under Ion Reporter Upload Options, select an option.

Option Description
Review results after run Use this option to review the completed run results and then manually
completion, then upload upload the data to Ion Reporter™ Software.
to Ion Reporter
IMPORTANT! Review the results in Completed Runs & Reports, then
click Upload to IR4Upload as Planned to upload the data to Ion
Reporter™ Software.

Automatically upload to Run results are automatically uploaded to Ion Reporter™ Software when a
Ion Reporter after run run is complete. If you select an analysis workflow, an analysis is launched
completion immediately after the run. Successful analyses are then available to you
when you sign in to Ion Reporter™ Software with the account used in the
setup.

6. Click Next in the workflow bar to continue with the Planned Run or with Planned Run template
creation.

46 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Steps in the workflow bar 4

Research application step in the workflow bar

Use the Research Application step in the workflow bar to select research applications and target
techniques that apply to your template or plan . Available options in subsequent steps are restricted to
those options that are compatible with the selected research application and target technique.

1. Select the research application used in your plan.

Research application Description
DNA Detects and annotates low frequency (to 0.5% limit of detection) somatic
variants (SNPs, INDELs, and CNVs) from targeted DNA libraries using Ion
AmpliSeq™ HD technology. This method is compatible with DNA purified
from tumor or liquid biopsy research samples.
DNA and Fusions Detects and annotates low frequency (to 0.5% limit of detection) somatic
(Separate Libraries) (SNPs, INDELs, and CNVs) variants from targeted DNA libraries, and
gene fusions from matching targeted RNA libraries using Ion AmpliSeq™
HD technology. This method is compatible with DNA and RNA purified
separately from tumor or liquid biopsy research samples.
DNA and Fusions (Single Detects and annotates low frequency (to 0.5% limit of detection) somatic
Library) variants (SNPs, INDELs, CNVs, and fusions) from targeted nucleic acid
libraries using Ion AmpliSeq™ HD technology. This method is compatible
with DNA and RNA purified together from tumor or liquid biopsy research
samples.
Fusions Detects and annotates gene fusions from targeted RNA libraries using
Ion AmpliSeq™ HD technology. This method is compatible with RNA
purified from tumor or liquid biopsy research samples
Human Identification For templates to run Applied Biosystems™ Precision ID set of panels.
Immune Repertoire For use with the Ion AmpliSeq™ Immune Repertoire panel.
Metagenomics Reserved for future use with Ion Reporter™ Software.
Mutation Load For use with the Oncomine™ Tumor Mutation Load Assay panel.
Oncology - Liquid Biology For use with liquid biopsy oncology research panels.
Pharmacogenomics For use with Ion AmpliSeq™ Pharmacogenomics Research Panel that is
imported from AmpliSeq.com .
RNA For use with RNA (fusions) libraries.
Typing For use when performing molecular fingerprinting to detect viral or
bacterial strains for research purposes.

Torrent Suite™ Software 5.18 User Guide 47

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

2. Select the Target Technique that pertains to the selected research application.
Research Application selected Available Target Technique
DNA AmpliSeq DNA
AmpliSeq Exome
AmpliSeq HD - DNA
Other
TargetSeq
Whole Genome
DNA and Fusions (Separate Libraries) AmpliSeq DNA and Fusions
AmpliSeq HD - DNA and Fusions (Separate Libraries)
AmpliSeq RNA
DNA and Fusions (Single Library) AmpliSeq HD - DNA and Fusions (Single Library)
Fusions AmpliSeq HD - Fusions
Human Identification AmpliSeq DNA
Immune Repertoire AmpliSeq RNA
Mixed Samples (DNA/RNA)
Metagenomics 16S Targeted Sequencing
Other
Mutation Load AmpliSeq DNA
Oncology - Liquid Biology Tag Sequencing
Pharmacogenomics AmpliSeq DNA
RNA AmpliSeq RNA
RNA Sequencing
Typing Other
Whole Genome

3. Click Next in the workflow bar to continue with the Planned Run or with Planned Run template
creation.

48 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Steps in the workflow bar 4

Kits step in the workflow bar

Use the Kits step in the workflow bar to set up information that is needed for sample preparation and
sequencing, including the chip and kits used. Options that are available in the Kits step depend on the
instrument used. Selections in this step influence how the data are analyzed after sequencing.

Note: Some Planned Run templates have parameter settings in the Kits step that cannot be changed.
To change locked parameter settings, create a new template. For more information, see “Create a
Planned Run without a Planned Run template” on page 40.

1. In the Kits step in the workflow bar, enter or select the following information.

Item Selection
Instrument Select the sequencing instrument system being used, for example,
Ion S5™.
Sample Preparation Kit (Optional) Select the sample preparation kit used.
Library Kit Type Select the kit used to prepare the library (for example, Ion
AmpliSeq™ Library Kit Plus).
Template Kit 1. Select the instrument system used: OneTouch, IonChef, or IA.
2. Select the templating kit used.

Sequencing Kit Select the sequencing kit used (for example, Ion S5™ Sequencing
Kit).
Chip Type Select the sequencing chip type to be used (for example, Ion 540™
Chip).
Control Sequence (Optional) Select the control sequence added to the library
preparation. Leave blank if not used.
Barcode Set Select the barcode set used (for example, IonXpress).
Flows Enter the number of nucleotide reagent flows required to complete
the sequencing run (for example, 400).
Mark as Duplicate Reads Select this option to mark duplicate reads in the BAM file after a run
is completed. Do not use with Ion AmpliSeq™ data.
For more information, see “About the Mark as Duplicates Reads
option” on page 51.
To remove marked duplicates from the BAM file, select the
FilterDuplicates plugin in the Plugins step in the workflow bar.
For more information, see “Plugins step in the workflow bar” on
page 52.
Enable Realignment Select this option to perform realignment, an optional step that is
executed immediately after TMAP. This step adjusts the alignment,
primarily in the CIGAR string.
For more information, see “TMAP modules” on page 307.

Torrent Suite™ Software 5.18 User Guide 49

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

2. (Optional) In Advanced Settings, click Customize to customize the Advanced Settings

parameters.
For more information, see “Advanced Settings—Kits step in workflow bar” on page 51.
IMPORTANT! We recommend using the default settings. Consult your local Field Service
Engineer before modifying advanced settings.

Item Selection
Templating Protocol Script that the Ion Chef™ Instrument follows to perform the templating
reaction. We recommend that you do NOT change this setting.
Forward Library Key Select your forward library key, if you have one.
Test Fragment Key Enter your test fragment key.
Base Calibration Mode Select one of the following base calibration options:
• Default Calibration—allows a random subset of wells to be used for
base calibration. This option uses TMAP to align the training subset
of wells and is recommended if a good reference for the template is
available.
• Enable Calibration Standard—allows wells belonging to the Calibration
Standard to be selected as the training subset.
• Blind Calibration—uses the same random subset of wells as Default
Calibration but does not require an alignment step to generate the
calibration model. This option is recommended if the template does not
align well to a reference genome or if no reference is specified.
• No Calibration

See your template kit user guide for more details.

Forward 3' Adapter Select your forward 3' adapter.
Flow Order Select the flow order. For more information, see “flow order” on page 395.

3. Click Next in the workflow bar to continue with the Planned Run or with Planned Run template
creation.

50 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Steps in the workflow bar 4

Advanced Settings—Kits step in workflow bar

You can customize the kit advanced settings in the Kits step in the workflow bar.

IMPORTANT! We recommend using the default settings. Consult your local Field Service Engineer
before modifying advanced settings.

1. In the Kits step in the workflow bar, expand the Advanced Settings box, then select Customize.

2. Edit one of the following settings.

Item Selection
Templating Protocol Script that the Ion Chef™ Instrument follows to perform the templating
reaction. We recommend that you do NOT change this setting.
Forward Library Key Select your forward library key, if you have one.
Test Fragment Key Enter your test fragment key.
Base Calibration Mode Select one of the following base calibration options:
• Default Calibration—allows a random subset of wells to be used for
base calibration. This option uses TMAP to align the training subset
of wells and is recommended if a good reference for the template is
available.
• Enable Calibration Standard—allows wells belonging to the Calibration
Standard to be selected as the training subset.
• Blind Calibration—uses the same random subset of wells as Default
Calibration but does not require an alignment step to generate the
calibration model. This option is recommended if the template does not
align well to a reference genome or if no reference is specified.
• No Calibration

See your template kit user guide for more details.

Forward 3' Adapter Select your forward 3' adapter.
Flow Order Select the flow order. For more information, see “flow order” on page 395.

About the Mark as Duplicates Reads option

For some applications, duplicate reads coming from PCR cause problems in downstream analysis. The
presence of duplicate reads can create the appearance of multiple independent reads supporting a
specific interpretation, when some of the reads are in fact duplicates of each other with no additional
evidence for the interpretation.
Torrent Suite™ Software uses an Ion-optimized approach, which considers the read start and end
positions by using both the 5′ alignment start site and the flow in which the 3′ adapter is detected.
Duplicate reads are flagged in the BAM file in a dedicated field. Use of this method is recommended
over other approaches, which consider only the 5′ alignment start site.

Torrent Suite™ Software 5.18 User Guide 51

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

Marking duplicate reads is not appropriate for Ion AmpliSeq™ data, because many independent
reads are expected to share the same 5′ alignment position and 3′ adapter flow as each other.
Marking duplicates on an Ion AmpliSeq™ run risks inappropriately flagging many reads that are in fact
independent of one another.

Plugins step in the workflow bar

Use the Plugins step in the workflow bar to select plugins to include in a Planned Run or a Planned
Run template. Plugins expand the analysis capabilities of Torrent Suite™ Software. Plugins added in this
step run automatically during the sequencing run, and plugin results appear in the run report. The plugin
results are added to the run report and can be used for various purposes. You can set a plugin to run
automatically after every run if you add the plugin to the Planned Run or Planned Run template. You can
also configure the plugin, if necessary.
• The list of available plugins depends on which plugins are active on the Ion Torrent™ Server that is
connected to the instrument you use. Plugins that are installed, configured, and enabled on your
Ion Torrent™ Server are active, and are available in this list.
• The IonReporterUploader plugin does not appear in this list because it is configured in the
IonReporterUploader step.
• When you enable some plugins, such as the variantCaller and coverageAnalysis plugins, a
Configure link appears for that plugin. For information on configuring each plugin, see “Preinstalled
plugins” on page 135.
• If you select the variantCaller plugin and the Planned Run does not use a predefined configuration,
you must click the Configure link to configure the plugin before you can proceed to the next
step or save the Planned Run or Planned Run template. For details about how to configure the
variantCaller plugin, see Chapter 8, “Variant calls in Torrent Suite™ Software”.

1. In the Plugins step in the workflow bar, select the plugins to execute in the Planned Run.

2. Click Next in the workflow bar to continue with the Planned Run or with Planned Run template
creation.

52 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Steps in the workflow bar 4

Projects step in the workflow bar

Use the Projects step in the workflow bar to select one or more projects to receive data from the
completed run. When you create a Planned Run template, select the projects to receive data from every
run that is created from this template.
For more information about projects, see “View result sets in a project” on page 117.

1. In the Projects step in the workflow bar, in the scrolling list, select the checkbox next to each
project name that is to receive data from the completed run.
The list includes all projects that are created and available on the Ion Torrent™ Server.

2. You can also search for or add projects.

Item Selection
Search for (Optional) To search for projects, enter a case-sensitive search term or partial
projects search term in the search box below the list, then click Search.
Add projects (Optional) To create a new project or projects, click Add Project, then enter a
name, or enter multiple names that are separated by commas.
Remove added (Optional) To remove an added project or projects, click Remove New Projects.
projects

3. Click Next in the workflow bar to continue with the Planned Run or with Planned Run template
creation.

Plan step in the workflow bar

Use the Plan step in the workflow bar to review the plan and enter or select additional information to
complete the Planned Run.

1. In the Plan step in the workflow bar, enter or select the required information. The available options
are different depending on your sequencing application.

Item Selection
Run Plan Name Enter a name for the Planned Run.
(Required)
Analysis Parameters Select Default to accept default analysis parameter settings (recommended).
Advanced users can customize analysis parameters by selecting Custom
and editing appropriate analysis parameters. For more information, see
“Copy an analysis parameter set” on page 61.
Default Reference & Bed Files
Reference Library Select the reference library file appropriate for your sample. Depending on
your application, you may have to select separate DNA, RNA, and Fusions
reference library files.

Torrent Suite™ Software 5.18 User Guide 53

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

(continued)
Item Selection
Target Regions Select the target regions BED file appropriate for your sample. Depending on
your application, you may have to select separate DNA and fusions target
regions files.
Check with your local Field Service Engineer for updates to ensure that the
most current files are being used. For BED file installation instructions, see
“Upload a target regions file” on page 259.
Hotspot Regions Select the hotspots (BED or VCF) file that is appropriate for your sample.
For BED file installation instructions, see “Upload a hotspots file” on
page 261.

2. Depending on your application, select the Use same reference & BED files for all
chips/barcodes checkbox if you are using the same reference sequences and target regions
and hotspots BED files across all chips/barcoded samples that are included in the Planned Run. If
you are using different reference sequences or BED files for one or more of your chips/barcoded
samples, clear the Use same reference & BED files for all chips/barcodes checkbox.

3. (Optional) For DNA and Fusions application, select the Same sample for DNA and Fusions
checkbox when using the same sample for both DNA and Fusions libraries.

4. Depending on your application, complete the following:

Item Selection
Number of For barcoded samples, enter the number of barcodes to be used in this run, then
barcodes click to the right of this option.
Alternatively, click the first barcode, then click , and all subsequent barcodes
are numbered from the first barcode value.
Number of chips For non-barcoded samples, enter the number of chips to be used in this run, then
click .

The Samples Table is populated with barcode information or chip number for each sample.

5. (Optional) Select an option next to the sequencing application (such as Oncology or Pre-
implantation Genetic Screening) to populate required sample information into the Samples
Table.

54 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Steps in the workflow bar 4

6. Complete the Samples Table.

• Save the samples table to a CSV file, fill out required sample information, then upload the
samples table to populate the Samples Table automatically.
a. Click Save Samples Table to save the CSV file to your computer.
b. Edit the CSV file by entering required sample information into the appropriate sample
information columns, then save the CSV file to your computer.
c. Click Load Samples Table, then select an appropriate CSV file containing sample
information specific for this Planned Run.
d. Click Load to populate the Samples Table in Torrent Suite™ Software with sample
information that is supplied by the CSV file.
• Alternatively, manually enter sample information into the Samples Table using the software.
The available options are different depending on your sequencing application.

Item Selection
Barcode For barcoded samples, select a barcode.
Control Type (Optional) Click the Control Type column heading
to expand the column, then select the control
type.
Sample ID (Optional) Enter a sample ID for each sample.
Sample Description (Optional) Enter a sample description for each
sample.
DNA/Fusions For DNA and Fusions application, select DNA or
Fusions for each sample.
Reference If using different reference and BED files for one
or more samples, click the Reference heading to
expand the sections. Then select the reference,
target regions, and hotspots files for each sample.
Annotations Click the Annotations column heading to expand
the annotation information that is specific for your
application (for example, cancer type or Embryo
ID), then complete the required information.
Sample Tube Label Scan or enter the barcode of the Ion Chef™
sample tubes to be used in the run.
Chip Barcode Scan or enter the barcode of the Ion Chef™
sample tubes to be used in the run.
Sample Collection Date Enter the date that the blood sample was drawn.
Sample Receipt Date Enter the date that the laboratory received blood
sample.

Torrent Suite™ Software 5.18 User Guide 55

 Chapter 4 Plan and execute an instrument run
4 Steps in the workflow bar

(continued)
Item Selection
Ion Reporter workflow Select the Ion Reporter™ Software analysis
workflow specific for your run. If you do not
see your analysis workflow, select the Show All
Worklows checkbox in the column heading.
This option is available if Ion Reporter™ Software
is connected.
Relation Select sample relationship group.
This option is available if Ion Reporter™ Software
is connected.
Gender Select Male, Female, or Unknown.
This option is available if Ion Reporter™ Software
is connected.
IR Set ID Set this option to the same value for related
samples. After file transfer, in Ion Reporter™
Software, samples with the same IR Set ID are
considered related samples and are launched in
the same analysis (for example, normal sample
and its corresponding tumor sample).
Do not give unrelated samples the same IR Set ID
value even if the value is zero or blank.
This option is available if Ion Reporter™ Software
is connected.

7. (Optional) In Add a note, add a note about your Planned Run.

8. (Optional) If using LIMS metadata, in Add LIMS Meta Data, enter the text that is associated with
the Planned Run.

9. (Optional) In the Monitoring Thresholds pane, adjust Bead Loading (%), Key Signal (1-100), and
Usable Sequence (%) minimum thresholds for your Planned Run.
If monitoring thresholds are not met, the run is still processed and an alert message is shown on
the run report after analysis is complete.

10. When you are finished with your selections, scroll to the bottom of the screen, then click Plan Run.
The Planned Run is added to the Planned Runs list on the Planned Runs screen.

56 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Review Planned Run settings 4

Review Planned Run settings

You can review the Planned Run settings of a completed run.

1. In the Data tab, click Completed Runs & Reports, then select a run of interest.
The report for that run opens.

2. Click Report Actions4Review Plan.

A Review Plan summary lists the details of the Planned Run. The subcategory details are different
based on different runs.

Category Subcategory
Review Plan The name of the completed run.

Report The name of the report that was generated for the
completed run.
Application Research Application
Research Category
Sample Grouping
Target Technique
Sample Set
Kits Sample Preparation Kit
Library Kit
Library Key
3' Adaptor
Flow Order
Template Kit
Templating Protocol
Sequencing Kit
Control Sequence
Library Read Length
Flows
Chip Type
Barcode Set
Mark as Duplicates Reads
Base Calibration Mode
Enable Realignment

Torrent Suite™ Software 5.18 User Guide 57

 Chapter 4 Plan and execute an instrument run
4 Review Planned Run settings

(continued)
Category Subcategory
Kits Manifold Heater
Note: A value of Default means that this setting
is not used. Otherwise the value for this setting is
Dynamic.

Monitoring Bead Loading (%)

Key Signal (1-100)
Usable Sequence (%)
Reference Reference Library
Target Regions
Hotspot Regions
Fusions Reference Library
Fusions Target Regions
Plugins & Output Plugins
Projects
Uploaders
Notes
LIMS Meta Data
Plan Meta Data TS version when created
Plan created via
Barcodes & Samples Sample Tube Label
Chip Barcode
A table of information about the barcode used in
the run. Table columns include:
Barcode
Sample Name
Sample ID
DNA/RNA
Reference
Target Regions
Hotspot Regions
Analysis Parameters Used (Default) BeadFind Args
Analysis Args
Pre-BaseCaller Args for calibration
Calibration Args
BaseCaller Args

58 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Import panel files and parameters from AmpliSeq.com 4

(continued)
Category Subcategory
Analysis Parameters Used (Default) Alignment Args
IonStats Args
History A log of system actions taken during the run.
Table columns include:
Date
User
Log

3. After reviewing the information, click Close.

Import panel files and parameters from AmpliSeq.com

You can import panel files and parameters from AmpliSeq.com for an Ion AmpliSeq™ On‑Demand
Panel, an Ion AmpliSeq™ Made-to-Order Panel, or an Ion AmpliSeq™ Community Panel design. Each
package includes a primer pool results panel file, hotspot BED files, target region files, and JSON
parameters files that are required to produce your sequencing results. You can import the file package
directly to the Ion Torrent™ Server, in which the files are available immediately for use in Torrent
Suite™ Software. Before you can import, you must link your Ion Torrent™ Server account with your
AmpliSeq.com account. Alternatively, you can manually upload panel files that you have saved to a
storage location.
For an Ion AmpliSeq™ Ready-to-Use Panel and an Ion AmpliSeq™ Community Panel, parameter settings
that are optimized for the variantCaller plugin are included in your new template. You can configure the
variantCaller plugin with these settings when you create the Planned Run, if desired. For details, see
“variantCaller plugin configuration” on page 193.
Human, animal, and plant reference sequence BED files are also available for import from
AmpliSeq.com.
For more information about Ion AmpliSeq™ Designer, see the Ion AmpliSeq™ Designer: Getting Started
User Guide (Pub. No. MAN0010907).

Link your Ion Torrent™ Server account to AmpliSeq.com

To import a Planned Run template from AmpliSeq.com into Torrent Suite™ Software, you must first
link your Ion Torrent™ Server account to AmpliSeq.com. Linking your Ion Torrent™ Server account is a
one-time requirement.
Before you can link your account, you must generate an access code on AmpliSeq.com.

1. To generate an access code for AmpliSeq.com:

a. Go to AmpliSeq.com, and sign into your account.

b. Click My Account4Manage Access Code

Torrent Suite™ Software 5.18 User Guide 59

 Chapter 4 Plan and execute an instrument run
4 Import panel files and parameters from AmpliSeq.com

c. In the Manage Access Code dialog box, click Generate to receive an access code. If you
already have an access code, enter it into the Access Code field. Select an Access Code
Expiration in the dropdown menu.

2. In Torrent Suite™ Software, click (Settings)4Accounts.

3. Click Link to AmpliSeq.

Scroll down to view the link button if needed.

4. Enter your AmpliSeq.com username and access code,

then click Save.

Note: Enter the access code that you generated on AmpliSeq.com into the Access Code field.

Your Ion Torrent™ Server account is now linked, and import of panel information from AmpliSeq.com is
enabled.
To unlink your Ion Torrent™ Server account, click Unlink [email protected].

Import Planned Run template parameters

You can import Planned Run template parameters directly from AmpliSeq.com.
Before you can import files directly from AmpliSeq.com, you must link your Ion Torrent™ Server
account to your AmpliSeq.com account. For more information, see “Link your Ion Torrent™ Server
account to AmpliSeq.com” on page 59. If you want to import files that are saved to a hard drive or other
storage location, see instead “Manually upload panel files” on page 61.

1. In the Plan tab, in the Templates screen, click AmpliSeq.com .

2. In the next screen, select the panel type that you need, then find a panel or panels from the list of
available panels.
• The DNA tab includes exome panels and the RNA tab includes fusion panels.
• Some panels do not have optimized variantCaller plugin parameters available for all chips
and sequencers. A warning identifies the panels for which optimized variantCaller plugin
parameters have not been developed for the selected chip type.
• If you have ordered Ion AmpliSeq™ Made-to-Order Panel designs, a list of the panel files for
import appears on this screen.
• If you have downloaded a ZIP archive for a panel from AmpliSeq.com to your computer, you
can also create a Planned Run template by manually uploading the archive on the right pane
of this screen.

3. (Optional) Click the columns to sort the rows alphabetically.

4. Click Import.

5. In the Ampliseq Panel Import dialog box, click Import Selected.

6. Refresh your browser to track the progress of the import. When the Status column shows
Complete, return to the Templates screen.

60 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Import panel files and parameters from AmpliSeq.com 4

The new template is listed on the Templates screen.

Manually upload panel files

If you import individual panel files from AmpliSeq.com and save the files to a storage location, you
must manually upload them before you can access them in Torrent Suite™ Software.
Use this procedure only to import files from AmpliSeq.com that were previously saved to a hard
drive or other storage location. This procedure is not necessary if you import panel files directly from
AmpliSeq.com as described in “Import Planned Run template parameters” on page 60.

1. In the Plan tab, click Templates.

2. Click Upload4Upload Design/Panel Zip Archive.

3. In the Import Panel from Zip Archive dialog box:

a. Click Select File, then browse to your compressed panel file.

Note: The instrument type and chip type are automatically selected, based on the configuration
file that is included in the panel file.

a. Click Upload Panel from Zip Archive.

b. Close the upload dialog box.

4. To check the status of the upload, click (Settings)4Reference Sequences, then click Upload
History.

Copy an analysis parameter set

You can copy an existing analysis parameter set, and then customize the settings and save it as a new
parameter set. We recommend this procedure if you need a unique analysis parameter set for a custom
analysis that other users do not need to use in their runs. Copying an analysis parameter set ensures
that the uploaded parameter set remains intact for other users.

1. Click (Settings)4Analysis Parameters.

In the Analysis Parameters screen, factory parameters are denoted by "Ion Torrent" in the Source
column.

2. To filter the parameter sets by chip type, select your chip type from All Chips.

3. Identify the parameter set that you want to copy, then click (Actions)4Copy in the row for that
set.

Torrent Suite™ Software 5.18 User Guide 61

 Chapter 4 Plan and execute an instrument run
4 Create Planned Runs

4. In the Copy Analysis Parameters dialog box, enter a parameter name and description, make any
changes, then click Save.

Your new analysis parameter set is available in the Analysis Parameters table. The Source
column lists the name of the user who created it.

5. Click (Actions)4View in the row of the analysis parameter set to view the details for that
parameter set in the list.

6. You can select the custom analysis parameter set for use in a Planned Run or reanalysis of a
completed run.
Option Description
Create a Planned Run or In the Plan tab of the workflow bar, under the Analysis Parameters
a custom Planned Run section, click Details+4Custom, then select the parameter from the list.
template You must first specify a chip type for the Planned Run (under Kits in the
workflow bar) before you can select the custom parameter set.
Reanalyze a completed For details, see “Reanalyze a run” on page 124.
run

Create Planned Runs

You can create a Planned Run in two different ways:
• Create a Planned Run with Sample Sets.
• Create a Planned Run with a template.

62 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create Planned Runs 4

Plan by Sample Set

You can define samples and preselect the attributes that you want to associate with each sample
before you start to plan templating and sequencing runs. You can then organize samples into Sample
Sets that are available to select and reuse when you create a Planned Run. This approach, which is
known as plan by Sample Set, can save time when you plan your instrument runs if:
• Your samples include many attributes.
• You want to use the same Sample Sets for many instrument runs.
• Your laboratory assigns tasks such as planning and defining sample attributes to individuals who
have specific areas of expertise.
• Your samples include attributes for use with Ion Reporter™ Software.
For example, if you select the Sample Set group type Trio, only Trio analysis workflows are
available to choose when you configure a Planned Run for use with Ion Reporter™ Software.
• You want to set up multisample analyses in Ion Reporter™ Software.
• Your Ion Torrent™ Server is connected to a LIMS.

Create a Planned Run for a 2-pool Sample Set

When you use the Oncomine™ Comprehensive Assay Plus panel, you can combine multiple Sample
Sets for use in a single Planned Run. When you combine multiple Sample Sets, you can extend the
number of samples that you use in a sequencing run. Each Sample Set can contain up to 8 samples.
You have the option to use all samples that are included in the Sample Sets to be combined or divide
the samples into one or two pools for the sequencing run.
All Sample Sets that are combined in a Planned Run must use the same library prepration protocol. For
example, a planned run that uses 2 pools must use Sample Sets that are configured to use a multiple
pool library preparation protocol.
For more information, see Oncomine™ Comprehensive Assay Plus User Guide (Pub. No. MAN0018490).

Create a Planned Run with Sample Sets

If you set up your samples in Sample Sets before you plan an instrument run, you can add one or more
Sample Sets to your Planned Run.
Note that a Sample Set that uses an Ion AmpliSeq™ library preparation kit must also use the
corresponding barcode kit that comes with the library preparation kit.

1. In the Plan tab, click Samples.

2. In the Sample Sets screen, select one or more Sample Sets to add to the Planned Run.
• To plan a run using a single Sample Set, click (Actions) 4Plan Run in the row of the
Sample Set.

Torrent Suite™ Software 5.18 User Guide 63

 Chapter 4 Plan and execute an instrument run
4 Create Planned Runs

• To plan a run using multiple Sample Sets, select the checkboxes next to the Sample Sets that
you want to add to the Planned Run, then click Plan Run.

IMPORTANT! Ensure that all selected Sample Sets use the same barcode kit. To verify the
barcode kit that is used, expand the Sample Set entry to view its details.

The Select a Run Template to apply to this experiment dialog box lists Planned Run templates
that support your Sample Set.

3. In the Plan Run from Sample Set dialog box, select a run template to use for the experiment, then
click Plan Run.
If you do not see the template that you are looking for, select Show All Templates, then look again
for the template.
The Create Plan workflow opens to the Kits step with the Sample Sets that you selected:

4. In the Kits step, enter or select the required information. For more information, see “Kits step in the
workflow bar” on page 49.

64 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create Planned Runs 4

5. In the Barcoding step in the workflow bar, enter or select the required information. Depending on
your sequencing application, options can vary.

Item Selection
Analysis Parameters Select Default to accept default analysis parameter settings
(recommended).
Advanced users can customize analysis parameters by selecting Custom,
then editing appropriate analysis options. For more information, see
“Command Line Args (Advanced) screen” on page 67.
Reference Library Select the reference library file that is appropriate for your sample.
Depending on your application, you may have to select separate DNA,
RNA, and fusions reference library files.
Target Regions Select the target regions BED file appropriate for your sample. Depending
on your application, you may have to select separate DNA and fusions
target regions files.
Ensure that you are using the current BED or VCF files.
Hotspots Select the hotspots (BED or VCF) file appropriate for your sample.
Ensure that you are using the current BED or VCF files.

6. Select the Use same reference & BED files for all barcodes checkbox if you are using the same
reference, target regions, and hotspots files across all barcoded samples in the Planned Run.
If you are using different reference and/or BED files for one or more of your barcoded samples,
deselect the Use same reference & BED files for all barcodes checkbox.

7. In Sample Tube Label, scan or enter the barcode of the Ion Chef™ sample tubes to be used in the
run.

8. In Chip Barcode, scan or enter the barcode that is printed on the chip that is used for this run.

Torrent Suite™ Software 5.18 User Guide 65

 Chapter 4 Plan and execute an instrument run
4 Create Planned Runs

9. Complete the samples table.

• You can save the samples table to a CSV file, fill out all required sample information, and then
upload the samples table to populate the Samples Table automatically.
a. Click Save Samples Table to save the CSV file to your computer.
b. Edit the CSV file by entering all required sample information into the appropriate sample
information columns, then save the CSV file to your computer.
c. Click Load Samples Table, then select an appropriate CSV file containing sample
information specific for this Planned Run.
d. Click Load to populate the samples table with sample information supplied by the CSV
file.
• Alternatively, you can manually enter sample information into the samples table. Depending on
your sequencing application, options can vary.

Item Selection
Barcode For barcoded samples, select a barcode.
Sample Name Select a sample that is a part of the selected sample set or sets.
(Required)
Control Type Click the Control Type column heading to expand the column, then select
the control type from the dropdown list.
Sample ID (Optional) Review sample ID information for each sample. To edit Sample
ID, you must edit the Sample Set as described in “Edit a Sample Set” on
page 31.
Sample Description (Optional) Review sample description for each sample. To modify Sample
Description, you must edit the Sample Set as described in “Edit a Sample
Set” on page 31.
DNA/Fusions For DNA and fusions application, select DNA or Fusions for each sample.
Reference If using different reference and BED files for one or more samples, click the
Reference column heading to expand the sections, then select reference,
target regions, and hotspots files for each sample.
Annotations Click the Annotations column heading to expand the annotations specific
for your application (for example, cancer type or embryo ID), then complete
the required information.
Ion Reporter workflow Select the Ion Reporter™ Software analysis workflow specific for your run.
If you do not see your analysis workflow, select the Show All Workflows
checkbox in the column heading.
Relation Select sample relationship group.
Gender Select Male, Female, or Unknown.
IR Set ID Set the IR Set ID to the same value for related samples. After file transfer,
in Ion Reporter™ Software, samples with the same IR Set ID are considered
related samples and are launched in the same analysis (for example,
normal sample and its corresponding tumor sample). Do not give unrelated
samples the same IR Set ID value even if the value is zero or blank.

66 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create Planned Runs 4

10. Click Next to continue the steps to create the Planned Run.
The software takes you to the next step in the workflow bar. For more information, see “Steps in
the workflow bar” on page 44.

11. Click Save & Finish.

The Planned Run is added to the Planned Runs table and can be used in an instrument run.

Command Line Args (Advanced) screen

When planning a Sample Set in the Barcoding step in the workflow bar, you can click Custom, then
use the Advanced Options screen to customize advanced arguments for analysis parameters.

Argument Description

Beadfind args Beadfind module command line arguments.

These arguments should not be modified unless instructed by Ion
Torrent™ Technical Support.

Analysis args Analysis command line arguments.

These arguments should not be modified unless instructed by Ion
Torrent™ Technical Support.

Torrent Suite™ Software 5.18 User Guide 67

 Chapter 4 Plan and execute an instrument run
4 Create Planned Runs

(continued)

Argument Description

Pre Basecaller args for calibration BaseCaller command line arguments. For information on --barcode-
mode, --barcode-cutoff, and --barcode-filter parameters,
see “BaseCaller module arguments” on page 297.
This field is used only if a Base Calibration Mode other than 'No
Calibration' is used.
Other BaseCaller arguments should not be modified unless instructed
by Ion Torrent™ Technical Support.

Recalibration Args Recalibration command line arguments.

Basecaller Args BaseCaller command line arguments. For information on --

barcode-mode, --barcode-cutoff, and --barcode-filter,
see “BaseCaller module arguments” on page 297.
Other BaseCaller arguments should not be modified unless instructed
by Ion Torrent™ Technical Support.

Alignment Args Arguments for the TMAP aligner.

This replaces the TMAP Args setting that appears in previous software
releases.

Create a Planned Run for mixed samples with a Planned Run template
To plan a run for DNA and Fusion sample pairs and several individual Fusion or DNA samples, start with
a DNA and Fusions Planned Run template. Then alter the template to accommodate single samples on
the same chip. The following example is the procedure for creating a mixed Sample Set consisting of
two sample pairs, one DNA-only sample, and two Fusion-only samples.

1. In the Plan tab, click Templates, then click the DNA and Fusions research application.

2. Identify a DNA and Fusions template for the instrument system that you use, then in that row click
(Actions) 4Copy.

3. Enter a Template Name and select a DNA Target Regions file, then click Copy Template.

4. Return to the Templates screen, click the DNA and Fusions research application, then select the
copied template.

5. In the Ion Reporter step of the workflow bar, select an Ion Reporter™ Software account and
analysis workflow, ensure that the DNA and Fusions Sample Grouping is selected, then click
Next.

6. Ensure that the DNA and Fusions (Single Library) research application and the AmpliSeq HD
DNA and Fusions (Single Library) target technique is selected, then click Next.

7. Click Plan in the workflow bar.

68 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create Planned Runs 4

8. (Optional) The optimal number of barcodes to use with the selected panel/template is set as the
default, but you can change it. If necessary, enter the number of barcodes, then click .

9. (Optional) Clear the Same sample for DNA and Fusions option. This option is available for DNA
and fusion applications.

10. Rename the samples if desired. To rename the samples, in the Samples table, in the Sample
Name column, click the sample name, then enter a new name.

11. (Optional) Change the DNA/Fusions selections to match samples. To change the DNA/Fusions
selection for a sample, navigate to the DNA/Fusions column in the Samples Table, then select
DNA or Fusions in the row of the sample.

12. (Optional) Select a Cancer Type for each sample.

13. Select the appropriate Ion Reporter™ Software analysis workflows. To select an analysis workflow,
click the existing selection in the Samples Table, then select an analysis workflow from the list.

14. In the Samples Table, select a Relation and Gender , then click Plan Run at the bottom of the
screen.
For more information, see “Create a Planned Run with Sample Sets” on page 63.

Torrent Suite™ Software 5.18 User Guide 69

 Chapter 4 Plan and execute an instrument run
4 Create Planned Runs

Create a Planned Run with multiple Ion Reporter™ Software analysis

workflows
You can automatically launch multiple workflows for use with a single sample when you use preinstalled
Planned Run templates for use with the Immune Repertoire research application.

1. In the Plan tab, click Templates, then select Immune Repertoire from the left navigation menu.

2. In the Template Name column of the templates table, click the template name. For example, Ion
AmpliSeq™ Immune Repertoire Assay Plus - TCRB for S5.
Alternatively, you can click Favorites, then click the template name, if the template is in the
favorites list.
The Create Plan workflow bar opens to the Plan step. The Run Plan Name is prepopulated with
the template name.

3. In the Planned Run Name field, enter a unique name for the Planned Run. Enter other information
in the Plan step as required. For more information, see “Plan step in the workflow bar” on page 53.

4. Click the Ion Reporter step in the workflow bar, then select the Ion Reporter Account to which
output files will be transferred to in Ion Reporter™ Software.
The Ion Reporter™ Software account that is added to the Planned Run is used to view and further
analyze the sequencing run results in Ion Reporter™ Software.
If the Ion Reporter™ Software account is not configured, click Configure to add another account.
For more information, see “Set up an account for IonReporterUploader plugin” on page 229.

5. Select a Sample Grouping that corresponds to the sample relationship in Ion Reporter™ Software.
The Existing Workflow dropdown menu updates to show only Ion Reporter™ Software analysis
workflows that are appropriate for the sample.

6. Under Ion Reporter Upload Options, select Automatically upload to Ion Reporter after run
completion.
Run results are automatically uploaded to Ion Reporter™ Software when a run is complete. When
you select multiple analysis workflows, you have the option to use multiple analysis workflows with
a single immune repertoire sample.

Note: An analysis that use the selected analysis workflows is launched immediately after the run.
Successful analyses are then available to you when you sign in to Ion Reporter™ Software with the
account used in the setup.

7. In the Existing Workflow dropdown menu, select the Ion Reporter™ Software analysis workflows
to use with the sample for automatic launches in Ion Reporter™ Software.
When a sample and analysis workflows are launched in Ion Reporter™ Software, successful
analyses are available for the account and organization that you selected.

8. (Optional) To create a new analysis workflow, click Create New Workflow to open Ion Reporter™
Software in a new browser window. In Ion Reporter™ Software, create a new analysis workflow,
then save it. When you return to Torrent Suite™ Software, refresh the browser. You can then select
the newly created analysis workflow in the Existing Workflow list.

70 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create Planned Runs 4

9. Click Next to continue with the Planned Run creation.

The software takes you to the next step in the workflow bar. Use other steps in the workflow bar
to enter or change settings if needed. For more information, see “Steps in the workflow bar” on
page 44.

10. In the Plan step, manually enter sample information into the Samples Table using the software.
Use the Ion Reporter workflow option to select multiple analysis workflows for use with a single
immune repertoire sample.
a. (Optional) Deselect the Show All Workflows checkbox in the column heading to narrow the
list of analysis workflows to only the analysis workflows for use with the nucleic acid type for
the sample barcode.

b. Click the analysis workflow name under Ion Reporter workflow.

A dropdown menu lists available analysis workflows under Ion Reporter workflow.

c. For each barcode listed in the Samples Table, select one of the options for use to launch
multiple analysis workflows with a single immune repertoire sample.

Ion Reporter analysis workflow options for use with immune repertoire Planned Runs

Item Selection
All Use this option to select all available analysis
workflows for use with the single sample immune
repertoire analysis.
Upload Only Do not use this option for Planned Runs that
launch multiple analysis workflows.
Analysis workflow Select one or more analysis workflow for use with
the single sample analysis.

As you make selections, the settings are updated in the Summary pane. You can also use the
information in this pane to review the settings that are predefined by the template.
After you select the analysis workflows for use with the Planned Run, the table lists the number of
analysis workflows that are selected.

Torrent Suite™ Software 5.18 User Guide 71

 Chapter 4 Plan and execute an instrument run
4 Create Planned Runs

11. Manually enter other sample information into the Samples Table using the software. The available
options are different depending on which research application is used.

Samples Table options

Item Selection
Barcode For barcoded samples, select a barcode.
Sample Name Select a sample that is a part of the selected
(Required) sample set or sets.

Control Type (Optional) Click the Control Type column heading

to expand the column, then select the control
type.
Sample ID (Optional) Enter a sample ID for each sample.
Sample Description (Optional) Enter a sample description for each
sample.
DNA/RNA For DNA and RNA applications, select DNA or
RNA for each sample.
Reference If using different reference and BED files for one
or more samples, click the Reference heading to
expand the sections. Then select the reference,
target regions, and hotspots files for each sample.
Sample Tube Label Scan or enter the barcode of the Ion Chef™
sample tubes to be used in the run.
Chip Barcode Scan or enter the barcode of the Ion Chef™
sample tubes to be used in the run.
Sample Collection Date Enter the date that the blood sample was drawn.
Click the cell, then select a date in the calendar or
enter a date with YYYY-MM-DD format.
Sample Receipt Date Enter the date that the laboratory received blood
sample. Click the cell, then select a date in
the calendar or enter a date with YYYY-MM-DD
format.
Ion Reporter workflow[1] Select the Ion Reporter™ Software analysis
workflows for use with the Planned Run.
To narrow the list of analysis workflows to
only the analysis workflows for use with the
immune repertoire analysis, deselect the Show All
Workflows checkbox in the column heading.
This option is available only if Ion Reporter™
Software is connected.
Relation Select sample relationship group.
This option is available if Ion Reporter™ Software
is connected.

72 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create Planned Runs 4

Samples Table options (continued)

Item Selection
Gender Select Male, Female, or Unknown.
This option is available if Ion Reporter™ Software
is connected.
Population The super population code assignment for a
sample, as defined by the human 1000 genomes
project ( www.internationalgenome.org/faq/
which-populations-are-part-your-study/). The
population is relevant to the analysis of
samples by the TCRB-LR assay workflow in
Ion Reporter™ Software. The TCRB-LR analysis
workflow produces a haplotype group assignment
for samples having a population attribute of
"European".
Mouse Strains The name of a mouse strain. Choose from a
select number of the most common strains. In
Ion Reporter™ Software 5.12, the selected mouse
strain will not affect Ion Reporter™ Software
analysis workflows.
IR Set ID Set this option to the same value for related
samples. After file transfer, in Ion Reporter™
Software, samples with the same IR Set ID are
considered related samples and are launched in
the same analysis (for example, normal sample
and its corresponding tumor sample).
Do not give unrelated samples the same IR Set ID
value even if the value is zero or blank.
This option is available if Ion Reporter™ Software
is connected.
[1] See step 10 in this procedure for more information.

12. Click Save Samples Table to save changes to the Samples Table.

13. When you have completed the selections, review the settings in the Summary pane, then
click Plan Run at the bottom of the Plan step.
The Planned Run is added to the list on the Planned Runs screen.

Torrent Suite™ Software 5.18 User Guide 73

 Chapter 4 Plan and execute an instrument run
4 Create multiple Planned Runs

Create multiple Planned Runs

To facilitate running the same sequencing run multiple times, you can use a template CSV file to create
multiple Planned Runs at one time. The template CSV file for batch planning is available for download in
the Torrent Suite™ Software.
Each column in the CSV file represents an individual Planned Run. Each row contains the run
parameters for each individual Planned Run. You can add sample information to Planned Runs that
is required for Ion Reporter™ Software analyses, including account, workflow, and workflow-related
attributes such as gender, relation, and IR Set ID.
The latest CSV batch planning template file indicates the version of the template in the top row. This
version number is required. When you download the template CSV file, the version is automatically
included.

Create multiple Planned Runs for non‑barcoded libraries

You can create multiple Planned Runs with a template CSV file. To create multiple Planned Runs for
individual non-barcoded libraries, a single batch planning template CSV file is required.

1. In the Plan tab, click Templates.

2. In the row for the template that you want to use to

create multiple Planned Runs, click (Actions)4
Plan Multiple.

3. In the Plan Runs from Template dialog box, enter the

number of Planned Runs that you want to create, then
click Download CSV for batch planning.

74 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create multiple Planned Runs 4

4. Save the batch planning template CSV file to your drive, then open the file.

In this example, the template creates four Planned Runs with non-barcoded libraries.

5. Enter the plan parameters for each Planned Run. The following parameters are required:
• Template name (auto-populated)
• Plan name
• Sample
• Templating Kit name (auto-populated)
• Chip type

6. Name, then save the CSV file.

7. In the Plan tab, in the Templates screen, click

Upload4Upload Plans.

8. In the Upload Plan Runs dialog box, click Choose

File, select the edited CSV template, then click Open.

9. Click Upload CSV for batch planning.

Torrent Suite™ Software 5.18 User Guide 75

 Chapter 4 Plan and execute an instrument run
4 Create multiple Planned Runs

The system parses the files, then creates the Planned Runs.

Create multiple Planned Runs for barcoded libraries

To create multiple Planned Runs for multiplex sequencing of barcoded libraries, two batch planning
template CSV files are required:
• A master CSV file that is used to specify the plan name, kits, chips, projects, and plugin selections.
• A sample CSV file for each Planned Run.

1. In the Plan tab, click Templates.

2. In the row for a barcoded template that you want

to use to create multiple Planned Runs, click
(Actions)4 Plan Multiple.

3. In the Plan Runs from Template dialog box, enter the

number of Planned Runs that you want to create, then
click Download CSV for batch planning.

4. Unzip the downloaded archive file, then save the files to your drive.

76 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Create multiple Planned Runs 4

5. Open the tsPlan file appended with master.csv, enter the Template name, Plan name, Sample, and
Chip type.

In this example, the template creates four barcoded Planned Runs.

6. Save the CSV file.

7. Open each tsPlan file appended with samples.csv, enter the sample parameter information for
each barcoded sample, including Sample Name, Sample ID, Sample Description, and so on, then
save each file.

8. Add the Master CSV template and all Sample CSV template files to a compressed (zipped) folder.

9. In the Plan tab, in the Templates screen, click

Upload4Upload Plans.

10. In the Upload Plan Runs dialog box, click Choose

File, select the edited CSV template, then click Open.

11. Click Upload CSV for batch planning.

The system parses the files, then creates the Planned
Runs, that are then available for use in the Plan tab, in
Planned Runs screen.

Torrent Suite™ Software 5.18 User Guide 77

 Chapter 4 Plan and execute an instrument run
4 Planned Runs list

Planned Runs list

The Planned Runs screen under the Plan tab lists Planned Runs that are ready to execute on an
Ion Chef™ Instrument or a sequencer. Planned Runs are listed by date, and the list includes basic
information about each run, including its status in the sequencing workflow. For more information, see
“Planned Run status” on page 80.
The Planned Runs screen includes tools for searching, sorting, editing, copying, and deleting Planned
Runs, and transferring them to another Ion Torrent™ Server.

78 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Runs list 4

Manage Planned Runs

You can manage Planned Runs in various ways.
On the Plan tab, click Planned Runs then complete the selections for the following options.

Option Selection
View all Planned Runs Click All above the list.
View Planned Runs that Click by Template above the list.
were created from a
Planned Run template
View Planned Runs that Click by Sample above the list.
were created from a
Sample Set
Search the list 1. In the search box above the Planned Runs list, click (Search By), then
select the search type from the options.

2. Enter your search terms in the box, then click Go.

Filter the list Select your filter criteria from the lists above the list of Planned Runs.

Clear all search and filter Click Clear All above the list.
settings and display the
complete list
Sort the list Click a column header to sort the list by the information in that column. Only
columns with bold headers are sortable.
View multiple pages in Click the page number and scroll buttons below the list.
the list
Display a list of the In the Sample column, hover over the (Info) icon.
samples in the Planned
Run
Display a list of projects In the Project column, hover over the (Info) icon.
that the run results will be
transferred to
Delete Planned Runs Select the checkbox next to each Planned Run, then click Delete Selected
below the list.
Alternatively, click (Actions) in the Planned Run row, then select Delete.
You cannot delete Planned Runs with a status of Reserved.

Torrent Suite™ Software 5.18 User Guide 79

 Chapter 4 Plan and execute an instrument run
4 Planned Runs list

(continued)
Option Selection
Edit a Planned Run 1. Click (Actions) in the Planned Run row, then select Edit.
The Edit Plan workflow opens.
2. Edit the settings in any of the steps, then click Update Plan in the Save
step.

Review all the settings in Click (Actions) in the Planned Run row, then select Review.
a Planned Run
Copy a Planned Run 1. Click (Actions) in the Planned Run row, then select Copy.
The Copy Plan workflow opens.
2. Edit the settings in any of the steps, enter the name of the new plan in Run
Plan Name, then click Copy Plan in the Save step.

Transfer a Planned Run To transfer a Planned Run, see “Transfer a Planned Run to another Ion Torrent™
to another Ion Torrent™ Server” on page 83.
Server

Planned Run status

The Planned Run status appears in the Status column of the Planned Runs list.
When you select a Planned Run on a sequencer and start sequencing, the Planned Run is removed
from the Planned Runs list.
You can change the status of an Ion Chef™ Instrument run under specific circumstances. For more
information, see “Manually change Ion Chef™ Instrument run status” on page 81.

Status Description

Pending The Planned Run is available and ready for use by an Ion Chef™
Instrument. It is unavailable for sequencing until the Ion Chef™
Instrument run is complete.
The software determines whether a run is Pending on an Ion Chef™
Instrument based on the template kit selection when you create the
run.

Reserved The Planned Run is in use by an Ion Chef™ Instrument, and

is unavailable for use until the current Ion Chef™ Instrument run
completes.

Planned The Planned Run is available and ready for use by a sequencing
instrument.

Voided The Ion Chef™ Instrument run is canceled through the Ion Chef™
Instrument.

80 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Runs list 4

Manually change Ion Chef™ Instrument run status

An Ion Chef™ Instrument run must have a status of Planned before a sequencer can start a sequencing
run. If the connection between an Ion Chef™ Instrument and Torrent Suite™ Software is temporarily
lost or interrupted, the status of the Ion Chef™ run may be marked as Reserved, even if the run has
completed. To resolve this problem, you can manually change the status to Planned and enable the run
for sequencing.

1. In the Plan tab, click Planned Runs.

2. Find the Planned Run of interest (with a status of Reserved), then click (Actions)4Completed
on Chef.
The status for the Ion Chef™ Instrument run on the Planned Runs screen changes from Reserved
to Planned. The sequencer can now use the Planned Run to start a sequencing run.

Torrent Suite™ Software 5.18 User Guide 81

 Chapter 4 Plan and execute an instrument run
4 Planned Runs list

Execute a Planned Run on a sequencer

A Planned Run is listed in the Planned Runs screen until it is executed on a sequencer. To execute the
run, select it on the sequencer touchscreen, after which the run is removed from the Planned Runs list.
On the Ion GeneStudio™ S5 System and Ion S5™ System:

• On an Ion GeneStudio™ S5 System or an Ion S5™ System sequencer, select the Planned Run from
the drop-down list on the Run Selection screen, then press Review. On the Select Run screen,
ensure that the selections are correct, then press Start run.

82 Torrent Suite™ Software 5.18 User Guide

 Chapter 4 Plan and execute an instrument run
Planned Runs list 4

Transfer a Planned Run to another Ion Torrent™ Server

If you have multiple Ion Torrent™ Servers and sequencers on a network, you can create a Planned Run
on one Ion Torrent™ Server, then transfer it to a different Ion Torrent™ Server to perform the run. This is
useful if an Ion Chef™ Instrument or sequencer that is associated with a sever that is offline or busy.
A network administrator or your local Field Service Engineer must first set up this networking capability.

Network

TS 1 TS 2 TS 3
(origin) (destination) (destination)

IC 1 S5 1 IC 2 S5 2 IC 3 S5 3

For example, as shown in the diagram, a Planned Run can be set up on the first Ion Torrent™ Server (TS
1) and run on its associated Ion Chef™ Instrument (IC 1). But if the associated Ion S5™ Sequencer (S5 1)
is busy or offline, you can transfer the Planned Run to another Ion Torrent™ Server on the network (TS 2
or TS 3) to perform the run on those associated sequencers (S5 2 or S5 3).

1. In the Planned Runs screen, find the Planned Run that you want to transfer.
The status of the Planned Run listed in the Status column must be either Pending (for runs to
be sent to an Ion Chef™ Instrument) or Planned (for runs to be sent to a sequencer). You cannot
transfer runs that are in progress on an Ion Chef™ Instrument (status is Reserved).

2. Click (Actions) for the selected Planned Run, select Transfer, then select the name of the
destination Ion Torrent™ Server on the network.

Torrent Suite™ Software 5.18 User Guide 83

 Chapter 4 Plan and execute an instrument run
4 Planned Runs list

3. Click Transfer to confirm.

• If the transfer is successful, a green confirmation message appears.

• If any files or other settings required for the run are missing on the destination server, a red
message reports what is missing. Edit the transferred Planned Run on the destination server to
add the files or missing settings to perform the sequencing run.

• You can no longer access the Planned Run on the origin server after it has transferred.
• To move the results of a sequencing run to a different Ion Torrent™ Server, use the RunTransfer
plugin. For more information, see “RunTransfer plugin” on page 171.

84 Torrent Suite™ Software 5.18 User Guide

 5 Monitor runs in progress

■ Monitor a sequencing run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86

■ Monitor an Ion Chef™ run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
■ View data for runs in progress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
■ Auto Refresh the Monitor tab . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
■ Review the Planned Run settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
■ Stop an analysis job . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
■ View system memory usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91

In Torrent Suite™ Software, use the Monitor tab to monitor information about runs that are in progress
on various instruments. You can also review the Planned Run settings for a sequencing run that is
currently in progress.
For each run, you can view reported metrics, thumbnail graphs, and other indicators.
Active runs and all runs completed within the previous 7 days are available to view. More data about
completed runs is available in the Data tab.

Torrent Suite™ Software 5.18 User Guide 85

 Chapter 5 Monitor runs in progress
5 Monitor a sequencing run

Monitor a sequencing run

Use the Monitor tab to view the thumbnail graphs and metrics of a sequencing run in progress to
determine quickly whether to abort or continue the sequencing run.
In the Monitor tab, click Runs in Progress, then view run metrics in List View.

During a sequencing run, a temporary thumbnail entry shows run metrics and a heatmap image of chip
loading as the information becomes available. You can see immediately in the heatmap image, and in
the thumbnail graphs, whether any run quality metrics are flagged ( ) as falling below the thresholds
that are defined in your Planned Run.

Metric Description
Loading Addressable wells on the chip that have detectable loading.
Live ISPs Loaded Ion Sphere Particle (ISP) wells that have a live signal.
Library ISPs Live Ion Sphere Particle (ISP) wells with a library template.
Key Signal Average 1-mer signal in the library key.
Usable Seq Percentage of the sequence available for analysis after filtering.
Flow Transfer Progress of the sequencing run expressed as number of the total number of
flows completed.

If you decide to abort a sequencing run based on the chip loading metrics observed, see “Stop an
analysis job” on page 90.

86 Torrent Suite™ Software 5.18 User Guide

 Chapter 5 Monitor runs in progress
Monitor an Ion Chef™ run 5

Monitor an Ion Chef™ run

Use the Monitor tab to view details about Ion Chef™ runs from the previous 7 days. The Planned
Runs screen also contains information about the status of Ion Chef™ runs. For more information, see
“Planned Run status” on page 80.

1. In the Monitor tab, click Ion Chef.

2. View the run information.

Item Definition
Last Updated The date and time of the currently displayed run status.
Sample Set For more information, see Chapter 3, “Samples and Sample Sets”.
Plan The Ion Chef™ run plan in progress.
Chef Instrument The identity of the Ion Chef™ Instrument in use.
Library Prep Progress The progress of an Ion AmpliSeq™ library preparation run. For an
Ion AmpliSeq™ on Ion Chef™ run only.
Library Prep Status The current stage of the library preparation run.
• Not started
• In progress
• Complete

Template Prep Progress The progress of a template preparation run.

Template Prep Status The current stage of the template preparation run.
• Not started
• In progress
• Complete

Estimated Time Remaining The estimated time remaining until the run is completed.
Estimated Time Until User The estimated time and date when the run pauses for QC or is
Intervention completed.

For an Ion Chef™ run in progress, check the Estimated Time Remaining or the Estimated Time
Until User Intervention to see the time remaining before you can remove Ion Sphere™ Particles
(ISPs) samples at the QC pause or remove loaded chips for sequencing.

View data for runs in progress

You can view data for runs that are in progress.
The Runs in Progress screen on the Monitor tab has two views:
• List View shows 20 runs per screen, with details for each run.
• Table View shows one run per row in columns that you can sort by clicking a column head. This
view shows only the information that is associated with each report.

Torrent Suite™ Software 5.18 User Guide 87

 Chapter 5 Monitor runs in progress
5 Auto Refresh the Monitor tab

Both views show 20 runs at a time. If you have more than 20 runs, multiple screens are shown.

1. In the Monitor tab, click Runs in Progress.

2. To monitor details about Ion Chef™ Instrument runs, click Ion Chef.

3. To view more data about a run, click the run report name link.
The run report is opened in the Data tab. You can use the navigation links to view different types of
data.

Auto Refresh the Monitor tab

Use the Auto Refresh feature to update the information on the Monitor tab screens every 20 seconds.
Without Auto Refresh, the screens are a static display of information at the time you open the screen.

• To set the Runs in Progress screen to automatically refresh:

a. In the Monitor tab, select Runs in Progress, then click Auto Refresh.

b. Click Stop Refresh to turn the Auto Refresh feature off.

• To set the Ion Chef screen to automatically refresh.

a. In the Monitor tab, select Ion Chef, then click Auto Refresh.

b. Click Stop Refresh to turn the Auto Refresh feature off.

88 Torrent Suite™ Software 5.18 User Guide

 Chapter 5 Monitor runs in progress
Review the Planned Run settings 5

Review the Planned Run settings

In the Monitor tab you can review the Planned Run settings for a run that is in progress.

1. In the Runs in Progress List View, click Review Run Plan for the run of interest.

The Review Planned Run dialog box displays the Planned Run information and settings.

2. Click Close to return to the Monitor tab, Runs in Progress screen.

Torrent Suite™ Software 5.18 User Guide 89

 Chapter 5 Monitor runs in progress
5 Stop an analysis job

Stop an analysis job

You can stop an analysis job for a run that has started but is not completed.

1. Click (Settings)4Services.

2. Scroll down to the Active Jobs section, find the Name for the sequencing run that you want to
stop. The Status Message column indicates job is running.

3. Click Terminate for the analysis job that you want to stop.

4. In the confirmation dialog box, click Yes to end the job.

5. Refresh your browser to update the information in the

Active Jobs section. The job is removed from the
Active Jobs list. The list displays No active jobs if no
other jobs are active.

6. In the Data tab, click Completed Runs & Reports.

The status is TERMINATED next to the name of the

analysis job that you stopped.

You can always start a new analysis job.

90 Torrent Suite™ Software 5.18 User Guide

 Chapter 5 Monitor runs in progress
View system memory usage 5

View system memory usage

You can view information about how much system memory is being used in the System Services
screen. This information is useful to monitor sequencing runs, and to troubleshoot issues that are
related to memory usage.

1. Click (Settings)4Services.

2. Scroll to the System Memory Usage section.

The current system memory usage is shown in GB and as a percentage of the total memory that is
available.

Torrent Suite™ Software 5.18 User Guide 91

 6 Review and manage run reports

■ About run reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

■ Search for a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
■ Open a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
■ View details about completed runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
■ Organize run results with projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114
■ Reanalyze a run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124
■ Edit a run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
■ Set the Completed Runs & Reports screen to automatically refresh . . . . . . . . . . . . . . . . . . . . . . . . 128

A Torrent Suite™ Software run report contains statistics and quality metrics from completed sequencing
runs. You can use this information to evaluate the run. You can also complete other tasks from the run
report.

About run reports

For runs completed on an Ion S5™, Ion S5™ XL, or Ion GeneStudio™ S5 Series system, each run report
includes one full chip report and one thumbnail report. If the run has been reanalyzed, additional reports
are available when you open the run report.
You can complete several tasks from the run report, including:
• Upload output files from the run report to Ion Reporter™ Software. For more information, see “Run
the IonReporterUploader plugin manually” on page 235.
• Review, edit, or copy the Planned Run settings for the sequencing run. For more information,
see “Review Planned Run settings” on page 57 and “Create a custom Planned Run template” on
page 37.
• Rerun the data analysis for the run. For more information, see “Reanalyze a run” on page 124.
• Archive, edit, or delete data for the run. For more information, see Chapter 11, “Data management”.
• Toggle between different run reports for the same sample. For more information, see “Open a run
report” on page 93.
• Run Torrent Suite™ Software plugins. For more information, see “Run a plugin manually from the
sequencing run report” on page 132.
• Download the run report or plugin summary in PDF format. For more information, see “Download a
run report summary PDF” on page 109 and “Download a plugin report PDF” on page 132.

For further details about how to evaluate a run, see How to assess an Ion S5™/Ion GeneStudio™ S5
sequencing run report User Bulletin, (Pub. No. MAN0017983).

92 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Search for a run report 6

Search for a run report

You can search, sort, or filter the Completed Runs & Reports list to find a run report of interest.

1. In the Data tab, click Completed Runs & Reports, then complete the selections for the following
options.
Option Selection
Search the list In Search, enter a search term, then click Go.
Sort the list Select a sort order from the Sort list (List View or Table View) or click any bolded
column header (List View only) to sort the list. Click the column header a second time
to reverse the sort order.
Limit the list to In Date, select a preset range, or click Date Range, then select a Start and End
recent runs date.
Filter the list Select one or more filters to limit the Completed Runs & Reports list.
Click More Filters to see all available filters. Within a filter, enter text in Find to limit
the filter choices.
To remove a filter, deselect the filter choice or click Clear in the filter list.
View favorites Click the icon ( ) next to Search to limit the list to completed runs that are
designated as Favorite.
To set a completed run as a favorite, click the icon ( ) next to the completed run
name. The icon color changes to blue.

2. Click Clear All to remove filters and restore all results.

Open a run report

Every sequencing run report includes at least two versions: a full chip report that contains complete
details about the run, and a thumbnail version that includes a limited data set. If the run has been
reanalyzed, additional reports are available.
The thumbnail reports use a limited set of data points to give a summary of the fully sequenced and
analyzed run. Thumbnail reports can be used to determine quickly the success of the run or whether
a run should be terminated. Thumbnail reports are appended with _tn at the end of the report name

Torrent Suite™ Software 5.18 User Guide 93

 Chapter 6 Review and manage run reports
6 Open a run report

and can be opened before the full chip reports are generated. The full chip reports contain all the data
points and can be used for your analysis review.

1. In the Data tab, click Completed Runs & Reports.

Completed Runs & Reports are displayed in List View layout.

2. (Optional) Click Table View to review Completed Runs & Reports details in a table layout.

3. To open an individual run report:

• In the List View, find the pane that contains details about your run of interest, then click the
link in the Report Name column to view details about any of the available reports for that run.

If more than two reports are listed, click Show all reports to view the list of reports associated
with your run of interest.
• In the Table View, find the run that you want to view the report for, then click the link in the
Report Name column.
To open another report that is associated with your run of interest, click the Reports list, then
select the report that you want to open.

Review unaligned reads

To determine the quality of the sequencing run, you can review the quality metrics for the unaligned
reads. Primary pipeline processing, base calling, and signal processing generate these metrics. The
quality metrics for unaligned reads are divided into three categories:
• Quality of chip loading, expressed as the density of Ion Sphere™ Particles (ISPs) loaded onto the
chip.
• Quality of the ISPs that are loaded onto the chip.
• The length of sequencing reads.

94 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

1. In the Data tab, in the Completed Runs & Reports screen, find the report that you want to review,
then click the report name link in the Report Name column.

2. In the left navigation menu, click Unaligned Reads.

3. Review the unaligned read quality metrics in ISP Density, ISP Summary, and Read Length
panes.

4. (Optional) Click to view more details about the information in each pane.

Run report metrics before alignment

To assess the sequencing run, you can review the quality metrics for the unaligned reads.
Primary pipeline processing, basecalling, and signal processing generate these metrics. The following
prealignment metrics are provided in the run report. Access the run report in the Torrent Suite™
Software using the Data tab.

1 2 5 11 12 13

3
6
4
14
7

10

Number Metric Description

1 Total Bases The number of filtered and trimmed base pairs reported in the output BAM
file.

2 Key Signal The average signal for all library ISPs with library key (TCAG).

3 ISP Loading The percentage of chip wells that contain an Ion Sphere Particle (ISP). The
percentage value considers only addressable wells.

4 ISP Loading A visual representation of well loading distribution on the chip surface.
Density Red color indicates areas of high loading and blue indicates areas of low
loading.

5 Total Reads The total number of filtered and trimmed reads independent of length
reported in the output BAM file.

Torrent Suite™ Software 5.18 User Guide 95

 Chapter 6 Review and manage run reports
6 Open a run report

(continued)

Number Metric Description

6 Usable Reads The percentage of library ISPs that pass the polyclonal, low quality, and
primer-dimer filters. This percentage is calculated by dividing final library
ISPs by library ISPs.

7 ISP Summary- The percentage of chip wells that contain an ISP. The percentage value
Loading considers addressable wells.

8 ISP Summary- The predicted number of live ISPs that have a key signal identical to the
Enrichment library key signal or test fragment (TF) key signal. The Percent Enrichment
value reported is the number of loaded wells with live ISPs that are Library
ISPs or TF ISPs. This number is calculated by dividing wells with live ISPs
by the number of wells loaded with ISPs.

9 ISP Summary- The percentage of clonal ISPs (all library and TF ISPs that are clonal, not
Clonality polyclonal).
An ISP is clonal if all of its DNA fragments are cloned from a single
original template. All the fragments on such an ISP are identical and they
respond in unison as each nucleotide is flowed in turn across the chip. This
percentage is calculated by dividing the number of ISPs with a single DNA
template by the number of live wells.

10 ISP Summary- The percentage of reads, which pass all filters, and which are recorded in
Final Library the output BAM file. This value can be different from the Total Reads due to
technicalities associated with read trimming beyond a minimal requirement
that results in Total Reads being slightly less than Final Library.

11 Mean Read The average length, in base pairs, of called reads.

Length

12 Median Read The median length, in base pairs, of called reads.

Length

13 Mode Read The mode length, in base pairs, of called reads.

Length

14 Read Length The read length histogram is a histogram of the trimmed lengths of all reads
Histogram present in the output files.

96 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

Review aligned reads

View the aligned reads to determine the accuracy of your sequencing run.

1. In the Data tab, click Completed Runs & Reports, then select a report of interest.

2. In the left navigation menu, click Aligned Reads, then review the metrics to determine the
accuracy of your sequencing data.

Click , or on an image to open an enlarged view.

Quality following alignment

You can use read alignment to evaluate the quality of the sequencing reaction and the quality of
the corresponding library when an accurate reference is available. Reads are aligned to a reference
genome sequence. Any discrepancy in alignment to a reference, whether biological (actual variant) or
technical (sequencing error) is listed as a mismatch. Alignment performance metrics are reported using
the alignment quality (AQ) score, which defines the accuracy of sequencing reads when compared to a
reference genome sequence. Torrent Suite™ Software reports alignment quality using three parameters:
• AQ17—the greatest length at which the error rate is 2% or less.
• AQ20—the greatest length at which the error rate is 1% or less.
• Perfect—the longest perfectly aligned segment.

Aligned read length calculation

The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read
at which the accuracy in the bases, up to and including the position, meets the accuracy threshold.
Accuracy is specified using the Phred -10log10 transformation, where 20 represents an error rate of
1%, and 17 represents an error rate of 2%.
In Torrent Suite™ Software, the alignment quality (AQ) score represents alignment quality for the total
number of bases that are sequenced or for consecutive sequencing reads. The AQ20 length is the
greatest length at which the error rate is 1% or less, and the AQ17 length is the greatest length at which

Torrent Suite™ Software 5.18 User Guide 97

 Chapter 6 Review and manage run reports
6 Open a run report

the error rate is 2% or less. The ideal length is the longest perfectly aligned segment. The AQ score for
the total number of bases represents the number of all aligned bases in the sequencing reaction that
meet a specific AQ score.
For all of these calculations, the alignment is constrained to start from position 1 in the read - that is,
no 5' clipping is allowed. The underlying assumption is that the reference to which the read is aligned
represents the true sequence that is seen.
Appropriate caution must be taken when values for the AQ score are interpreted for situations in which
the sample that is sequenced has substantial differences relative to the reference used. For example,
for alignments to a rough draft genome, or for samples that are expected to have high mutation rates
relative to the reference used. In these situations, the AQ20 and AQ17 lengths can be short even when
sequencing quality is excellent.
The AQ20 length is calculated using the following steps:
• Every base in the read is classified as being correct or not correct according to the alignment to the
reference.
• At every position in the read, the total error rate is calculated up to and including that position.
• The greatest position at which the error rate is one percent or less is identified and that position
defines the AQ20 length.

For example, if a 100‑bp read consists of 80 perfect bases that are followed by 2 errors that are then
followed by 18 more perfect bases, the total error rate at position 80 is zero percent. At position 81 the
total error rate is 1.2% (1/81), at position 82 the error rate is 2.4%, continuing up to position 100 where
it is 2% (2/100). The greatest length at which the error rate is 1% or less is 80, and the greatest length
at which the error rate is 2% or less is 100. Therefore, the AQ20 and AQ17 lengths are 80 and 100
bases, respectively.

Alignment
Torrent Suite™ Software provides a view on alignment that helps determine run and library quality.
Many alignment algorithms are available in the marketplace. You are encouraged to consult with
a bioinformatician for the most appropriate alignment algorithm for your downstream analysis
requirements.
Alignment in Torrent Suite™ Software is performed using TMAP. TMAP is currently an unpublished
alignment algorithm, created by the authors of the BFAST algorithm. For more information, see “TMAP
modules” on page 307, or contact your local Field Service Engineer or Technical Support.
Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP,
BFAST, is based on the ideas in the following publications:
• Homer N, Merriman B, Nelson SF (2009) BFAST: An Alignment Tool for Large Scale Genome
Resequencing. PLoS ONE 4(11): e7767. doi: 10.1371/journal.pone.0007767
• Homer N, Merriman B, Nelson SF (2009) Local alignment of two-base encoded DNA sequence.
BMC Bioinformatics 10: 175. doi: 10.1186/1471-2105-10-175

98 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

Reads used for alignment

The alignment process involves aligning reads produced by the pipeline to a reference sequence
and extracting metrics from those alignments. By default, Torrent Suite™ Software aligns all reads to
the reference; however, there may be situations, particularly with large reference sequence, when the
alignment exceeds the amount of time that you are willing to wait. If so, the software can define on a
per-reference basis the maximum number of reads that are aligned from a run.
When the number of reads in a run exceeds a reference-specific maximum, a random sample of reads
is taken, and results are extrapolated to represent the full run. By sampling a random pool of reads
and extrapolating the alignment quality values to represent all reads, the software provides sufficient
information to assess the quality of the sample, library, and sequencing run.
The output of the alignment process is a BAM file. The BAM file includes an alignment of all reads,
including the unmapped reads, with exactly one mapping per read. When a read maps to multiple
locations, the mapping with the best mapping score is used. If more than one such mapping exists, a
random mapping is used and a mapping quality of zero is given.

Predicted quality (Q20)

The number of called bases with a predicted quality of Q20 is reported. The predicted quality values are
reported on the Phred scale, defined as -10 log10 (error probability). Q20, therefore, corresponds to a
predicted error rate of one percent.

Per-base quality score system

The Ion Torrent™ technology per-base quality score system uses a Phred-like method to predict the
probability of correct base calls. The prediction is based on the quality of the base incorporation signal
that was used for generating the base calls. The quality score system used by the sequencers uses a
set of six predictors whose values are correlated with the probability of a base miscall.
A Phred lookup table is used for converting the values of predictors to error probabilities. The lookup
table is generated by training on a representative data set in a customer configuration. The lookup table
is retrained for each software release and is shipped as part of the software package. Quality scores are
published in the BAM file.

Quality score predictors

Torrent Suite™ Software uses the following six quality score predictors that are correlated with empirical
base call quality:

Predictor Description

P1 Penalty Residual—A penalty based on the difference between predicted and

actual flow values. Computed by the base caller.

P2 Local Noise—Noise (defined as the maximum absolute difference between the

flow value and the nearest integer) in the immediate neighborhood (plus/minus 1
base) of the given base.

Torrent Suite™ Software 5.18 User Guide 99

 Chapter 6 Review and manage run reports
6 Open a run report

(continued)

Predictor Description

P3 High-Residual Events—Number of high-residual flows in the 20-flow window

around the flow containing the base. A flow has high residual when the
normalized difference between the observed and model-predicted signal
exceeds 0.4 or falls below –0.4. The more high-residual flows in the window,
the lower quality the base call.

P4 Multiple Incorporations—Number of incorporated bases in this flow. Length of

the homopolymer. For multiple incorporations of the same nucleotide in one
flow, the last base in the incorporation order is assigned a value equivalent
to the total number of incorporations. All other bases in the sequence of the
multiple incorporations are assigned the value 1.

P5 Environment Noise—The average signal noise (defined as the absolute

difference between the flow value and the nearest integer) in the neighborhood
(plus/minus 5 bases) of the given base.

P6 State Inphase—Live polymerase in phase.

The six quality predictors are calculated for each base. Other predictors (not described here) are
computed from the corrected flow values generated by the base caller.
The corresponding per-base quality value is found by finding the first line in the lookup table for which
all six calculated predictors are less than or equal to the predictor values in the table. This process
occurs automatically as part of the standard analysis.
The Phred lookup tables are stored in the /opt/ion/config directory on Ion Torrent™ Server. The Ion
Torrent™ Server supports separate Phred tables for each type of chip.
The per-base quality along with all other read information is written to the unmapped BAM file. The
per-base quality scores are reported in the QUAL field, which is part of the SAM/BAM file format
specification (see https://samtools.github.io/hts-specs/SAMv1.pdf, pages 6 and 8.
The quality scores are on a phred-10*log_10 (error rate) scale.
References
1. Brockman, et al. (2008): "Quality scores and SNP detection in sequencing-by-synthesis systems."
Genome Res. 18: 763-770.References.
2. Ewing B, Hillier L, Wendl MC, Green P. (1998): "Base-calling of automated sequencer traces using
phred. I. Accuracy assessment." Genome Res. 8(3):175-185.
3. Ewing B, Green P. (1998): "Base-calling of automated sequencer traces using phred. II. Error
probabilities." Genome Res. 8(3):186-194.

100 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

Run report metrics after alignment

To assess the sequencing run when an accurate reference is available, you can review the quality
metrics for aligned reads. Reads are aligned to a reference genome sequence. The following post-
alignment metrics are provided in the run report.

1 2 7 8

9
10
3 11
12

4
5
6

Number Metric Description

1 Total Aligned The number of filtered and trimmed aligned base pairs reported in the
Bases output BAM file that are aligned to the reference sequence, excluding the
library key, barcodes, and 3' adapter sequences.

2 Reference The ratio of the total aligned bases divided by the number of bases in the
Coverage reference sequence. Reference coverage does not account for enrichment
done to selectively amplify a subset of the reference sequence.

3 Alignment plot A plot of the number of aligned reads (blue) and unaligned (purple) by
position in an aligned sequence.

4 Total Reads The total number of reads after filtering.

5 Aligned Reads The number of reads that align to the reference sequence expressed as a
total count and percentage of the total aligned reads.

6 Unaligned The number of reads that do not align to the reference sequence
Reads expressed as a total count and percentage of the total reads.

7 Mean Raw The mean raw accuracy across each individual base position in a read
Accuracy 1x calculated as 1− (total errors in the sequenced base) / total bases
sequenced.

8 AQ17 Total The total number of bases over all positions that align with an error rate of
Bases 2% or less.

9 Total Number of The total number of bases over all positions that align with a given error
Bases (bp) rate. (AQ17 ≤2% error rate, AQ20 ≤1% error rate, Perfect = no measurable
error)

Torrent Suite™ Software 5.18 User Guide 101

 Chapter 6 Review and manage run reports
6 Open a run report

(continued)

Number Metric Description

10 Mean Length The average length, in base pairs, for aligned reads at a given error rate.
(bp) (AQ17 ≤2% error rate, AQ20 ≤1% error rate, Perfect = no measurable error)

11 Longest The maximum sequence read length for a given error rate. (AQ17 ≤2%
Alignment (bp) error rate, AQ20 ≤1% error rate, Perfect = no measurable error)

12 Mean Coverage The ratio of the total aligned bases at a given error rate to the size of the
Depth (x) target region. (AQ17 ≤2% error rate, AQ20 ≤1% error rate, Perfect = no
measurable error)

Run report metrics

You can use the six run report metrics to evaluate the quality of a sequencing run:
• Throughput (or Total Bases)—The number of filtered and trimmed base pairs reported in the output
BAM file.
• ISP loading density—The percentage of chip wells that contain Ion Sphere™ Particles (ISPs). The
percentage value considers only potentially addressable wells. Bead loading density is calculated
as the number of loaded wells divided by the number of potentially addressable wells.
• Total reads—The total number of filtered and trimmed reads independent of length reported in the
output BAM file.
• Read length—The length of called reads measured in base pairs.
• Read length histogram—A histogram that reflects the size distribution of the library minus the Ion
adapter sequences.
• Key signal—The average signal (post software processing) for all ISPs that identically match the
library key (TCAG). When the library key signal is lower than expected, increased 3' quality trimming
occurs. Therefore, the higher the starting key signal, the less the impact of signal droop and the
less 3' quality trimming is expected to occur.

Throughput considerations
To assess a run, examine the throughput or total bases. Consider whether these numbers make sense
for the application and chip type.

Number of Throughput
Chip type Number of reads
addressable wells 200 Base Read 400 Base Read

Ion 510™ Chip ~6 million 2–3 million 0.3–0.5 Gb 0.6–1 Gb

Ion 520™ Chip ~12 million 4–6 million 0.6–1 Gb 1.2–2 Gb

Ion 530™ Chip ~37 million 15–20 million 3–4 Gb 6–8 Gb

Ion 540™ Chip ~150 million 60–80 million 10–15 Gb N/A

Ion 550™ Chip ~260 million 100–130 million 20–25 Gb N/A

102 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

ISP loading density

ISP loading density is the percentage of chip wells that contain an Ion Sphere™ Particle (ISP; templated
and non-templated, or live and dud ISPs). This percentage value considers only the potentially
addressable wells and is a result of the software well classification step.
The ISP density image is a color image of the Ion Chip™ that shows the percentage of loading across
the physical surface. Red indicates adequate ISP loading density, yellow indicates less-than adequate
loading density, and blue indicates an absence of loaded beads.

Note: To open a larger version of the ISP density image, click the chip image in the run report.

Total reads
The total reads value is the total number of reads that are written to barcode or no-match output BAM
files. Filtered reads are not included in this count.

Well classification
Empty and loaded wells are separated by the differences in buffering over the chip during the
nucleotide key flows (flows 1-8). Wells that are loaded with ISPs and associated polymerase have
greater buffering capacity than empty wells and the software uses this difference to identify and classify
loaded versus empty wells.
Live versus dud (non-templated ISPs) and TF versus Library ISPs are also identified based on data from
the key flows. Therefore, both sequencing primer and sequencing polymerase are required for proper
well classification.

Torrent Suite™ Software 5.18 User Guide 103

 Chapter 6 Review and manage run reports
6 Open a run report

Read filtering and trimming

Empty and loaded wells are separated by the differences in buffering and signal over the chip during
the nucleotide key flows (flows 1–8). Wells that are loaded with ISPs and associated polymerase have
greater buffering capacity and higher signal than empty wells, and Torrent Suite™ Software uses these
differences to identify and classify loaded versus empty wells.
After well classification, the software further processes the identified test fragments and library reads,
including read filtering and trimming. This processing affects the total number of library reads and
bases. You can see both well classification and library read filtering results that are displayed in the
run report. Read trimming operations trim bases off the read, thereby making reads shorter, while read
filtering operations completely remove them from the output BAM files. By default, reads that have a
trimmed read length of less than 25 bases are being filtered. The different categories of filtered reads
shown in the run report are in the table below.

Filter Description

Polyclonal Filters reads from ISPs with >1 unique library template population.
Occasionally, low or unexpected signal ISPs can also get caught in this
filter.

Low Quality Filters reads with unrecognizable key signal, low signal quality, and
reads trimmed to <25 bases.

Primer Dimer Filters reads where no or only a very short sequencing insert is present.
Reads that, after P1 adapter trimming, have a trimmed length of <25
bases are considered primer dimers.

You can see both well classification and library read filtering results that are displayed in the run report.

1 Well classification results

2 Library ISP filtering results

The ISP summary panel also presents the well classification and library ISP summary table using
slightly different calculations.

104 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

1 Usable reads percentage

2 ISP summary percentages

The usable reads percentage is calculated by

library reads passing filters (77,529,592) x 100

% usable reads =
number of library ISPs identified (134,802,984)

Each ISP summary percentage is calculated by dividing the current value by the previous values. For
example,

library reads passing filters (77,529,592) x 100

% final library =
number of clonal reads (92, 369,180)

Torrent Suite™ Software 5.18 User Guide 105

 Chapter 6 Review and manage run reports
6 Open a run report

Read length
Read length value is the length of called reads measured in base pairs. The Read Length histogram
presents all filtered and trimmed library reads reported in the output BAM file and the mean read length
in base pairs. The shape of the histogram should closely resemble the library size distribution trace,
without the adapter sequences.

1 The y-axis provides the read count.

2 The x-axis provides the read length in base pairs.

In addition to the loading density and read filtering and trimming, the average library read length also
affects the total sequencing run throughput. Read length is considered in the total sequencing run
throughput. For example, a sequencing run on an Ion 530™ chip produces about 15 million final library
reads:
• If the average read length is 300 bp, then the approximate throughput is 15,000,000 reads * 300 bp
= 4.5 Gbp.
• If the average read length is 400 bp, then the approximate throughput is 15,000,000 * 400 bp = 6
Gbp.

106 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Open a run report 6

Key signal
The library key signal is determined in the first eight flows of the sequencing run. The library key
sequence is TCAG and all four nucleotides (T, C, A, and G) are incorporated during the first eight
nucleotide flows.

Note: The library and test fragment (TF) keys, and the flow order can be found under the Analysis
Details section of the run report.

Analysis detail Example Description

Flow Order TACGTACGTCTGAGGATCGATGTACAGC The order in which the chip is exposed to

each dNTP.

Library Key TCAG A short known sequence of bases used to

distinguish the library fragment from the
test fragment.

TF Key ATCG The nucleotide sequence that is used to

identify test fragment reads.

The reported key signal is the average signal (post software processing) for all ISPs that identically
match the library key (TCAG). Each templated library ISP in a well has many library templates (ideally,
clonally amplified during template preparation) all of which contribute to the dNTP incorporation signals
reported for that well. The more templates per ISP, the higher the reported incorporation signal is for
that well. In simple terms, the key signal essentially measures the number of templates per ISP or the
efficiency of the template preparation reaction.
When the library key signal is lower than expected, increased 3’ quality trimming can result, especially
for long reads (400-base read sequencing). Over the sequencing run, as with all sequencing by
synthesis technologies, the signal that is generated drops due to the reaction conditions (polymerase
dissociation) and eventually becomes indistinguishable from the background noise. As the signal
generated approaches the background noise, the quality of the read decreases and is subject to 3’
quality trimming by the software. Therefore, the higher the starting key signal, the less the impact of the
signal droop and the less 3’ quality trimming is expected to occur.

Output files
You can view and download the output files from your sequencing runs. The files include:
• Library sequences of unaligned and aligned reads
• Barcode reports of performance metrics for each barcode included in the run, if you used barcode
adapters during the library preparation for your sample.

Torrent Suite™ Software 5.18 User Guide 107

 Chapter 6 Review and manage run reports
6 Open a run report

Download output files

You can download the library files for unaligned and aligned reads in BAM or BAI file formats.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click Output Files or scroll to the Output Files section, then click a file
type to download the following files:
Option Description
Unaligned Reads Nucleotide bases covered by reads that have not been aligned to the reference. Can
be downloaded as a binary aligned/mapped (BAM) file.
Aligned Reads Number of bases covered by reads that have been aligned to the reference. Can be
downloaded as a BAM or binary aligned/mapped index (BAI) file.

View and download barcode reports

You can view barcode reports for sequencing runs that use barcode adapters during library preparation
for samples. The reports show key performance metrics for each barcode included in the run.
The number of barcodes in the barcode report reflects the barcode set that was used in the run and the
barcodes that are present in the sample. Data is included only for barcodes that are present in the run.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click Output Files, then scroll to the barcode section of the run report.

The barcode section of a run report displays the following information and provides access to
downloadable files for each barcode:

Column Description

Barcode Name The individual barcode in the barcode set.

The row labeled No barcode reports on unclassified barcodes, which are reads
that could not be classified as a match for one of the expected barcodes in the
barcode set.

Sample Name of the sample that was sequenced on instrument.

Bases Post-filtering base output for each barcode.

% ≥ Q20 The percentage of reads that have a predicted quality score of Q20 or better.

Reads Total number of filtered and trimmed library reads (independent of length). This
number is reported in the barcode BAM file.

Mean Read Length The average read length, in base pairs (bp), of all filtered and trimmed library
reads reported in the BAM file for the barcoded run.

108 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
View details about completed runs 6

(continued)

Column Description

Read Length Histogram A thumbnail histogram of the read lengths for this barcode. Click the thumbnail
histogram to open a larger image.

UBAM Download a binary file that contains unaligned or unmapped reads. Viewing the
file requires a viewer application, such as the Integrative Genomics Viewer from
the Broad Institute.

BAM Download a compressed, binary form of the SAM file. The BAM file contains
aligned reads sorted by genome reference location.

BAI Download the BAM index (BAI) file. This file speeds up the access time for a
coordinate-sorted BAM file.

Download a run report summary PDF

You can download a run report summary in PDF format. The PDF report reflects what is visible in the
run report screen.

1. In the Data tab, click Completed Runs & Reports, then click the report name link for your
completed sequencing run.

2. Click Download PDF 4Summary PDF.

A PDF version of the run report is downloaded through the browser to a directory on your
computer, based on the browser settings.

View details about completed runs

You can view various details about a completed sequencing run in Torrent Suite™ Software.

Torrent Suite™ Software 5.18 User Guide 109

 Chapter 6 Review and manage run reports
6 View details about completed runs

View test fragments for a completed run

You can view the test fragment results and determine the quality of your sequencing run if you included
key signal test fragments in your run.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link to open the
report of interest.

2. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click Test Fragments.

Parameter Description
Test Fragment Test fragment name. For more information, see “Test fragments” on
page 279.
Reads Number of filtered & trimmed reads identified for this test fragment.
Percentage 50AQ17 The percentage of reads for this test fragment with a minimum of 50
base pairs in length and an error rate of 1 in 50, Phred-like 17, or
better. Quality is based on alignment, not predicted quality.
Percent 100AQ17 The percentage of reads for this test fragment with a minimum of
100 base pairs in length and an error rate of 1 in 100, Phred-like 17,
or better. Quality is based on alignment, not predicted quality.
Read length histogram A thumbnail histogram of trimmed lengths of all reads present in the
test fragment.

3. In the Read length histogram column, click the thumbnail histogram to open a larger image and
review the histogram details.

The figure shows an example histogram of read lengths, represented in base pairs (bp), that have a Phred-like score
of ≥17, or one error in 50 bp (only the ends are shown because of width considerations). Distributions skewed to the
right are ideal, showing longer read lengths (test fragments are a discrete length). It is likely that the sequence can
extend all the way through the test fragment, if enough flows are run, so that the histogram displays only a maximum
size based on the length of the test fragment.

110 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
View details about completed runs 6

View consumables used in a completed run

You can view a summary of reagent usage in an S5 Consumable Summary for sequencing runs on Ion
S5™ Systems and Ion GeneStudio™ S5 Systems.

1. In the Data tab, click Completed Runs & Reports, then click the name of the report of interest to
open the report.

2. In the left navigation menu, click Details or scroll down to the Details section of the run report,
then click the S5 Consumables Summary tab.

3. Note the details, including remaining uses for the cleaning solution.
Detail Description
Chip Type Chip type and version.
Chip Barcode Barcode number of the chip.
Ion S5 Cleaning Solution Row includes Part Number, Lot Number, Expiration Date, and
Remaining Uses.
Ion S5 Sequencing Reagents Row includes Part Number, Lot Number, Expiration Date, and
Remaining Uses.
Ion S5 Wash Solution Row includes Part Number, Lot Number, Expiration Date, and
Remaining Uses.

View the summary for an Ion Chef™ Instrument run

You can view a summary for a completed run by an Ion Chef™ Instrument by viewing the run report.

1. In the Data tab, click Completed Runs & Reports, then click the report name link to open the
report of interest.
If necessary, filter the list to show only Ion Chef™ Instrument runs.

2. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click the Chef Summary tab.

The following parameters are listed.

Torrent Suite™ Software 5.18 User Guide 111

 Chapter 6 Review and manage run reports
6 View details about completed runs

• Chef Last Updated • Reagent Lot Number

• Chef Instrument Name • Reagent Part Number
• Chef Operation Mode • Reagent Cartridge Serial Number
• Sample Position • Solution Lot Number
• Tip Rack Barcode • Solution Part Number
• Chip Type 1 • Templating Protocol Planned
• Chip Type 2 • Solution Cartridge Serial Number
• Chip Expiration 1 • Solution Expiration
• Chip Expiration 2 • Templating Protocol Executed
• Templating Kit Type • Chef Script Version
• Chef Flexible Workflow • Chef Package Version
• Reagent Expiration Start Time
• Completion Time

View the calibration report for a completed run

You can review calibration settings that were applied to a run. Results can be calibrated to TMAP, the
reference genome, or the calibration standard. For more information on setting calibration options, see
“Advanced Settings—Kits step in workflow bar” on page 51.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link to open the
report of interest.

2. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click the Calibration Report tab.
Calibration details are displayed. If Default Calibration was selected for the run, the tab lists the
usual Pre Base and Calibration Arguments. If No Calibration or the Calibration Standard were
selected, the tab lists the control reads, total bases, and Q20 bases.

112 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
View details about completed runs 6

Another way to access calibration details is to click Report Actions4Review Plan, then scroll
down to Advanced Parameters. For more information, see “Review Planned Run settings” on
page 57.

View analysis details for a completed run

You can view analysis details for a completed run report.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link to open the
report of interest.

2. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click the Analysis Details tab.

3. Review the analysis details.

Torrent Suite™ Software 5.18 User Guide 113

 Chapter 6 Review and manage run reports
6 Organize run results with projects

View software versions used in a run

You can view information about the versions of the software that was used for a completed run.

IMPORTANT! The version numbers that are shown can be different from your current version of the
software depending on the date of the run. It is possible that the report was analyzed with an older
version of the software. See (Settings)4About in Torrent Suite™ Software for a complete list of
modules and their version on your Ion Torrent™ Server. See the Torrent Suite™ Software Release Notes
for details about the versions in a specific release.

1. In the Data tab, click Completed Runs & Reports, then click the report name link to open the
report of interest.

2. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click the Software Version tab.
The Software Version tab shows only the software products that were used to analyze the
selected run.

Organize run results with projects

Projects are groups of result sets that you can create and to organize results into unique categories
that are useful for your organization. A project can contain run results for the same laboratory project or
results from completed runs that you want to combine. Projects also allow you to combine run results
into a single run report. When you open a list of projects, you can:
• Quickly find and view details for a group of run results.
• Search the list by project name or partial name, or by date (date range, current month, current
week, current day, or specific date).
• Click Edit to rename a project
• Click Delete to delete a project.
• Click Log to view a log of the project history.

114 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Organize run results with projects 6

Search for projects by name

You can search for projects and result sets lists by name.

1. (Optional) To display a result sets list, in the Projects table, click the name of the project containing
your result set.

2. To find the projects or result sets or of your interest, you can search, sort, and filter the Projects
and Result Sets lists.
Option Selection
Search the list Enter your search term in Search names, then click Go. The information displayed in
the table is limited only to the names that match or contain the search string.
In Search names, you can enter a complete or partial name. For example, the
following project names match the search string "mpli": amplicon, amplicon33,
AmpliSeq, Samplier. The search is not case‑sensitive and wildcards are not
supported in the search string.
Sort the list Click any bolded column header in the table to sort the order in which the projects or
result sets are displayed. Click the column header a second time to reverse the sort
order.
Filter the list by • In Last Modified select a preset range (for example, last 7 days, or this month).
date • Click Date Range, then select the Start and End dates to limit your search to
projects or result sets that are modified within the selected date range.
• Click Older than Date or Newer than Date to limit your search to project or
result sets that are modified before or after the selected date.

3. Click Clear to remove all search criteria and to display the unfiltered list of projects or result sets.

Torrent Suite™ Software 5.18 User Guide 115

 Chapter 6 Review and manage run reports
6 Organize run results with projects

Add a project to a Planned Run

You can group specific result sets in a project, then add the project to a Planned Run or Planned Run
template. The result sets that are in a project are viewable in the Data tab.
When you create a Planned Run, search for, then enter project names in the Projects step in the
workflow bar:

For more details, see Chapter 4, “Plan and execute an instrument run”.

Add selected results to another project

1. In the Data tab, click Projects to see the list of projects.

2. In the Name column of the Projects table, click the project name to view the list of result sets in
the project.

116 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Organize run results with projects 6

3. Select the checkboxes in the row of the result sets that you want to add to one or more other
projects, then click Process Selected4Add to Project.

4. Select the checkbox for each project that the result sets are to be copied to, then click Add
projects.

View result sets in a project

1. In the Data tab, click Projects to see the list of projects.

2. Select a project in the list to view the result sets that are included in the project.

Compare reports of runs in a project

You can compare report metrics side-by-side for all runs that are assigned to a project.

1. In the Data tab, click Projects.

2. Select a project.

3. Click Compare All to view all the runs in the project side-by-side.

4. (Optional) Click Customize.

The Show and Hide dialog box opens.

5. (Optional) In the Run Info column, deselect metadata to remove it from view.

Torrent Suite™ Software 5.18 User Guide 117

 Chapter 6 Review and manage run reports
6 Organize run results with projects

6. (Optional) In the Result Name column, deselect runs to remove them from view.

7. Click Apply.

8. Review the reports for all runs in the project.

9. (Optional) Export the results.

• Click Download PDF to create a PDF report.
• Click Download CSV to create a CSV file of the results.

118 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Organize run results with projects 6

Manage data for result sets in projects

You can export, archive, or delete data from results that are included in a project.

1. In the Data tab, click Projects to see the list of projects.

2. Select a project from the list to view the result sets in the project.

3. Click Process Selected4Data Management.

For details on how to export, archive, or delete data results in the project, see “Manually export run
data” on page 336, “Manually archive run data” on page 336 , and “Manually delete selected data
from a run report” on page 337.

Combine aligned reads from multiple run reports

If you are running an application that requires better coverage than the coverage provided by a single
chip, you can:
• run multiple chips with the same sample and library
• combine aligned reads from multiple sequencing reports
The combined aligned reads can be treated the same way as results from a single run. For
example, it can be exported or used as an input for a plugin.

1. In the Data tab, click Projects to see the list of projects.

2. Select a project in the list to view the result sets in the project.

3. Select the result set or sets that you want to combine into a single run result set.

4. Click Combine Selected4Combine Alignments.

5. In the Combine Selected dialog box, enter a new report name.

6. Make appropriate selections:

Option Description
Mark as Select this to identify duplicate reads and mark them in the BAM file.
duplicate For some applications, duplicate reads coming from PCR cause problems in
downstream analysis. The presence of duplicate reads can create the appearance
of multiple independent reads supporting a specific interpretation, when some reads
are in fact duplicates of each other with no additional evidence for the interpretation.

Note: Marking duplicate reads is not appropriate for Ion AmpliSeq™ data, because
many independent reads are expected to share 5' alignment position and 3' adapter
flow as each other. Marking duplicates on an Ion AmpliSeq™ run risks inappropriately
flagging many reads that are in fact independent of one another.

Overwrite Select this to identify duplicate names in your combined samples so that you can
sample name rename them.

Torrent Suite™ Software 5.18 User Guide 119

 Chapter 6 Review and manage run reports
6 Organize run results with projects

7. Click Launch.

8. (Optional) Click Report to open the summary of the report, or Log to open the log for the report.

The combined report is added to the project from which the combine action was run.

Download a CSV file of metrics

You can download a CSV file of analysis metrics for one or more result sets, then compare results
across analyses.

1. In the Data tab, click Projects, then click a project name to open the list of result sets for the
project.

2. Select the checkboxes for the analyses, then click Download Selected CSV.
The analysis metrics file is downloaded through the browser to a directory on the computer, based
on the browser settings.

Analysis metrics file fields

In the analysis metrics file, each line represents a Torrent Suite™ Software analysis run. Within each line,
fields are separated by a comma. Each comma-separated field is listed in a separate column. You can
open the files with spreadsheet software such as Microsoft™ Excel™ or Apache® OpenOffice™ Calc.
The file has many fields per entry. Rows 4 through 11 (marked by *) contain test fragments metrics. The
other rows contain library read metrics.

Field Description

Report Name of the analysis run report.

Status Status of the analysis (for example, Started,

Complete).

Flows Number of flow cycles from the actual sequencing

run.

TF Name* Test Fragment Name.

Q10 Mean* Average Q10 read length.

Q17 Mean* Average Q17 read length.

System SNR* System Signal-to-Noise Ratio.

50Q10 Reads* Number of TF Ion Sphere™ Particles (ISP) at 50+ bp

at Q10.

50Q17 Reads* Number of TF Ion Sphere™ Particles (ISP) at 50+ bp

at Q17.

Keypass Reads* Number of reads that have test fragment keys.

TF Key Peak Counts* Signal strength of the first three bases of the TF key.

120 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Organize run results with projects 6

(continued)

Field Description

Total_Num_Reads Total number of reads.

Library_50Q10_Reads Reads of length at least 50bp with 90% or greater

accuracy.

Library_100Q10_Reads Reads of length at least 100bp with 90% or greater

accuracy.

Library_200Q10_Reads Reads of length at least 200bp with 90% or greater

accuracy.

Library_Mean_Q10_Length Average length of reads with 90% or greater

accuracy.

Library_Q10_Coverage Average per base coverage considering reads with

90% or greater accuracy.

Library_Q10_Longest_Alignment Longest read length amongst reads with 90% or

greater accuracy.

Library_Q10_Mapped Bases Total bases from reads with 90% or greater

accuracy.

Library_Q10_Alignments Number of alignments from reads with 90% or

greater accuracy.

Library_50Q17_Reads Reads of length at least 50bp with 98% or greater

accuracy.

Library_100Q17_Reads Reads of length at least 100bp with 98% or greater

accuracy.

Library_200Q17_Reads Reads of length at least 200bp with 98% or greater

accuracy.

Library_Mean_Q17_Length Average length of reads with 98% or greater

accuracy.

Library_Q17_Coverage Average per base coverage considering reads with

98% or greater accuracy.

Library_Q17_Longest_Alignment Longest read length amongst reads with 98% or

greater accuracy.

Library_Q17_Mapped Bases Total bases from reads with 98% or greater

accuracy.

Library_Q17_Alignments Number of alignments from reads with 98% or

greater accuracy.

Library_50Q20_Reads Reads of length at least 50 bp with 99% or greater

accuracy.

Torrent Suite™ Software 5.18 User Guide 121

 Chapter 6 Review and manage run reports
6 Organize run results with projects

(continued)

Field Description

Library_100Q20_Reads Reads of length at least 100 bp with 99% or greater

accuracy.

Library_200Q20_Reads Reads of length at least 200 bp with 99% or greater

accuracy.

Library_Mean_Q20_Length Average length of reads with 99% or greater

accuracy.

Library_Q20_Coverage Average per base coverage considering reads with

99% or greater accuracy.

Library_Q20_Longest_Alignment Longest read length amongst reads with 99% or

greater accuracy.

Library_Q20_Mapped_Bases Total bases from reads with 99% or greater

accuracy.

Library_Q20_Alignments Number of alignments from reads with 99% or

greater accuracy.

Library_Key_Peak_Counts Signal strength of the first three bases of the library

key.

Library_50Q47_Reads Number of perfect reads of length at least 50 bp.

Library_100Q47_Reads Number of perfect reads of length at least 100 bp.

Library_200Q47_Reads Number of perfect reads of length at least 200 bp.

Library_Mean_Q47_Length Average length of perfect reads.

Library_Q47_Coverage Average per-base coverage considering only perfect

reads.

Library_Q47_Longest_Alignment Longest reads length amongst perfect reads.

Library_Q47_Mapped_Bases Total bases from perfect reads.

Library_Q47_Alignments Number of alignments from perfect reads.

Library_CF CAFIE metric: Carry forward.

Library_IE CAFIE metric: Incomplete extension.

Library_DR CAFIE metric: Signal/polymerase loss (droop).

Library_SNR System signal-to-noise ratio.

Sample Name of the sample.

Library Name of the reference genome.

Notes Any additional user-provided notes.

122 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Organize run results with projects 6

(continued)

Field Description

Run Name Long name of the analysis run.

Run Date Date that the sample was sequenced.

Run Directory Location of the raw DAT files on the Ion Torrent™
Server.

Num_Washouts Deprecated field. Value for this field is 0 in CSV file.

Num_Dud_Washouts Deprecated field. Value for this field is 0 in CSV file.

Num_Washout_Ambigous Deprecated field. Value for this field is 0 in CSV file.

Num_Washout_Live Deprecated field. Value for this field is 0 in CSV file.

Num_Washout_Test_Fragment Deprecated field. Value for this field is 0 in CSV file.

Num_Washout_Library Deprecated field. Value for this field is 0 in CSV file.

Library_Pass_Basecalling Deprecated field. Value for this field is 0 in CSV file.

Library_pass_Cafie Deprecated field. Value for this field is 0 in CSV file.

Number_Ambiguous Deprecated field. Value for this field is 0 in CSV file.

Number_Live Number of wells producing a signal.

Number_Dud Number of wells with ISPs but no signal.

Number_TF Number of wells containing test fragment.

Number_Lib Number of wells containing library.

Number_Bead Number of wells containing beads.

Library_Live Number of wells containing library ISP with signal.

Library_Keypass Number of wells containing library ISP with signal

and match key.

TF_Live Number of wells containing test fragment ISP with

signal.

TF_Keypass Number of wells containing test fragment ISP with

signal and match key.

Keypass_All_Beads Number of wells containing ISP with signal and

match key.

P Plugin data output in JSON format. The structured

text format includes named fields.

s Status of plugin data output in JSON format.

Torrent Suite™ Software 5.18 User Guide 123

 Chapter 6 Review and manage run reports
6 Reanalyze a run

Remove a result set from a project

You can remove a result set from a project. Removing does not delete the selected run reports and their
result sets from the system; it removes them only from the current project.

1. In the Data tab, click Projects to see the list of projects.

2. To view the list of result sets in the project, in the Name column of the Projects table, click the
project name.

3. Select the checkboxes in the row of the result sets that you want to remove from the project, then
click Process Selected4Remove from Project.

Reanalyze a run
You can reanalyze a run to correct a setup error such as a default reference alignment or an assigned
barcode, or to optimize analysis parameters.
Torrent Suite™ Software provides two ways to change the options used to analyze sequencing data.
If you want to change the options for the results of a sequencing run one time, you can change the
options in the run report, then immediately reanalyze the data. If you want to change the run report for
all subsequent reanalysis runs, you can edit the run report and save the updated report.

1. In the Data tab, click Completed Runs & Reports.

2. Search, filter, or sort the list to find your run report of interest. For more information, see “Search
for a run report” on page 93.

3. Do one of the following:

• In Table View mode, in the row of the run of interest, click (Actions)4Reanalyze.
• Alternatively, switch to List View mode, find your run of interest, then click Reanalyze.

124 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Reanalyze a run 6

4. In the menu on the left, click Reanalyze Run, enter a Report Name for the new run, then select
from the available options.
Option Description
Thumbnail only Select to reanalyze only the thumbnail report. This option is available only for Ion
S5™ System and Ion GeneStudio™ S5 Systems data.
Start reanalysis • Select Signal Processing to reanalyze from DAT files.
from The analysis does not use the Use data from the previous result option but
reprocesses from the DAT files. You can also use Analysis and Base Calling
options.
• Select Base Calling (default) to reanalyze from 1.WELLS files.
The analysis uses the Use data from the previous result or Base Calling
options but reprocesses from the 1.WELLS file. The analysis does not use the
Analysis Parameters option.

Use data from Select the previous result if more than one result is available. This option applies
previous result only when starting reanalysis from the basecalling step.
Analysis Use the default analysis parameters or click Custom to select the analysis
Parameters parameters.
For more information, see “Copy an analysis parameter set” on page 61.

5. (Optional) In the menu on the left, click Analysis Options, then set the options as needed.
Option Description
Library Key The sequence that is used to identify library reads.
TF Key The sequence that is used to identify test fragment reads.
3′ Adapter The sequence of the 3′ Adapter that is used.
Mark as Duplicate Reads Select to have PCR duplicates flagged in the BAM file.
Base Calibration Mode Base calibration mode allows for empirical alignments to influence flow
signals to achieve better homopolymer calibration to improve overall
accuracy.
Enable Realignment Select to use an optional analysis step to adjust the alignment, primarily in
the CIGAR string.

6. (Optional) Set the reference and barcoding options.

a. In the menu on the left, click Reference & Barcoding, then click Edit Run Plan.

b. On the Edit Run Plan screen, set the default options as needed.

c. Click Update Run to return to the reanalyze setup screen to select plugins to use in the
analysis.

d. If you do not need to return to the setup screen to change the plugins, click Update Run and
Reanalyze.

Torrent Suite™ Software 5.18 User Guide 125

 Chapter 6 Review and manage run reports
6 Edit a run report

7. (Optional) In the menu on the left, click Plugins.

a. Select the plugin to include in the reanalysis.

b. (If needed) Click the Configure link next to the plugin, scroll down to configure the plugin,
then click Save Plugin Settings.
For more information, see “Plugin configuration” on page 129, or the configuration topic
specific to the selected plugin.

c. Repeat steps a and b to include additional plugins in the reanalysis.

8. Click Start Analysis.

Change the default alignment reference

You can change the default alignment reference for a completed run, and then analyze the run again.

1. In the Data tab, click Completed Runs & Reports.

2. Use either Table View or List View, then find the run of interest.
For help finding an individual run, see “Search for a run report” on page 93.

3. In the row of the run that you want to reanalyze, click (Actions)4Reanalyze.

4. In the next screen, click Reference & Barcoding.

5. Click Edit Run Plan, change any settings as appropriate, then click either Update Run or Update
Run & Reanalyze.
For more information, see “Create a custom configuration for the variantCaller plugin” on page 196
and “Run the variantCaller plugin manually” on page 192.

Edit a run report

You can edit a completed run report to correct a setup error or optimize parameters for later reanalysis.
Preinstalled Planned Run templates cannot be edited. Create a copy of the preinstalled Plan Run
template, then make changes in the copy.

1. In the Data tab, click Completed Runs & Reports.

2. Search, filter, or sort the list to find the run report of interest.
For more information, see “Search for a run report” on page 93.

3. Open the Edit Run wizard.

• Use Table View, then click (Actions)4Edit in the row of the run report that you want to
edit.
• Use List View, then identify the run report of interest, then click Edit.

The Edit Run wizard opens to the Save screen.

126 Torrent Suite™ Software 5.18 User Guide

 Chapter 6 Review and manage run reports
Edit a run report 6

4. Click a step in the workflow bar to access the screens to make changes.
Workflow step Description
Ion Reporter Select the Ion Reporter Account, Sample Grouping, and Ion Reporter
Upload Options.
Research Application Select the Research Application and Target Technique.
Plugins Select the plugins to be included in the run.
Projects Select the Project for the run data.
Save Enter a Run Plan Name, then complete the information as needed.

5. To use the edited run report for the results of a sequencing one time, click Update Run &
Reanalyze to start the reanalysis immediately. Click, click Update Run to save the edits to the run
for future reanalysis.

Add or change barcoding for a completed run report

You can change barcoding when you set up a reanalysis, but you can also change barcoding for all
future reanalyses. Use the Edit option to:
• Add barcoding to a completed sequencing run.
• Change the barcode set for a completed sequencing run.
• Remove barcoding from a completed sequencing run.

In each case, you must reanalyze the run after editing the barcode information. These steps apply only
to completed runs.

1. In the Data tab, click Completed Runs & Reports.

2. In table or list view, navigate to your run of interest.

For help finding an individual run, see “Search for a run report” on page 93.

3. Click (Actions)4Edit in the row of the run.

4. In the Edit Run screen, edit the Run Plan Name if desired, make the appropriate barcoding
changes, then click either Update Run, or Update Run & Reanalyze.

Torrent Suite™ Software 5.18 User Guide 127

 Chapter 6 Review and manage run reports
6 Set the Completed Runs & Reports screen to automatically refresh

Set the Completed Runs & Reports screen to automatically

refresh
Use the automatic refresh feature to update the Completed Runs & Reports screen. When the
automatic refresh function is turned on (the default), the screen refreshes every 20 seconds. When
the automatic refresh function is turned off, the screen is a static display of information at the time you
opened the screen.

1. In the Data tab, on the Completed Runs & Reports screen, click Auto Refresh.

The button changes to Stop Refresh indicating that the automatic refresh function is turned off.

2. Click Stop Refresh to turn off the automatic refresh function.

128 Torrent Suite™ Software 5.18 User Guide

 7 Manage plugins for data analysis

■ Plugin configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129

■ Run a plugin manually from the sequencing run report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
■ Download a plugin report PDF . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
■ View plugin run status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
■ Preinstalled plugins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135
■ Plugins available on Connect . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174

You can expand the analysis capabilities of Torrent Suite™ Software with plugins that are preinstalled
with the software. Additional plugins can be downloaded and installed from Connect. The plugin results
are added to the report summary and can be used for a variety of purposes.

Plugin configuration
Some plugins have settings that can be configured by users. These plugins can be configured three
different ways.
• Global configuration: For plugins that can be configured globally, your administrator can change
the settings for all users of the software on a selected server. These default settings can be
overridden when setting up a Planned Run or Planned Run template, or when running the plugin
manually.
Some plugins require configuration. Plugins can fail if required settings are not configured. For
example, some plugins require that a file directory is configured to receive output files.
• Planned Run configuration: Some plugins can be configured when setting up a Planned Run or
Planned Run template. These options are available under Plugins in the Planned Run workflow bar.
Settings that are selected here override the global settings.
• Manual configuration: Some plugins can be configured when they are selected to run on the data
from a sequencing run after the run is complete. These plugins can be configured and run from the
Run Summary screen. Settings that are selected here override the global settings or any Planned
Run settings.

Torrent Suite™ Software 5.18 User Guide 129

 Chapter 7 Manage plugins for data analysis
7 Plugin configuration

Configure plugins globally

An administrator can change the global configuration of a plugin. The following preinstalled plugins can
be configured globally.
• DataExport plugin
• ERCC_Analysis plugin
• FileExporter plugin
• IonReporterUploader plugin
• RunTransfer plugin

Some plugins that cannot be configured globally can be configured when you set up a Planned Run or
a Planned Run template, or if you run the plugin after a sequencing run.

1. Click (Settings)4Plugins.

2. In the Manage column for the plugin of interest, click (Actions)4Configure.

The settings in the configuration dialog box vary depending on the plugin. See the plugin-specific
configuration topic for more information.

3. To save your changes, click Submit or Save Configuration.

Configure a plugin to run automatically

You can configure a plugin to run automatically by default. You can configure any plugin that is installed
in Torrent Suite™ Software, whether it is preinstalled or is downloaded from the Connect. If a plugin runs
automatically, you can still rerun the plugin manually after a sequencing run is completed. For details,
see “Run a plugin manually from the sequencing run report” on page 132.

• To set a plugin to run automatically after every run:

a. Click (Settings)4 Plugins.

130 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugin configuration 7

b. Ensure that the Enabled checkbox is selected next to the plugin name that you want to run
automatically by default.

You can click Enabled, Disabled, or Either to filter the list of plugins that is shown.

c. Select the Selected by Default checkbox next to the plugin name.

The plugin is now set to run after every sequencing run. You can deselect the Selected by Default
checkbox to disable automatic execution of the plugin.

• To set a plugin to run automatically as part of a Planned Run or Planned Run template (not required
if you previously set the plugin to run by default after every run):
a. Under the Plan tab, in the Templates screen, select an application in the left navigation menu.

b. Select an existing Planned Run template from the list. Alternatively, select Add New
Template, or Plan New Run to create a new Planned Run template or Planned Run.

c. Click Plugins in the workflow bar.

d. Select the plugins that you want to run automatically after a run.

Note: If Configure appears after selecting the plugin, be sure to click the link and configure
the plugin before starting the run. For detailed plugin configuration information for available
plugins, see “Preinstalled plugins” on page 135.

e. Click Next, or another tab in the workflow bar to make further changes to your Planned Run.

f. When all changes to the Planned Run have been made, click Plan in the workflow bar, then
click Plan Run.

The plugin is now set to run after every sequencing run that uses the Planned Run or Planned Run
template.

Torrent Suite™ Software 5.18 User Guide 131

 Chapter 7 Manage plugins for data analysis
7 Run a plugin manually from the sequencing run report

Run a plugin manually from the sequencing run report

After a sequencing run is complete, you may want to manually run a plugin to perform an analysis,
regardless of whether a plugin was run automatically after a run. You may need do this if you did not
configure the plugin in the run plan, to run an updated version of a plugin, or to run a previously used
plugin with a different configuration.

1. In the Data tab, click Completed Runs & Reports, then click the report name link for the
completed sequencing run.

2. Click Plugins4Select Plugins to Run, then click the name of the plugin that you want to run.

3. In the Configure Plugin screen, click the screen to configure the plugin if needed. If prompted,
select the desired plugin options, then click Submit to start the analysis.
For detailed plugin configuration information for the available plugins, see the configuration topic
for each plugin in “Preinstalled plugins” on page 135.
If the plugin does not require configuration, analysis starts immediately without a confirmation
screen.

Download a plugin report PDF

You can download a PDF file of a plugin report for a completed sequencing run.

1. In the Data tab, click Completed Runs & Reports, then click the report name link for your
completed sequencing run.

2. Click Download PDF 4Plugins PDF.

A detailed report of the plugins that are included the run report is downloaded through the browser
to a directory on your computer, based on the browser settings.

View plugin run status

After a plugin run is started, it is listed in the Plugin section of the run report. You can view the status
of a plugin run to determine whether the run has completed. You can also stop a plugin run in progress,
view a log for the plugin run, or delete the completed plugin report.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link for your
completed sequencing run.

2. In the left navigation menu, click the plugin name, or scroll to the Plugins section of the run report.
The plugin run status (Queued, Started, or Completed) is listed under the name of each plugin.

132 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
View plugin run status 7

Stop a plugin run

You can stop a plugin run that is in progress.

1. In the left navigation menu, click the name of the plugin you want to stop, or scroll to the
appropriate plugin section in the run report.

2. In the Data tab, click Completed Runs & Reports, then click the Report Name link for your
completed sequencing run.

3. In the left navigation menu, click Plugins, or the name of the plugin results to be deleted.

4. Click Stop to cancel a plugin run that has started.

Open a plugin log

If a Plugin report indicates that an error occurred during a plugin run, you can view a log that contains
details about the plugin run.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link for your
completed sequencing run.

2. In the left navigation menu, click Plugins, or the name of the plugin that has the log you want to
view.

3. Click View Log to the right of the plugin name.

The log for the plugin run opens.

Delete plugin results from a run report

You can delete plugin results from the Plugins section of the run report.

1. In the Data tab, click Completed Runs & Reports, then click the report name link for your
completed sequencing run.

2. In the left navigation menu, click Plugins, or the name of the plugin results that you want to delete.

3. Click Delete to the right of the plugin name.

The plugin results are deleted from the run report.

Torrent Suite™ Software 5.18 User Guide 133

 Chapter 7 Manage plugins for data analysis
7 View plugin run status

Rescan a plugin
If you uninstalled and reinstalled a plugin, you can rescan the plugin to ensure that all files from the
previous installation were removed. When you rescan a plugin, the files for the plugin are updated with
any changes.
You can also rescan the output files from the list of reports when you view the usage for a plugin.

1. Click (Settings)4Plugins. The installed plugins are listed.

2. Click Actions4Rescan in the row of the plugin.

You cannot complete other operations in Torrent Suite™ Software until the rescan is complete.

134 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Preinstalled plugins
The following table lists and describes the plugins that are preinstalled with Torrent Suite™ Software.

Plugin name Description

ampliSeqRNA plugin Generates statistics, downloadable data files, and interactive

visualizations that represent targeted RNA transcripts for sequencing
runs that use the Ion AmpliSeq™ Transcriptome Human Gene
Expression Kit or Ion AmpliSeq™ RNA panels.

AssemblerSPAdes plugin Performs an initial level analysis on assembly and provides metrics.
The plugin is ideal for genomes less than 50 Mb in size.

coverageAnalysis plugin Generates statistics and graphs to describe the level of sequence
coverage that is produced for targeted genomic regions.

DataExport plugin Exports data from a sequencing run to an external hard drive or a
removable media, such as a USB drive.

ERCC_Analysis plugin Indicates whether a problem exists with library preparation or

sequencing for runs that use the ERCC RNA Spike‑In Mix.

FieldSupport plugin Provides assistance with technical support. Enable and run this plugin
only under the guidance of Thermo Fisher Scientific Technical Support.
If you have questions about this plugin, contact your local Field Service
Engineer or Technical Support.

FileExporter plugin Customizes the output file names of an analysis run. This plugin allows
you to rename output files. Also generates a FASTQ format file of
the analysis output, renames variantCaller plugin output files (when
available), and compresses output files.

FilterDuplicates plugin Removes duplicate reads and creates BAM files that do not contain the
duplicate reads.

immuneResponseRNA plugin Quantifies gene expression levels for the Oncomine™ Immune
Response Research Assay.

IonReporterUploader plugin Transfers run results files to Ion Reporter™ Software.

For details, see Chapter 9, “Integration with Ion Reporter™ Software”.

molecular Coverage Analysis plugin Generates statistics, downloadable data files, and interactive
visualization of molecular coverage over targeted regions of the
reference genome.

PGxAnalysis plugin For use with the Ion AmpliSeq™ Pharmacogenomics Research Panel,
which is a targeted gene panel that allows the interrogation of
pharmacogenomics variants in samples for genotyping and CYP2D6
copy number detection.

RunTransfer plugin Transfers the signal processing output of a completed sequencing run
from one Ion Torrent™ Server to another Ion Torrent™ Server, then runs
an analysis of the transferred files on the receiving Ion Torrent™ Server.

Torrent Suite™ Software 5.18 User Guide 135

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

(continued)

Plugin name Description

sampleID plugin This plugin produces an identification code (sampleID) for each
barcode in a sample.

variantCaller plugin Calls single-nucleotide polymorphisms (SNPs), multinucleotide

polymorphisms (MNPs), insertions, deletions (INDELs), and block
substitutions in a sample across a reference or within a targeted subset
of that reference.

ampliSeqRNA plugin
The ampliSeqRNA plugin is used with the Ion AmpliSeq™ Transcriptome Human Gene Expression Kit,
Ion AmpliSeq™ Transcriptome Mouse Gene Expression Kit, or Ion AmpliSeq™ RNA panels. The plugin
generates statistics, downloadable data files, and interactive visualizations that represent targeted RNA
transcripts.
Use the ampliSeqRNA plugin on runs that are aligned to the human or mouse transcriptome references
and appropriate target regions files listed below. For more information on the references, see “Import a
preloaded reference sequence file” on page 248 and for more information on target regions files, see
“View and manage target regions files” on page 256.

Reference Target Regions file Notes

hg19_AmpliSeq_Transcriptome_V1 hg19_AmpliSeq_Transcriptome_v1 The most up-to-date annotations

.2 [1] .2 are included in the panel files
available from AmpliSeq.com.
For more information, see the Ion
AmpliSeq™ Transcriptome Human
Gene Expression Kit User Guide
(Pub. No. MAN0010742).

AmpliSeq_Mouse_Transcriptome_ AmpliSeq_Mouse_Transcriptome_ The most up-to-date annotations

V1 v1 are included in the panel files
available from AmpliSeq.com.
For more information, see the Ion
AmpliSeq™ Transcriptome Mouse
Gene Expression Kit User Guide
(Pub. No. MAN0017343).
[1] Previous versions (hg19_AmpliSeq_Transcriptome_ERCC_V1 and hg19_AmpliSeq_Transcriptome_V1.1) are still supported for those
users who have already performed experiments with the older reference files.

136 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

ampliSeqRNA plugin configuration

The configuration options for the ampliSeqRNA plugin are described in the following table. This plugin
cannot be configured globally.
You can change the Reference Genome used in the plugin run, for example from hg19 to mm10, if you
edit the run report, then reanalyze the raw reads. For details, see “Edit a run report” on page 126.
Alternatively, you can reanalyze the run. For details, see “Reanalyze a run” on page 124.

Setting Description

The following settings can be configured when you select the ampliSeqRNA plugin as part of a Planned
Run or Planned Run template.

Filter Barcodes Select this checkbox to remove whole barcodes from subsequent
analyses if they have a relatively low number of reads, such as those
that can result from barcode contamination. A warning appears in the
barcode summary report if any barcodes were discounted from the
analysis. This setting is ignored for runs not employing barcodes.
Typically, this option is not needed if your Planned Run specifies which
samples to associate with specific barcodes.

ERCC Tracking Select this checkbox if your Ion AmpliSeq™ RNA targets (amplicons)
were spiked with ERCC tracking targets.

Setting Description

The following settings can be configured when you run the ampliSeqRNA plugin manually.

Library Type ampliSeqRNA is selected automatically and is currently the only library
type that the ampliSeqRNA plugin is designed to work with.
If the Planned Run specified a different application, a message warns
you that the plugin may not be appropriate for the run.

Targeted Regions This is set by default to the target regions file used in the Planned Run.
You can override the default setting that each barcode uses. This might
be useful to specify a subset of genes of interest, or to correct the
original Planned Run.

Filter Barcodes Select this checkbox to remove whole barcodes from subsequent
analyses.
Typically, this option is not needed if your Planned Run specifies which
samples to associate with specific barcodes.

ERCC Tracking Select this checkbox if your Ion AmpliSeq™ RNA targets (amplicons)
are spiked with ERCC tracking targets.

Torrent Suite™ Software 5.18 User Guide 137

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

Review ampliSeqRNA plugin results

The ampliSeqRNA plugin generates an initial summary report that lists the samples, the number of
mapped reads, the percent of valid reads, and the percent of targets detected. A series of log2
reads-per-million (RPM) pair correlation plots are included for rapid correlation analysis. Microsoft™
Excel™-compatible reports are also generated, including differential expression tables. Additional details
about read coverage are also provided on a per-barcode basis, along with a list of gene annotations for
each sequenced region.
After the sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, locate the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click ampliSeqRNA to view the plugin results.

• Click the ampliSeqRNA.html link to open the ampliSeqRNA Report – Barcode Summary for
all barcodes.
• In the barcode table, click individual barcode names to see the results for an individual
barcode.
• Click the Distribution Plots, Correlation Heatmap, Correlation Plot, and Gene Heatmap
tabs to review the data graphically.

Graphical report Description

Distribution Plots
Reads Alignment Summary A graphical summary of the number of mapped and unmapped
reads across barcodes, as reported in the Barcode Summary
table.

138 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

(continued)
Graphical report Description
Distribution of Gene Reads Distribution of genes across barcodes showing the frequency of
numbers of genes having similar log10 read counts. All curves
are plotted on the same axis scale. The counts data are fitted to
a Gaussian kernel using the default R 'density' function.
Correlation Heatmap A heatmap of Spearman correlation r-values for comparing log2
RPM reads pair correlation barcodes, with dendrogram reflecting
ordering of barcodes as being most similar by these values.
Correlation Plot
Barcode read pair correlation Lower panels show log2(RPM+1) values plotted for each pair
plot of barcodes, with linear least squares regression line overlaid
and line slope reported. Upper panels show Pearson correlation
r-values for the regression line. Diagonal panels show the
frequency density plot for the individual log(RPM+1) values for
each barcode. (If only one barcode has reads, a density plot is
displayed.) Click the plot to open an expanded view.
Gene Heatmap
Gene Representation Heatmap Displays 250 genes showing the most variation in representation
across barcodes as measured by the coefficient of variation
(CV) of normalized read counts for genes that have at least one
barcode with at least 100 RPM reads, plotted using log10 of
those counts. For this plot, barcodes are omitted if they have
<105 total reads.
• Click the links at the bottom of the report to download associated report files.

ampliSeqRNA plugin reports

The following ampliSeqRNA plugin reports are available for download from the results screen as tab-
delimited text files, which are compatible with Microsoft™ Excel™ or similar applications.

Report Description

Barcode Summary Report A table listing each barcode sample name, total reads, aligned reads,
and percent aligned.

Absolute Reads Matrix A table listing absolute reads for the genes found on each barcode.

Absolute Normalized Reads Matrix A table listing absolute normalized reads for the genes found on each
barcode.

CHP files normalized by RPM A file format designed for use with Applied Biosystems™ microarray
software applications to produce additional reports.

Differential Expression for Barcode A pop-up window that allows you to compare two barcodes. You can
Pair set a threshold for minimum read count and exclude targets from the
differential expression table. Differential expression for each target that
is represented as the log2 of the ratio of RPM reads of the experiment
barcode to the control barcode.

Torrent Suite™ Software 5.18 User Guide 139

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

AssemblerSPAdes plugin
The AssemblerSPAdes plugin is a de Bruijn graph assembler. The plugin breaks sequence reads into
kmers of defined length, makes a connected graph, and traverses through that graph to produce
contigs. The plugin report includes basic analysis metrics such as number of contigs, N50, length of
the longest contig, and a downloadable FASTA file of the assembled sequences. The plugin assumes
a haploid genome, and is ideal for genomes under 50 Mb in size. For multiploid genomes, reads from
different copies of a chromosome tend to assemble into different contigs.
For de novo assembly, use a Generic Sequencing application Planned Run template for the Torrent
Suite™ Software analysis.

AssemblerSPAdes plugin configuration

The configuration options for the AssemblerSPAdes plugin are described in the following table. These
settings can be configured only when you select this plugin to run manually from the Run Summary
screen. After you select the plugin, click Advanced Settings + to display these options.

Setting Description

Fraction of reads to use The default setting of 100% is recommended, and handles most
changes in coverage. If you enter a value of less than 100%, the reads
are randomly sub-sampled.

Only process barcodes By default, the plugin processes all barcodes in the analysis
and produces a separate set of contigs for each barcode.
To limit plugin analysis to only specific barcodes, list those
barcodes here (separated by commas and no spaces. For example,
IonXpress_001,IonXpress_002,IonXpress_003).

Skip barcodes with fewer than __ The software ignores barcodes whose number of reads do not meet
reads the threshold specified here. The default threshold is 500 reads. This
setting is intended to filter out barcode classification problems with
noisy data.

RAM to allocate The plugin attempts to allocate the specified amount of RAM when it
runs. The default is 32 GB. With larger amounts of memory, the plugin
runs faster. With less memory, the plugin takes longer to complete.
The plugin crashes if the memory allocation fails.

SPAdes version Select the version that you prefer. Select the default of 3.1.0 if you are
not sure.

140 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

(continued)

Setting Description

Assembly settings Set this menu as follows:

• Uniform coverage (default setting)—This is used for data with
average GC (35–68%) content. This setting uses the default
kmers.
• Non-uniform coverage—choose this setting for data with low GC (
<35%) content. This setting uses the default kmers.
• Highly non-uniform coverage—choose this setting for data with
high GC (>68%) content. This setting uses a different set of kmers.
• Custom—choose this setting to enter user-defined K and Mode
settings.
– K—enter values (separated by commas, no spaces) to
determine the size and number of kmers to be used in
the analysis. Enter short kmer values to improve error-prone
or low-coverage regions, long kmers to resolve repetitive
regions, or a combination of kmer values to account for both
situations.
Note: Each additional kmer adds a fixed amount to the
processing time (for example, using 2 kmers takes twice as
long as 1 kmer).
– Mode—Select Multi-cell (default) for data with average or low
GC content. Select Single-cell for data with high GC (>68%)
content.

Run read correction before doing This setting is enabled by default, which is recommended.
assembly

Skip assembly if previous results Select this checkbox to detect whether assembly results already exist,
exist and you do not want to overwrite the results.

Torrent Suite™ Software 5.18 User Guide 141

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

Review AssemblerSPAdes plugin results

After the sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, locate the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click AssemblerSPAdes to view the plugin results.

The plugin results show assembly statistics for the selected barcode.
• To show assembly statistics for an individual barcode, select a barcode in the View Results
menu.
• To download results for all barcodes used in the run, click Downloads.
• To download a FASTA file of the assembled contigs, click Assembled Contigs (FASTA).
• To download a FASTA file of the assembled scaffolds, click Assembled Scaffolds (FASTA).
• To download a copy of the assembly summary statistics, click Assembly Statistics.

142 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

You can also click SPAdes Log (TXT) to view the execution file for the AssemblerSPAdes plugin, or
click QUAST report (HTML) to view a QUAST report.

coverageAnalysis plugin
Use the coverageAnalysis plugin to view statistics and graphs that describe the level of sequence
coverage produced for targeted genomic regions. The results in the Summary screen for a run analyzed
with the plugin vary based on the library type that you select when you configure the plugin. You can
export some charts as graphics, such as the Amplicon and Reference Coverage charts.

coverageAnalysis plugin configuration

The coverageAnalysis plugin uses the following settings.

Setting Description

The following settings are available for all library types.

Reference Genome The reference genome selected in the Planned Run.

Library Type The default value is the library type selected in the Planned Run and can be changed
only if the plugin is run manually. If you change the library type, a different report is
generated.

Targeted Regions The targeted regions are selected in the Planned Run, and can be changed only after
the run is complete if the plugin is run manually. Target regions can be overwritten by
the specific barcode targets.
Select the targeted regions file from the list. For whole genome and Ion Total RNA-Seq
sequencing runs, you typically select None.

Barcode-specific Targets This option is available only when the coverageAnalysis plugin is run manually.
Select the checkbox to assign specific target region files to individual barcodes.
1. Select a specific barcode.
2. Select the specific Target Regions file to associate with the selected barcode.
3. Click Add.
4. Repeat steps 1 through 3 to associate additional barcodes with specific Target
Region files.

Alternatively, you can copy and paste the barcode/target file pairs manually.
Barcodes without a Target Region specified above assume the default target specified
by the Target Regions option.
For targeted applications, any barcode targets specifically set to None, or defaulting
to Target Regions set to None, are omitted from subsequent analysis.
When the Barcode-specific Targets option is deselected, all barcodes use the targets
specified by the Target Regions, even if barcode-specific targets are listed.

The following are advanced options.

Minimum Aligned Length Specify the minimum aligned length that is required to ensure that the read is included
in an analysis.

Torrent Suite™ Software 5.18 User Guide 143

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

(continued)

Setting Description

Minimum Mapping Quality Specify a minimum value that reads must exceed to be included in the analysis.

Tier 1 Coverage Depth Specify the first-tier coverage depth at which percentage of target coverage is
reported. This value must be at least 2, because the coverage depth output is always
specified at 1x read depth. The default value of 20 means that the percentage of
targets, total base targets, and/or individual target bases with at least 20 reads is
reported.

Tier 2 Coverage Depth Specify the second-tier coverage depth at which percentage of target coverage is
reported. This value must be greater than the value used for the first-tier coverage.
The default value of 100 means that the percentage of targets, total target bases,
and/or individual target bases with at least 100 reads is reported.

Tier 3 Coverage Depth Specify the third-tier coverage depth at which percentage of target coverage is
reported. This value must be greater that the value used for the second-tier coverage.
The default value of 500 means that the percentage of targets, total target bases,
and/or individual target bases with at least 500 reads is reported.

The following settings are available only with specific library types.

Uniquely Mapped Reads Select this option to analyze only reads that are mapped to a unique location in the
reference. Reads that are non-uniquely mapped can have equally well-aligned reads
that are mapped to multiple locations and are typically mapped randomly to one.

Sample Tracking The Ion AmpliSeq™ Sample ID Panel is a companion panel of 9 primer pairs that can
be added to any Ion AmpliSeq™ human gDNA panel during target amplification to
generate a unique identification tag for research samples. Select this checkbox if you
added the Ion AmpliSeq™ Sample ID Panel to your library.

Target Padding Enter a number to pad the target by the number of bases entered. If you do not enter
a number, the default of 0 is used.

Non-duplicate Reads Select the checkbox to avoid duplicates. The analysis must have included alignments
with Mark Duplicates enabled.

Review coverageAnalysis plugin results

The coverageAnalysis plugin generates a Coverage Analysis Report. This report includes read statistics
and several charts. The statistics and charts that are presented depend on the library type for the
analysis.
The report summary lists the barcodes, the samples, the number of mapped reads, the percentage
of on target reads, mean base coverage depth, and base coverage uniformity. Microsoft™ Excel™-
compatible reports are also generated, including differential expression tables. Additional details
regarding read coverage are also provided on a per-barcode basis, along with a list of gene annotations
for each sequenced region.

144 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

You can download statistics files and the aligned reads BAM file from the file links at the bottom of the
Coverage Analysis Report. After the sequencing run completes, review the plugin results in the report
summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click coverageAnalysis to view the plugin summary.
A summary table of the coverage analysis, by barcode, is included in the coverageAnalysis
summary pane.

4. In the coverageAnalysis barcode summary, in the Barcode Name column, click a link to open a
detailed Coverage Analysis Report for that barcoded sample.
Alternatively, click the coverageAnalysis.html link to open the summary table for all barcodes in a
new window.

5. In the Coverage Analysis Report, review the plugin results. Click the links at the bottom of
the Coverage Analysis Report to download associated statistics and summary files for each
barcoded sample in the run.

Reads statistics
General statistics

Statistic Description

Number of mapped reads The total number of reads mapped to the reference genome.

Percent reads on target The percentage of filtered reads mapped to any targeted region relative to all reads
mapped to the reference. If no target regions file is specified, this value will be the
percentage of reads passing uniquely mapped and/or nonduplicate filters, or 100%
if no filters were specified. A read is considered on target if at least one aligned
base overlaps at least one target region. A read that overlaps a targeted region but
where only flanking sequence is aligned, for example, due to poor matching of 5'
bases of the read, is not counted.

Amplicon read coverage statistics

The following statistics describe the reads that are assigned to specific amplicons. Each sequence
read is assigned to exactly one of the amplicons specified by the targets file. If a read spans multiple
amplicon targets, the target region that the reads covers most is assigned. In the event of a tie, the
target that is the closest to the 3' end is assigned.

Statistic Description

Number of amplicons The number of amplicons that is specified in the target regions file.

Percent assigned amplicon The percentage of reads that were assigned to individual amplicons relative to all
reads reads mapped to the reference. A read is assigned to a particular (inner) amplicon
region if any aligned bases overlap that region. If a read might be associated with
multiple amplicons, it is assigned to the amplicon region that has the greatest
overlap of aligned sequence.

Torrent Suite™ Software 5.18 User Guide 145

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

(continued)

Statistic Description

Average reads per amplicon The average number of reads assigned to amplicons.

Uniformity of amplicon The percentage of amplicons that had at least 20% of the average number of reads
coverage per amplicon. Cumulative coverage is linearly interpolated between nearest integer
read depth counts.

Amplicons with at least N The percentage of all amplicons that had at least N reads.
reads

Amplicons with no strand The percentage of all amplicons that did not show a bias towards forward or
bias reverse strand read alignments. An individual amplicon has read bias if it has ≥10
reads and the percentage of forward or reverse reads to total reads is greater than
70%. Amplicons with <10 reads are considered to have no strand bias.

Amplicons reading end-to- The percentage of all amplicons that were considered to have a sufficient
end proportion of assigned reads (70%) that covered the whole amplicon target from
'end‑to‑end'. To allow for error, the effective ends of the amplicon region for read
alignment are within 2 bases of the actual ends of the region.

Amplicon base composition A number that represents the proportion of amplicons showing low representation
bias (<0.2x mean reads) in the lower and/or upper quartiles of amplicons ordered by
increasing G/C base pair content of their insert sequences. The value is relative
to that in the center 50th percentile of amplicons and weighted by the standard
deviation of representation over all amplicons. An RMS (root mean square) value
is used so that a bias greater in either upper or lower quartiles produces a larger
value than a mean bias seen more equally in both outer quartiles. The value is 0
if the uniformity of amplicon coverage metric is 100%, however, the value is not
necessarily high at lower amplicon uniformity.

Target base coverage statistics

The following statistics describe the targeted base reads of the reference. A base covered by multiple
target regions is counted only once per sequencing read.

Statistic Description

Bases in target regions The total number of bases in all specified target regions of the reference.

Percent base reads on target The percent of all bases covered by reads aligned to the reference that covered
bases in target regions. Clipped bases, deletions, and insertions (relative to the
reference) are not included in this percentage.
If no specific target regions were specified, the whole genome is the targeted
regions.

Average base coverage The average number of reads of all targeted reference bases. This is the total
depth number of base reads on target divided by the number of targeted bases, and
therefore includes any bases that had no coverage.

146 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

(continued)

Statistic Description

Uniformity of base coverage The percentage of bases in all targeted regions (or whole genome) that is covered
by at least 20% of the average base coverage depth reads. Cumulative coverage is
linearly interpolated between nearest integer base read depths.

Target base coverage at Nx The percentage of target bases covered by at least N reads.

Target bases with no strand The percentage of all target bases that did not show a bias toward forward or
bias reverse strand read alignments. An individual target base is considered to have read
bias if it has ≥10 reads and the percentage of forward or reverse reads to total
reads is greater than 70%. Target bases with <10 reads are considered to have no
strand bias.

Percent end‑to‑end reads The percentage of on‑target reads that fully cover their assigned amplicon (insert)
from 'end‑to‑end'. To allow for error, the effective ends of the amplicon region for
read alignment are within 2 bases of the actual ends of the region.

Example charts generated by the coverageAnalysis plugin

Many of the charts in the detailed Coverage Analysis Report include a Plot menu that allows you to
change characteristics of the chart. For example, you can show both strands (see callout 3 in Figure 5).
The button (in the top right corner of a chart) opens the chart Viewing Options panel. The button
opens a description of the chart.

Figure 1 Representative Depth of Coverage Chart

The Depth of Coverage Chart shows the distribution of targeted base coverage. The X‑axis represents the base read
depth. The left Y-axis represents the number of reads at a given base read depth or a range (bin) of base read depths, as
a percentage of the total number of base reads. The right Y-axis represents the cumulative count of the number of reads
at a given read depth or greater, as a percentage of the total number of reads. The individual orange bars represent the
percentage of reads in the specific range of base read depths. The blue curve measures the cumulative reads at a given
base read depth or greater. If your analysis includes a regions of interest file, this chart reflects only target regions (reads
that fall within a region of interest).

In most charts, you can click a data point to open a detail pane for that data. For example, in the
Depth of Coverage Chart in Figure 1, click an individual orange bar to open the detail pane for bases
within a specific range of base read depths. Click a point on the blue curve to open the detail pane for
cumulative bases at that base read depth or greater. For example detail panes, see Figure 2. Similarly,

Torrent Suite™ Software 5.18 User Guide 147

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

you can click any point or bar within the Amplicon Coverage chart to view details for each amplicon
coverage bin (see Figure 4).

Figure 2 Example detail panes

Figure 3 Representation Plots

Use the Display list to view different amplicon representation plots. This figure shows an example Pass/Fail vs. Target G/C
Content plot.

148 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Figure 4 Example Amplicon Coverage Chart

The Amplicon Coverage charts summarize the amplicon coverage results. Several plots views are available. The X‑axis in
all plots represents individual amplicons. The left Y‑axis in all plots represents assigned reads (on a base 10 log scale).
Use the Plot and Overlay lists to customize the chart view. The right Y‑axis varies depending on the plot view that is
selected from the Overlay dropdown list. Click on any bar or any point on the chart to view the detail pane for that data.

1 Example Total Reads plot with a Target GC percentage overlay

2 Click on a bar to open the detail pane for the specific amplicon. Click View in Reference Coverage Chart to zoom
in on the amplicon in the Reference Coverage Chart (see callout 3 in Figure 5).

Torrent Suite™ Software 5.18 User Guide 149

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

Figure 5 Example Reference Coverage Chart

The Reference Coverage Chart is an overlay of where target regions are defined and overlap on the reference. The X‑axis
represents the target region chromosomal position. The Y‑axis represents the Base Read Depth.

1 Example Total Base Reads plot with Viewing Options panel expanded. The plot is zoomed in on a specific
chromosomal region. Click a yellow bar (top of the chart) to open the detail pane for a specific amplicon in the
Amplicon Coverage Chart (see callout 2 in Figure 4).
2 Example Total Base Reads plot where a chromosomal region has multiple targets. In the Resolve Multiple Targets
pane, click to zoom in on the region, or click one of the links to open the detail pane for the specific amplicon in
the Amplicon Coverage Chart.
3 Example Strand Base Reads plot that is zoomed in on one specific amplicon. Click the yellow box to open the detail
pane for the specific amplicon in the Amplicon Coverage Chart.

150 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Output files generated by the coverageAnalysis plugin

You can download coverageAnalysis plugin results files from links that are contained in the File Links
section.
Sometimes the file name can be too long to open in applications such as Microsoft™ Excel™. To resolve
this problem, right‑click the file and click Save As to rename the downloaded file.
Click (Help) next to the file to open a description of the file.
The following is an example of the content of a results file that is generated by the coverageAnalysis
plugin.
The list of files depends on the application type selected.

File Description

Coverage A summary of the statistics presented in the tables at the top of the plugin report. The first line
statistics is the title. Each subsequent line is either blank or contains a statistic title followed by a colon (:)
summary and its value.

Base depth of Coverage summary data used to create the Depth of Coverage Chart. This file contains the
coverage following fields:
• read_depth: the depth at which a (targeted) reference base has been read.
• base_cov: the number of times any base was read (covered) at this depth.
• base_cum_cov: the cumulative number of reads (coverage) at this read depth or greater.
• norm_read_depth: the normalized read depth (depth divided by average base read
depth).
• pc_base_cum_cov: same as base_cum_cov but represented as a percentage of the
total base reads.

Torrent Suite™ Software 5.18 User Guide 151

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

(continued)

File Description

Amplicon Coverage summary data used to create the Amplicon Coverage Chart. This file contains these
coverage fields:
summary • contig_id: the name of the chromosome or contig of the reference for this amplicon.
• contig_srt: the start location of the amplicon target region.
This coordinate is 1-based, unlike the corresponding 0-based coordinate in the original
targets BED file.
• contig_end: the last base coordinate of this amplicon target region.
Note: The length of the amplicon target is given as tlen = (contig_end - contig_srt + 1).
• region_id: the ID for this amplicon as given as the 4th column of the targets BED file.
• gene_id: the gene symbol as given as the last field of the targets BED file.
• gc_count: the number of G and C bases in the target region. %GC = 100% * gc / tlen.
• overlaps: the number of times this target was overlapped by any read by at least one
base.
Individual reads might overlap multiple amplicons where the amplicon regions themselves
overlap.
• fwd_e2e: the number of assigned forward strand reads that read from one end of the
amplicon region to the other end.
• rev_e2e: the number of assigned reverse strand reads that read from one end of the
amplicon region to the other end.
• total_reads: the total number of reads assigned to this amplicon. This value is the sum
of fwd_reads and rev_reads and is the field that rows of this file are ordered by (then
by contig id, srt and end).
• fwd_reads: the number of forward strand reads assigned to this amplicon.
• rev_reads: the number of reverse strand reads assigned to this amplicon.
• cov20x: the number of bases of the amplicon target that had at least 20 reads.
• cov100x: the number of bases of the amplicon target that had at least 100 reads.
• cov500x: the number of bases of the amplicon target that had at least 500 reads.

Chromosome Base reads per chromosome summary data used to create the default view of the Reference
base coverage Coverage Chart. This file contains these fields:
summary • chrom: the name of the chromosome or contig of the reference.
• start: the coordinate of the first base in this chromosome. This is always 1.
• end: the coordinate of the last base of this chromosome. Also its length in bases.
• fwd_reads: the total number of forward strand base reads for the chromosome.
• rev_reads: the total number reverse strand base reads for the chromosome.
• fwd_ontrg (if present): the total number of forward strand base reads that were in at least
one target region.
• seq_reads: the total sequencing (whole) reads that are mapped to individual contigs.

152 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

(continued)

File Description

Aligned reads Contains all aligned reads that are used to generate this report, in BAM format. This is the same
BAM file file that can be downloaded from the main report (for the specific barcode). See the current
SAM tools documentation for more file format information.

Aligned reads BAI Binary BAM index file as required by some analysis tools and alignment viewers such as IGV.
file This is the same file that can be downloaded from the main report (for the specific barcode).

DataExport plugin
Use the DataExport plugin to export data from a sequencing run to a network drive, an external hard
drive, or a removable media device, such as a USB drive. The exported data can be used to create
backups, or to quickly transfer files to another system. When you configure the plugin, you select which
file categories from the run are included in the export.
Before you use the DataExport plugin, a software administrator must configure the path to the directory
that is used for the export. The Destination Path to the external drive is then available in the global
settings for the plugin.

DataExport plugin configuration

The DataExport plugin can be configured to set the destination path of the exported files, and to specify
the file types to be exported.
The configuration options for the DataExport plugin are described in the following table:

Setting Description

Destination Path Designates the location of the network drive, external hard drive or removable
media device where the files are exported to.

Signal Processing Input Exports DAT files.

Basecalling Input Exports WELLS files.

Output Files Exports all output files, including BAM files, reports, and analysis files.

Intermediate Files Exports files used for troubleshooting by qualified system engineers.

Review DataExport plugin results

After the sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the Summary, click DataExport to view the plugin summary.

Torrent Suite™ Software 5.18 User Guide 153

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

After the export is complete, the report is available in the DataExport pane. The following parameters
are shown.

Parameter Description

FILE CATEGORIES Lists the categories for the file types that are included in the export.

DESTINATION Location where the files are exported to after the plugin is run.

STATUS Shows the status of the file transfer.

ERCC_Analysis plugin
Use the ERCC_Analysis plugin to determine if a problem exists with either the library preparation or
the sequencing instrument run. The ERCC_Analysis plugin determines the relative abundance of the
actual versus expected number of ERCC transcript reads for sequencing runs that include ERCC RNA
Spike-in Controls.
The ERCC_Analysis plugin takes approximately 2–3 minutes to complete for sequencing runs with
≤1,000,000 total reads, and 1–2 minutes longer for each additional million total reads. For example, a
run with 5 million total reads can take 10–15 minutes. If Torrent Suite™ Software is busy performing
additional processing functions, plugin run times are longer.
You can configure the ERCC_Analysis plugin to run automatically. However, automatic execution is not
recommended, unless most analyses on the Ion Torrent™ Server include ERCC controls.

ERCC_Analysis plugin configuration

The configuration options for the ERCC_Analysis plugin are described in the following table.

Setting Description

Use only forward strand reads Available when manually running the plugin.

Passing R-squared value (Optional) To change the R-squared value to set a default value for
the summary report screen, enter a value between 0 and 1 as your
minimum acceptable R-squared value (a lower value is indicated by a
red light in the summary report).
The value you enter on the ERCC Plugin Configuration screen is used
when the plugin is auto-run and when the plugin is manually launched
without entering a value. You can override this value on a per-run basis
when the plugin is manually launched.

Minimum transcript counts The minimum number of reads that an ERCC transcript must have to
be included in the analysis.

ERCC pool used Select the ERCC transcript pool used when preparing the library.

154 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

(continued)

Setting Description

Barcodes of interest
IMPORTANT! If you configure a Planned Run or Planned Run
template to execute the ERCC_Analysis plugin, and your experiment
uses the Ion Total RNA-Seq Kit v2, you must select a barcode option:

· Select IonXpressRNA if your experiment uses this kit.

· Select RNA_Barcode_None if your experiment does not use a
barcode kit

Review the ERCC_Analysis plugin results

After the sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, locate the run of interest, then click the link Completed Runs & Reports screen,
click the report name to open.

3. In the left navigation menu of the EERC_Analysis screen, click ERCC_Analysis to view a
summary of the plugin analysis results.

4. (Optional) Click the ERCC_Analysis.html link to open the ERCC Analysis Report and view the
barcode summary and plugin analysis results.

Setting Description
Use only forward strand reads Indicates whether forward strand reads were used in the analysis.
Passing R-squared value The value entered on the ERCC Plugin Configuration screen.
Minimum transcript counts The minimum number of reads included in the analysis.
ERCC pool used The ERCC transcript pool used when preparing the library.

5. In Barcode Name, click the barcode name to open the ERCC Report to see the results for an
individual barcode.

Interpret the ERCC Dose Response plot

The axes of the ERCC Dose Response plot are log (base 2), with the raw read counts for each ERCC
transcript on the y-axis and the known relative concentration of the ERCC transcripts on the x-axis.
In the plot, the points are color-coded based on mapping quality. There is also a line of best fit, the
parameters (slope, y-intercept, and R‑squared value) of which are shown in tabular form to the right
of the graph (N = the number of points (ERCC transcripts) included in the regression analysis). Ideally,
the points all fall on a straight line. However, the raw counts and relative concentration should at least
correlate with a high R-squared (for example, ≥0.9) value. Although 92 transcripts are in the ERCC
mix, it is not expected that all 92 are detected. The number of transcripts detected depends on the
sequencing depth.

Torrent Suite™ Software 5.18 User Guide 155

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

View ERCC transcript details

You can look at the details of an ERCC transcript in two ways: by using the plot or by using the
transcript. To view all of details of a ERCC transcript, you can use both ways.

• Using the plot—Hover over a point in the ERCC Dose Response plot to display a popup window
that shows details regarding that transcript. Zoom in on the overlapping points on the plot to more
easily distinguish the points.
a. To zoom in on area of interest, click, drag the cursor over the area. Release the cursor when
the area of interest is highlighted.

b. Double‑click in the plot, or click Reset Zoom to zoom out to the full view of the ERCC Dose
Response plot.

Parameter Description
log2 relative ERCC The log (base 2) of the relative ERCC transcript concentration.
concentration
log2 ERCC counts The log (base 2) of the mapped reads to an ERCC transcript.
transcript The ERCC transcript identifier, including length in base pairs (bp).
reads The number of reads that map to the particular transcript.
mean mapping A Phred score of the probability that this read was aligned specifically versus any
quality other place in the reference. In practice it is based on the absolute and relative
alignment scores for the first two alternative mapping locations. The mapping
quality that is reported is based on mean base read quality (after trimming).
The points in the display are color coded based on the mapping quality.

156 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

• Using the transcript—Scroll to the transcript, then click the [+] next to the transcript name.

Parameter Description
Reads The number of reads that map to the transcript.
Coverage Depth The minimum and maximum number of reads covering bases in the transcript. If
coverage is 100%, the minimum value is > 0.
Coverage The number of base positions covered by at least one read. Also expressed as a
percentage of the full length.
Start Sites The number of base positions that are the start site for a read.
Unique Start Sites The number of base positions that have only one read starting at the position.
Coverage CV The coefficient of variation for coverage = average coverage / standard deviation
coverage for the entire transcript.

Definitions
This section defines terms used in the plugin output.
• Coverage Depth—The minimum and maximum number of reads covering bases in the transcript.
If coverage is 100%, the minimum value is >0.
• Coverage—The number of base positions covered by at least one read.
• Start Sites—The number of base positions that are the start site for a read.
• Unique Start Sites—The number of start sites that have only one read starting at the site.
• Coverage CV—The coefficient of variation for coverage = average coverage / stddev coverage for
the entire transcript.

ERCC resources
The External RNA Controls Consortium (ERCC) is hosted by the U.S. National Institute of Standards
and Technology.
For more information on ERCC RNA Spike-In Control Mixes (Cat. Nos. 4456739 and 4456740), see the
ERCC RNA Spike‑In Control Mixes User Guide (Pub. No. 4455352).
For more information on ERCC analysis, see the ERCC_Analysis Plugin User Bulletin
(Pub. No. 4479068).

FieldSupport plugin
The FieldSupport plugin is used for technical support purposes only. For details, contact Technical
Support or your Field Application Scientist.

IMPORTANT! Enable and run this plugin only when directed by Thermo Fisher Scientific Technical
Support or your local Field Service Engineer.

Torrent Suite™ Software 5.18 User Guide 157

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

FileExporter plugin
Use the FileExporter plugin to rename the output files from the Torrent Suite™ Software runs.
The plugin also offers the following options:
• Generates files of the analysis results that use BAM, VCF, XLS, or FASTQ formats.
• Renames variantCaller plugin output files (when available).
• Compresses the analysis results files.
• Provides links that allow you to download the results files.

Configure the FileExporter plugin

1. Select from the following options to choose the file types that you export:
Option Description
Include Select to generate a separate link for the file in the plugin results.
Archive Select Archive for each file type that you want to include in a compressed file. You can export
a standard compressed directory in a ZIP or tar.bz2 format.

For each option, you can choose to include or archive the following file types:

File types Description

BAM Native file format for data generated by Ion instruments.
Variant Call Format (VCF) File containing only the differences between the BAM file and a
reference file.
Variant Caller File (XLS) Microsoft™ Excel™ format of VCF.
FASTQ Text format of the nucleotides.

158 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

2. Name the file. Select one of the following:

• Select a unique file name by entering the desired name in the Custom Name text box.

• Create a name using parameters of the run. Drag and drop components from the selections
pane onto the name pane row. The naming options are in the blue boxes. The name appears
under Example Name.
• Select the delimiter that is used between metadata fields. Support delimiters are dot, dash,
and underscore (a naming pattern uses only one delimiter).

1 Name pane row

3. Click Save Configuration.

Review FileExporter plugin results

After the sequencing run completes, you can download the following files after you run the FileExporter
plugin from the report summary.
• Any of the Torrent Suite™ Software analysis output files that use BAM, VCF, XLS, or FASTQ formats.
• A compressed file that contains the analysis output files.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

Torrent Suite™ Software 5.18 User Guide 159

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

3. In the left navigation menu, click FileExporter to view the plugin summary.
BAM files load quickly, and you may see these files first in the list of links. The other file formats
take longer to download, so you may have to wait for the links to the VCF, XLS, and FASTQ
formats to appear.

4. Ensure that the status of the plugin run is Completed. If the status is not Completed or the
list of files does not include all the files that you selected when you configured the plugin, click
Plugins4Refresh plugins at the top of the Summary screen.

5. When the list contains the files that you want to download, click a file name link under Output
Files to download.

6. To review the parameters that were used for the files, click Show Parameters.

FilterDuplicates plugin
Use the FilterDuplicates plugin to remove duplicate reads from merged data after a run is completed.
The removed BAM files are saved in the FilterDuplicates directory. The original BAM files in the main
analysis directory are not modified.
The Mark as Duplicate Reads feature in the main analysis pipeline marks reads as duplicates but does
not remove them from the BAM files. Enable this feature in the Kits step of Planned Run creation.

Review FilterDuplicates plugin results

After the sequencing run completes, review the FilterDuplicates plugin results, and download the BAM
files with duplicate reads removed.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click FilterDuplicates to view the plugin summary.

4. In the FilterDuplicates section, click FilterDuplicates.html to open the BAM Files with Duplicate
Reads Removed report in the browser.
BAM files load quickly, and you may see these files first in the list of links. The other file formats
take longer to download, so you may have to wait for the links to the VCF, XLS, and FASTQ
formats to appear.

160 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

The plugin output contains links to the BAM files that have duplicate reads that are removed. This
table also shows the percentage of reads that were removed and the percentage of all reads that
reached the adapter.

5. To download the filtered BAM Files, click the link for each file listed that you want to download.
The BAM files are downloaded through the browser to a directory on the computer, based on the
browser settings.

immuneResponseRNA plugin
Use the immuneResponseRNA plugin to quantify gene expression levels for the Oncomine™ Immune
Response Research Assay. This plugin produces gene transcript quantification from sequence read
data. The plugin summary includes gene expression counts (number of aligned reads to a given gene
target), a data analysis summary, and QC plots. The normalized, gene-level count data from the run are
available to download for further analyses with Transcriptome Analysis Console (TAC) v3.1 software.
The immuneResponseRNA plugin requires a target regions BED file and an associated reference
sequence library FASTA file. For more information on installing these files, see Chapter 10, “References
management”.
The plugin also accepts a second (optional) BED file that specifies a subset of target genes allowing
sample clustering.

immuneResponseRNA plugin configuration

The configuration options for the immuneResponseRNA plugin are described in the following table:

Setting Value

Library Type AmpliSeqRNA

Targeted Regions ImmuneResponse_v3.1_target_designed_20160908.bed

Add new gene list (Optional) Select your target gene subset BED file in the Add genes of
interest list.

Review immuneResponseRNA plugin results

After the sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click immuneResponseRNA to view the plugin summary.

4. In the immuneResponseRNA section, click the immuneResponseRNA.html link to open the

immuneResponseRNA Report for all barcodes.
BAM files load quickly, and you may see these files first in the list of links. The other file formats
take longer to download, so you may have to wait for the links to the VCF, XLS, and FASTQ
formats to appear.

Torrent Suite™ Software 5.18 User Guide 161

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

5. In the Analysis Summary window, review your Mapped Reads, Valid Reads, and the Targets
that are detected by barcode.

Column Description
Barcode Name The barcode used for the sample.
Sample The sample name as it was entered in the sequencing Run Plan.
Mapped Reads The number of reads that map to the reference sequences.
Valid Reads The percentage of mapped reads ≥50% amplicon length.
Targets ≥1 reads The number of targets/genes with at least 1 read.
Targets ≥2 reads The number of targets/genes with at least 2 reads.
Targets ≥10 reads The number of targets/genes with at least 10 reads.

6. Click an individual barcode name to view the results for that barcode.

7. Scroll down, then click the Sample Characteristics, Sample Correlation, Analysis of Selected
Targets (available only if a Genes of interest subset BED file was selected), or Analysis of All
Targets tabs to review the data in graphic format.

Downloadable reports
The following reports are available for download as tab-delimited text files, compatible with Microsoft™
Excel™, or similar applications.
At the bottom of the screen are links for downloading raw analysis output files:

Report hyperlink Description

Download Barcode A table listing the sample name for each barcode, total reads, aligned reads on
Summary Report targets, and number of targets detected.

Download absolute read A table listing read counts for each barcoded sample along with gene
counts data annotations.

162 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

(continued)

Report hyperlink Description

Download RPM data A table listing RPM (Read count per million mapped reads) for each barcoded
(normalized by total read sample along with gene annotations. RPM is calculated as:
counts)
(read count) × 106 / total number of mapped reads

Download mean A table listing housekeeping-gene normalized, log2-transformed read counts

housekeeping scaled for each barcoded sample along with gene annotations. Conceptually, these
log2 RPM data values are read count normalized by the average expression of housekeeping
(hk) genes rather than by the total number of mapped reads as described above.
The values are calculated as:

These values are useful for differential analysis when a large proportion of
the target genes (non-housekeeping genes) are expected to be differentially
expressed or when the expression levels of the housekeeping genes in the 2
groups differ significantly.

Download CHP files The RPM data is converted to CHP file format for use with Transcriptome
normalized by RPM Analysis Console (TAC) software. The downloaded ZIP file contains all the CHP
files from the sequencing run. Each barcoded sample has one CHP file.

Download CHP files The housekeeping genes data is converted to CHP file format for use with
normalized by mean Transcriptome Analysis Console (TAC) software. The downloaded ZIP file
housekeeping genes contains all the CHP files from the sequencing run. Each barcoded sample has
one CHP file.

Download background A table containing background expression (in absolute read count) from four
expression from genomic experiments using genomic DNA and H2O as negative control samples.
DNA and H2O
neg_control

IonReporterUploader plugin
Analysis files that are generated in Torrent Suite™ Software can be directly transferred to an Ion
Reporter™ Software account in Ion Reporter™ Software with the IonReporterUploader plugin.
Ion Reporter™ Software uses Torrent Suite™ Software output BAM file for analysis. The Ion Reporter™
Software annotation-only analysis workflow also accepts the VCF output file of the variantCaller plugin.
Use the IonReporterUploader plugin to transfer these BAM and VCF output files to Ion Reporter™
Software.
For details about the IonReporterUploader plugin, see Chapter 9, “Integration with Ion Reporter™
Software”

Torrent Suite™ Software 5.18 User Guide 163

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

molecular Coverage Analysis plugin

Use the molecular Coverage Analysis plugin to view statistics and graphs that describe the level of
sequence molecular coverage produced for targeted genomic regions. The plugin generates statistics,
downloadable data files, and interactive visualization of molecular coverage over targeted regions of the
reference genome.
The plugin is only compatible with libraries prepared using Ion AmpliSeq™ HD or Taq Sequencing
chemistries.

molecular Coverage Analysis plugin configuration

The molecular Coverage Analysis plugin uses the following settings.

Setting Description

Reference Genome The reference genome selected in the Planned Run.

Library Type The library type selected in the Planned Run.

Targeted Regions Select the appropriate target region for this run.
The targeted regions are selected in the Planned Run and can be changed only after
the run is complete if the plugin is run manually. Target regions can be overwritten by
the specific barcode targets.

Barcode-specific Targets Select this checkbox to assign specific target region files to individual barcodes. This
option is available only when the plugin is run manually.
1. Select a specific barcode.
2. Select the specific Target Regions file to associate with the selected barcode.
3. Click Add.
4. Repeat above steps to associate additional barcodes with specific Target Region
files.

Alternatively, you can copy and paste the barcode/target file pairs manually.
When the Barcode-specific Targets option is deselected, all barcodes use the targets
specified by the target regions, even if barcode-specific targets are listed.

Parameter file Click to load the external parameter file that pertains to this plugin.

Review molecular Coverage Analysis plugin results

The molecular Coverage Analysis plugin generates a Molecular Coverage Analysis Report. This report
includes molecule statistics and several charts. The report summary lists the barcodes, the samples,
the median molecular coverage, the molecular uniformity, and the median reads per functional
molecule, and the median percentage of functional reads. Additional details regarding molecular
coverage are also provided on a per-barcode basis, along with a list of gene annotations for each
sequenced region.

164 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

You can download statistics files at the bottom of Molecular Coverage Analysis Report. After the
sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation pane, click molecular Coverage Analysis to view the plugin summary.
A summary table of the molecular coverage analysis, by barcode, is included in the Summary
screen.

4. In the molecularCoverageAnalysis barcode summary, in the Barcode Name column, click a link
to open a detailed Molecular Coverage Analysis Report for that barcoded sample.
Alternatively, click the molecularCoverageAnalysis.html link to open the summary table for all
barcodes in a new window.

5. In the Molecular Coverage Analysis Report, review the plugin results.

6. Click the links at the bottom of the Molecular Coverage Analysis Report to download associated
statistics and summary files for each barcoded sample in the run.

Molecule statistics
Statistic Description

Median Functional Molecular A functional molecule is a collection of reads that covers the amplicon
Coverage per Amplicon and satisfies all criteria associated with the parameters (for example,
min_tag_fam_size and min_fam_per_strand_cov) in the parameter
file. Molecular coverage is the number of functional molecules. The median
is calculated across all amplicons.

Uniformity of Molecular Coverage for Percentage of amplicons having molecular coverage between 0.5x and 2x of
all Amplicons the median molecular coverage.

Percentage of Amplicons larger than Percentage of amplicons having molecular coverage more than 0.8x of the
0.8x Median Functional Molecular median functional molecular coverage
Coverage

Median Total Molecular Coverage per The number of molecules that satisfies size criteria in the parameters file.
Amplicon The median is calculated across all amplicons.

Percentage of Reads with Perfect Percentage of reads whose molecular tags are exactly the same with design.
Molecular Tags

Median Functional Molecular Loss The metric is calculated by 1- (Functional Molecular Coverage) /
due to Strand Bias per Amplicon (Molecular Coverage without Strand Constraint), which
measures the loss of functional molecules due to strand constraint for
molecular functionality. The median is calculated across all amplicons.

Median Percentage of Functional The percentage of functional molecules out of the number of molecules that
Molecules out of Total Molecules per satisfies size criteria. The median is calculated across all amplicons.
Amplicon

Torrent Suite™ Software 5.18 User Guide 165

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

(continued)
Statistic Description

Median Reads per Functional For each amplicon, the number of reads supporting each functional
Molecule molecule is averaged across all functional molecules for that amplicon to
determine the number of reads per functional molecule at the amplicon
level. The median is calculated across all amplicons.

Median Reads Contributed to For each amplicon, the percentage of reads supporting functional molecules
Functional Molecules per Amplicon is (Number of Reads Supporting Functional Molecules) /
(Number of Reads). The median is calculated across all amplicons.

Percentage of Amplicons below LOD is calculated based on the number of functional molecules for each
(around) n% LOD amplicon and variant calling parameters in the parameter file. Around x n%
means in the range from 0.5x n% to 2x n%.

Example charts generated by the molecular Coverage Analysis plugin

The charts in the detailed Molecular Coverage Analysis Report include Plot and Overlay menus that
allow you to customize the data that is displayed in each chart.
Click (Search) (in the top right corner of a chart) to open the chart Viewing Options panel. Click
(Help) to open a description of the chart.

Figure 6 Representative Depth of Coverage Chart

The Depth of Coverage Chart summarizes the amplicon depth of coverage results. The X‑axis represents the amplicon
molecular depth. The left Y-axis represents the number of amplicons at a given molecular depth or a range (bin) of
molecular depths, as a percentage of the total number of amplicons. The right Y-axis represents the cumulative count of
the number of amplicons, at a given molecular depth or greater, as a percentage of the total number of amplicons. The
individual orange bars represent the percentage of amplicons in the specific range of molecular depths. The blue curve
measures the cumulative amplicons at a given molecular depth or greater. Use the Plot dropdown list to switch between
Maximum Read Depth, 99.9% of All Reads, and Normalized Coverage plots.

166 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Figure 7 Representative Amplicon Coverage charts

The Amplicon Coverage charts summarize the amplicon molecular coverage results. The X‑axis in all plots represents
amplicons that are grouped into bins, where each bin contains amplicons that have the same molecular coverage.
Depending on the plot selection, the left Y‑axis represents either the average number of molecules (on a base 10 log
scale) or the percentage of functional molecules in a given bin. The right Y‑axis represents the percentage of functional
reads in a given bin. Use the Plot and Overlay dropdown lists to customize the chart view. To zoom in on a subset of
amplicons, use the pointer to draw a rectangle that contains the region of interest. Use Zoom Out to revert to the initial
view.

1 Representative Total Molecules plot with an Perc Functional Reads overlay

2 Representative Strand Molecules plot with an Perc Functional Reads overlay
3 Representative Reads per Molecule plot with an Perc Functional Reads overlay

Torrent Suite™ Software 5.18 User Guide 167

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

Figure 8 Example detail panes

In most plots, you can click a data point to open a detail pane for that data. For example, in the Depth of Coverage Chart
in Figure 6, click an individual orange bar to open the detail pane for amplicons in a specific range of molecular depths
or click a point on the blue curve to open the detail pane for cumulative amplicons at that molecular depth or greater.
Similarly, you can click any point or bar within each Amplicon Coverage chart to view details for each amplicon coverage
bin. For example detail panes, see Figure 8.

168 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Output files generated by the molecular Coverage Analysis plugin

You can download plugin results files from links that are contained in the File Links section of
the Molecular Coverage Analysis Report. The output is a tab-separated text file with an XLS file
extension.
Click (Help) next to the file to open a description of the file.
The following is an example of the content of a results file that is generated by the molecular Coverage
Analysis plugin.

Setting Description

Coverage statistics This section of the file is a summary of the statistics presented in the tables at the top of the
summary Molecular Coverage Analysis Report plugin report. The first line is the title. Each subsequent
line is either blank or a particular statistic title followed by a colon (:) and its value.

Amplicon This section of the Amplicon molecular coverage summary file contains the following fields.
molecular coverage • contig_id: the name of the chromosome or contig (from contiguous) of the reference
summary for this amplicon.
• contig_srt: the start location of the amplicon target region. This coordinate is 1-
based, unlike the corresponding 0-based coordinate in the original targets BED file.
• contig_end: the last base coordinate of this amplicon target region. The length of the
amplicon target is given as (contig_end - contig_srt + 1).
• region_id: the ID for this amplicon as given as the 4th column of the targets BED file.
• gene_id or attributes: the gene symbol or attributes field as provided in the
targets BED file.
• func_mol_cov: the number of molecules (functional molecules) which are available for
the variantCaller plugin.
• lod: LOD (limitation of detection) calculated from the number of functional molecules.
• strict_func_umt_rate: the percentage of functional molecules used with strict
molecular tags.
• func_mol_cov_loss_due_to_strand: the percentage of functional molecules loss
due to strand bias.
• fwd_only_mol_cov: the number of molecules containing forward strand only.
• rev_only_mol_cov: the number of molecules containing reverse strand only.
• both_strands_mol_cov: the number of molecules containing both forward strand
and reverse strand.
• r2m_conv_rate_all: the percentage of reads contributed to functional molecules.
• reads_per_func_mol: the average reads per functional molecules.
• perc_to_mol_(<3_reads): the percentage of reads contributed to small size
molecules(size<3).
• perc_to_mol_(>=3&<30_reads): the percentage of reads contributed to median
size molecules (size ≥3 && size <30).
• perc_to_mol_(>=30_reads): the percentage of reads contributed to large size
molecules (size ≥30).

Torrent Suite™ Software 5.18 User Guide 169

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

PGxAnalysis plugin
The PGxAnalysis plugin is designed to be used with the Ion AmpliSeq™ Pharmacogenomics Research
Panel, a targeted gene panel that allows the interrogation of Pharmacogenomics variants in samples
for genotyping and CYP2D6 copy number detection. The plugin analysis incorporates optimized variant
calling for the Ion AmpliSeq™ Pharmacogenomics Research Panel, export of results that are compatible
with downstream reporting software, and detection of gene and exon-level CNV for CYP2D6.
Analysis by the PGxAnalysis plugin requires two other Torrent Suite™ Software plugins: the variantCaller
plugin for genotyping and coverageAnalysis plugin for CYP2D6 copy number detection.
The figure shows a summary of the analysis pipeline.

The run plan template that is used with the Ion AmpliSeq™ Pharmacogenomics Research Panel must
be imported from AmpliSeq.com. The template includes optimized TVC parameters. The variantCaller
plugin that includes pharmocogenomics parameters settings musbe be run before the PGxAnalysis
plugin to complete the analysis. For details about how to set up Torrent Suite™ Software Planned
Runs that incorporate the Ion AmpliSeq™ Pharmacogenomics Research Panel Planned Run template
and the PGxAnalysis plugin, see the following documents at the Thermo Fisher Scientific website
(thermofisher.com):
• Customization Guidelines for Ion AmpliSeq™ Pharmocogenomics Research Panels
(Pub. No. MAN0014300)
• Create a Planned Run using the Ion AmpliSeq™ Pharmocogenomics Research Panel Plugin (Pub.
No. MAN0013730)

170 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Review PGxAnalysis plugin results

After the sequencing run completes, review the plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click PGxAnalysis to view the plugin summary.

4. Click the PGxAnalysis.html link to open the Pharmacogenomics Analysis Report.

5. View the plugin analysis reports.

• Click the variantCaller_out link to view the Variant Caller Report. See Chapter 8, “Variant calls
in Torrent Suite™ Software” for details on variantCaller plugin results interpretation.
• Click the coverageAnalysis_out link to view the Coverage Analysis Report. See “Review
coverageAnalysis plugin results” on page 144 for details on coverageAnalysis plugin results
interpretation.

RunTransfer plugin
Use the RunTransfer plugin to do the following:
• Transfer the signal processing output files from a completed run to a different Ion Torrent™ Server.
• Rerun an analysis of the transferred signal processing files on the new server. The Run Summary
that includes the transferred files is listed in the Completed Runs & Reports for the server that
receives the transfer, as if it is generated on that server. The results of the analysis are contained in
the ISP images of the Run Summary.

The files that are transferred are the BaseCaller input category of files, including the 1.WELLS file. This
file contains observations from the instrument that are captured electronically.

RunTransfer plugin configuration

The RunTransfer plugin requires global configuration to connect to the Ion Torrent™ Server that receives
transferred files.
The following configuration settings are used by the plugin:

Setting Description

IP address or fully qualified The IP address or fully qualified host name of the receiving Ion Torrent™
hostname Server.

Remote TS Username (default The user name of the administrator-level user on the receiving Ion
ionadmin) Torrent™ Server. The default administrator user name on a new Ion
Torrent™ Server is ionadmin, but this can be changed.

Torrent Suite™ Software 5.18 User Guide 171

 Chapter 7 Manage plugins for data analysis
7 Preinstalled plugins

(continued)

Setting Description

Password The password of the administrator-level user on the receiving Ion

Torrent™ Server.

Upload Path The path of the directory used to store transferred files and analyses on
(default /results/uploads/) the receiving Ion Torrent™ Server.

Review RunTransfer plugin results

After the sequencing run completes, you can review information about the run reports that were
transferred to another Ion Torrent™ Server.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click RunTransfer to view the plugin summary.
In the RunTransfer section, review a list of the files that were transferred.

4. Click the Report Name link to open the summary for your report.

sampleID plugin
Use the sampleID plugin to track samples or possibly identify misassignment or mix up between
samples and barcodes in a sequencing run. The sampleID plugin produces a unique identification code
(SampleID) for each barcode in a sample.
The sampleID plugin can be run on sequencing results from any panel that includes the 9 primer pairs
of the Ion AmpliSeq™ Sample ID Panel.
For example, the Ion AmpliSeq™ Sample ID Panel contains 9 primer pairs that can be combined with
any Ion AmpliSeq™ Ready-to-Use Panel or Custom Panel. The sampleID plugin can be used with the
Ion AmpliSeq™ Sample ID Panel, which is a human SNP genotyping panel, to ensure the accuracy of
samples and increase confidence in sample data management. The Ion AmpliSeq™ Sample ID Panel
is composed of the identified human sample gender and IUPAC base letters for eight high-frequency
noncoding SNPs.
For the samples to work with this plugin, the Ion AmpliSeq™ library must have been prepared with Ion
AmpliSeq™ sample tracking amplicons.
The sampleID plugin is preconfigured and does not require input.

172 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Preinstalled plugins 7

Review sampleID plugin results

After the sequencing run completes, review the plugin results in the report summary.

Note: If the sampleID is undetermined, a ? can appear in the report summary. The sampleID can be
undetermined due to low coverage. For example, F-? is reported if only the female gender can be
called due to low coverage and F-GCTYR??A is reported if specific alleles (2 out of the 8 called) could
not be called due to low coverage or ambiguous allele frequency.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click sampleID to view the plugin summary.

4. Click sampleID.html to open the sampleID report in the browser tab. Then, you can open a
detailed report and other data files.

5. (Optional) Scroll to the File Links table, then click a link to:
• Download a PDF image of the report.
• Download all variant calls as a table file.
• Download the tracking target regions file.
• Download the tracking loci regions (SNPs) file.
• Download the aligned tracking reads (BAM) file.
• Download the aligned tracking reads index (BAI) file.

6. (Optional) Click Download Barcode Summary Report to open the data in a downloadable tab-
separated spreadsheet, or PDF report.

7. To return to Torrent Suite™ Software, click back in the browser.

variantCaller plugin
The variantCaller plugin calls single-nucleotide polymorphisms (SNPs), multiple nucleotide
polymorphisms (MNPs), insertions, deletions, and block substitutions in a sample across a reference
or within a targeted subset of that reference.
This plugin provides optimized preset parameters for many experiment types. It can also be
customized. After you find a parameter combination that works well on your data and that has the
balance of specificity and sensitivity that you want, you can save that parameter set and reuse it in your
research. Customization is supported when you run the plugin after a sequencing run and when the
plugin is run through a Planned Run.
For details about the variantCaller plugin, see Chapter 8, “Variant calls in Torrent Suite™ Software”.

Torrent Suite™ Software 5.18 User Guide 173

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Plugins available on Connect

Two plugins are supported by Thermo Fisher Scientific and are available on Connect at https://
apps.thermofisher.com/apps/publiclib/#/plugins. These plugins are not preinstalled in the Torrent
Suite™ Software. For details about plugins that are included with the software, see “Preinstalled plugins”
on page 135.

Plugin name Description

“RNASeqAnalysis plugin” Analyzes cDNA reads. This plugin is an RNA transcript alignment and analysis
on page 174 tool for use with the reference genomes hg19 and mm10.

“smallRNA plugin” on Analyzes small RNA reads with an emphasize on microRNA molecules. Use with
page 188 reference genome hg19 only.

RNASeqAnalysis plugin
The RNASeqAnalysis plugin is an RNA Transcript Alignment and Analysis tool for use with reference
genomes hg19 and mm10.
To use the hg19 or mm10 genomes with this plugin, the reference genomes must first be imported
from the preloaded references screen. Also, annotation files for the human and mouse references are
available for import. For more information on downloading references and annotation files, see “Import
a preloaded reference sequence file” on page 248.

Annotation file name Description

Human

hg19_annotation_v1.gtf Human genome annotation (hg19)

XrRNA.fasta Human auxiliary small RNA sequences (cDNA)

Mouse

mm10_annotation_v1.gtf Mouse genome annotation (mm10)

XrRNA.fasta Mouse auxiliary small RNA sequences (cDNA)

Use this plugin to analyze cDNA reads, as produced by RNA-Seq. Reads are aligned to the reference
genome using STAR and bowtie2 aligners to find full and partial mappings. The alignments are analyzed
by HTSeq and Picard tools to collect assigned read counts and cufflinks to extract gene isoform
representation. For barcoded data, comparative representation plots across barcodes are created in
addition to individual reports for each barcode. All alignment, detail, and summary report files are
available for download.

174 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

RNASeqAnalysis plugin configuration

The RNASeqAnalysis plugin can be configured with either the hg19 or mm10 reference genome when
you plan a run. You can also add hg19 and mm10 annotation files.
This plugin requires the use of the RNA Seq Planned Run templates for sequencing runs: Ion RNA–
Small or Ion RNA–Whole Transcriptome. If the RNA Seq Planned Run templates are not used when you
run the plugin manually, you receive an error.

Setting Description

Reference Genome In the Configure Plugin dialog box, select:

• hg19, or
• mm10

Regenerate indices Check to ensure that any indexing and annotation files previously
generated for the specified reference are deleted before the analysis
starts. New files are generated as needed, which may add several
hours to the plugin run time (approximately 3 hours for human-sized
genomes).
Using this option is necessary if the plugin previously failed during
reference index generation or the reference sequence was updated.

To use the mouse mm10 Reference Genome with this plugin, first import the preloaded Ion reference
genome using Torrent Suite™ Software. For more information, see “Import a preloaded reference
sequence file” on page 248.

Torrent Suite™ Software 5.18 User Guide 175

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Review RNASeqAnalysis plugin run results

After a sequencing run completes, you can review plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link for your
completed sequencing run.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.
Reports for any plugins that have completed analysis are included in the Summary.

3. In the left navigation menu, click RNASeqAnalysis to view the plugin results.

4. In the RNASeqAnalysis section, view the Barcode Summary for the RNASeqAnalysis plugin.
The summary includes columns for Barcode Name, Sample, Total Reads, Aligned Reads, Percent
Aligned, Mean Read Length, Genes Detected, and Isoforms Detected.
• Click the RNASeqAnalysis.html link to open the report in the browser tab.
• Click the RNASeqAnalysis.html link to view the RNASeqAnalysis Report for all barcodes.
• Click the links at the bottom of the report to download associated report files:

Link name Download description

Barcode Summary Report A table that lists the sample name for each barcode, total reads,
aligned reads and percent aligned.
absolute reads table A table that lists absolute reads for the genes found for each
barcode.
absolute normalized reads A table that lists absolute normalized reads for the genes found
table for each barcode.
aligned reads distribution A table that lists the distribution of genes across barcodes to
table show the frequency of numbers of genes having similar log10
read counts.
isoform FPKM values table The isoform gene heatmap in a table format.
• Click the links at the bottom of the RNASeqAnalysis Report to download raw analysis output
files for the selected barcode. For examples, see “Individual barcode view” on page 180.

Link name Raw analysis output file description

Download the Statistics An overview of the individual barcodes from the
Summary RNASeqAnalysis plugin results.
Gene Read Counts A table that lists the number of times a gene was counted for the
individual barcodes.
Output Files A directory for various output files for the selected barcode.
Cufflinks Output Files A list of links to Cuflinks output files.

176 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

• Click individual barcode names to see graphs for the selected barcode. For examples, see
“Downloadable reports for individual RNASeqAnalysis plugin barcodes” on page 178.

Link name Download description

Reference table A plot that shows the number of genes that have reads in log10
counting bins.
Gene Mapping Summary A summary of reads mapped to genes of the annotated
reference.
Base Mapping Summary A summary of base reads aligned to genetic features of an
annotated reference.
Normalized Transcript A plot of normalized transcript coverage that shows the
Coverage frequency of base reads with respect to the length of individual
transcripts as they are aligned to in the 3" to 5" orientation.
Gene Isoform Expression Box plots showing variation of isoforms expressed at FPKM ≥
0.3 for each set of genes grouped by the number of anticipated
(annotated) isoforms. Whiskers are defined by points within
Q1-1.5xIQR to Q3+1.5xIQR. Only genes with 25 or less isoforms
are represented in this plot. The data and a plot for all genes are
available for download using the download reports links at the
bottom of the screen.
• Click the Distribution Plots, Correlation Heatmap, Correlation Plot, and Gene Heatmap
tabs to review the following data graphically.

Graphical report Description

Distribution Plots For details, see “Distribution plots” on page 182.
Correlation Heatmap For details, see “Correlation heatmap” on page 184.
Correlation Plot For details, see “Correlation plot” on page 185.
Gene Heatmap For details, see “Gene heatmap” on page 186.
Isoform Heatmap For details, see “Isoform heatmap” on page 186.

Torrent Suite™ Software 5.18 User Guide 177

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Downloadable reports for individual RNASeqAnalysis plugin barcodes

You can download raw analysis output files for individual barcodes if you click the links at the bottom of
the RNASeq Analysis Report.
• Download the Statistics Summary—Provides an overview of the individual barcodes RNA Seq
Analysis results.

178 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

• Download the Gene Read Counts—Lists the number of times a gene was counted for the
individual barcode.

• Download Output Files (page)—Provides a directory for various output files for this barcode.

• Download Cufflinks Output Files (page)—Provides a list of links to Cufflinks output files.

Torrent Suite™ Software 5.18 User Guide 179

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Individual barcode view

Click any barcode of interest in the RNASeqAnalysis Report to see graphs for the selected barcode.
Reference table—A plot showing the number of genes with reads in log10 counting bins.

Gene Mapping Summary—A summary of reads mapped to genes of annotated reference.

Base Mapping Summary—A summary of base reads aligned to genetic features of an annotated
reference.

Transcript Coverage—A plot of normalized transcript coverage the frequency of base reads the length
of individual transcripts they are aligned to in the 3' to 5' .

180 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

Isoform Expression— plots showing the variation of isoforms that are expressed at FPKM ≥ 0.3
for each set of genes that are grouped by the number of anticipated (annotated) . Whiskers points
Q1-1.5xIQR to Q3+1.5xIQR. Only genes with 25 or less isoforms are represented in this plot. The data
and a plot for all genes are available for download using the download reports links at the bottom of the
screen.

Torrent Suite™ Software 5.18 User Guide 181

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Distribution plots
Reads Alignment Summary—A graphical summary of the number of mapped and unmapped reads
across barcodes, as reported in the barcode summary table.

Alignment Distribution—A graphical summary of the distribution of reads to genomic features.

Normalized Transcript Coverage—An overlay of individual normalized transcript coverage plots for
each barcode.

182 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

Distribution of Gene Reads—Distribution of genes across barcodes showing the frequency of

numbers of genes having similar log10 read counts. All curves are plotted on the same axis scale.
The counts data are fitted to a Gaussian kernel using the default R 'density' function.

Distribution of Isoform Reads—Distribution of transcript isoforms across barcodes showing the

counts of isoforms having similar FPKM values. All curves are plotted on the same y-axis, normalized to
the highest count, and scaled for FPKM values ≥0.3.

Torrent Suite™ Software 5.18 User Guide 183

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Correlation heatmap
The correlation heatmap is a heatmap of Spearman correlation r-values for comparing log2 RPM reads
pair correlation barcodes. The dendrogram (lines on the top and the left side of the heatmap) reflects
the ordering of barcodes as being most similar by these values.

184 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

Correlation plot
The correlation plot is a barcode read pair correlation plot. Lower panels show log2(RPM+1) values
plotted for each pair of barcodes, with linear least squares regression line overlaid and line slope
reported. Upper panels show Pearson correlation r-values for the regression line. Diagonal panels show
the frequency density plot for the individual log(RPM+1) values for each barcode. (If only one barcode
has reads, a density plot is displayed.)
Click the plot to open an expanded view in a new window.

Torrent Suite™ Software 5.18 User Guide 185

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

Gene heatmap
The following is a gene representation heatmap of 250 genes showing the most variation in
representation across barcodes as measured by the coefficient of variant (CV) of normalized read
counts for genes that have at least one barcode with at least 100 RPM reads. The heatmap is plotted
using log10 of those counts. For this plot, barcodes are omitted if they have less than 100,000 total
reads.

Isoform heatmap
A transcript isoform representation heatmap of up to 250 gene transcript isoforms showing the most
variation in representation across barcodes as measured by the coefficient of variation (CV) of FPKM

186 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

values for isoforms that have an FKPM value ≥ 100 for at least one barcode, plotted using log10 of
FKPM+1. Barcodes are excluded if they have less than 1,000 isoforms detected at FPKM values ≥ 0.3.

Torrent Suite™ Software 5.18 User Guide 187

 Chapter 7 Manage plugins for data analysis
7 Plugins available on Connect

smallRNA plugin
Use the smallRNA plugin to analyze microRNA (miRNA) reads. Reads are aligned to mature miRNAs
using the TMAP or bowtie2 alignment software that is bundled with the plugin. Unmapped reads
are further aligned to the whole‑genome to rescue miRbase unaligned reads and count other RNA
molecules (tRNAs, rRNAs, mRNAs, and so on). miRNA raw counts are generated using featureCounts
software.
When you configure the plugin, you can select the barcode adapter sequence, if any, that is trimmed
from the 3' end of the reads.

smallRNA plugin configuration

The configuration options for the smallRNA plugin are described in the following table.

Setting Description

microRNA mirbase (build 20) – Use to align against a mirBase reference, constructed from the
reference mirBase GFF file with 10 bp padding.
genome – Use to align against the whole genome.

Rescue reference hg19

Adapter Sequence This setting allows you to select the adapter sequence that you want to trim from the
3' end of the reads.
• TGGAATTCTCGGGTGCCAAGGATCACCGACTGCCCATAGAGAGGCTGAGAC –
The adapter sequence for the TriLink small RNA Barcode Set. This is the default
setting.
• ATCACCGACTGCCCATAGAG – The adapter sequence for the IonXpressRNA
barcode set.
• (none) – No adapter sequence is trimmed from the reads.

Minimum adaptor Specifies the minimum length of sequence at the 3' end of the read that must match
overlap the adapter sequence for identification and trimming.
The default value is 5. Do not change the default setting unless you understand how
the change can affect the sequencing data.

Minimum read Reads that are shorter than the specified length are filtered out regardless of the
length adapter sequence.
The default value is 15. Do not change the default setting unless you understand how
the change can affect the sequencing data.

Review smallRNA plugin results

After your sequencing run completes, review plugin results in the report summary.

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click smallRNA to view the plugin results.

188 Torrent Suite™ Software 5.18 User Guide

 Chapter 7 Manage plugins for data analysis
Plugins available on Connect 7

4. In the smallRNA section, click smallRNA.html link to open the smallRNA Analysis Report for all
barcodes.
• In the barcode table, click individual barcode names to see the results for an individual
barcode.

Report Description
Download the Statistics An overview of read mapping statistics and smallRNA
Summary molecules.
mirBase mapping quality Mapping quality output from Qualimap.
(page_)
Download the mirRNA Mature A table with per mature RNA read counts.
Counts
Download the miRNA Per A table with 5p-arm and 3p-arm read counts on the same line.
Precursor 5p-3p Counts
Download the miRNA High A table with per mature read counts for miRNAs identified as
Confidence Mature Counts high confidence miRNAs in mirBase build 21
Download the miRNA Per A table with 5p-arm and 3p-arm read counts on the same line.
Precursor 5p-3p Counts Restricted to miRNAs identified as high confidence miRNAs in
mirBase Build 21.
Download the mirBase mirBase alignments converted to genomic coordinates when
alignments (BAM) file mirBase was used as reference.
(genomic coordinates)
Download the mirBase Index file for the mirBase alignment.
alignments index (BAI) file
Download Output files (page_) A page that provides the ability to download all output files
individually.
• Click Download Barcode Summary Report to download the data into downloadable tab-
separated spreadsheet, or PDF report.
• Click Download absolute reads matrix to download a table that lists absolute reads for the
genes that are found on each barcode.

Torrent Suite™ Software 5.18 User Guide 189

 8 Variant calls in Torrent Suite™
Software

■ About the variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190

■ Run the variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
■ Create a custom configuration for the variantCaller plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196
■ Apply configuration settings to specific barcodes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
■ Create and use a custom parameters setting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
■ Review variantCaller plugin run results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
■ Save adjusted parameters to a variantCaller plugin configuration . . . . . . . . . . . . . . . . . . . . . . . . . . 214
■ variantCaller plugin advanced parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215

About the variantCaller plugin

The variantCaller plugin calls single-nucleotide polymorphisms (SNPs), multinucleotide polymorphisms
(MNPs), insertions, deletions (INDELs), and complex variants in a sample across a reference genome or
within a targeted subset of that reference in Torrent Suite™ Software.
You can set the plugin to run automatically after a sequencing run is completed, or you can run the
plugin manually for completed runs.
When you configure the variantCaller plugin, you can adjust parameter settings to affect the stringency
of the variant calls that are made on your data. Adjustments to the parameters balance the specificity
(that is, false positive calls) and sensitivity (that is, true positive calls). For more information, see
“variantCaller plugin configuration” on page 193.
These parameter settings, when combined with the reference genome that you select, a target regions
file, and a hotspots file, comprise a configuration that you can save, then use for subsequent runs of the
variantCaller plugin. You can also select a predefined configuration that is included with Torrent Suite™
Software.
Preconfigured plugin settings are available as predefined or custom configurations that are available
when you configure the variantCaller plugin. Use these configurations to save significant setup time.
Predefined configurations for use with the Ion AmpliSeq™ and Ion AmpliSeq™ HD research applications
can also be downloaded from AmpliSeq.com. For more information, see “Import panel files and
parameters from AmpliSeq.com” on page 59.

190 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Run the variantCaller plugin 8

Run the variantCaller plugin

The variantCaller plugin identifies variants and adds a VCF file to the output that is available for
completed sequencing runs. You can run the variantCaller plugin for sequencing results in Torrent
Suite™ Software.
• To see variant calls immediately after a sequencing run, configure the variantCaller plugin as part of
the Planned Run.
• You can also manually configure and run the variantCaller plugin after the sequencing run from a
completed run report. You must run the plugin manually after the run to use a reference genome,
target regions file, or hotspots file for one or more barcodes that are is specified in the Planned
Run.

To get variantCaller plugin results as quickly as possible, set up the plugin to run automatically.

Configure the variantCaller plugin to run by default after every run

To run the variantCaller plugin automatically after the Torrent Suite™ Software analysis completes,
configure the variantCaller plugin to run by default.
If the variantCaller plugin runs automatically, you can run the plugin again manually after a sequencing
run is completed. For more information, see “Run the variantCaller plugin manually” on page 192.

IMPORTANT! Parameter changes that you make in a Planned Run affect only that specific run. If you
change variantCaller plugin parameter settings in a Planned Run template, the changes affect all users
who create Planned Runs from that template.

1. Click (Settings)4 Plugins.

2. Ensure that the Enabled checkbox in the row of the variantCaller plugin is selected.

3. Select the Selected by Default checkbox in the row of the variantCaller plugin name.
The plugin is now set to perform its function after every sequencing run.

4. (Optional) To disable automatic execution of the plugin, deselect the Selected by Default
checkbox in the row of the plugin.

5. To use a reference genome, target regions file, or hotspots file for one or more barcodes that are
specified in the Planned Run, run the variantCaller plugin manually after the run.

Configure the variantCaller plugin to run as part of a Planned Run

Variants are called for each barcode that is configured to use the specific reference genome, target
regions file, and hotspot file that is included in the Planned Run. For more information, see “Plan step
in the workflow bar” on page 53. When you configure the variantCaller plugin in a Planned Run, you
cannot change the reference genome, target regions file, or hotspots file for any barcoded sample. The
Planned Run uses the same parameter file for all barcodes.
You can configure the barcodes and set the variantCaller plugin to run automatically as part of a
Planned Run in Torrent Suite™ Software.

Torrent Suite™ Software 5.18 User Guide 191

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Run the variantCaller plugin

If the variantCaller plugin runs automatically, you can run the plugin again manually after a sequencing
run is completed.

IMPORTANT! The variantCaller plugin parameter settings are saved in Planned Run templates but are
not saved in Planned Runs. Parameter changes that you make in a Planned Run affect only that specific
run. When you change variantCaller plugin parameter settings in a Planned Run template, your changes
affect all users who create Planned Runs from that template.

1. In the Plan tab, click Templates, then select a research application in the left navigation menu.

2. Select an existing Planned Run template from the list. Alternatively, select Add New Template, or
Plan New Run to create a new Planned Run template or Planned Run.

3. Click Plugins in the workflow bar.

4. Select variantCaller plugin, then click Configure.

The variantCaller plugin parameter settings change according to the selections you make. Default
settings can be different depending on the sequencer in use.

5. Select settings that are appropriate for the sequencing instrument that is used, the experiment,
and the frequency of the variants of interest. For more information, see “variantCaller plugin
configuration” on page 193.

6. Click Next, or another tab in the workflow bar to make further changes to your Planned Run.

7. When all changes to the Planned Run have been made, click Plan in the workflow bar, then click
Plan Run.

The plugin is now set to run after every sequencing run that uses the Planned Run template or new
Planned Run.

Run the variantCaller plugin manually

You can run the variantCaller plugin on a completed run report in Torrent Suite™ Software. If the
sequencing run includes barcodes, you can apply one configuration that you saved previously to all
barcodes. You can also apply a different configuration for individual barcodes. For more information,
see “Create a custom configuration for the variantCaller plugin” on page 196.

1. In the Data tab, click Completed Runs & Reports screen, then click the Report Name link for the
completed sequencing run of interest.

2. Click Plugins 4Select Plugins to Run, then click the name of the plugin that you want to run.

3. In the Select a Plugin to Run dialog box, select the variantCaller plugin, then click Configure.
The Configure Plugin window opens. The variantCaller plugin parameter settings change
according to the selections you make. Default settings can be different depending on the
sequencer in use.

192 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Run the variantCaller plugin 8

4. Select settings that are appropriate for the sequencing instrument that is used, the experiment,
and the frequency of the variants of interest. For more information, see “variantCaller plugin
configuration” on page 193.

5. When your changes are complete, click Submit.

The variantCaller plugin reruns, then applies the changes that you made.

variantCaller plugin configuration

Use the Torrent Variant Caller screen to configure the variantCaller plugin. For information about how
to get to this screen, see “Configure the variantCaller plugin to run as part of a Planned Run” on
page 191

1 2

3 5
6

10

8 9

1 Configuration
2 Manage Configurations/Barcodes
3 Settings included in a predefined or custom configuration
4 Add panel
5 Add targets
6 Add hotspots
7 Configuration Name
8 Load external parameter file
9 Copy selected setting to Custom
10 Show Advanced Settings

Torrent Suite™ Software 5.18 User Guide 193

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Run the variantCaller plugin

Setting Details

Configuration [1] A reusable predefined or a custom configuration for the variantCaller plugin
that includes settings for a reference genome, targeted regions, hotspots, and
parameter settings.
For more information, see “Create a custom configuration for the variantCaller
plugin” on page 196.

Manage Manage and apply configurations for barcodes when you run the variantCaller
Configurations/Barcodes plugin manually. For more information, see “Apply configuration settings to
[1] specific barcodes” on page 197.
(Optional) To run the variantCaller plugin manually for a limited number of
barcodes, select Skip this barcode for the barcodes that you do not want to
include in the plugin run.
For more information, see “Apply configuration settings to specific barcodes”
on page 197.

Chip Type [1] The chip type that is used in the sequencing run.
If you change this option, it affects only the fields that are selected by default
in the variantCaller Configuration screen. It does not affect the sequencing
run.

Library Type [1] Library type options include:

• Whole Genome
• AmpliSeq
• AmpliSeq HD
• TargetSeq

When Library Type is set to AmpliSeq, read trimming is automatically applied

to remove the primers from reads.

Variant Frequency [1] Variant frequency options include:

• Somatic—Detects somatic variants at low allele frequencies.
• Germline—Detects germline variants that are expected to be present at
low allele frequencies.
• Rare Somatic—Detects rare somatic variants in FFPE or cfDNA samples.
The option is available only if AmpliSeq HD is selected as the Target
Technique in the Planned Run.

AmpliSeq Panel [1] Panels ordered from AmpliSeq.com have predefined variantCaller plugin
parameter settings. For details, see “Import panel files and parameters from
AmpliSeq.com” on page 59.
When an Ion AmpliSeq™ panel is selected, the plugin configuration screen
automatically selects target regions, hotspots, and parameter settings files
that are for use with the panel.

Add panel [1] Upload a panel.

194 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Run the variantCaller plugin 8

(continued)

Setting Details

Reference Genome [1] The reference genome that is for use with variant calling.
To configure barcodes in the run to use the same genome reference that was
used for the current run report, select the As Specified in the Plan for Each
Barcode option. If the selected reference genome differs from the reference
genome that is included in the Planned Run, the software must realign the
data, which requires more time for the plugin run.

Targeted Regions Target Regions are the regions of interest for which you want to call variants.
If a target regions file is not provided, the variantCaller plugin analyzes every
position of the reference genome, which typically takes longer.
To configure barcodes to use the same target regions file that is included
in the current Planned Run, select the As Specified in the Plan for Each
Barcode option.
Before a targeted regions file can be selected, it must be uploaded from in
Torrent Suite™ Software and associated with a specific reference genome. For
more information, see “Upload a target regions file” on page 259.

Add targets Upload a target regions file.

Hotspots Hotspots files are BED or VCF files that define variant alleles of interest.
Hotspots files instruct the variantCaller plugin to include these variant alleles in
its output files, including evidence for a variant and the filtering thresholds that
disqualified a variant candidate. A hotspots file affects only the variantCaller
plugin, not other parts of the analysis pipeline. If you do not specify a hotspots
file, the software reports only the de novo variants that show as present. In
contrast, if a hotspots file is used, the variant calls and the filtering metrics
for each hotspot allele are reported in the output VCF file, including data for
absent or NOCALL variants.
To configure hotspots files to use the same hotspots file that is included in the
current Planned Run, select the As Specified in the Plan for Each Barcode
option.
Before a hotspots file can be selected, it must be uploaded from in Torrent
Suite™ Software and associated with a specific reference genome. For more
information, see “Upload a hotspots file” on page 261.

IMPORTANT! A carefully designed hotspot file is recommended to optimize

the overall performance of variant calling. For help with designing a hotspots
file, contact your local Field Service Engineer.

Add Hotspots Upload a hotspots file.

Torrent Suite™ Software 5.18 User Guide 195

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Create a custom configuration for the variantCaller plugin

(continued)

Setting Details

Parameter Settings Option to use parameter settings that are predefined in the variantCaller
plugin, or to use Custom parameter settings. For Ion AmpliSeq™ experiments,
panel templates from AmpliSeq.com can contain parameter settings that
are optimized for the variantCaller plugin and are available for use during
variantCaller plugin configuration.
• The variantCaller plugin provides generic parameter settings that are
optimized for the selected Chip Type, Library Type, and Variant
Frequency, and for the parameters settings that are downloaded from
AmpliSeq.com .
• Select Custom to change the advanced parameter settings. For more
information, see “variantCaller plugin advanced parameters” on page 215.

Load external parameter Imports a file that contains parameter settings.

file

Copy selected settings to Creates a custom parameter setting that is based on a generic parameter
Custom setting. For more information, see “Create and use a custom parameters
setting” on page 199.

Configuration Name [1] Names and saves a custom configuration when changes are made to the
predefined settings.

Show Advanced Settings Configure advanced parameter settings. For more information, see
“variantCaller plugin advanced parameters” on page 215.
Hover over the field to see tooltips with descriptions of the advanced settings.
[1] Hidden in sequencing runs that use Tag Sequencing as the target technique.

Create a custom configuration for the variantCaller plugin

You can create a custom configuration for the variantCaller plugin in Torrent Suite™ Software. Later,
when you run the plugin manually, you can apply the custom configuration to the variantCaller plugin
run, or to individual barcodes that are included in the run.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link for the
completed sequencing run.

2. Click Plugins4Select Plugins to Run.

3. In the Select a Plugin to Run dialog box, select the variantCaller plugin, then click Configure.
The variantCaller plugin configuration screen opens.

4. Set plugin configuration parameters.

For more information, see “variantCaller plugin configuration” on page 193 and “Create and use a
custom parameters setting” on page 199.

5. In Configuration Name, enter a name for the configuration, then click Save.

196 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Apply configuration settings to specific barcodes 8

The new configuration is included in the Configuration drop-down list in the variantCaller plugin
configuration screen. You can apply the configuration when you run the variantCaller plugin manually.

Apply configuration settings to specific barcodes

You can save and retrieve custom configurations, for the variantCaller plugin and apply these custom
configurations to specific barcodes when you run the variantCaller plugin manually from a completed
Torrent Suite™ Software run Report. By applying specific custom configurations to individual barcodes,
you can refine your analysis results.
You can use configurations for barcoded runs to:
• Save a variantCaller plugin configuration that applies to all barcodes.
• Apply one or more saved configurations to individual barcodes.
When you apply saved configurations to specific individual barcodes, you must run the plugin
immediately after you apply the configurations. You can apply a saved configuration to an individual
sample on a chip for each barcode. Configurations applied to individual barcodes cannot be saved.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name for the completed
sequencing run of interest.

2. Click Plugins 4Select Plugins to Run, then in the Select a Plugin to Run dialog box, click
variantCaller.

3. In the Configure Plugin dialog box, click Manage Configurations/Barcodes, then click OK.

4. In the Torrent Variant Caller dialog box, in the Setup tab, apply configurations to all barcodes or
specific configurations to individual barcodes.
Option Selection
Apply the same configuration to all In Set All, select the configuration to apply to all barcodes.,
barcodes in a sequencing run. then click Submit.
Apply a specific configuration to an In the Configuration column, select the configuration
individual barcode. from the list of available configurations for each individual
barcode.

Torrent Suite™ Software 5.18 User Guide 197

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Apply configuration settings to specific barcodes

5. (Optional) In the Torrent Variant Caller dialog box, in the Configuration tab, create a new
configuration or edit an existing one.
Option Selection
Edit a configuration. 1. Click Edit. The Configure Plugin dialog box becomes specific to the
configuration selected.
2. Change the existing selections as desired.
To add a new panel, target regions, or hotspots file, you are redirected to
the appropriate Settings ( ) screen. Close the Configure Plugin dialog
box, then reopen the dialog box to access the new file.
3. Click Show Advanced Settings, then edit the parameters if needed.
4. Click Save.

Delete a 1. Click Delete.

configuration.
2. Click OK to confirm.

Create a new 1. Click Add.

configuration.
2. Enter a configuration name.
3. Make selections from the available lists.
4. Click Save.

198 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Create and use a custom parameters setting 8

Create and use a custom parameters setting

You can create a custom parameters setting that you can save and reuse. The custom parameters
setting that you create can be used with a manual run of the variantCaller plugin. To use a customized
parameter file that is designed for your customized panel or other special requirements, you must
create a custom parameters setting, then run the variantCaller plugin manually with the custom
parameters setting.
The parameters file in the variantCaller plugin is a JSON text file that contains the variant calling
parameters that are listed in “variantCaller plugin advanced parameters” on page 215.

1. In the Data tab, in the Completed Runs & Reports screen, click the report name of the run that
you want to apply configuration settings to.

2. Click Plugins4Select Plugins to Run, then in the Select a Plugin to Run dialog box, click
variantCaller.

3. In the Parameter Settings section, click Custom, then complete the selections for one of the
following options.
Option Selection
Use a JSON parameters file 1. Click Load external parameter file.
that you have saved on your
2. Browse to the JSON file, then click Open.
computer.
Edit a predefined 1. In Configuration, select the predefined parameter setting that you
parameters setting. want to edit.
2. Click Copy selected to Custom.
3. If you agree to save the new custom parameter setting, click OK.
4. Click Show Advanced Settings to enter changes for the custom
parameter settings.

You can edit the values of the advanced parameter settings. Predefined parameter settings are in
read-only mode and cannot be edited.

The custom parameters setting is now ready to be applied to run results when you run the variantCaller
plugin manually.

Review variantCaller plugin run results

After a variantCaller plugin run completes, you can access variantCaller run results from the run report
screen in Torrent Suite™ Software. On the run report screen, in the variantCaller section you can:
• Review the summary of the variantCaller plugin run for each barcode used.
• Review the library type, reference genome, targeted regions, hotspots file, and parameter settings
that were used in the run.
• Download data files for all barcodes and each individual barcode or sample.

Torrent Suite™ Software 5.18 User Guide 199

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

You can also access the detailed variantCaller plugin summary report for each barcode or sample from
the variantCaller section on the run report screen. In the detailed variantCaller plugin summary report
screen, you can:
• View variant call information by allele for the specific barcode, such as allele location on the
chromosome, allele annotations, coverage metrics, and quality metrics.
• Review the library type, reference genome, target regions, hotspots, and parameter settings that
were used in the run.
• Download BED files and the parameters file that are used for the specific barcode.
• Download BAM and BAI files for the mapped and TVC-processed reads.
• Download data files for variant calls and coverage for the specific barcode.
• View variant calls in IGV.

The variantCaller plugin supports SNPs, MNPs, INDELs, and complex alleles as input candidates at
genomic positions with the target regions file. If the variant is outside of the target regions, then the
variant is not generated as a candidate and is not further evaluated, even if the variant is specified in the
hotspots file.

1. In the Data tab, click Completed Runs & Reports.

2. In the Completed Runs & Reports list, find the run of interest, then click the report link in the
Report Name column in the row of the run.

3. In the left navigation menu, click variantCaller to navigate to the variantCaller results section.
• If the sequencing run contains barcodes, the plugin report includes a list of the barcodes that
were used and file download options for all barcodes and each individual barcode.

200 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

Downloads options for all barcodes that were used in the plugin run.

Download option Description

VCF.ZIP A compressed directory that contains separate VCF files for each
barcode.
XLS.ZIP A compressed directory that contains separate XLS files for each
barcode.
XLS A file that contains a list of alleles for all barcodes in a tab-separated file
that can be opened by Microsoft™ Excel™.
COV A file that contains the coverage of the variant call results for
all barcodes in tab-separated file format, which can be opened in
Microsoft™ Excel™.
• If the sequencing run does not contain barcodes, the plugin report contains information for the
sample that is used in the run and the file download options for the sample.

4. To open the detailed variantCaller plugin report for a specific barcode or sample, do one of the
following in the variantCaller run summary table:
• In the Barcode name column in a barcoded sequencing run report, click the barcode name
link.
• In the Sample column in a report from a sequencing run that does not contain barcodes, click
the sample name link.

Torrent Suite™ Software 5.18 User Guide 201

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

Detailed variantCaller plugin report

The detailed variantCaller plugin report contains variantCaller run information, results, and the
associated files for download that are specific for an individual barcode or sample.
To access the report, click the sample name link in the Sample column in a report from a sequencing
run.

3
4

1 Review run information for a specific barcode or sample and download the associated files.
2 View variants called and their associated allele annotation information, coverage metrics, and quality metrics. For
more information, see “Variant Calls by Allele table” on page 203.
3 Export the variant data files for troubleshooting. For more information, see “Export files for troubleshooting” on
page 213.
4 Adjust variantCaller plugin filter settings that were used for the specific barcode or sample, then save the adjusted
parameters to a new configuration. For more information, see “Save adjusted parameters to a variantCaller plugin
configuration” on page 214.

The following table lists and describes the download options for an individual barcode, or the sample
used in the run. The available options in the table depend on the run type.

Download option Description

Target Regions BED—The BED file that specifies the genomic positions of interest.

Hotspot Regions BED—The BED file that specifies the variant alleles of interest.

Effective Regions BED—The BED file that specifies the regions that are processed in the
variantCaller run for the sample or barcode (available if read trimming is
enabled).

Parameter Settings JSON—The JSON file that contains the parameter settings used in the
variantCaller run for the sample or barcode.

202 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

(continued)

Download option Description

Mapped Reads • BAM—The BAM file that is input to the Torrent Variant Caller Pipeline for
discovering and evaluating variants. Note that realignment may be applied.
• BAI—The BAI file that contains the index information for the corresponding
BAM file.

Torrent Variant Caller- • BAM—The BAM file that is processed by Torrent Variant Caller. Note that
Processed Reads read trimming and read filtering may be applied. In Tag Sequencing and Ion
AmpliSeq™ HD runs, the BAM file may contain consensus reads that are
obtained by compressing the reads in the mapped BAM that originate from
the same DNA molecule.
• BAI—The BAI file that contains the index information for the corresponding
BAM file.

Variants Calls • VCF.GZ—The compressed VCF file that contains the variant calls.
• VCF.GZ.TBI—The index file for VCF.GZ.
• XLS—The file that contains a list of variant alleles in the tab-separated file
format, which can be opened in Microsoft™ Excel™.
• COV—The file that contains coverage analysis for each variant call, which
can be opened in Microsoft™ Excel™.

Variants + Non-Variant • gVCF.GZ—The bgzip-compressed genome-VCF file that contains the

Coverage variant calls.
• gVCF.GZ.TBI—The tabix index file for gVCF.GZ.

View Variant Calls in IGV IGV—The JNLP file that can be opened using (IGV) to visualize the variant calls.

Variant Calls by Allele table

The detailed variantCaller plugin report contains the Variant Calls by Allele table. The table lists the
details about each variant that is called, including the allele locus, allele annotation, coverage metrics,
and quality metrics for the specific barcode or sample. You can use the table to find the variant alleles
of interest and information about those alleles. You can also export the information to be saved to your
local storage.
To access the report, click the sample name link in the Sample column in a report from a sequencing
run.

Torrent Suite™ Software 5.18 User Guide 203

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

1 Find the variants of interest by applying filters to the table to narrow down the list of variants called.
2 Change the display of the table to view allele annotation, coverage metrics, or quality metrics for each variant. To
switch between different displays, you can select one of the following tabs.
• View Allele Annotation. For more information, see “View allele annotations ” on page 205.
• View Coverage Metrics. For more information, see “View coverage metrics ” on page 206.
• View Quality Metrics. For more information, see “View quality metrics” on page 207.
3 Click the column heading to sort variant alleles by the values in the column.
4 Export the information that is associated with the selected variant alleles to an XLS file. The exported XLS
file contains all the information about the selected variants, including the information listed in the View Allele
Annotation, View Coverage Metrics, and View Quality Metrics tabs. The tabs that are available depend on the run
type. For information about how to export the information, see “Export variant calls to a file” on page 208.

Column Description

Position The chromosome (or contig) name in the reference genome, and the position of
the chromosome (or contig) in the one-based coordinate.

Ref The reference base or bases.

Variant The variant allele base or bases.

Allele Call The zygosity (homozygous or heterozygous) or type (absent or No Call) of the
allele that is called by the zygosity (homozygouse or heterozygous) or type
(Absent or No Call) of the allele all by the variantCaller plugin.

Frequency The frequency, in %, of the variant allele.

LOD The limit of detection (LOD) at the genome location, estimated based on the
number of detected molecules.
This column is available only for sequencing runs that use the tag sequencing
or Ion AmpliSeq™ HD as the target technique in the Planned Run. For more
information, see “Research application step in the workflow bar” on page 47.

204 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

(continued)

Column Description

Quality The Phred-scored quality.

For variants found by the Long INDEL Assembler, this value is always set to 50.
Larger values mean higher confidence in the call.
Quality is calculated by posterior probability that the variant allele frequency is
greater than the cutoff (min_allele_freq in the parameter file), if a variant
call is made, or posterior probability that the variant allele frequency is below
this cutoff (if a reference call). The posterior probability that is computed as
conditional on the reads observed includes sampling variability.
Quality score is typically very large for reads strongly distinguishing variants with
good depth, that is, under the model assumed, evidence is overwhelming for
the variant or for the reference. Marginal values can mean that either the reads
do not distinguish the variant well, there is insufficient depth to resolve, or the
observed allele frequency is near the cutoff.

PPA (Optional) An indication (0 or 1) of whether the variant allele is a possible polyploidy

allele (PPA). Only absent alleles can be labeled as PPA; heterozygous and
homozygous alleles are not treated as PPA.
This column is available if the report_ppa parameter is set to 1. For more
information on how to set the report_ppa parameter, see “Torrent Variant
Caller module advanced settings” on page 215.

View allele annotations

You can view the following information in the View Allele Annotations tab of the Variant Calls by
Allele table.

Column Description

Allele Call Decision whether the allele is detected (Heterozygous or Homozygous), not
detected (Absent), or filtered (No Call). No Call and Absent are for only hotspot
calls.

Subset Of The name of the called allele that is a strict superset of the two SNPs. For
example, if a called (homozygous or heterozygous) MNP is composed of two
SNPs, then the MNP is considered to be a strict superset of the two SNPs.

Variant Type The type of the variant called.

• SNP—single nucleotide polymorphism.
• IND—insertion.
• DEL—deletion.
• MNP—multiple nucleotide polymorphism or the substitution of a block
sequence by the block of another length.
• COMPLEX—Block substitution of sequence by a block of unequal length.

Torrent Suite™ Software 5.18 User Guide 205

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

(continued)

Column Description

Allele Source Allele source is called as:

• Hotspot—for alleles included in the hotspots file.
• Novel—for all other alleles.

Allele Name The allele name as defined in the hotspots file.

For novel alleles, the name is defined as tvc.novel.#.

Gene ID The Gene ID as defined in the target regions file.

Region Name The region name as defined in the target regions file.

View coverage metrics

You can view the following information in the View Coverage Metrics tab of the Variant Calls by Allele
table. The columns that are available on this tab vary according to the run type.

Column Description

Total Read Cov Total read coverage at this position, after downsampling.
Variants calls are made on a sample of reads when coverage is higher than
specified in the parameter settings file. This is referred to as "downsampling".
For more information, see downsample_to_coverage in “variantCaller plugin
advanced parameters” on page 215.

Read Cov +[1] Total read coverage on the forward strand, after downsampling.

Read Cov -[1] Total read coverage on the reverse strand, after downsampling.

Allele Read Cov The number of reads that contain this allele, after downsampling.

Allele Read Freq[2] The frequency of this allele across all reads.

Total Mol Cov[2] The number of molecules covering this location.

Allele Mol Cov[2] The number of detected molecules containing this allele.

Allele Mol Freq[2] The frequency of molecules containing this allele.

Allele Cov +[3] Allele coverage on the forward strand, after downsampling.

Allele Cov -[3] Allele coverage on the reverse strand, after downsampling.

Strand bias[3] The discrepancy between allele frequencies on the forward and reverse strands.
[1] This column is unavailable for sequencing runs that use Tag Sequencing as the target technique.
[2] This column is only shown for sequencing runs that use Tag Sequencing or Ion AmpliSeq™ HD as the target technique.
[3] This column is unavailable for sequencing runs that use Tag Sequencing or Ion AmpliSeq™ HD as the target technique.

206 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

View quality metrics

You can view the following information in the View Quality Metrics tab of the Variant Calls by Allele
table.
This tab does not appear in Tag Sequencing runs.

Column Description

Common Signal Shift The distance between predicted and observed signal at the allele locus. [RBI]

Reference Signal Shift The distance between predicted and observed signal in the reference allele.
[REFB]

Variant Signal Shift The distance between predicted and observed signal in the variant allele. [VARB]

Relative Read Quality The Phred-scaled mean log-likelihood difference between the prediction under
reference and variant hypothesis. [MLLD]

HP Length Homopolymer length.

Context Error + The probability of sequence-specific error on the forward strand (reported only
for deletion variants).

Context Error - The probability of sequence-specific error on the reverse strand (reported only
for deletion variants).

Context Strand Bias Basespace strand bias (reported only for deletion variants).

Values that cause a candidate to be filtered out are shown in colored cells. For candidates that are
filtered out, the column name shows the filtering reason.

Torrent Suite™ Software 5.18 User Guide 207

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

Export variant calls to a file

You can export variant calls to a tab-separated file that can be opened using spreadsheet software
such as Microsoft™ Excel™. The exported file is named subtable.xls and has the same columns that
are included in the Variant Calls by Allele table. The file includes columns for all three display options:
View Allele Annotations, View Coverage Metrics, and View Quality Metrics.

1. In the Data tab, in the Completed Runs & Reports screen, click the report name of the run from
which you want to export variant calls to a file.

2. In the left navigation menu, click variantCaller, then open the detailed variantCaller plugin report
for a specific barcode or sample.
• In the Barcode name column in a barcoded sequencing run report, click the barcode name
link.
• In the Sample column in a report from a sequencing run that does not contain barcodes, click
the sample name link.

3. In the Variant Calls by Allele table, select the checkbox in the row of each variant that you want to
export, then click Export Selected.

4. Select Download table file of selected rows, then click OK.

The subtable.xls file is created and downloaded to your computer.

5. (Optional) View the file, then save it to your local storage using a descriptive file name.

208 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

Troubleshoot variantCaller plugin results

You can troubleshoot results in the variantCaller plugin detailed report to analyze why expected variants
were missed (false negatives) or to examine false positives. Plugin parameters can be adjusted and
the plugin can be rerun. You can also export troubleshooting results to share them with a field
bioinformatics specialist (FBS).

Find false negatives with an alignment viewer

When an expected variant is not called by the variantCaller plugin, an alignment viewer, such as
Integrative Genomics Viewer (IGV) or Ion Reporter™ Genomic Viewer (IRGV) can help you confirm the
absence of the variant in the sample, or help you understand how to adjust the plugin parameters to
enable the plugin to call the variant. Using the IGV or IRGV can reveal problems such as mismapping
or low coverage. In particular, an alignment viewer lets you visually inspect the coverage of the region
where the variant is expected, and focus attention on the depth of coverage and the quality of the
bases covering the position of the variant. Low coverage or low base quality can explain a no-call. A
genomic viewer can also reveal that variant is slightly misplaced (especially for INDELs) and therefore
not called.

1. On the detailed variantCaller plugin summary report screen, click IGV to open the viewer.

Torrent Suite™ Software 5.18 User Guide 209

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

2. In the viewer, select the chromosome where the variant of interest is located, scroll to the
chromosomal position of the variant, then zoom in until you can read the nucleotide sequence
surrounding the variant allele.

210 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

3. Hover over a variant read to view read analytics.

4. Adjust plugin parameters.

5. Rerun the variantCaller plugin.

Find false negatives by using the variantCaller plugin report

You can use built-in variantCaller plugin tools to display and examine call details.

• If a hotspots file was used:

a. Check that the position of the variant is included in the hotspots file.
b. Check the Variant Calls output table. Values that cause a candidate to be filtered out are
shown in colored cells. For candidates that are filtered out, the column name shows the
filtering reason.

Torrent Suite™ Software 5.18 User Guide 211

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Review variantCaller plugin run results

c. Adjust plugin parameters.

d. Rerun the variantCaller plugin.
• If a hotspots file was not used:
a. Navigate to the variantCaller plugin results directory on the Ion Torrent™ Server and open the
small_variants_filtered.vcf file.
– Open the detailed report in Torrent Suite™ Software, then click the Barcode Name link in
a report from a barcoded sequencing run. Or, click the Sample Name link in a report from
a non-barcoded sequencing run. Scroll to, or search for the small_variants_filtered.vcf
link. You can click the link to view the file in the browser or download the file to your
computer.
– On Linux backend, the variantCaller plugin results directory can be found
at /results/analysis/output/Home/{analysis_report_name}/plugins/vari
antCaller/ for non-barcoded runs
or /results/analysis/output/Home/{analysis_report_name}/plugins/vari
antCaller/{bar code}/ for barcoded runs.
b. Find the location of the variant, then examine the FR (filtered reason) field.
c. Relate the reason to plugin run parameters using the parameter definitions in “variantCaller
plugin advanced parameters” on page 215.
d. Adjust plugin parameters.
e. Rerun the variantCaller plugin.

Fix false positives

False positives are usually related to artifacts that create unexpected amplification, such as a primer-
dimer or contamination problems. Some false positives are reported because of the difficulties inherent
with the handling of homopolymer regions.
Use one of the following methods to resolve these issues:
• Adjust parameters that control the homopolymer calls. This can increase the report of false
negatives.
• If you are repeatedly running a panel, manually curate specific sites (positions), since the false
positive tends to occur in the same positions.

The variantCaller plugin does not support manual curation. Manual curation is available in the
command-line version.

212 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
Review variantCaller plugin run results 8

Export files for troubleshooting

Torrent Suite™ Software includes a tool that helps you determine why variant calls are unclear in
analyses. You can use the Slicer tool to select one or more variant calls, then export the related data as
miniature BAM, BED, and VCF files. You can then share these files with a field bioinformatics specialist
for further review.
Navigate to the variantCaller plugin output table, then follow the steps listed below.

1
Click Show Troubleshooting.
2
Select the variant or variants of interest.
3
Click Export for Troubleshooting.
4
Enter the Expectant Variant.
5
Click Export.
6
Wait for the export process to complete, then click Download the zip.
The compressed directory of miniature BAM, BED, and VCF files is downloaded to a directory on the
computer, basesd on the browser settings.

Torrent Suite™ Software 5.18 User Guide 213

 Chapter 8 Variant calls in Torrent Suite™ Software
8 Save adjusted parameters to a variantCaller plugin configuration

Save adjusted parameters to a variantCaller plugin

configuration
You can adjust the variantCaller plugin parameters that are used for the barcode, then save the adjusted
parameters to a configuration.
The reference genome, target regions, and hotspots files in the saved configuration inherit the files that
are used to obtain the variantCaller plugin results for this barcode.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name for the completed
sequencing run of interest.

2. In the left navigation menu click variantCaller, or scroll to the variantCaller results section.

3. Click the barcode name link to open the detailed variantCaller plugin summary.

4. Click Show Filter Settings, then adjust the Parameter threshold values.

5. Enter the Configuration Name that stored the adjusted parameters, then click Save to
Configuration.

6. To apply the updated configuration to additional barcodes, run the plugin manually, then assign the
saved configuration with the adjusted parameters to the desired barcodes.

214 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
variantCaller plugin advanced parameters 8

variantCaller plugin advanced parameters

Advanced parameter settings for the variantCaller plugin allow additional customization of the variant
calling algorithm and are for use only by advanced users.
In general, you can safely customize parameters for SNP calling. For INDEL calling, changes to the
parameters tend to have a significant impact on the number of INDELs called. As a result, consider the
tradeoff between sensitivity and specificity for INDEL calls when you optimize customized parameters.
The variant calling pipeline in the variantCaller plugin contains three modules:
• Torrent Variant Caller module—The Torrent Variant Caller module evaluates the list of candidates
and examines evidence for the variants in flow space.
• FreeBayes module—The FreeBayes module, as a candidate generator, generates lists of variant
candidates.
• Long INDEL Assembler module—Some long INDELs, if improperly aligned to the reference
genome, may not be discovered and evaluated by the FreeBayes and the Torrent Variant Caller
modules. The purpose of the Long INDEL Assembler module is to call these long INDELs. A
unification step in the pipeline combines the variants that are called by the Torrent Variant Caller
and the Long INDEL Assembler module into one VCF file. The VCF file is available to the software.

Torrent Variant Caller module advanced settings

The following table lists and describes the Torrent Variant Caller module advanced settings.

IMPORTANT! The advanced parameters and settings are recommended for advanced users only. If
you need help setting advanced parameters, contact your local Field Service Engineer.

Torrent Variant Caller advanced parameters and settings

Parameter Description

X_min_allele_freq X is one of the allele types in {indel, snp, mnp, hotspot}.

A variant evaluation parameter: The presence of the allele of the type is defined
by which allele frequency is greater than this value.
Allowed values: Decimal between 0 and 1
Suggested trial value: between 0.01 (somatic) and 0.2 (germline)

X_min_variant_score X is one of the allele types in {indel, snp, mnp, hotspot}.

A filter parameter: A called allele of the type needs to have a QUAL score greater
than this Phred-scaled value.
Filter reason: quality score.
Related VCF fields: QUAL
Allowed values: Decimal values ≥ 0
Suggested trial value: > 10

Torrent Suite™ Software 5.18 User Guide 215

 Chapter 8 Variant calls in Torrent Suite™ Software
8 variantCaller plugin advanced parameters

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

X_min_coverage X is one of the allele types in {indel, snp, mnp, hotspot}.

A filter parameter: The location of a called allele of the type needs to have a
coverage greater than this value.
Filter reason: MINCOV
Related VCF fields: FRO, FAO
Allowed values: Integers ≥ 0
Suggested trial value: between 5 and 20

X_min_cov_each_stra X is one of the allele types in {indel, snp, mnp, hotspot}.

nd
A filter parameter: Minimum coverage required on each strand for a the type of
allele to be called.
Filter reason: PosCov or NegCov
Related VCF fields: FSRF, FSRR, FSAF, FSAR
Allowed values: Integers ≥ 0
Suggested trial value: ≥ 3

X_strand_bias X is one of the allele types in {indel, snp, mnp, hotspot}.

A filter parameter: A candidate allele of the type will be filtered out if its strand
bias p-value is less than X_strand_bias_pval, and its strand bias is greater
than X_strand_bias. The parameter is critical for filtering out the false positive
calls due to the strand-specific sequencing error.
Filter reason: STDBIAS and STDBIASPVAL
Related VCF field: STB
Allowed values: Decimal numbers between 0.5 (requires perfect balance on
both strands) and 1.0 (tolerates extremely strong strand bias)
Suggested trial value: 0.95

X_strand_bias_pval X is one of the allele types in {indel, snp, mnp, hotspot}.

A filter parameter: A candidate allele of the type will be filtered out if its strand
bias p-value is less than X_strand_bias_pvall and its strand bias is greater
than X_strand_bias.
Filter reason: STDBIAS and STDBIASPVAL
Related VCF field: STBP
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.01 for strand bias filter, 1 for no strand bias filter

216 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
variantCaller plugin advanced parameters 8

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

X_min_var_coverage X is one of the allele types in {indel, snp, mnp, and hotspot}.
A filter parameter: Minimum number of variant coverage after flow-evaluation
required to make the call.
Filter reason: VarCov
Related VCF field: FAO
Allowed values: Integer ≥ 0
Suggested trial value: 3 (TagSequencing or AmpliSeq HD), 0 (other)

downsample_to_cover Reduce coverage in over-sampled locations to this value to save computational

age time.
Allowed values: Integers ≥1
Suggested trial value: 400 (germline), 2000 (somatic)

use_fd_param (experimental in Torrent Suite™ Software 5.4)

A filtering parameter: Use Flow Disruptiveness (FD) instead of allele types
(INDEL, SNP, MNP) as the criterion to select the parameter set.
If turned on, the (non-FD, weak FD, strong FD) allele applies the (INDEL, SNP,
MNP) parameters, respectively.
If powered on, the (non-FD, weak FD, strong FD) allele applies the (INDEL, SNP,
MNP) parameters, respectively.
Allowed values: 0: do not use FD parameters, 1: use FD parameters.

data_quality_string A filter parameter: A called variant needs to have a mean log-likelihood

ency difference per read greater than this Phred-scaled value.
Filter reason: STRINGENCY
Related VCF field: MLLD
Allowed values: Decimal numbers ≥ 0
Suggested trial value: ≥ 6.5

filter_unusual_pred A filter parameter: A called variant needs to have RBI less than this value. The
ictions parameter is critical for filtering out the false positive calls due to the strand-
specific sequencing error.
Filter reason: PREDICTIONSHIFTx
Related VCF fields: RBI = sqrt(FWDB ^ 2 + REVB ^ 2)
Allowed values: Decimal numbers ≥ 0
Suggested trial value: 0.3

Torrent Suite™ Software 5.18 User Guide 217

 Chapter 8 Variant calls in Torrent Suite™ Software
8 variantCaller plugin advanced parameters

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

filter_deletion_pre A filter parameter: Filter out a deletion if the observed clusters deviate from
dictions predictions more than this amount.
Filter reason: PREDICTIONVarSHIFTx or PREDICTIONRefSHIFTx
Related VCF fields: VARB, REFB
Allowed values: Decimal numbers ≥ 0
Suggested trial value: 0.2

filter_insertion_pr A filter parameter: Filter out an insertion if the observed clusters deviate from
edictions predictions more than this amount.
Filter reason: PREDICTIONVarSHIFTx or PREDICTIONRefSHIFTx
Related VCF fields: VARB, REFB
Allowed values: Decimal numbers ≥ 0
Suggested trial value: 0.2

min_callable_prob A reporting parameter (TagSeq/AmpliSeq HD only): The minimum callable

probability for the calculation of Limit Of Detection (LOD).
• LOD is defined to be the lowest possible allele frequency in the sample
such that the variant is callable with probability greater than this value,
when the molecular depth is given.
• Allowed values:Decimal numbers between 0 and 1
• Suggested trial value:0.98

min_fam_per_strand_ An evaluation parameter for Tag Sequencing and Ion AmpliSeq™ HD runs only:
cov Minimum required coverage of reads on each strand in a bi-directional functional
molecular tag family.
Allowed values: Integers ≥ 0
Suggested trial value: 1

min_tag_fam_size An evaluation parameter for Tag Sequencing and Ion AmpliSeq™ HD runs only:
Minimum number of reads with same molecular tag required to form a functional
molecular family.
Allowed values: Integer ≥ 1
Suggested trial value: 3

tag_trim_method An evaluation parameter for Tag Sequencing and Ion AmpliSeq™ HD only:
Requirement of the molecular tag of the read must match the format specified in
the Planned Run.
Allowed values: strict-trim (requires match), sloppy-trim (does not require
match)
Suggested trial value: sloppy-trim

218 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
variantCaller plugin advanced parameters 8

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

indel_func_size_off An evaluation parameter for Tag Sequencing and Ion AmpliSeq™ HD runs only:
set requires a family size ≥ (min_tag_fam_size + this value) to be functional for
calling HP-INDEL.
Allowed values: Integers ≥ 0
Suggested trial value: 0

heavy_tailed A variant evaluation parameter: (2*heavy_tailed-1) is the degree of freedom of

the t-distribution for modeling the heavy tail in signal residual distribution.
Allowed values: Integers ≥ 1
Suggested trial value: 3

outlier_probability A variant evaluation parameter: probability that a read comes from none of the
models under consideration.
The variantCaller plugin will make NOCALL with filter reason REJECTION if FXX
is too high.
Related VCF field: FXX
Allowed values: Decimal numbers between 0 and 1.0
Suggested trial value: between 0.005 and 0.01

prediction_precisio A variant evaluation parameter: The number of pseudo data points suggesting
n our predictions match the measurements without bias.
Allowed values: Decimal numbers ≥ 0.1
Suggested trial value: 1.0

max_flows_to_test A variant candidate evaluating parameter: The maximum number of scoring

flows being used.
Allowed values: Integers > 0
Suggested trial value: 10

suppress_recalibrat A variant evaluation parameter: Homopolymer recalibration values should not be

ion used when set.
Allowed values: 0 = enable recalibration, 1 = disable recalibration
Suggested trial value: 0

do_snp_realignment A variant candidate evaluating parameter: Realign reads in the vicinity of SNP
candidates when set.
Related VCF content: REALIGNEDx
Allowed values: 0 = do not realign, 1 = realign
Suggested trial value: 0

Torrent Suite™ Software 5.18 User Guide 219

 Chapter 8 Variant calls in Torrent Suite™ Software
8 variantCaller plugin advanced parameters

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

do_mnp_realignment A variant candidate evaluating parameter: Realign reads in the vicinity of MNP
candidates when set.
Related VCF content: REALIGNEDx
Allowed values: 0 = do not realign, 1 = realign
Suggested trial value: 0

realignment_thresho A variant candidate evaluating parameter: Maximum allowed fraction of reads

ld where realignment causes an alignment change.
Related VCF content: SKIPREALIGNx
Allowed values: Decimals between 0 and 1
Suggested trial value: 1

min_ratio_for_fd A filter parameter: Claim flow-disruption if the portion of reads that are flow-
disrupted greater than or equal to this value.
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.1

indel_as_hpindel A filter parameter: A flag indicating whether INDEL filters or SNP filters should be
applied to non-HP INDELs.
Allowed values: 0 (false), 1 (true)

hp_max_length A filter parameter: HP indels of more than this length will be filtered out.
Filter reason: HPLEN
Related VCF field: HRUN
Allowed values: Integers ≥ 1
Suggested trial value: 8

hp_indel_hrun A filter parameter: Define the HRUN for filtering HP-INDEL variants with lengths
specified by hp_del_len and hp_ins_len.
Filter reason: HPINSLEN, HPDELLEN
Related VCF field: HRUN
Allowed values: Vector of positive integers (for example, [1,2,3]) with size
matches hp_del_len and hp_ins_len
Suggested trial value: []

220 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
variantCaller plugin advanced parameters 8

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

hp_ins_len A filter parameter: Filter out HP-INS variants whose INS length is less than
or equal to the corresponding entry of this vector if the HRUN is defined in
hp_indel_hrun.
Filter reason: HPINSLEN
Related VCF field: HRUN
Allowed values: Vector of non-negative integers (for example, [1,2,3]) with size
matches hp_del_len and hp_indel_hrun.
Suggested trial value: []

hp_del_len A filter parameter: Filter out HP-DEL variants whose DEL length is less than
or equal to the corresponding entry of this vector if the HRUN is defined in
'hp_indel_hrun'.
Filter reason: HPDELLEN
Related VCF field: HRUN
Allowed values: Vector of nonnegative integers (for example, [1,2,3]) with size
matches hp_ins_len and hp_indel_hrun.
Suggested trial value: []

use_position_bias A filter parameter: Enable the position bias filter when set.
Filter reason: POSBIAS, POSBIASPVAL
Allowed values: 0 = disable, 1= enable
Suggested trial value: (AmpliSeq) 1, (other) 0

position_bias A filter parameter: Filter out a variant if the position bias is greater
than position_bias and the position bias p-value is less than
position_bias_pval.
Filter reason: POSBIAS, POSBIASPVAL Related VCF field: POSBIAS
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.75

position_bias_pval A filter parameter: Filter out a variant if the position bias is greater
than position_bias and the position bias p-value is less than
position_bias_pval.
Filter reason: POSBIAS, POSBIASPVAL Related VCF field: POSBIASPVAL
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.05

Torrent Suite™ Software 5.18 User Guide 221

 Chapter 8 Variant calls in Torrent Suite™ Software
8 variantCaller plugin advanced parameters

Torrent Variant Caller advanced parameters and settings (continued)

Parameter Description

position_bias_ref_f A filter parameter: Skip the position bias filter if (reference read count) /
raction (reference and alt read count) ≤ this value.
Filter reason: POSBIAS, POSBIAS-PVAL
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.05

error_motifs The file name of the error motif file

sse_prob_threshold A filter parameter: Filter threshold for motif-predicted error probability.

Filter reason: NOCALLxPredictedSSE, NOCALLxPositiveSSE,
NOCALLxNegativeSSE
Related VCF fields: SSEP, SSEN
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.02

report_ppa A reporting parameter: Report Possible Polyploidy Alleles (PPA) in the VCF file
and the variant calls in the XLS files.
Related VCF field: PPA
Allowed values: 1 = report PPA, 0 = do not report
Note: This feature is experimental and by default is set to report_ppa = 0 (do
not report).

222 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
variantCaller plugin advanced parameters 8

FreeBayes module advanced settings

The FreeBays module advanced parameter settings control the behavior of the FreeBayes module,
a module within the variantCaller plugin, which performs read filtering and generates lists of variant
candidates.

IMPORTANT! The advanced parameters settings are recommended for advanced users only. If you
need help setting advanced parameters, contact your local Field Service Engineer.

Parameter Description

allow_indels Candidate generation parameter: Allow INDEL candidates to be generated when

set.
Allowed values: 0 = does not generate indel candidates, 1 = generates INDEL
candidates
Suggested trial value: 1

allow_snps Candidate generation parameter: Allow SNP candidates to be generated when

set.
Allowed values: 0 = does not generate SNP candidates, 1 = generates SNP
candidates
Suggested trial value: 1

allow_mnps Candidate generation parameter: Allow MNP candidates to be generated when

set.
Allowed values: 0 = does not generate MNP candidates , 1 = generates MNP
candidates
Suggested trial value: 1

allow_complex Candidate generation parameter: Allow complex variant candidates to be

generated when set.
Allowed values: 0 = does not generate complex candidates, 1 = generates
complex candidates
Suggested trial value: 1

gen_min_alt_allele_ A candidate generation parameter: A non-HP-INDEL candidate needs to have an

freq allele frequency greater than this value in the pileup.
Allowed values:Decimal numbers between 0 and 1
Suggested trial value: 0.02 to 0.15

gen_min_indel_alt_a A candidate generation parameter: An HP-INDEL candidate needs to have an

llele_freq allele frequency greater than this value in the pileup.
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.02 to 0.15

Torrent Suite™ Software 5.18 User Guide 223

 Chapter 8 Variant calls in Torrent Suite™ Software
8 variantCaller plugin advanced parameters

(continued)

Parameter Description

gen_min_coverage A candidate generation parameter: A variant candidate location needs to have

coverage depth greater than this value.
Allowed values: Integers ≥ 0
Suggested trial value: 6

min_mapping_qv A read filtering parameter: Minimum mapping quality value required for a read to
be counted (for both candidate generation and variant evaluation).
Allowed values: ≥ 0
Suggested trial value: 4

read_snp_limit A read filtering parameter: Do not use reads with number of SNPs above this.
Allowed values: Integers ≥ 0
Suggested trial value: 10

read_max_mismatch_f A read filtering parameter: Ignore reads with fraction of mismatch greater than
raction this value.
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 1.0

min_cov_fraction A read filtering parameter: Do not use reads with fraction of covering the best
assigned unmerged target region below this.
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.9 (TagSequending and Ion AmpliSeq™ HD), 0
(otherwise)

read_mismatch_limit A read filtering parameter: Do not use reads with number of mismatches (where
1 gap open counts 1) above this value.
Allowed values: Integers ≥ 0 (0 disables the filter)
Suggested trial value: 5 (Tag Sequencing and Ion AmpliSeq™ HD), 0 (other)

224 Torrent Suite™ Software 5.18 User Guide

 Chapter 8 Variant calls in Torrent Suite™ Software
variantCaller plugin advanced parameters 8

Long INDEL Assembler module advanced settings

The Long INDEL Assembler module advanced parameter settings control the behavior of the Long Indel
Assembler module, a module within the variantCaller plugin.

IMPORTANT! The advanced parameters settings are recommended for advanced users only. If you
need help setting advanced parameters, contact your local Field Service Engineer.

Parameter Description

kmer_len Size of the smallest k-mer used in assembly.

Impact: Increasing values make INDEL calls less sensitive but more specific.
Allowed values: Integers ≥ 5
Suggested trial value: 11 and 30

min_var_freq Minimum frequency of the variant to be reported.

Impact: Increasing values make INDEL calls less sensitive but more specific.
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.1 and 0.4

min_var_count Minimum support for a variant to be evaluated.

Impact: Increasing values make INDEL calls less sensitive but more specific.
Allowed values: Integers > 1
Suggested trial value: 3 and 30

short_suffix_match Minimum assembled sequence match on both sides of the variant.

Impact: Increasing values make INDEL calls less sensitive but more specific.
Allowed values: Integers > 2
Suggested trial value: 4 and kmer_len

min_indel_size Minimum size indel reported by assembly.

Impact: Increasing values make INDEL calls less sensitive but more specific.
Allowed values: Integers > 0
Suggested trial value: 2 and 30

max_hp_length Variants containing HP larger than this are not reported.

Impact: Increasing values make INDEL calls more sensitive but less specific.
Allowed values: Integers > 1
Suggested trial value: 2 and 11

Torrent Suite™ Software 5.18 User Guide 225

 Chapter 8 Variant calls in Torrent Suite™ Software
8 variantCaller plugin advanced parameters

(continued)

Parameter Description

relative_strand_bia Variants with strand bias above this are not reported.
s
Impact: Increasing values make INDEL calls more sensitive but less specific.
Allowed values: Decimal numbers between 0 and 1
Suggested trial value: 0.6 and 1.0

output_mnv Enables reporting of complex variants.

Allowed values: 1 = report complex variants, 0 = don't report
Suggested trial value: 0

Advanced argument settings

Parameter Description

Torrent Variant Caller arguments Advanced arguments for Torrent Variant Caller.

Alignment arguments Desirable alignment arguments for variant calling purpose.

Realignment of the BAM file may be triggered in the plugin if the entry
is different from the alignment arguments specified in the run plan.

Unify vcf arguments Advanced manipulation of the variant calling VCF file.

SVB BED file Full path to a previously uploaded sequence

variant baseline (SVB) BED file. For
example, /results/uploads/BED/65536/foo/unmerged.

226 Torrent Suite™ Software 5.18 User Guide

 9 Integration with Ion Reporter™
Software

■ About Ion Reporter™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228

■ Install the IonReporterUploader plugin on an Ion Torrent™ Server . . . . . . . . . . . . . . . . . . . . . . . . . . 229
■ Set up an account for IonReporterUploader plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
■ Automatically transfer Torrent Suite™ Software output to Ion Reporter™ Software . . . . . . . . . . . 231
■ Run the IonReporterUploader plugin manually . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
■ IonReporterUploader plugin configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 236
■ IonReporterUploader plugin file transfer progress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238
■ Tune IonReporterUploader plugin speed parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
■ Review IonReporterUploader plugin results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
■ IonReporterUploader command-line utility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243

Torrent Suite™ Software 5.18 User Guide 227

 Chapter 9 Integration with Ion Reporter™ Software
9 About Ion Reporter™ Software

About Ion Reporter™ Software

Ion Reporter™ Software performs analysis on BAM files that are output from Torrent Suite™ Software.
VCF output files, that result from using the variantCaller plugin, can also be transferred and used for Ion
Reporter™ Software analyses, if an annotation-only analysis workflow is used to process the files in Ion
Reporter™ Software.
To transfer these BAM and VCF output files to Ion Reporter™ Software, you must add one or more
Ion Reporter™ Software accounts. You can add accounts at any time, or when you configure the
IonReporterUploader plugin. After an account is configured, there are several ways that you can transfer
files to an organization in Ion Reporter™ Software.
• Torrent Suite™ Software can automatically transfer files from a completed run report to Ion
Reporter™ Software and either make them available:
– As analyses in Ion Reporter™ Software. In this case, the output files are transferred to Ion
Reporter™ Software and the analysis workflow of your choice for use in Ion Reporter™ Software
is automatically launched on your newly transferred samples.
– In Ion Reporter™ Software as BAM and VCF files that can be later defined as samples in Ion
Reporter™ Software.
• You can optionally choose to upload data manually to Ion Reporter™ Software Use this option if,
for example, you want to upload data to Ion Reporter™ Software multiple servers. To upload data
manually from Torrent Suite™ Software to Ion Reporter™ Software, do one of the following:
– Run the IonReporterUploader plugin manually from a completed run report.
– Select the option to review results from a completed run in Torrent Suite™ Software when you
create a Planned Run.

When the IonReporterUploader plugin defines samples from the newly transferred samples for Ion
Reporter™ Software, sample relationships for paired and trio samples and sample attributes are also
defined. For details, see “Sample gender” on page 235.
Ion Reporter™ Software is available under separate license and is not included with Torrent Suite™
Software.

228 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
Install the IonReporterUploader plugin on an Ion Torrent™ Server 9

Install the IonReporterUploader plugin on an Ion Torrent™

Server
The IonReporterUploader plugin is installed automatically on an Ion Torrent™ Server when you update to
a new release of Ion Reporter™ Software.
To update the IonReporterUploader plugin on Ion Reporter™ Software that is connected to the Internet,
you can use the off-cycle plugin upgrade process. For details, see “Enable off-cycle product updates”
on page 329 and “Update off-cycle release plugins” on page 331.
If you do not have an internet connection, then download and install the latest version that is named
IonReporterUploader_<version>.deb from http://iru.ionreporter.thermofisher.com/.

1. Click (Settings)4Plugins.

2. In the list of plugins, click Install or Upgrade Plugin.

3. Click Upload a Plugin file, then browse to and select the IonReporterUploader.zip file that you
downloaded.

4. Click Open, then click Upload and Install.

The new IonReporterUploader plugin is added to the list of plugins in Torrent Suite™ Software.

Set up an account for IonReporterUploader plugin

Before you can transfer files to Ion Reporter™ Software with the IonReporterUploader plugin, you must
configure a valid Ion Reporter™ Software account. Torrent Suite™ Software uses the account information
to transfer output files to an Ion Reporter™ Software organization.
You can add more than one account for the IonReporterUploader plugin. When you add multiple
accounts, any available account can be selected when you run the plugin, or when you manually upload
output files to Ion Reporter™ Software. You can upload the Torrent Suite™ Software output files to any of
the Ion Reporter™ Software accounts that are available in Torrent Suite™ Software.

IMPORTANT! When you upgrade to a new version of Ion Reporter™ Software, you must reconfigure
the IonReporterUploader plugin with an Ion Reporter™ Software account that is set up for the
new version of Ion Reporter™ Software. This account must be set up before you can access the
IonReporterUploader plugin from the updated software.
When an account is set up, two email notifications are sent each time that an IonReporterUploader
plugin finishes a run. The first email is sent when the plugin run starts. Another email is sent when the
upload to Ion Reporter™ Software is complete. The notifications are sent to the email address of the Ion
Reporter™ Software user who is signed in when the IonReporterUploader plugin is launched.

Torrent Suite™ Software 5.18 User Guide 229

 Chapter 9 Integration with Ion Reporter™ Software
9 Set up an account for IonReporterUploader plugin

If you use Ion Reporter™ Software on Thermo Fisher™ Connect Platform you must have an access code
to complete this procedure. An access code is not required for Ion Reporter™ Server.

1. If you do not already have an access code for use with Ion Reporter™ Software on Thermo Fisher™
Connect Platform, create an access code for use with the IonReporterUploader plugin setup. If you
use Ion Reporter™ Server, proceed to Step 2.
a. Sign into Ion Reporter™ Software.

b. Click (Settings)4 Manage Tokens.

c. Click Set New Access Code, then enter an access code in the New Access code field.
The access code must contain at least 6 characters. The maximum length of the access code
is 50 characters.

d. Select an expiration time in the Access code Age dropdown menu, then click Save and
Generate.

Note: The IRU token is used for the IonReporterUploader command-line utility. The API
token is used internally for the Ion Reporter™ Software Web services API. Neither token is
required for this procedure. For more information, see Ion Reporter™ Software system help.

The access code that you must use to set up the IonReporterUploader plugin is shown in the
Manage Tokens dialog box. Save this access code for use in future account setups. Alternatively,
you can reset the access code as needed.

2. In Torrent Suite™ Software, click (Settings)4 Ion Reporter Configure:

3. In the Ion Reporter Uploader Account Configuration screen, click Add Account, then select an
account type.
Option Selection
Ion Reporter™ Software on Connect Select Ion Reporter Cloud
Ion Reporter™ Software on an Ion Reporter™ Server Select Ion Reporter

4. In the Add Ion Reporter account screen, enter the appropriate account information.
Ask your system administrator for values for a local Ion Reporter™ Server.

Item Selection
Server Type Enable HTTPS.
Display Name Enter a name of your choice for the account. This name can be selected
when you configure a Planned Run template or run the IonReporterUploader
plugin manually. Use only the alphanumeric, dash, underscore, and space
characters.
Server Enter: 40.dataloader.ionreporter.iontorrent.com, or the address for your local
Ion Reporter™ Server.
Port 443 is the port number that is automatically populated.

230 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
Automatically transfer Torrent Suite™ Software output to Ion Reporter™ Software 9

(continued)
Item Selection
Username Enter your Ion Reporter™ Software username (your email address).
Password For Ion Reporter™ Software on Thermo Fisher™ Connect Platform. Enter the
access code.
For Ion Reporter™ Server, enter the password.

5. Select one of the following account options:

• Default—The account that is configured by default in the Planned Run templates and Planned
Runs. If the main account is for file transfers, select the Default checkbox. You can change
the default account after you set up a Planned Run template, or through the Upload to IR
menu on the completed run report.
• Get Versions—Select an available version of the software.
This option is available if multiple versions of Ion Reporter™ Software are available and multiple
accounts are configured.

6. Click Add.

7. (Optional) The IonReporterUploader plugin can manage multiple configurations. To add another
configuration, repeat the procedure.

When at least one account is successfully configured, the IonReporterUploader plugin is ready to
transfer output files to Ion Reporter™ Software. If you set up multiple accounts, the accounts are listed
in the Upload to IR menu in the completed run report that you can use to upload output files manually
to Ion Reporter™ Software. The accounts are also listed when you configure an Ion Reporter™ Software
Planned Run or Planned Run template.

Automatically transfer Torrent Suite™ Software output to Ion

Reporter™ Software
To transfer output files from a Torrent Suite™ Software analysis to Ion Reporter™ Software automatically,
configure the IonReporterUploader plugin when you create a Planned Run.
The results files that are transferred to Ion Reporter™ Software can be:
• Automatically defined as samples Ion Reporter™ Software that are launched in an analysis workflow
immediately after the instrument run is complete. Successful analyses are then available in Ion
Reporter™ Software when you sign in with the account that is included in the setup.
IMPORTANT! To set up automatic transfer, you must select the IonReporterUploader plugin and
select the Ion Reporter™ Software analysis workflow in the Planned Run.

Torrent Suite™ Software 5.18 User Guide 231

 Chapter 9 Integration with Ion Reporter™ Software
9 Automatically transfer Torrent Suite™ Software output to Ion Reporter™ Software

• Made available in Ion Reporter™ Software as output files (BAM and VCF files) that can later be
defined as samples in Ion Reporter™ Software. In this case, you can define your samples and
then launch the analysis manually in Ion Reporter™ Software. This approach is commonly used to
annotate the VCF files, using the annotation-only analysis workflow in Ion Reporter™ Software.
VCF files are available as output files when you configure the IonReporterUploader plugin. For
details, see Chapter 8, “Variant calls in Torrent Suite™ Software”.

For sequencing runs that use barcoded data, select the correct barcode kit under Kits in the workflow
bar. When you select a barcode kit, a sample name field for each barcode is generated.
Use the plan by Sample Set feature when you configure Ion Reporter™ Software in your Planned Run or
template. For details, see “Plan by Sample Set” on page 63.

1. In the Plan tab, click Templates, then select a Research Application, for example, AmpliSeq
DNA.

2. Select a template that matches your panel.

For example, if you are using an Ion AmpliSeq™ Exome Panel, select the Ion AmpliSeq™ DNA
template with the same name.

3. Add samples, confirm the default settings, enter a plan name, then select Ion Reporter in the
workflow bar.

4. Select the Ion Reporter™ Software account that you want to use by default for the transfer of
output files to Ion Reporter™ Software.
Data files are transferred to the default Ion Reporter™ Software account, unless you change it
during run planning.
IMPORTANT! If you select None, you must transfer files from Torrent Suite™ Software manually to
Ion Reporter™ Software.

5. If the Ion Reporter™ Software account is not configured, click Configure to add an account.
For more information, see “Set up an account for IonReporterUploader plugin” on page 229.

6. Select a Sample Grouping that corresponds to the sample relationship in Ion Reporter™ Software.
When you select a Sample Grouping, the workflow bar in Ion Reporter™ Software displays only
analysis workflows that match the type of analysis workflows selected.

7. Select an option in the Existing Workflow menu.

Option Description
Ion Reporter Use this option to launch automatically the analysis workflow in Ion Reporter™
workflow for your Software with the sample data from the run. Successful analyses are available in
sample type Ion Reporter™ Software with the account and organization that you selected.
Upload Only Use this option to transfer only the output files from the sequencing run to Ion
Reporter™ Software. If you use this option, you can access the samples in Ion
Reporter™ Software. VCF files are also available if you ran the variantCaller plugin.

232 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
Automatically transfer Torrent Suite™ Software output to Ion Reporter™ Software 9

8. (Optional) Click Create New Workflow to open Ion Reporter™ Software in a new browser window.
In Ion Reporter™ Software, create your new analysis workflow, then save it.
When you return to Torrent Suite™ Software, refresh the browser. You can select the newly created
analysis workflow in the Existing Workflow menu.

9. Under Ion Reporter Upload Options, select an option.

Option Description
Review results after Use this option to review the completed run report and then manually
run completion, then transfer the data files to Ion Reporter™ Software.
upload to Ion Reporter
IMPORTANT! After you review the results in Completed Runs &
Results, you must click Upload to IR4Upload as Planned to upload
the data to Ion Reporter™ Software.

Automatically upload to Use this option to upload automatically results to Ion Reporter™ Software.
Ion Reporter after run If you select an analysis workflow, an Ion Reporter™ Software analysis is
completion launched immediately after the run. Successful analyses are then available
in Ion Reporter™ Software when you sign in with the account that is
included in the setup.

10. Continue with the steps to create the Planned Run.

For more information, see “Steps in the workflow bar” on page 44.

11. If appropriate, enter the gender of a sample.

For more information, see “Sample gender” on page 235.

12. To save the Planned Run or Planned Run template, do one of the following actions in the workflow
bar:
• Click Save for a new Planned Run template, enter the new template name, and optionally
mark it as a favorite.
• Click Save & Finish if you used Plan by Sample Set, then enter the new Planned Run name.
• Click Plan Run for a new Planned Run, then enter the new run plan name and sample
information.

13. The Planned Run is added to the Planned Runs table and can be used in an instrument run.

Torrent Suite™ Software 5.18 User Guide 233

 Chapter 9 Integration with Ion Reporter™ Software
9 Automatically transfer Torrent Suite™ Software output to Ion Reporter™ Software

Manage the Ion Reporter™ Software analysis workflow list

You can reduce the number of Ion Reporter™ Software analysis workflows that are listed when you
create a Planned Run or Planned Run template in Torrent Suite™ Software. To do so, use the Tag
for IRU label in Ion Reporter™ Software. Only workflows that use this tag are listed when you plan
instrument runs in Torrent Suite™ Software.

1. Sign in to Ion Reporter™ Software.

2. In the Workflows tab, click Overview.

3. Select an analysis workflow, then click Actions4Tag for IRU.

The Tag for IRU in the Details section for the analysis workflow is changed to Yes. Only analysis
workflows that include the Tag for IRU label are listed when you plan instrument runs in Torrent
Suite™ Software.

4. To undo, select Untag for IRU.

234 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
Run the IonReporterUploader plugin manually 9

Sample gender
Several analysis workflows in Ion Reporter™ Software, especially copy number variation detection and
Ion AmpliSeq™ IDP trio, are limited when the sample gender is unknown, and they return unexpected
results when the gender is incorrectly specified.
For example, in the Ion AmpliSeq™ IDP trio analysis workflow, when the gender of the proband is not
known, variants cannot be assigned in the categories HasMaleMaternalX and HasUnknownX.
If a sample with no gender is transferred from Torrent Suite™ Software to Ion Reporter™ Software, you
can go to the Define Samples step in Ion Reporter™ Software and edit the sample to specify the
gender attribute.

Note:
· You cannot edit samples that have been launched in an Ion Reporter™ Software analysis. Instead,
define new samples from the BAM or VCF data files, and add the correct gender metadata to the
new samples.
· the gender of the sample is not specified or is specified as "Unknown", the Integrative Genomics
If
Viewer uses female as the gender.

Run the IonReporterUploader plugin manually

You can run the IonReporterUploader plugin manually from a completed run report in Torrent Suite™
Software. This process transfers data from a completed sequencing run to Ion Reporter™ Software.
You might want to run IonReporterUploader plugin manually if after a sequencing run is completed, for
example, you want to annotate only variants, and therefore upload only VCF files. This option is not
available when the plugin is run from the Planned Run or run template. Instead both BAM and VCF files
are uploaded to Ion Reporter™ Software.
For barcoded runs, you can select the barcodes that you want to include in your plugin results. You
can also select the barcode kit on the instrument before the run, then run the plugin manually when the
run is complete. In this case, the barcode kit that you enter on the sequencer is used in the run. The
barcode kit that you select on the instrument overwrites the barcode kit that is selected in the Planned
Run.
When you run the plugin manually, you can select whether to upload only VCF files, only BAM files, or
both VCF and BAM files.
You can also see the barcoded samples that were used in the sequencing run. You can upload any
barcoded sample that includes a sample name.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link for your
completed sequencing run.

2. Click Plugins4Select Plugins to Run link, then click IonReporterUploader.

The Configure Plugin dialog box opens.

Torrent Suite™ Software 5.18 User Guide 235

 Chapter 9 Integration with Ion Reporter™ Software
9 IonReporterUploader plugin configuration

3. For runs that include barcoded samples, click Barcode Sample Settings.
You can select one or more samples to upload to Torrent Suite™ Software. Select the checkbox for
barcodes for the sample or samples that you want to upload. By default, all samples that include
sample names are selected for upload.
IMPORTANT! To upload a sample with a barcode, the barcode must include a sample name. If
you select a barcode for a sample that is not named, the IonReporterUploader plugin does not
upload the sample.

4. (Optional) To adjust speed parameters in IonReporterUploader plugin that change the rate at which
files are uploaded, click Advanced Settings.
a. Set the Number of Parallel Streams to Default (the recommended optimal speed) or select 1-5
to slow down upload.

b. Set File Segment Size to Default (recommended), or 16MB, 32MB, 64MB, or 128MB.

5. In the Upload Options section of the Configure Plugin dialog box, select the file types that you
want to upload: BAM, VCF, or BAM and VCF. Then click Launch IRU in the row next to the Ion
Reporter™ Software account that you want to use for the upload.

6. Click Yes to confirm that you want to upload the data.

Your upload starts. Upload times vary depending on the speed of your internet connection and the
size of the dataset being transferred. An email notification is sent when the upload is complete.
When the upload completes, you can sign in to Ion Reporter™ Software, then launch an analysis on
the new datasets.

IonReporterUploader plugin configuration

The following settings are configured when you set up accounts for the IonReporterUploader plugin. For
more information, see “Set up an account for IonReporterUploader plugin” on page 229.

Item Selection

Server Type Enable HTTPS.

Display Name Enter a name of your choice. This name can be selected when a run
plan template is created or edited and is visible to other Torrent Suite™
Software users. Use only the alphanumeric, dash, underscore, and
space characters.

Server Enter 40.dataloader.ionreporter.iontorrent.com.

Port Enter 443.

Username Enter your Ion Reporter™ Software user name (your email address).

Password For Ion Reporter™ Software on Thermo Fisher™ Connect Platform.

Enter the access code for use with the IonReporterUploader plugin
setup.
For Ion Reporter™ Server, enter the password.

236 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
IonReporterUploader plugin configuration 9

(continued)

Item Selection

Default Enable if this account is for automatic analyses in Ion Reporter™

Software.

Version Select the version for use with each account.

The following settings can be configured when you run the IonReporterUploader plugin manually.
You can select barcodes for the samples or samples that were used in the sequencing run. By selecting
these barcodes, you can select the samples that you want to upload to Ion Reporter™ Software. For
details, see “Run the IonReporterUploader plugin manually” on page 235.

Setting Description

Barcode Sample Settings Select the barcodes for the sample or samples used in the sequencing
run that you want to upload to Ion Reporter™ Software.

Select Ion Reporter™ Software Select the Ion Reporter™ Software account to use to upload files to Ion
account Reporter™ Software

Upload Options

BAM Select this option to upload only BAM files.

VCF Select this option to upload only VCF files.

BAM and VCF Select this option to upload both BAM and VCF files.

Advanced Settings For details on these settings, see “Tune IonReporterUploader plugin speed parameters”
on page 240.

Number of Parallel Streams Set the Number of Parallel Streams to Default (the recommended
optimal speed) or select 1-5 to slow down upload.

File Segment Size Set File Segment Size to Default (recommended), or to 16MB, 32MB,
64MB, or 128MB.

Torrent Suite™ Software 5.18 User Guide 237

 Chapter 9 Integration with Ion Reporter™ Software
9 IonReporterUploader plugin file transfer progress

IonReporterUploader plugin file transfer progress

You can monitor the progress of the transfer of analysis results files from Torrent Suite™ Software to Ion
Reporter™ Software.

To monitor IonReporterUploader
See details in…
plugin progress through…

Email Email notifications sent for each plugin run:

• When the plugin starts to transfer your files.
• When the upload to Ion Reporter™ Software is complete.

Email notifications are sent to the email address of the Ion Reporter™
Software user whose authentication token was used to configure the
plugin.

Torrent Suite™ Software “View plugin run status” on page 132.

Log files “Open a plugin log” on page 133.

View IonReporterUploader plugin status details

You can view a list of the run reports on which the IonReporterUploader plugin has been run, the plugin
completion status, and the sizes of the plugin output.

1. Click (Settings)4Plugins.
The installed plugins are listed.

2. Click (Actions)4Usage in the row of the IonReporterUploader plugin.

238 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
IonReporterUploader plugin file transfer progress 9

3. View the following information from the list of run reports:

• Time that a plugin run started and ended.
• Status of the plugin run.
• Size of the plugin run result output files.

Delete IonReporterUploader plugin report files

IMPORTANT! This action permanently deletes the IonReporterUploader plugin report for a run and
cannot be undone.

1. Sign in to Torrent Suite™ Software.

2. Click Settings ( )4Plugins. The installed plugins are listed.

3. Click Settings ( )Usage for IonReporterUploader plugin:

4. Click Delete on the row for the plugin report that contains the files that you want to delete.

The output files for the plugin report are deleted.

Torrent Suite™ Software 5.18 User Guide 239

 Chapter 9 Integration with Ion Reporter™ Software
9 Tune IonReporterUploader plugin speed parameters

Tune IonReporterUploader plugin speed parameters

You can adjust speed parameters for the IonReporterUploader plugin to change the rate at which files
are uploaded.
Update these settings only if file transfers from IonReporterUploader plugin are difficult or slow with the
default settings.

1. In the Data tab, click Completed Runs & Reports.

2. Click Plugins4Select Plugins to Run, then select IonReporterUploader.

3. Click Advanced Settings.

a. Set the Number of Parallel Streams to Default (the recommended optimal speed) or select 1-5
to slow down upload.

b. Set File Segment Size to Default (recommended), or 16MB, 32MB, 64MB, or 128MB.

Review IonReporterUploader plugin results

1. In the Data tab, click Completed Runs & Reports.

2. In the list of runs, find the run of interest, then click the link in the Report Name column.

3. In the left navigation menu, click IonReporterUploader to view the plugin results.

240 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
Review IonReporterUploader plugin results 9

4. From the IonReporterUploader plugin, you can view information that is related to the data transfer,
including the name of the Ion Reporter™ Server used, the version of Ion Reporter™ Software that is
on the server, the server directory that contains the uploaded files, and the Ion Reporter™ Software
organization and user account that was used. You can also review details about barcoded samples
that were uploaded with the IonReporterUploader plugin, or failed to upload.
To do this Click
View error messages associated with the plugin run. Errors
View warnings that contain details about the barcoded samples that are Warnings
used in the plugin run.
Show or hide a detailed status of the pre- and post-processing of the data Show detailed
transfer. status/Hide detailed
status
Open a report the data transfer in a separate browser tab. Stdout
Open the plugin log files in a separate browser tab. Log
Open a startplugin.json file that contains metadata used by the Input
plugin.
Download a CSV file that contains a list of the uploaded and defined Download CSV list
samples. of samples that are
uploaded and defined
Download a compressed directory of the IonReporterUploader plugin log Download IRU logs
files and other plugin files

Torrent Suite™ Software 5.18 User Guide 241

 Chapter 9 Integration with Ion Reporter™ Software
9 Review IonReporterUploader plugin results

Torrent Suite™ Software output and Ion Reporter™ Software analysis phases
Typically the BAM file output of your Torrent Suite™ Software analysis is uploaded to Ion Reporter™
Software and then the software runs through major analysis phases:
1. Mapping
2. Variant calling
3. Annotation

The following table describes how Torrent Suite™ Software output files are used in Ion Reporter™
Software analyses.

242 Torrent Suite™ Software 5.18 User Guide

 Chapter 9 Integration with Ion Reporter™ Software
IonReporterUploader command-line utility 9

Torrent Suite™ Software output Output from this Torrent Suite™ Input to this Torrent Suite™
file Software analysis phase Software workflow

BAM file Torrent Suite™ Software analysis Any except annotation-only

pipeline

VCF file Torrent Suite™ Software Annotation-only

variantCaller plugin

The IonReporterUploader plugin by default uploads both the BAM file and the VCF file from the Ion
Torrent™ Server to Torrent Suite™ Software.
The following table describes the input and output file types for the analysis phases.

Analysis phase Input file type Output file type

Mapping BAM file (mapped or unmapped) Mapped BAM file

Variant calling Mapped BAM file VCF file

Annotation VCF file (with or without Annotated VCF file

annotations)

Each output file type is required as input to the next analysis phase. In almost all cases, the Ion
Reporter™ Software analysis phases are performed in order.
The exception is the annotation phase. The annotation-only analysis workflow runs this phase by
itself. (All other analysis workflows include the annotation phase as their last analysis phase.) The
annotation-only analysis workflow requires as input a VCF file, which can be generated from either an
Ion Reporter™ Software analysis, a variantCaller plugin analysis, or a different source.

IonReporterUploader command-line utility

The IonReporterUploader command-line utility is an alternative to the IonReporterUploader plugin that
is included with Torrent Suite™ Software. You can use the IonReporterUploader command-line utility to
transfer results files to Ion Reporter™ Software and to define samples, based on the transferred files.
The IonReporterUploader command-line utility uses your sign in ID to transfer run data from Torrent
Suite™ Software to Ion Reporter™ Software. The utility supports these transfer scenarios:
• Transfer a single BAM or VCF file
• Transfer all results files for a Torrent Suite™ Software analysis
• Transfer results files that are in a single flat folder
• Transfer multiple files that are not restricted to a single folder

You can later analyze the samples with Ion Reporter™ Software. You can enter IonReporterUploader
command-line utility options through command line arguments, or through a properties file.

CAUTION! IonReporterUploader command-line utility should not be used for uploading samples
from references other than hg19 and GRCh38. Although E-coli and animal reference genomes can be
used in Torrent Suite™ Software, they are not supported in Ion Reporter™ Software.

Torrent Suite™ Software 5.18 User Guide 243

 Chapter 9 Integration with Ion Reporter™ Software
9 IonReporterUploader command-line utility

The IonReporterUploader command-line utility can be run on any of the following:

• An Ion Torrent™ Server.
• A standard Linux™ computer.
• A standard Windows™ computer that uses the Windows™ XP operating system or later.
• A standard Macintosh™ computer.

IonReporterUploader command-line utility supports the upload of combined Ion Reporter™ Software
analysis results that are output by the Combine Alignments option in the Torrent Suite™ Software
Projects tab. The IonReporterUploader plugin does not support uploading these files.

Download IonReporterUploader command-line utility

The IonReporterUploader command-line utility is an alternative to the IonReporterUploader plugin that
is included with Torrent Suite™ Software.
This procedure explains how to download and extract the IonReporterUploader command-line utility.
The procedure can vary, based on the operating system of the target computer. In general, decompress
the downloaded directory on your target machine, then copy the directory IonReporterUploader-
cli to a convenient location.

IMPORTANT! Use only the decompression utility available on your local computer. Do not
decompress files on a different operating system and copy those files to a computer that uses a
different operating system.

1. Download the IonReporterUploader command-line utility at: http://

iru.ionreporter.thermofisher.com/.
Ideally, download the IonReporterUploader command-line utility onto the computer where it is to
be run. At a minimum, you must use a computer with the same operating system.

2. Click the filename IonReporterUploader-cli.zip, then download the file to the target
computer.

3. Extract the downloaded IonReporterUploader-cli.zip file, then copy the

IonReporterUploader-cli directory to a convenient location on the target computer.

Run IonReporterUploader command-line utility

The IonReporterUploader command-line utility irucli is ready to run after you extract it. Run the
IonReporterUploader command-line utility from the IonReporterUploader-cli bin directory (with
the irucli.bat or irucli.sh script).
Instructions to use the IonReporterUploader command-line utility are downloaded with the utility.
For more information, see the IonReporterUploader Command-Line Utility User Guide (Pub. No
MAN0017648.

244 Torrent Suite™ Software 5.18 User Guide

10 References management

■ About references . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245

■ Reference sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
■ Target regions and hotspots files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255
■ Test fragments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279
■ Barcodes and barcode sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 280
■ Upload history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 284

About references
Torrent Suite™ Software provides access to references for use in your sequencing runs. References are
available for reference genome sequences, barcode sets, test fragments, and other files that filter or
restrict genomic sequencing and analysis to the regions of interest. Before you can use some of these
files in sequencing runs, you must upload or import the files to the Ion Torrent™ Server that is connected
to the sequencing instrument.
References are accessed in Torrent Suite™ Software from (Settings)4Reference Sequences.
Options are listed in the left navigation menu.

Reference type Description

Reference sequences Import preloaded Torrent Suite™ Software validated reference genome
sequences, or a custom reference genome to add them to Planned Runs
and Planned Run templates.

Obsolete reference sequences Reference sequences become obsolete and are listed in the Obsolete
References Sequences screen after Torrent Suite™ Software is updated
with a release that includes a new TMAP index.

Target regions Upload these files to add them to your Planned Runs.

Hotspots Upload hotspots files to add them to your Planned Runs. The
variantCaller plugin generates output files that include these positions
whether or not a variant is called, and include evidence for a variant and
the filtering thresholds that disqualified a variant candidate.

Test fragments Use these known sequences to monitor system characteristics.

Barcodes Upload Ion barcode sets or your own custom barcodes sets for use in
sequencing runs.

Upload history Review records of recent uploads of target regions, hotspots, and ZIP
files from AmpliSeq.com.

Torrent Suite™ Software 5.18 User Guide 245

 Chapter 10 References management
10 Reference sequences

Reference sequences
To identify genetic variations within a nucleic acid sample, sequencing reads are aligned to a reference
genome sequence. Torrent Suite™ Software comes preloaded with reference genome files containing
genomic sequences that represent several species, including two commonly used human genome
references—hg19 and GRCh38. You can also import a custom reference file to use for your sequence
analysis.
As part of the standard analysis process in Torrent Suite™ Software, reads are aligned to a genomic
reference using the TMAP aligner that comes preinstalled on the Ion Torrent™ Server. For more
information, see “TMAP modules” on page 307.

hg19 reference
The Human Genome version 19 (hg19) reference is a human genome reference that is based on the
Genome Reference Consortium's human genome assembly version 37 with patch 5 (GRCh37.p5), and
its equivalent UCSC hg19 reference. For more information, see the Genome Reference Consortium's
website: ncbi.nlm.nih.gov/grc/human/data. Several notable differences exist between the hg19
reference in Torrent Suite™ Software and the GRCh37.p5/UCSC hg19 reference sequences:
• The Y chromosome PAR regions in the hg19 reference are hard masked with 'N', while the
GRCh37.p5 reference Y chromosome PAR regions are unmasked.
• Three nucleotide positions that are masked with 'N' in the GRCh37/UCSC hg19 reference have
IUPAC ambiguity codes in hg19 reference sequence.
• The hg19 reference in Torrent Suite™ Software uses the Revised Cambridge Reference Sequence
(rCRS) for chromosome M, while UCSC hg19 uses the original chromosome M sequence.

For more information, see genome.ucsc.edu/cgi-bin/hgGateway?org=human&db=hg19.

To download sequence and annotation data, go to the Genome Browser FTP
server at hgdownload.soe.ucsc.edu/goldenPath/hg19 or the Downloads screen at
hgdownload.soe.ucsc.edu/downloads.html#human.

Hard masked PAR regions in chromosome Y

The mammalian Y chromosome contains regions that are identical to the X chromosome
called pseudoautosomal regions (PARs). These regions allow for recombination between the sex
chromosomes. When the human Y chromosome was sequenced and assembled, the PAR regions were
not sequenced, and therefore were not included in the assembly. Instead, the corresponding sections
from the X chromosome sequence were copied onto the Y chromosome. This sequence duplication
must be considered when sequence analysis is performed by the software so that allelic duplication
can be distinguished from other types of duplications such as repeats and segmental duplication.
When the female DNA sample is sequenced, reads from the PAR regions align to both the X and the Y
PAR sequences. This alignment affects the mapping quality of the reads in these regions and creates
problems with variant calling on the gender chromosomes. For this reason, the PAR sequence on the Y
chromosome is replaced with 'N', or "hard masked", in the hg19 reference. In the GRCh37 reference,
the PAR sequence is unmasked. Hard masking the PAR sequence on the Y chromosome preserves the
PAR coordinates on the Y chromosome and eliminates the duplication at this locus. The Y chromosome

246 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Reference sequences 10

in the hg19 assembly contains two PAR regions that are taken from the corresponding regions in the X
chromosome and have identical DNA sequences.

Chromosome Y PAR coordinates Corresponding chromosome X PAR coordinates

10,001–2,649,520 60,001–2,699,520

59,034,050–59,363,566 154,931,044–155,260,560

Three positions with ambiguity codes

Three positions on chromosome 3 are masked with 'N' in the UCSC version of the hg19/GRCh37
reference genome. These positions have IUPAC ambiguity codes in our hg19 version:
• M—IUPAC code for A or C nucleotides
• P—IUPAC code for A or G nucleotides

IUPAC ambiguity code in hg19 Hard masked character in UCSC

Position
reference hg19

60830534 M N

60830763 R N

60830764 R N

Chromosome M reference sequence

The hg19 reference in Torrent Suite™ Software uses the Revised Cambridge Reference Sequence
(rCRS) for the Homo sapiens mitochondrial sequence (chromosome M or chrM) – GenBank accession
number NC_012920. UCSC hg19 reference uses the original chromosome M sequence – GenBank
accession number NC_001807. UCSC begins using the rCRS for chromosome M in the GRCh38 (hg38)
assembly.
The following background information is from the UCSC site http://genome.ucsc.edu/cgi-bin/
hgGateway?org=human&db=hg19.
"Since the release of the UCSC hg19 assembly, the Homo sapiens mitochondrion sequence
(represented as 'chrM' in the Genome Browser) has been replaced in GenBank with the record
NC_012920. We have not replaced the original sequence, NC_001807 in the hg19 Genome Browser.
We plan to use the Revised Cambridge Reference Sequence (rCRS) in the next human assembly
release."

GRCh38 reference
The Genome Reference Consortium human genome assembly version 38 (GRCh38) is the latest version
of the GRC human genome reference. The GRCh38 assembly is referred to as "hg38" in the UCSC
Genome Browser and includes the following updates to the GRCh37/UCSC hg19 version:
• Alternate sequences for highly variable genes
• Centromere representation
• Sequence updates such as fixed errors, filled gaps, and changes to chromosome coordinates
• Updated mitochondrial genome sequence (GenBank accession number NC_012920.1)

Torrent Suite™ Software 5.18 User Guide 247

 Chapter 10 References management
10 Reference sequences

• Hard masked PAR regions in chromosome Y

Chromosome Y PAR coordinates Corresponding chromosome X PAR coordinates

10,000–2,781,479 10,000–2,781,479
56,887,902–57,217,415 155,701,382–156,030,895

For more information, see genome.ucsc.edu/cgi-bin/hgGateway?db=hg38.

To download sequence and annotation data, go to Genome Browser FTP
server at hgdownload.soe.ucsc.edu/goldenPath/hg38/ or the Downloads screen at
hgdownload.soe.ucsc.edu/downloads.html#human.

Import reference sequence files

Torrent Suite™ Software includes validated reference sequence files that you can download onto your
Ion Torrent™ Server. You can also import custom reference sequence files from your local storage
or a remote server. After you import the reference sequence files onto your Ion Torrent™ Server, the
reference sequences are available for use when you set up Planned Runs and when the software
performs data analysis.

Guidelines for importing custom reference sequence files

The following guidelines are for preparing a new custom reference genome sequence file to be imported
into Torrent Suite™ Software:
• Download a FASTA format reference genome file and save it to your local storage. FASTA files can
found at ncbi.nlm.nih.gov/genome.
• The file selected for import must have a .fasta extension.
• When working with larger genomes, performance improves if you compress the FASTA file. Torrent
Suite™ Software supports ZIP and GZIP archive file formats, provided each archive file contains
one FASTA file.
• The variantCaller plugin does not support IUPAC base codes other than A, C, T, G, and N.
When the software uploads a genome containing other IUPAC characters, each such character
is replaced with N.
• Prepare any related target regions, hotspots, and reference annotation files to upload with the
reference genome file and save them to your local storage. For more information, see “Target
regions and hotspots files” on page 255 and “Import reference sequence files” on page 248.

Import a preloaded reference sequence file

Validated reference sequence genome files suitable for use with Torrent Suite™ Software are preloaded
on the Ion Torrent™ Server.

248 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Reference sequences 10

Before you can use the reference files in Planned Runs, you must import the reference files into the
software.
You can also edit the reference genome information, or permanently delete the reference file from the
software. For more information, see “View a reference sequence file” on page 251.

IMPORTANT! If you edit or delete a reference sequence file, the change affects all users.

1. Click (Settings)4Reference Sequences.

2. Click Import Preloaded Reference Sequences.

The Ion References and Downloads lists are displayed.

3. In the Ion References list, find the file of interest, then complete the selections based on the
reference type.
Option Selection
Reference To import a reference file, click Import in the row of the reference file to import.
Annotation Files To download annotation files that pertain to the reference file that you are importing:
1. Click Import Annotation Files.
2. In the Import Annotation Files dialog box, select the annotations that you want
to import, then click Import Selected.

The file import status appears in the row of the selected file in the Ion References list. When the
status is complete, a compressed folder in ZIP file format is added to the Downloads list and the
reference genome is added to the Reference Sequences table. You can now use the reference
genome in a Planned Run.

Torrent Suite™ Software 5.18 User Guide 249

 Chapter 10 References management
10 Reference sequences

Import a custom reference sequence file

If you want to use a custom reference genome sequence in a Planned Run and data analysis, you can
import a custom reference file into the Torrent Suite™ Software from your local storage or a remote
server location.

IMPORTANT! First-time users should review custom reference file rules and restrictions to avoid
uploading errors. For more information, see “Guidelines for importing custom reference sequence files”
on page 248.

1. Click (Settings)4Reference Sequences.

2. Click Import Custom Reference.

3. In the Add New Reference Genome dialog box, do one of the following.
• Upload a FASTA file from your local storage.
a. Select the Upload File tab.
b. Click Select File.
c. Navigate to and select the file from your local storage, then click Open.
• Upload a FASTA file from a remote server.
a. Select the Install via URL tab.
b. In Reference URL, enter the file path to the reference file.

250 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Reference sequences 10

4. Complete the required information. This information is used in various report outputs and in the
Reference Sequences table.

Item Description
Short name Enter a recognizable short form of the genome name. Make sure that the
(Required) short name does not repeat with other reference genome files. You can
delete any reference genome that you do not use to allow the short name
to be used again for a new reference genome file. Use any alphanumeric
character and underscore (_).
Description Enter a longer, more descriptive reference genome name. The description
(Required) usually includes the genus, species, version, and other identifying reference
genome information.
Version Enter the genome version number and the accession number, if there is one
(Required) (for example, "hg19", "gi|39933080|NC_005296.1").

Notes Use to record any notes about the reference genome.

(Optional)

5. Click Import Reference.

The reference genome and associated information is added to the Reference Sequences table.

After the reference genome file is imported, you can view and edit the reference genome information,
or delete the reference genome file. For more information, see “View a reference sequence file” on
page 251. If you encounter any errors during file upload, see “Troubleshooting file import/upload errors”
on page 381.

View a reference sequence file

After you import a reference sequence file into Torrent Suite™ Software, you can view the file properties
and review the reference sequence in the FASTA format.
For instructions on how to import the file into Torrent Suite™ Software , see “Import reference sequence
files” on page 248.

1. Click (Settings)4Reference Sequences.

2. In the Reference Sequences screen, do one of the following to access the reference sequence file
properties screen.
• In the Reference Sequences table, in the Short Name column, click the reference sequence
file name.
• Click Import Preloaded Reference Sequences, then click complete in the row of the
imported Ion reference file.

The file properties screen opens.

Torrent Suite™ Software 5.18 User Guide 251

 Chapter 10 References management
10 Reference sequences

3. Click the FASTA file link to view the FASTA format reference sequence in the browser window.

Edit reference sequence file properties

After you import a reference sequence file into Torrent Suite™ Software, you can edit the file properties.
To edit the reference sequence file properties, you must first import the file into Torrent Suite™ Software.
For more information, see “Import reference sequence files” on page 248.

1. Click (Settings)4Reference Sequences.

2. In the Reference Sequences table, in the Short Name column, click the reference sequence file
name.
The file properties screen opens.

252 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Reference sequences 10

3. In the file properties screen, edit the file properties. Only these file properties can be edited.
Property Description
Description Description of the reference.
Version Version number or letter of the reference.
Notes Any meaningful details about the reference.
Enabled References are enabled by default. To disable a reference that is not being used anymore,
deselect Enabled.

You cannot edit Short Name. To change or reuse the reference sequence file short name, click
Delete Genome to delete the existing reference sequence file from the Ion Torrent™ Server, then
upload a new file.

4. Click Save.

Torrent Suite™ Software 5.18 User Guide 253

 Chapter 10 References management
10 Reference sequences

Permanently delete a reference sequence file

After you import a reference sequence file using Torrent Suite™ Software, you can permanently delete
the file from the Ion Torrent™ Server. Deleting a reference sequence file is useful if you want to upload a
new file using the same Short Name as an existing file, or if you no longer require the reference for your
Planned Runs.

IMPORTANT! Recovery of a deleted reference sequence is not possible.

1. Click (Settings)4Reference Sequences.

2. In the Reference Sequences table, in the Short Name column, click the reference sequence file
name.

3. In the file properties screen, click Delete Genome4Yes, Delete It.

The reference is removed from the Reference Sequences table and is permanently deleted from
the Ion Torrent™ Server.

Obsolete reference sequences

A reference sequence becomes obsolete and is listed in the Obsolete References Sequences table
after Torrent Suite™ Software is updated with a release that includes a new TMAP index.
Torrent Suite™ Software automatically records the libraries that were installed before the upgrade, then
automatically creates the list of obsolete reference sequences.
Each list is different, depending on the reference sequences that you use.

254 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

Target regions and hotspots files

Target regions and hotspots Browser Extensible Data (BED) files supply chromosome positions or
regions as reference information during the analysis of a sequencing run. These BED files, when applied
to a reference sequence in a Planned Run, or in a variantCaller plugin configuration, perform two
functions:
• Target regions files narrow the analysis to your regions of interest, for example, regions that are
amplified with primer panels in targeted sequencing. When a target regions file is selected in a
Planned Run, the complete Torrent Suite™ Software analysis pipeline, including plugins, is restricted
to the regions of the reference sequence specified in that file. Target regions files use only BED file
format.
• Hotspots files instruct the variantCaller plugin to include loci known to be frequently altered in its
output files, including evidence for a variant and the filtering thresholds that disqualify a variant
candidate. A hotspots file affects only the variantCaller plugin, not other parts of the analysis
pipeline. A hotspots file is usually a BED file, or it can be a Variant Call Format (VCF) file that is
generated from a BED file by Torrent Suite™ Software during a sequencing run.

Target regions and hotspot files are listed on screens that are accessed from the Reference
Sequences link. When a target regions or hotspots file is uploaded to Torrent Suite™ Software, it is
assigned a specific reference sequence, and is then available for use when that reference sequence is
selected during run planning.

Guidelines for using target regions and hotspots files

• Target regions BED files provide an option to restrict analysis to regions of interest. Do not specify a
target regions BED file in the Plan step of the Planned Run workflow if you want variant analysis to
span an entire genome. Use the whole-genome application with a reference sequence to support
whole‑genome analysis.
• All regions that are included in the target regions BED file that you select are analyzed. Before you
upload your target regions BED file, follow the instructions in “Modify a BED file” on page 258 to
delete lines representing regions containing variants that you do not want to call.
• The BED file coordinates (for example: chr2 29443689 29443741) use zero-based indexing and a
half-open interval. The start position is included, and the range extends up to, but not including, the
end position.
• BED files that are used with Ion AmpliSeq™ panels define only the internal segment, and do not
include the primer sequence.
• A BED or VCF file is tied to a specific reference sequence. The coordinates in a BED or VCF
file must match coordinates and the coordinate sorting in the reference sequence. Torrent Suite™
Software reference sequences are sorted alpha-numerically (not by a chromosome sort). The BED
files and VCF files that you use with references must also use an alpha-numeric sort. If you upload
your own reference genome sequence, the BED and VCF files that you use with that reference
must be sorted by the same method as your reference file.
• The variantCaller plugin calls variant candidates at hotspot positions with higher sensitivity than
candidates at other positions. You can customize specific variantCaller parameters separately for
hotspot candidates.
• Torrent Suite™ Software accepts VCF files as hotspots files, but the VCF file must be generated by
the variantCaller plugin from a hotspots BED file.

Torrent Suite™ Software 5.18 User Guide 255

 Chapter 10 References management
10 Target regions and hotspots files

• Target regions and hotspots files for use with Ion AmpliSeq™ panels can be downloaded with panel
files from AmpliSeq.com.
• If you need Oncomine™ panel target regions and hotspots files, contact your local Field Service
Engineer.

View and manage target regions files

You can upload target regions files for use with a specific reference sequence. After target regions
files are uploaded, the files are available when the related reference sequence is selected for use in
a Planned Run. When you select a target regions file in run planning, the sequencing run results are
restricted to the regions of the reference sequence that is specified in the target regions file.

1. To view the target regions files that are available on the Ion Torrent™ Server, click
(Settings)4Reference Sequences.

2. In the left navigation pane, click Target Regions.

Available target regions files are listed in the Target Regions table.

3. In Search, enter a search term, or select a target region from Reference to filter the list.

256 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

4. Click a target regions file name to open a Target Regions Details screen that displays information
such as the number of targets, genes, covered bases, description, and notes. Scroll to view
original upload information.

File information Target Regions detail

Processed File The name of the file. Click to download the BED file to view on your
computer.
Reference The reference genome species.
Number of Targets The number of target regions included in the file.
Number of Genes The number of genes included in the target regions file.
Covered Bases The number of bases covered by the target regions file.
Description A short description of the file.
Notes (Optional) Additional information about the target regions file.
Enabled Select the checkbox to enable use of the file in a Planned Run.
Deselect the checkbox to prevent use of the file in a Planned Run.

5. Enter any additional information if needed, then click Save Changes.

6. To delete a file from the Ion Torrent™ Server, click Delete.

View and manage hotspots files

You can upload hotspots files for use with a specific reference sequence. After hotspot files are
uploaded, the files are available when that reference sequence is selected for use in a Planned Run or
variantCaller plugin configuration. When you select a hotspots file in run planning, the file instructs the
variantCaller plugin to report on loci, which is known to be frequently altered, in its output files.

1. To view the hotspots files that are available on the Ion Torrent™ Server, click
(Settings)4Reference Sequences.

2. In the left navigation menu, click Hotspots. Available hotspots files are listed in the Hotspots table.

Torrent Suite™ Software 5.18 User Guide 257

 Chapter 10 References management
10 Target regions and hotspots files

3. In Search, enter a search term, or select a hotspot from Reference to filter the list.

4. Click the name of a hotspots file to open a Hotspots Details screen that displays file information
such as the number of loci, description, and notes. Scroll to view the original upload information.

File information Hotspots detail

Processed File The file name. Click to download the BED file to view on your
computer.
Reference The reference genome species.
Number of Loci The number of hotspot alleles included in the hotspot file.
Description A short description of the file.
Notes (Optional) Additional information about the hotspot file.
Enabled Select the checkbox to enable use of the file in a Planned Run.
Deselect the checkbox to prevent use of the file in a Planned Run.

5. Enter any additional information if needed, then click Save Changes.

6. To delete a file from Torrent Suite™ Software, click Delete.

Modify a BED file

You can modify an existing target regions or hotspots BED file, if necessary, to remove regions from the
file for which you do not want variants called.
If you modify a BED file, you must modify it before it is uploaded to Torrent Suite™ Software. A target
regions or hotspots BED file cannot be modified after the file is uploaded.
To modify a BED file:

1. Copy the BED file, then rename the new file in a way that reflects changes you make to the regions
being analyzed.

2. Open the BED file with a text editor.

3. Delete the lines for regions you do not want.

4. Save the file.

258 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

5. Upload the modified file as described in “Upload a target regions file” or “Upload a hotspots file”.

Note:
· If the region (or regions) appears in both your target regions BED file and in your hotspots BED
file, you must delete the line for those regions from both types of BED file.
· Do not modify a VCF hotspots file. We recommend that you upload it first to convert it to a BED
file before modifying it.

Upload a target regions file

You can upload a target regions BED file from your computer to Torrent Suite™ Software to use with a
reference sequence.
Target regions files are only BED files. Supported file extensions are .bed, .zip, and .bed.gz. During file
upload, the software validates the BED file, then ensures that the coordinate regions of the BED file
are valid for the selected reference genome. The new BED file is then available as an option when you
create a Planned Run.

IMPORTANT! You must upload target regions files that match both the reference sequence and
the reference sequence version. The uploader cannot always detect mismatch errors. It is your
responsibility to avoid the following uploading errors:

· Uploading a BED file for a reference sequence of a different version (for example, an hg18 BED with
an hg19 reference).
· Uploading a BED file for a different species.
· Uploading a hotspots BED file as a target regions BED file.

1. Click (Settings)4Reference Sequences, then click Target Regions in the left navigation
menu.

2. In the Target Regions screen, click Add Target Regions.

3. In the New Target Regions screen, click Select File, then navigate to the file to be uploaded.

4. Select the reference sequence from the Reference list.

IMPORTANT!
· Be careful to select the correct reference sequence because the new target regions file can be
used only with this reference.
· The reference sequence must be uploaded and available for selection before a target regions file
can be uploaded.

Torrent Suite™ Software 5.18 User Guide 259

 Chapter 10 References management
10 Target regions and hotspots files

5. (Optional) Add a description and notes.

6. Click Upload Target Regions File.

Wait while the file is validated. The status updates to Successfully Completed after the upload
finishes. Errors are reported in the Processing Log pane.

For large files, validation can take several minutes. Refresh your browser to check that validation is
complete.

The new file appears in the Target Regions list in the Plan step of the Planned Run workflow bar, and
in the Target Regions table in the References tab.

260 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

Upload a hotspots file

You can upload a hotspots file from your computer to Torrent Suite™ Software to use with a reference
sequence.
Hotspots files can be BED or VCF files. Supported file extensions are .bed, .vcf.gz, .zip, .bed.gz,
and .vcf.gz. During file upload, the software validates the BED or VCF file, then ensures that the
coordinate regions of the file are valid for the selected reference sequence. The new BED file is then
available as an option when you create a Planned Run or configure the variantCaller plugin.

IMPORTANT! Upload BED or VCF files that match both the reference sequence and the reference
sequence version. The uploader cannot always detect mismatch errors. It is your responsibility to avoid
the following uploading errors:

· Uploading a BED or VCF file to a reference sequence of a different version (for example, an hg18
BED file with an hg19 reference).
· Uploading a BED or VCF file for a different species.
· Uploading a target regions BED file as a hotspots BED file.
· Uploading a hotspots file listing loci not included in a target regions file.

1. Click (Settings)4Reference Sequences, then click Hotspots in the left navigation menu.

2. In the Hotspots screen, click Add Hotspots.

3. In the New Hotspots screen, click Select File, then navigate to the file to be uploaded.

4. Select the reference sequence from the Reference list.

IMPORTANT!
· Ensure that you select the correct reference sequence because the new hotspots file can be
used only with this reference.
· The reference sequence must be uploaded and available for selection before a hotspots file can
be uploaded.

5. (Optional) Add a description and notes.

6. Click Upload Hotspots File.

Wait while the file is validated. The status updates to Successfully Completed after the upload
finishes. Errors are reported in the Processing Log pane.

Torrent Suite™ Software 5.18 User Guide 261

 Chapter 10 References management
10 Target regions and hotspots files

Note:
· For large files, validation can take a few minutes. Refresh your browser to check that validation
is complete.
· If you selected a VCF file for upload, the software validates it and converts it to a BED file.

The new file appears in the Hotspots list in the Plan step of the Planned Run workflow bar, and in the
Hotspots table in the References tab.

BED file formats and examples

The Browser Extensible Display (BED) format is used for both target regions files and hotspot files.
Torrent Suite™ Software also accepts the Variant Call Format (VCF) for hotspot files.
BED files are text files with tab-separated fields.

Target regions BED file formats

Target regions files use a BED file format in 3‑column, 4‑column, 6‑column, and 8‑column formats.

262 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

3-column target regions BED file format

The 3-column target regions BED file format is used when amplicon IDs and gene names are not
known.
The track line is optional. If present, it includes these tab-separated fields:

Field Type Description

name String A unique design identifier.

Optional.

description String A description of the design.

Optional.

The following is an example of how to enter an optional track line.

track name="ASD270245" description="AmpliSeq Pool ASD270245"

In a 3-column target regions BED file, the coordinates lines require the following tab-separated fields:

Field Type Description

chrom String (chars ≥ 0x20, other The name of the chromosome.

than \tab) This name must be an exact
match with a chromosome in the
reference.

chromStart Unsigned int64 The starting position of the feature

(zero-based).

chromEnd Unsigned int64 The ending position of the feature

(not inclusive). Must be greater
than chromStart.

Partial example of a 3-column target regions BED file:

chr9 133738312 133738379

chr9 133747484 133747542
chr9 133748242 133748296
chr9 133748388 133748452
chr9 133750331 133750405
chr9 133738312 133738379
chr9 133747484 133747542
chr9 133748242 133748296
chr9 133748388 133748452
chr9 133750331 133750405
chr14 105246407 105246502
chr14 105246407 105246502
chr14 105246407 105246502
chr2 29432658 29432711

Torrent Suite™ Software 5.18 User Guide 263

 Chapter 10 References management
10 Target regions and hotspots files

4-column target regions BED file format

The 4-column target regions BED file format is used when gene names are not known and some or all
amplicon IDs are known.
The track line is optional. If present, it includes these tab-separated fields:

Field Type Description

name String A unique design identifier.

Optional.

description String A description of the design.

Optional.

The following is an example of how to enter an optional track line.

track name="ASD270245" description="AmpliSeq Pool ASD270245"

In a 4-column target regions BED file, the coordinates lines require the following tab-separated fields:

Field Type Description

chrom String (chars >= 0x20, other The name of the chromosome.
than \tab) This name must be an exact
match with a chromosome in the
reference.

chromStart Unsigned int64 The starting position of the feature

(zero-based).

chromEnd Unsigned int64 The ending position of the feature

(not inclusive). Must be greater
than chromStart.

AmpliconID String The amplicon ID. If missing, the

following string is used "chrom"
+ ":" + "chromStart" + "-" +
"chromEnd"

Partial example of a 4-column target regions BED file:

chr9 133738312 133738379 amplID73150

chr9 133747484 133747542 amplID73075
chr9 133748242 133748296 amplID73104
chr9 133748388 133748452 491413
chr9 133750331 133750405 74743
chr9 133738312 133738379 73150
chr9 133747484 133747542 73075
chr9 133748242 133748296 73104
chr9 133748388 133748452 491413
chr9 133750331 133750405 74743
chr14 105246407 105246502 329410
chr2 29432658 29432711 34014

264 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

6-column target regions BED file format

The 6-column target regions BED file format is used when some or all of the gene names are known.
BED files that are generated by AmpliSeq.com use this 6-column format.
The track line is required in a 6-column target regions BED file. The track line includes the following
information.

Field Type Description

name String A unique design identifier.

(Optional)

description String A description of the design.

(Optional)

type String Must be bedDetail (without

quotes).
(Required)

ionVersion String Version of Torrent Suite™ Software.

The following is an example track line:

track name="ASD270245" description="AmpliSeq Pool ASD270245" type=bedDetail

In a 6-column target regions BED file, the coordinates lines require the following fields.

Field Type Description

chrom String (chars ≥ 0x20, other The name of the chromosome.

than \tab) This name must be an exact
match with a chromosome in the
reference.

chromStart Unsigned int64 The starting position of the feature

(zero-based).

chromEnd Unsigned int64 The ending position of the feature

(not inclusive). Must be greater
than chromStart.

AmpliconID String Amplicon ID. If missing, the

following string is used "chrom"
+ ":" + "chromStart" + "-" +
"chromEnd"

ID String A customer-specified ID. If

missing, set to '.'. This field is not
used.

GeneSymbol String The gene name. If missing, set to

'.'.

Torrent Suite™ Software 5.18 User Guide 265

 Chapter 10 References management
10 Target regions and hotspots files

Partial example of a 6-column target regions BED file:

track name="ASD270249_v1" description="AmpliSeq Pool ASD270249"

type=bedDetail
chr9 133738312 133738379 AM73150 NM_005157 ABL1
chr9 133747484 133747542 AM73075 NM_005157 ABL1
chr9 133748242 133748296 AM73104 NM_005157 ABL1
chr9 133748388 133748452 AM491413 NM_005157 ABL1
chr9 133750331 133750405 74743 NM_005157 ABL1
chr9 133738312 133738379 73150 NM_007313 ABL1
chr9 133747484 133747542 73075 NM_007313 ABL1
chr9 133748242 133748296 73104 NM_007313 ABL1
chr9 133748388 133748452 491413 NM_007313 ABL1
chr9 133750331 133750405 74743 NM_007313 ABL1
chr14 105246407 105246502 329410 NM_001014431 AKT1
chr14 105246407 105246502 329410 NM_001014432 AKT1
chr14 105246407 105246502 329410 NM_005163 AKT1
chr2 29432658 29432711 34014 NM_004304 ALK

8-column target regions BED file format

An 8-column target regions BED file format is for fusion panels.

In an 8-column target regions BED file, the coordinates lines require the following tab-separated
fields. The format is similar to the 6-column target regions BED file, with two additional columns. The
additional columns are score and strand.

Field Type Description

chrom String (chars ≥ 0x20, other The name of the chromosome.

than \tab) This name must be an exact
match with a chromosome in the
reference.

chromStart Unsigned int64 The starting position of the feature

(zero-based).

chromEnd Unsigned int64 The ending position of the feature

(not inclusive). Must be greater
than chromStart.

AmpliconID String Amplicon ID. If missing, the

following string is used "chrom"
+ ":" + "chromStart" + "-" +
"chromEnd"

ID String A customer-specified ID. If

missing, set to '.'. This field is not
used.

GeneSymbol String The gene name. If missing, set to

'.'.

266 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

(continued)

Field Type Description

score Unsigned int64 Score. If missing, set to "."

strand String (+ or -) Strand. If unknown, set to "+".

BED files generated by Ion AmpliSeq™ Designer custom designs

The track line for BED files generated by Ion AmpliSeq™ Designer custom designs follow the 6‑column
BED format, but with two additional fields. These additional fields are not used by Torrent Suite™
Software.

Field Type Description

name String A unique design identifier.

description String A description of the design.

type String Must be bedDetail (without

quotes). Required.

ionVersion String Introduced in Torrent Suite™

Software 4.0. When set to "4.0"
or later, indicates that the BED file
supports the Extended BED Detail
format.

db String The UCSC Assembly ID.

reference String The Ion Torrent™ Server reference

ID. Present for Ion AmpliSeq™
Designer 5.2 and higher.

color String Code for color track in UCSC

Genome Browser when the file is
uploaded from AmpliSeq.com.

priority String Sets the order for color track in

UCSC Genome Browser (when
uploaded from AmpliSeq.com.

Hotspots file format

The track line is required in a hotspots BED file.
The following is an example track line:

track name="ASD270245" description="HotSpots locations for AmpliSeq

ASD270245" type=bedDetail db=hg38 reference=GRCh38.p2

Torrent Suite™ Software 5.18 User Guide 267

 Chapter 10 References management
10 Target regions and hotspots files

The track line includes these tab-separated fields:

Field Type Description

track name String A unique design identifier.

(Optional)

description String A description of the design.

(Optional)

type String Must be bedDetail (without

quotes).
(Required)

db String The UCSC Assembly identifier.

(Optional)

reference String The Ion Torrent™ Server reference

identifier.
(This field is optional for hg19, and
is required for GRCh38.)

In hotspots BED files, the coordinates lines require these tab-separated fields:

Field Type Description

chrom String (chars >= 0x20, other The name of the chromosome.
than \tab) This name must be an exact
match with a chromosome in the
reference.

chromStart Unsigned int64 The starting position of the feature

(zero-based).

chromEnd Unsigned int64 The ending position of the feature

(not inclusive). Must be greater
than chromStart.

HotSpotName String The name is either the COSMIC

identifier, dbSNP identifier, or
is user-defined. If missing, the
following string is used "chrom"
+ ":" + "chromStart" + "-" +
"chromEnd"

268 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

(continued)

Field Type Description

HotSpotAlleles String A string that describes the variant

using the following format:
REF=reference_allele ;
OBS=observed_allele ;
ANCHOR=base_before_allel
e

AmpliconID String The Amplicon identifier. If missing,

the following string is used
"chrom" + ":" + "chromStart"
+ "-" + "chromEnd"

HotSpotAlleles field
The HotSpotAlleles field in the hotspots file specifies the alleles that are involved in variant calls,
using this format:
REF= reference_allele; OBS= observed_allele
Examples:
• A TT insertion with 1-base prior at reference C: REF=;OBS=TT
• A TT deletion with 1-base prior at reference G: REF=TT;OBS=

Notes:
• 6-column format
– The elements can be empty: REF=; or OBS=;. Empty means deletion.
– An additional element ANCHOR=base_before_allele can be provided for backward
compatibility, but is optional. It is recommended that the ANCHOR key not be provided for
Torrent Suite™ Software 4.2 or later.
– Insertion alleles should have the same start and end position, and that position corresponds to
a region between two bases. SNV, MNV, deletion, and complex variants should correspond to
the reference bases that are spanned by the event.
– The REF and OBS should be on the forward genomic strand. There should be one alternative
allele per line.

8-column format
– The +/- strand notation in the hotspots file refers to the orientation of the Ion AmpliSeq™
Designer design input sequence, not to the reference sequence. REF and OBS alleles must
always be reported on the forward strand of the reference sequence.
– HotSpotAlleles are always reported based on the allele information from the positive strand
of the reference sequence. Even if the allele strand is negative, the REF and OBS bases still
report the alleles on the positive strand.

For example, if there is a hotspot either on the positive strand or on the negative strand on
a genomic coordinate, the strand information makes no difference as to what is reported on
the HotSpotAlleles column. The HotSpotAlleles column always reports the alleles on the positive

Torrent Suite™ Software 5.18 User Guide 269

 Chapter 10 References management
10 Target regions and hotspots files

strand. In the following example, the strands are different, but the reported alleles are always from
the positive strand:
chr 143815007 43815009 ID1 0 - REF=TG;OBS=AA AMPL1
chr 143815007 43815009 ID2 0 + REF=TG;OBS=AA AMPL2

Partial example of a hotspots BED file

track name="HSMv12.1" description="AmpliSeq Pool HSMv12.1" type=bedDetail

chr1 43815007 43815009 COSM19193 REF=TG;OBS=AA AMPL495041

chr1 43815008 43815009 COSM18918 REF=G;OBS=T AMPL495041
chr1 115256527 115256528 COSM585 REF=T;OBS=A AMPL30014
chr1 115256527 115256528 COSM586 REF=T;OBS=G AMPL30014
chr1 115256527 115256529 COSM33693 REF=TT;OBS=CC AMPL30014
chr1 115256527 115256529 COSM30646 REF=TT;OBS=CA AMPL30014
chr1 115256527 115256530 COSM53223 REF=TTG;OBS=CTT AMPL30014
chr1 115256528 115256529 COSM583 REF=T;OBS=A AMPL30014
chr1 115256528 115256529 COSM584 REF=T;OBS=C AMPL30014
chr1 115256528 115256529 COSM582 REF=T;OBS=G AMPL30014
chr1 115256528 115256530 COSM12725 REF=TG;OBS=AA AMPL30014
chr1 115256528 115256530 COSM579 REF=TG;OBS=CT AMPL30014

Note: The REF=;OBS= field is required, as is the track line.

Extended BED Detail format

Ion AmpliSeq™ Designer 3.0 and later uses Extended BED Detail format for the following fixed panels:
• CCP
• CFTR
• CHP v2
• Ion AmpliSeq™ Exome

New fixed panels that are introduced for Ion AmpliSeq™ Designer 3.0 and later also follow this format.
Other panels, and all panels from previous releases, do not use this format.
The Extended BED Detail format contains two additional fields (at the end of each line).

Name Values Description

Id Any string supplied by the user or A user-supplied name or

'.' identification for the region.

Description The key-value pairs separated by Contains a '.' or one or more of

semicolon, or '.' if empty the following:
• GENE_ID=
• Pool=
• SUBMITTED_REGION=

These key-value pairs are

described in the next table.

270 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

The following table lists the keys and describes the key-value pairs that are supported.

Key Description

GENE_ID A gene symbol or comma-separated list of gene symbols. If no gene symbol is

available, this key is absent.
Example: GENE_ID=brca1
Example: GENE_ID=brca1, ret

Pool The Ion AmpliSeq™ Designer pool or pools containing this amplicon.
Example: Pool=2
If an amplicon is present in multiple pools, the pools are delimited with ","
(comma), with the primary pool listed first. For example, if an amplicon is
present in pools 1 and 3, and 1 is the primary pool, the entry is Pool=1,3.
Single-pool designs do not include the Pool= key-value pair.

SUBMITTED_REGION The region name provided during the Ion AmpliSeq™ Designer design process.
If a region name is not provided, this key is absent.
Example: SUBMITTED_REGION=Q1

CNV_ID A gene symbol used to specify a copy number region for the cnv pca
algorithm. This takes precedence over the GENE_ID and once CNV_ID can
span multiple GENE_IDs.

CNV_HS A CNV region hotspot. This can be a value of either 0 or 1.

• 1 reports as a hotspot (HS) in the output VCF file from the CNV PCA
algorithm.
• 0 is not reported as HS.

The Extended BED Detail format requires a track line with both type=bedDetail and
ionVersion=4.0. The Torrent Suite™ Software BED validator treats the Id and Descriptor fields
as optional.

Examples from BED files in the Extended BED Detail format

This example shows the GENE_ID= and Pool= keys:

track name="4477685_CCP" description="Amplicon_Insert_4477685_CCP" type=bedDetail

ionVersion=4.0
chr1 2488068 2488201 242431688 . GENE_ID=TNFRSF14;Pool=2
chr1 2489144 2489273 262048751 . GENE_ID=TNFRSF14;Pool=4
chr1 2489772 2489907 241330530 . GENE_ID=TNFRSF14;Pool=1
chr1 2491241 2491331 242158034 . GENE_ID=TNFRSF14;Pool=3

This example is from the CFTR designed.bed file:

track type=bedDetail ionVersion=4.0 name="CFTRexon0313_Designed"

description="Amplicon_Insert_CFTRexon0313"
chr7 117119916 117120070 CFTR_1.91108 . GENE_ID=CFTR;Pool=1;SUBMITTED_REGION=1,31

Torrent Suite™ Software 5.18 User Guide 271

 Chapter 10 References management
10 Target regions and hotspots files

chr7 117120062 117120193 CFTR_1.38466 . GENE_ID=CFTR;Pool=2;SUBMITTED_REGION=1

chr7 117120186 117120304 AMPL244371551 . GENE_ID=CFTR;Pool=1;SUBMITTED_REGION=1,32

Merged Extended BED Detail format files

In the case of two overlapping records, those records are merged during upload into Torrent Suite™
Software. An ampersand (&) is the delimiter between multiple values in merged files.

Example 1
When these two GENE_ID fields appear in overlapping records:
GENE_ID=raf
GENE_ID=brca1
The merged GENE_ID field is:
GENE_ID=raf&brca1

Example 2
When these two GENE_ID fields appear in overlapping records:
GENE_ID=raf
GENE_ID=brca1,ret
The merged GENE_ID field is:
GENE_ID=raf&brca1,ret

Score and strand fields in uploaded hotspot BED files

Uploaded BED files are converted to add score and strand columns, with the default values 0 and +.
You see these values in BED files that you download from Torrent Suite™ Software:

track type=bedDetail name="BRCA1.BRCA2_HotSpots"

description="BRCA_HOTSPOT_ALLELES" allowBlockSubstitutions=true
chr13 32890649 32890650 COSM35423 0 + REF=G;OBS=A AMPL223487194
chr13 32893206 32893207 COSM23930 0 + REF=T;OBS= AMPL223519297
chr13 32893221 32893221 COSM23939 0 + REF=;OBS=CCAATGA AMPL223519297
chr13 32893290 32893291 COSM172578 0 + REF=G;OBS=T AMPL223521074

272 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

RNA fusions BED file formats and examples

The following information describes the target regions Browser Extensible Display (BED) format used
with Ion AmpliSeq™ RNA fusion designs. BED files are text files with tab-separated fields.

Track line
The track line is required in the Target Regions BED file. The following is an example track line:

track name="Fusions 2.6" description="AmpliSeq RNA" type=bedDetail

ionversion="4.0"

The track line includes these tab-separated fields:

Field Type Description

name String A unique design identifier.

(Optional)

description String The description of the design.

(Optional)

type String Must be bedDetail (without quotes).

(Required)

ionversion String Introduced in the Torrent Suite™ Software 4.0 (Ion

AmpliSeq™ Designer 3.0 and higher fixed panels).
When set to "4.0", indicates that the BED file
supports the Extended BED Detail format..
Optional. This field relates to only the BED file format
version, not the version of panel designs.

Columns
This format includes eight required columns that are separated by a tab (\t) character.

Torrent Suite™ Software 5.18 User Guide 273

 Chapter 10 References management
10 Target regions and hotspots files

Field Type Description

chrom String (chars ≥ 0x20, other The name of the chromosome.

than \tab) This name must be an exact
match with a chromosome in the
reference.

chromStart Unsigned int64 The starting position of the feature

(Insert Start not the Amplicon
Start). Must be zero-based.

chromEnd Unsigned int64 The ending position of the feature

(not inclusive) (Insert End not the
Amplicon End). Must be greater
than chromStart.

AmpliconID String The Amplicon ID. If missing, the

following string is used "chrom"
+ ":" + "chromStart" + "-" +
"chromEnd"

Score Unsigned int64 Score. If missing, set to '.'. This

field is not used.

Strand String (+ or -) Strand. If unknown, set to '+'.

ID String A customer-specified ID. If

missing, set to '.'. This field is not
used.

Key-value pairs String Multiple attributes specified as

semicolon separated key-value
pairs. See below for specific key-
value pairs. All of these KVPs are
required for fusions designs files,
but most of these are optional for
other White Glove designs.

The genomic (hg19) coordinates provided in the key-value pairs must represent the entire amplicon
sequence. If you want to generate the fusions mapping reference FASTA file from the BED file, all the
information that is needed should be available in the BED file.
The following key-value pairs are supported.

274 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

Key Value Example

TYPE The type of the event. Allowed TYPE=Fusion

values:
• Fusion
• CONTROL or
ExpressionControl
• Driver_Gene or
5p3pAssay
• GeneExpression
• RNA_Hotspot

FP_TRANSCRIPT_ID The transcript ID for the 5′ gene FP_TRANSCRIPT_ID=ENSG000

partner. 00156735
This key value pair is only for
fusion type targets.

TP_TRANSCRIPT_ID The transcript ID for the 3′ gene TP_TRANSCRIPT_ID=ENSG000

partner. This field is absent for 00077782
CONTROL type amplicons.
This key value pair is only for
fusion type targets.

BREAKPOINT The position in the sequence BREAKPOINT=56

for the breakpoint. Applicable to
only fusion type amplicons. This
position is number of bases from
the Insert start, not the Amplicon
Start.

FP_GENE_ID The name of the 5′ gene partner in FP_GENE_ID=BAG4

the fusion.
This key value pair is only for
fusion type targets.

FP_GENE_STRAND The strand for the 5′ gene partner. FP_GENE_STRAND=+

Allowed values are '+' and '-'.
This key value pair is only for
fusion type targets.

FP_EXON_NUMBER The exon number in the 5′ gene. FP_EXON_NUMBER=2

Use comma-separated values
if the amplicon spans multiple
exons.
This key value pair is only for
fusion type targets.

Torrent Suite™ Software 5.18 User Guide 275

 Chapter 10 References management
10 Target regions and hotspots files

(continued)

Key Value Example

TP_GENE_ID The name of the 3′ gene partner in TP_GENE_ID=FGFR1

the fusion. This field is absent for
CONTROL type amplicons.
This key value pair is only for
fusion type targets.

TP_GENE_STRAND The strand for the 3′ gene partner. TP_GENE_STRAND=-

Allowed values are '+' and '-'. This
field is absent for CONTROL type
amplicons.
This key value pair is only for
fusion type targets.

TP_EXON_NUMBER The Exon number in the 3′ gene. TP_EXON_NUMBER=6

Use comma-separated values
if the amplicon spans multiple
exons.
This key value pair is only for
fusion type targets.

FP_CHROM The chromosome of the 5′ gene. FP_CHROM=chr8

This key value pair is only for
fusion type targets.

FP_START The start position for the 5′ FP_START=38050257

segments. Use comma-separated
values if there are multiple
segment Starts.
This key value pair is only for
fusion type targets.

FP_END The end position for the 5′ FP_END=38050313

segments. Use comma-separated
values if there are multiple
segment Ends.
This key value pair is only for
fusion type targets.

TP_CHROM The chromosome of the 3′ gene. TP_CHROM=chr8

This field is absent for CONTROL
type amplicons.
This key value pair is only for
fusion type targets.

276 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Target regions and hotspots files 10

(continued)

Key Value Example

TP_START The start position for the 3′ TP_START=38283673

segments. Use comma-separated
values if there are multiple
segment Starts.
This key value pair is only for
fusion type targets.

TP_END The end position for the 3′ jTP_END=38283763

segments. Use comma-separated
values if there are multiple
segment Ends.

HOTSPOT_POSITION The genomic coordinate of the HOTSPOT_POSITION=3828376

hotspot snp covered by the 9
amplicon. Use comma-separated
values if multiple hotspots are
covered by the amplicon.

CHROM The chromosome name of the CHROM=chr8

target region. This key is for all
non-fusion type targets. For fusion
targets, we have FP_CHROM and
TP_CHROM.

GENE_ID The name of the gene for GENE_ID=LMNA

nonfusion type targets. For fusion
targets, we have FP_GENE_ID and
TP_GENE_ID.

TRANSCRIPT_ID The transcript Id for nonfusion TRANSCRIPT_ID=ENST000003

type targets. For fusion targets, 89048
we have FP_TRANSCRIPT_ID and
TP_TRANSCRIPT_ID.

GENE_STRAND The strand of the gene. This GENE_STRAND=+

key is for all nonfusion type
targets. For fusion targets, we
have FP_GENE_STRAND and
TP_GENE_STRAND.

EXON_NUM The exon number(s) in the EXON_NUM=3,4

gene. Use comma-separated
values if the amplicon spans
multiple exons. For fusion targets,
we have FP_EXON_NUM and
TP_EXON_NUM.

Torrent Suite™ Software 5.18 User Guide 277

 Chapter 10 References management
10 Target regions and hotspots files

(continued)

Key Value Example

START The start position of the target START=53586113,53585786

segment. Use comma-separated
values if there are multiple
segment starts in genomic space.
This key is for all nonfusion type
targets. For fusion targets, we
have FP_START and TP_START.

END The end position of the target END=53586228,53585803

segment. Use comma-separated
values if there are multiple
segments in genomic space. This
key is for all nonfusion type
targets. For fusion targets, we
have FP_END and TP_END.

MIN_READ_COUNT The minimum number of reads MIN_READ_COUNT=100

needed to call the particular target
as present/absent. This value is
optional and if present, overrides
the universal minimum read count
threshold (for example, 20).
Example usage—For EGFR
deletion assay, we would use
a higher read count threshold
(greater than 20).

Example BED file entries

BAG4-FGFR1.B2F6 1 156 AMP1 . + . TYPE=Fusion;BREAKPOINT=36;

FP_GENE_ID=BAG4;
FP_ GENE_STRAND=+;
FP_EXON_NUM=2;
TP_GENE_ID=FGFR1;
TP_GENE_STRAND=-;
TP_EXON_NUM=6;
FP_CHROM=chr8;
FP_START=3805025 7;
FP_END=38050313;
TP_CHROM=chr8;
TP_START=38283673;
TP_END=38283763;
FP_TRANSCRIPT_ID=ENSG00000156735;
TP_TRANSCRIPT_ID=ENSG00000077782 ITGB7.ENCTRL.E14E15 1 132 AMP99 . + .
TYPE=CONTROL;
FP_GENE_ ID=ITGB7;
FP_CHROM=chr12;
FP_EXON_NUM=14,15;
FP_START=53586113,53585786;
FP_END=53586228,53585803;

278 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Test fragments 10

FP_GENE_STRA ND=-;
FP_TRANSCRIPT_ID=ENSG00000139626

Test fragments
Test fragments are known genetic sequences that are used to measure the quality of your chip
loading and sequencing run. You can include test fragments in your sequencing run and, after the
run completes, review the Details section of the run report to evaluate the quality of your loading and
sequencing run. For example, TF_1 is a single known sequence fragment that is added along with the
customer library at the beginning of templating and is processed through sequencing. TF_C is already
templated on ISPs and added after enrichment so goes through the loading and sequencing portions of
the workflow.
Test fragments are displayed when there are at least 500 high-quality reads, with an 85% match against
the appropriate template in the Test Fragment list.

View test fragment details

You can view existing test fragment nucleotide sequences used for quality metrics.

1. Click (Settings)4 Reference Sequences, then click Test Fragments in the left navigation
menu.
The Test Fragments table appears.

2. In the Test Fragments table, in the Name column, click a test fragment name to view the test
fragment details such as the complete test fragment sequence.

3. (Optional) In the Edit Test Fragment dialog box, add comments about the test fragment.

Add a custom test fragment

You can add custom test fragments to Torrent Suite™ Software.

1. Click (Settings)4Reference Sequences, then click Test Fragments in the left navigation
menu.

2. In the Test Fragments screen, click Add Test Fragment.

Torrent Suite™ Software 5.18 User Guide 279

 Chapter 10 References management
10 Barcodes and barcode sets

3. In the Add New Test Fragment dialog box, complete the following information.
Item Selection
Name Enter a unique name for your test fragment.
Key Enter the test fragment key using only the uppercase letters A, T, C, and G.
Sequence Enter the sequence using only the uppercase letters A, T, C, and G.
Enabled Select to enable.
Comments (Optional) Enter any comments about the test fragment.

If you enter an invalid character or duplicate test fragment, you cannot save your changes.

4. Click Save.

Your new test fragment and its details are displayed in the test fragment table.

Edit or delete a custom test fragment

You can edit or delete custom test fragments in Torrent Suite™ Software.

IMPORTANT! The TF_1 default test fragment is used to evaluate templating, bead loading, and
sequencing quality. Do not modify the default test fragment sequence that is supplied in Torrent Suite™
Software.

You can make the following edits to custom test fragments:

• Change the test fragment name, key, or comments.
• Change the test fragment nucleotide sequence.
• Change whether or not the test fragment is enabled.

1. Click (Settings)4Reference Sequences, then click Test Fragments in the left navigation
menu.

2. click a link in the Name column in the Test Fragments table.

3. To manage the test fragments, in the Edit Test Fragment dialog box, do one of the following:
• Edit Name, Key, Sequence, or Comments, or select/deselect the Enabled checkbox, then
click Save. Changes appear in the Test Fragments table.
• Click Delete to permanently remove the test fragment from Torrent Suite™ Software. Deleted
test fragments are removed from the Test Fragments table.

Barcodes and barcode sets

Torrent Suite™ Software supports sequencing runs in which multiple samples can be processed, or
multiplexed. A DNA barcode adapter molecule is used to tag a sample library when it is prepared. The
sample is then identified and tracked based on the barcode.

280 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Barcodes and barcode sets 10

Barcode adapter sets are used to associate multiple adapter barcodes with each individual sample
when Planned Runs are set up, or when manual runs of Torrent Suite™ Software plugins are configured.
For more information, see “Plan step in the workflow bar” on page 53 and “Run a plugin manually from
the sequencing run report” on page 132.
During a sequencing run that uses barcodes, Torrent Suite™ Software generates output files with reads
that are associated with the barcodes. The barcoded reads are aligned against the reference genome,
and results are stored in BAM and BAM index (BAI) files for each barcode. Reads that cannot be
classified as into one of the barcodes in the designated set are grouped into a no-match group;
alignment against the reference is also performed on the no-match group.
Alignment metrics for each barcoded read are available in the run reports for completed sequencing
runs. For more information, see “Output files” on page 107.
A sequencing run on the Ion S5™ and Ion GeneStudio™ S5 Systems that uses barcodes requires a
sample preparation kit that includes a barcode set or kit, such as the Ion Xpress™ barcode set or Ion
Torrent™ Dual Barcode Kit 1–96. Torrent Suite™ Software includes barcode sets for the latest available
barcode kits.
You can create custom sets of barcode adapters with comma-separated value (CSV) files, then upload
these files onto the Ion Torrent™ Server as barcode sets for use during sequencing runs. To create the
custom barcode set, you can download a sample DNA barcode set CSV file or an existing DNA barcode
set CSV file, customize the DNA barcode set in the file, and import the custom DNA barcode set to the
Ion Torrent™ Server.
You can also transfer DNA barcode sets between two different Ion Torrent™ Servers.

IMPORTANT! The creation of custom barcode sets is for advanced users only. For help with creating
custom barcode sets, contact your local Field Service Engineer.

View a DNA barcode sequence

You can view barcode ID, barcode and adapter sequences, notes, and barcode type for individual
barcodes in a barcode set.

1. Click (Settings)4Reference Sequences, then click Barcode Sets in the left navigation menu.

2. In the Barcode Sets table in the Name column, click the barcode name.
A table appears listing all the individual barcode IDs within the barcode set and their associated
information.

3. Click any column header to sort the display of that column.

To edit the existing barcode set, download the barcode set CSV file, edit the file, then import the revised
CSV file into Torrent Suite™ Software. For more information, see “Download a DNA barcode set CSV
file” on page 282.

Torrent Suite™ Software 5.18 User Guide 281

 Chapter 10 References management
10 Barcodes and barcode sets

Download a DNA barcode set CSV file

You can download a DNA barcode set CSV file and save it on your local storage. Use this feature to
transfer DNA barcode sets between two different Ion Torrent™ Servers. Alternatively, you can download
an existing DNA barcode set CSV file, customize the DNA barcode set, then import the new custom
DNA barcode set onto your Ion Torrent™ Server.

1. Click (Settings)4Reference Sequences, then click Barcode Sets in the left navigation menu.

2. In the Barcode Sets table, in the Action column, click (Actions)4Download.

A CSV file containing DNA barcode information is downloaded.

Save the CSV file to your local storage. You can now transfer this file to another Ion Torrent™ Server
or edit the file and import the new custom DNA barcode set into Torrent Suite™ Software. For more
information, see “Add a custom DNA barcode set” on page 282.

Add a custom DNA barcode set

You can create custom DNA barcode sets and add them to Torrent Suite™ Software for use in Planned
Runs.
To add a custom barcode set, you must generate a Comma-Separated Value (CSV), save the file to your
local storage, then import the file into Torrent Suite™ Software. All custom DNA barcode set files must
have a .csv extension.

1. Click (Settings)4Reference Sequences, then click Barcode Sets in the left navigation menu.
The Barcode Sets table lists all the available custom and system DNA barcode sets.

2. (Optional) Create a custom DNA barcode set CSV file using an existing DNA barcode set.
a. In the row of the existing DNA barcode set, In the Action column, click
(Actions)4Download.
A CSV file is automatically downloaded to your computer.

b. Edit the CSV file as described in “DNA barcode set CSV file setup” on page 283, then save it
to your local storage.

3. In the Barcode Sets screen, click Add new DNA Barcodes.

4. In the Add New DNA Barcodes dialog box, in Barcode Set Name, enter a descriptive name for
the custom DNA barcode set.

5. (Optional) Create a custom DNA barcode set CSV file using the example CSV file.
a. Click Download the example file.
A CSV file is automatically downloaded to your computer.

b. For each individual barcode in the barcode set, enter the information in each column as
described in “DNA barcode set CSV file setup” on page 283.

c. Save the CSV file to your local storage.

282 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Barcodes and barcode sets 10

6. Click Choose File, select a DNA barcode set CSV file from your local storage, then click Open.

7. Click Upload File.

The custom DNA barcode set is added to the DNA Barcodes table in the Barcode Sets screen
and is now available to be used in a Planned Run.

DNA barcode set CSV file setup

Each row in the CSV file contains information for an individual barcode in the barcode set.

Column name Type Description

index Integer A unique index for an individual barcode (for example, 1, 2, 3,...)
Only numerical characters are accepted.

id_str String A unique name for an individual barcode entry. Typically the
name of the barcode kit followed by a 3′– to 4′– digit unique
identifier, such as IonXpress_001 or IonCode_0101.

sequence String The 5′– barcode sequence.

(Required) Upper‑case G, C, A, and T are allowed.

adapter String The portion of the 5′– barcode adapter not used to identify this
barcode. Often referred to as the "stuffer sequence".
Upper‑case G, C, A, and T are allowed.

annotation -- Use for any barcode-specific notes.

end_sequence String The 3′– barcode sequence.

IMPORTANT! This sequence is required for libraries that were

prepared using dual barcode technology.
Upper‑case G, C, A, and T are allowed.

end_adapter String The portion of the 3′– barcode adapter not used to identify this
barcode. Often referred to as the "stuffer sequence".
This sequence is available only for libraries that were prepared
using dual barcode technology.
Upper‑case G, C, A, and T are allowed.

Torrent Suite™ Software 5.18 User Guide 283

 Chapter 10 References management
10 Upload history

Delete a custom DNA barcode set

After you import a custom DNA barcode set into Torrent Suite™ Software, if you no longer want to use
the set in your Planned Runs, you can delete it from your Ion Torrent™ Server.

IMPORTANT! Do not delete the any system barcode set.

1. Click (Settings)4Reference Sequences, then click Barcode Sets in the left navigation menu.

2. In the Barcodes table, in the row of the barcode set to be deleted, click (Actions)4Delete.

3. In the Confirm Delete Barcode Set dialog box, click Delete Barcode Set.

4. Click Yes, Delete! to confirm.

The DNA barcode set is permanently deleted from your Ion Torrent™ Server.

Upload history
Upload History is a list of the recent uploads of compressed file directories from AmpliSeq.com, target
regions files, and hotspots files.

The following information is displayed.

284 Torrent Suite™ Software 5.18 User Guide

 Chapter 10 References management
Upload history 10

Column Description

Uploaded File The file name of the uploaded file.

Type Indicates whether the file is a target regions, hotspots, or ZIP file.

Date The date that the file was uploaded.

Status A report of whether the file was successfully uploaded.

Any errors that occur during upload are shown in this column.

Torrent Suite™ Software 5.18 User Guide 285

11 Data management

■ View disk usage parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 286

■ View category statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287
■ View active data management jobs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287
■ Search for run reports with disk usage status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
■ Keep run report data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
■ Import data for data transfers or restoration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 290
■ View the data management actions log . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 290

Use the Data tab to view information about completed runs. You can also import data for data transfers
or restoration.
Data management actions to archive, export, or delete files require administrator rights, except for
import; a regular user can import or restore data back to a local drive.

View disk usage parameters

In the Data tab, click Data Management, then scroll to the Disk Usage section.

Parameters in the Disk Usage section.

Parameter Definition
Keep File space devoted to files that are to be kept.
Used File space being currently used by data files.
Free Space available for storing data files.
Threshold I Threshold above which intermediate files are deleted or archived, based on the
automatic configuration settings.
Threshold S Threshold above which signal processing input files are deleted or archived,
based on the automatic configuration settings.
Threshold B Threshold above which basecaller input files are deleted or archived, based on
the automatic configuration settings.
Threshold O Threshold above which output files are deleted or archived, based on the
automatic configuration settings.

For details regarding automatic deletion and archive creation, see “Archive or delete data automatically”
on page 333.

286 Torrent Suite™ Software 5.18 User Guide

 Chapter 11 Data management
View category statistics 11

View category statistics

In the Data tab, click Data Management, then scroll to the Category Statistics section.

Category statistics in the Category Statistics section.

Parameter Definition
File Category Group File type. For details, see “Ion instrument data types” on page 332.
Total The total number of data sets in each file category.
Keep The number of data sets in each file category that are exempt from data
management actions.
Archived The number of data sets in each file category that have been removed from your
Ion Torrent™ Server by data management archival.
Deleted The number of data sets in each file category that have been removed from your
Ion Torrent™ Server by data management deletion.
In Process The data sets that are currently archiving/deleting/importing.
Error Error column displays the count of file categories that are currently in an error
state.
If a data management action is rerun on one of these file categories and
completes successfully, then that file category no longer appears in the error
count.
Disk Usage GB used by each file category.

View active data management jobs

You can view runs that are in progress on the Torrent Server.

1. Click the Data tab, click Data Management, then scroll to the Active Data Management Jobs
section.

Torrent Suite™ Software 5.18 User Guide 287

 Chapter 11 Data management
11 View active data management jobs

2. (Optional) click a report to see the status of that report.

Details about active data management jobs.

Parameter Definition
Started On The start date and time of the job.
State The status of the job or file.
Report Name The identifier of job.
Category Identifies the file as one of the following file types.
• Signal processing input—required input files for signal processing.
• Basecalling input—required input files for base calling.
• Output files—files for data processing.
• Intermediate files—files used for debugging.

Size The file size, in MB, of the report.

Destination The folder location for archive or export action on the report.
User The user who started the data management action. For auto-actions, "dm-
agent" is the user.
Comment Text box for notes.

Error messages
Monitor the Disk Space Management section for messages that require administrator action.

Error message Action

Backup drive is full or missing Replace the backup drive.

Error Check the file /var/log/ion/

data_management.log for information regarding
the specific error condition. If appropriate, report the
error to Ion technical support.

Disk full message

Torrent Suite™ Software performance is affected when a disk partition is more than 95% full. When a
Ion Torrent™ Server or a mounted storage device reaches 95% full (and again at 99%), a warning is
displayed at the top of the Torrent Suite™ Software screen.

*** CRITICAL! /results/: Partition is getting very full - 95% ***

288 Torrent Suite™ Software 5.18 User Guide

 Chapter 11 Data management
Search for run reports with disk usage status 11

Search for run reports with disk usage status

You can find run reports with searches that are based on disk usage status, such as whether the data
type is archived, or is stored in a local directory. You can also use other search criteria, including name
and report date.

1. In the Data tab, click Data Management, then scroll to the Disk Space Management section.

2. Enter a search term or select for the following criteria:

• Search names
• Report date
• File type settings that are configured as Keep, are stored in the Local directory, Archived,
Deleted, In-process, or contain an Error for each file type:
– SigProc (Signal processing)
– Basecalling (Basecalling input)
– Output
– Intermediate

3. After you select the filters, click Go.

Run reports that match the criteria that you use in the search are listed in the Disk Space Management
table.

Keep run report data

You can prevent data from being deleted for individual run reports by applying the Keep attribute to the
types of files that are associated with the run report that were created during the run. These file types
are:
• Signal processing input files
• Basecalling input files
• Output files
• Intermediate files

If the Keep is applied to a data file, the data file cannot be deleted by any user. Instead, an error occurs
if any user tries to confirm deletion of run report data.

1. In the Data tab, click Data Management, then scroll to the Disk Space Management section.

2. Find the report, then select the checkbox under the Keep column that appears on the left of each
file category in that row.

Torrent Suite™ Software 5.18 User Guide 289

 Chapter 11 Data management
11 Import data for data transfers or restoration

Import data for data transfers or restoration

You can import data to a Ion Torrent™ Server from a mounted storage drive such as an external server
or a USB drive. The import function can be used to transfer data between servers or restore data that
has been archived.
Data can be imported only from storage drives that have been mounted on your Ion Torrent™ Server.
For information about mounting a storage drive, see “Increase file storage and available disk space” on
page 338.
The Import function can retrieve only the data files that were previously exported or archived. For
example, if you try to import files from an archive that does not include signal processing input or
basecalling input files, these files are not retrieved.

Note:
· Exported and archived files on a mounted drive can be viewed and analyzed directly in Torrent Suite™
Software under Completed Runs & Reports. If you unmount the storage device, the data is no
longer available. Import files before unmounting a drive to continue using them.
· If you import data that has been previously archived, the original archive remains. After an import,
data exists in two locations. The data is copied to Ion Torrent™ Server and remains in the original
archive location. If you later delete the file manually, the imported files remain in the archive.

1. Under the Data tab, click Data Management.

2. In the Data Import section, click Import.

3. Select a mounted Archive Directory, or click Browse to navigate to a particular subdirectory, then
click Select.

4. Use the checkboxes to select the file categories that you want to import, then click Import.

Imported files appear as standard data files under Completed Runs & Reports. The State of the data
files on the server is Local.

View the data management actions log

You can view a log for each run report that describes each change that is made to data management
settings.

1. In the Data tab, click Data Management.

2. Scroll to the Disk Space Management section.

3. Find the report for which you want to view the data management actions log.
For details about how to search for a run in the Disk Space Management section, see “Search for
run reports with disk usage status” on page 289.

290 Torrent Suite™ Software 5.18 User Guide

 Chapter 11 Data management
View the data management actions log 11

4. Click (Actions)4View Log.

A new screen containing chronological list of actions that are taken for this run report opens. The
date of the action, name of the user, and any comments are displayed.

5. Click Close to return to the Data Management screen.

Torrent Suite™ Software 5.18 User Guide 291

12 Supported software modules

■ Analysis pipeline overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292

■ BaseCaller module and barcode classification overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293
■ TMAP modules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307

Torrent Suite™ Software supports additional software modules in the analysis pipeline. These are the
Signal Processing module, the BaseCaller module, and the TMAP modules.

Analysis pipeline overview

The following depicts and describes the beginning steps of the Torrent Suite™ Software analysis
pipeline.

292 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

Steps:
1. The sequencing instrument generates DAT files of raw traces of electrical signals.
2. The signal processing step converts the raw traces into a single number per flow per well, in the
1.WELLS file.
3. The BaseCaller module converts the 1.WELLS file information into a sequence of bases, and writes
the sequence into an unaligned BAM file.
4. The BAM file is passed to the TMAP module for alignment.

The signal processing step also marks several types of low-quality reads:
• Polyclonal reads (reads with two template beads instead of one).
• Reads with high signal processing residual (indicating an ambiguous signal value).
• Reads that do not contain a valid library key.

The signal processing step marks these problematic reads but does not remove them.

BaseCaller module and barcode classification overview

The BaseCaller module controls barcode classification and filtering and trimming.

Overview of the BaseCaller module functionality

In addition to creating a sequence of bases from the 1.WELLS file information, the BaseCaller module
also performs read filtering and read trimming.
Notes on read filtering
• Filters out low-quality reads that were marked during signal processing.
• Filters out reads that fail basecalling filters.
• The removed reads do not appear in the BAM file. The BaseCaller module keeps counts of these
reads but there is no record of specific reads that are filtered out.

Notes on read trimming

• Removes specific bases from the read for quality reasons.
• The read appears in the BAM file.
• The removed bases do not appear in the BAM file.

The BaseCaller module performs these functions:

1. Removes low-quality reads that were marked during the signal processing step.
2. Performs base calling:

a. From the signal values, creates the sequence of bases.

b. Estimates the base quality value for each base.
3. Performs 5′ barcode classification:

a. Assigns each read to a barcode.

b. Trims the barcode sequence away if the parameter --trim-barcodes=on is specified. The
default is 'on'.

Torrent Suite™ Software 5.18 User Guide 293

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

4. Trims 5′ PCR handle.

5. Trims 5' unique molecular tag.
6. Trims extra bases at the 5' end. Trimming is controlled by the parameter --extra-trim-left.
The default is 0, meaning no extra trimming.
7. Filters out reads that are too short. Filtering is controlled by the parameters--min-read-length
and -- trim-min-read-len.
8. Filters out reads that do not have the correct library key. Filtering is turned off by the parameter
--keypass-filter.
9. Trims the P1 adapter at the 3' end.
10. Classifies and trims the 3′ barcode.
11. Trims the 3′ PCR handle.
12. Trims the 3’ unique molecular tag.
13. Trims extra bases on the 3’ end. Trimming is controlled by the parameter --extra-trim-right .
The default is 0, meaning no extra trimming.
14. Performs quality trimming. Trimming is affected by the parameters --trim-qual-window-size
and -- trim-qual-cutoff.

The BaseCaller module classifies and trims read elements from the outside inwards to obtain the query
sequence. If an outer element cannot be identified, the BaseCaller module does not attempt to identify
and trim an inner one. If trimming the barcode is disabled using the -trim-barcodes parameter, PCR
handles, UMTs, or extra-bases will not be trimmed. Read elements on the 5' end will only be trimmed if
the P1 adapter was found.
Notes about quality trimming
• The purpose of quality trimming is to identify where quality problems start at the end of a read.
We try to identify when bases fall below a quality threshold and trim both of those bases and a bit
before those bases.
• The parameter --trim-qual-window-size sets the window size for quality trimming. The
algorithm slides through the sequence of bases and, each time the window shifts, computes the
mean Base QV value for all bases in the window.
• If the mean Base QV value for all bases in the window falls below a threshold (set by the parameter
--trim-qual-cutoff where the default 16), then trims all bases from the center of the window
at that time to the 5' end.

Notes about barcode classification and barcode filtering

Barcode classification determines which barcode group a read is assigned to. Barcode classification is
done for each read immediately after base calling.
Barcode filtering determines if a specific barcode is included in the run report or is filtered out. Barcode
filtering works on the barcode groups as a whole

294 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

Ion Torrent™ BAM format

Ion Torrent™ BAM files follow the conventions of the SAM/BAM Format Specification Working Group.
SAM stands for Sequence Alignment/Map.
The following highlights specific Ion Torrent™ conventions and the meaning of custom tags.
• Run ID: Every TS analysis assigns a run ID, a 5-character string consisting of upper-case letters
and numbers. A reanalysis of a specific run assigns a different run ID. Example: 0JU8V.
• Read Group ID: For non-barcoded runs the read group ID is equal to the run ID. For barcoded runs
it is a combination of the run ID and the barcode name, which is separated by a dot. Example:
0JU8V.IonXpress_001.
• Key Sequence (KS): For non-barcoded runs, the Key Sequence tag is the Ion Torrent™ library key
(TCAG). For barcoded runs the KS tag entry includes the barcode sequence and the barcode
adapter sequence if barcode trimming is enabled.
• Reverse Key Sequence (sk): For dual-barcoded runs, the Reverse Key Sequence tag includes the
end barcode adapter sequence and the end barcode sequence.
• SAM record (read) names: Read names are a combination of the run ID and the chip coordinates
of the well that produced the read. The coordinate values are 5-digit numbers and are given in the
order row and the column, which is separated by a colon. Example: 0JU8V:01308:00107.
• BAM header comment lines (CO): Comment lines in the BAM header are used to store base
calibration information, or information about the 3' adapter sequences.

Custom BAM recorder tags

Ion Torrent™ technology uses a collection of custom tags to store sequencing and alignment information
useful for downstream processing. In general, custom BAM tags starting with Z or Y are written by the
BaseCaller module, and BAM tags starting with X stem from TMAP. As a consequence, tags starting
with Z or Y are present both in aligned and unaligned BAM files, whereas tags starting with X appear
only in aligned BAM files.

BAM tag Type Description

XA Z The algorithm that produced this mapping and from what stage. The
format is the algorithm name and the zero-based stage (separated by a
dash).

XM i The target length, that is, the number of reference bases spanned by
the alignment.

XS i The alignment score of the next-best suboptimal mapping.

ZA i The number of library insert bases, where the library insert is defined
as the sequence after the 5' trimmed region (sequence in tags KS, ZK,
ZT, ZE), and before the 3' trimmed region (sequence belonging to the 3'
adapter, and the content of the tags SK, YK, YT, YE). Present only if a
3' adapter was found.

ZB i The number of overlapping adapter bases. Present only if a 3' adapter

was found.)

Torrent Suite™ Software 5.18 User Guide 295

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

(continued)

BAM tag Type Description

ZC B:i A vector of the following four values (present only if a 3' adapter was
found):
• Field 1: The zero-based flow during which the first base of the
adapter was incorporated (same as ZG).
• Field 2: The zero-based flow corresponding to the last insert base.
• Field 3: Length of the last insert homopolymer.
• Field 4: Zero-based index of adapter type found.

ZF i The zero-indexed flow position corresponding to the first template base

after 5' trimmed region.

ZG i The zero-based flow during which the first base of the adapter was
incorporated. (Present only if a 3' adapter was found.)

ZM B:s Normalized signals, which include phasing effects. Stored as

floor(256*value).

ZP B:f The estimated phase parameters for the read. The values are stored in
the order CF (carry forward), IE (incomplete extension), and DR (droop).

ZT Z The trimmed 5’ unique molecular tag sequence. Written only if a tag

was trimmed.

YT Z The trimmed 3’ unique molecular tag sequence. Written only if a tag

was trimmed.

ZE Z The 5’ trimmed sequence removed by the extra-trim-left

command. Written only if a sequence was trimmed.

YE Z The 3’ trimmed sequence removed by the extra-trim-right

command. Written only if a sequence was trimmed.

ZK Z The trimmed 5' portion of read group specific identifiers that can vary
within a read group. Written only if a tag was trimmed.

YK Z The trimmed 3' portion of read group specific identifiers that can vary
within a read group. Written only if a sequence was trimmed.

296 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

BaseCaller module arguments

The following select arguments are used with the BaseCaller module.

About BaseCaller module parameters

BaseCaller module parameters are provided to reanalyze a completed run. The default BaseCaller
module parameters are tuned for Ion Torrent™ sequencing data. In most cases, you do not need to
modify these settings.
Modifying these parameters is recommended for advanced users only. If you need to use a custom
barcode set, contact your Field Service Engineer for assistance. Correct parameter settings require
knowledge of the barcodes distances in signal space. The BaseCaller module parameter defaults are
optimized for the Ion Xpress™ barcode set, and likely are not correct for a custom barcode set.
When you reanalyze a run, other parameters are also listed in the BaseCaller arguments field. These
parameters are for internal use; do not change or remove these fields.

Note: Barcode classification is the process by which reads are assigned to one of the barcodes
present in one analysis run. Correct barcode classification is important because a classification error
results in a read being assigned to the wrong barcode, which in turn leads to the read being analyzed as
belonging to a wrong sample.

Barcode classification determines which barcode group a read is assigned to. Barcode classification is
done for each read immediately after base calling.
Barcode filtering determines if a specific barcode is included in the run report or is filtered out. Barcode
filtering works on the barcode groups as a whole.

Torrent Suite™ Software 5.18 User Guide 297

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

Barcode classification parameters

The more common BaseCaller module parameters relating to barcode classification are listed and
described in the following table. All parameters listed in this table are barcode classification parameters.

Parameter Default Description

--barcode- 1.0 The maximum distance allowed in barcode matches. A

cutoff threshold that sets the stringency for barcode matches. Lower
(Float)
values require more exact matches when assigning reads to
barcodes. Higher values allow less exact matches.
Reads that have a distance greater than this value are counted
as barcode no-matches.

--barcode-mode 2 The barcode mode.

(Integer) • 0—Classification based on exact barcode base match.
• 1—A barcode is scored by comparing each read sequence
to each barcode sequence in a flow space alignment.
Errors in each flow are summed over the length of the
barcode flows. Then any barcode with a number of errors
equal to or less than the --barcode-cutoff value can
be considered, and the barcode with the fewest errors with
respect to the input sequence is the matching barcode.
• 2—The barcode classification is based on signal
information, specifically on the squared distance between
the measured signal and the predicted barcode signal.

--barcode- 2.5 This setting controls how much ambiguity in barcode

separation assignment you want to tolerate, by investigating the distances
(Float)
to both the closest barcode and to the next closest barcode. A
read is rejected if the difference in these two distances is less
than the --barcode-separation setting.
--barcode-separation has no effect when --barcode-
mode is set to 1.

--barcode- 1 • 0—Keeps the 4.0 behavior: barcode filtering is done

filter-postpone independently on each block.
(Integer)
• 1—The BaseCaller module does barcode pre-filtering at
a 10x lower frequency threshold (10 times more lenient).
Barcode filtering is done on the full information of the
whole chip, after the 96 blocks are merged into one.
• 2—The BaseCaller module does not do any barcode
prefiltering. All barcode classification happens after the 96
blocks are merged into one. The "2" setting is slower,
creates more files, and involves more processing than the
"1" setting.

298 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

(continued)

Parameter Default Description

--barcode- 0.01 Barcode frequency threshold to be reported in the user

filter interface. The relative frequency of a barcode is the number of
(Float)
assigned reads divided by the number of reads assigned to the
most frequent barcode.
0.0—Off. The setting 0.0 causes all barcodes in the barcode set
to be reported in the user interface, including barcodes with no
or very few reads, provided that the barcode group has at least
--barcode-filter-minreads number of reads. Barcodes
with no or very few reads typically are not relevant to your
analysis and should be filtered out.

--barcode- 20 The threshold for the minimum number of reads in a barcode

filter-minreads group for that group to be reported in the user interface.
(Integer)

--end-barcodes on For dual barcoding runs, specifying "off" disables end barcode
classification and uses the start barcodes for read classification
(Boolean)
instead of both barcodes.
For example, for DNA germline or somatic variant calling, dual
barcodes are generally not needed. You may also do hybrid
analyses with varying limits of detection, that account for
fluctuations in read coverage.
When the parameter is set to "off":
• End barcodes are still searched for and trimmed off the
read if found.
• No sk tag is written in the BAM read group header.
• End barcodes, end barcode adapters, or PCR handles are
trimmed if they are found and all stored in the YK tag.
• Reads not having a YK tag are those that are normally
filtered by a dual barcode analysis, such as read where no
bead adapter was found.
• Using Ion AmpliSeq™ HD chemistry, the tag trimmer
options have to be adjusted to keep reads where
no end barcode was identified. Use --tag-filter-
method=need-prefix.
• Using Ion AmpliSeq™ HD chemistry, variant caller options
have to be adjusted to emulate a normal Ion AmpliSeq™
analysis. Specifically, variant caller needs to be configured
to ignore molecular tag information.
• End barcode classification will not be completely off.
Reads where an end barcode was identified that does
not match read group expectations, that is, reads that are
“certified contamination” are still being filtered and pushed
to no-match.

Torrent Suite™ Software 5.18 User Guide 299

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

(continued)

Parameter Default Description

--trim-barcodes on Trim the barcode and barcode adapter. If off, disables all other
5’ trimming.
(Boolean)

--barcode- 0.15 Validate the barcode adapter sequence. The parameter given is
adapter-check the maximum allowed squared residual per flow. This feature
(Float)
reduces cross-contamination, for example, between the Ion
Xpress™ Barcode Adapters and IonCode™ Barcode Adapters
barcode sets.
0—Off.

Cutoff setting
Notes about the --barcode-cutoff parameter with --barcode-mode set to 1:
• The setting 0 is the most restrictive setting. --barcode-cutoff set to 0 allows only reads that
perfectly match a barcode in base space.
• The setting 0 works with any barcode set (for both Ion Torrent™ sets and custom barcode sets).
• Do not set --barcode-cutoff greater than 2 with the Ion Xpress™ Barcode Adapters barcode
set. Values greater than 2 relax the classification rules and allow incorrect barcode assignments.

A rule of thumb for the maximum --barcode-cutoff setting is based on the minimum distance of the
barcode set in flow space:

The minimum distance for the Ion Xpress™ Barcode Adapters barcode set is 5. The maximum
recommended value for --barcode-cutoff is 2 for analyses that use the Ion Xpress™ Barcode
Adapters barcode set.

Separation setting
Notes about the --barcode-separation parameter:
• Larger values (close to the minimum distance of the code) require more strict matching of the
predicted signal for a read to be assigned to a barcode.
• Smaller values (for example, 0.2 and below) allow barcode assignment with an expanded tolerance
for errors. For example in the extreme case of separation=0, the measured signal may be in
between two predicted barcode signals.
• If --barcode-separation is set at or above the minimum distance of the barcodes in flow
space, no reads at all are assigned to a barcode.
• If --barcode-separation is set close to the minimum distance of the barcodes in flow space,
very few reads are assigned to a barcode.
• If --barcode-separation is too small, the risk of cross-contamination increases. More
ambiguous reads are forced into a barcode assignment (with a higher rate of error in these
assignments).

300 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

A rule of thumb for a good --barcode-separation setting is one half of the minimum distance of the
barcode set in flow space:

Other public parameters

The BaseCaller module and its parameter settings control these types of filtering:
• Keypass
• Quality trimming
• Adapter trimming

The public BaseCaller module parameters are listed and described in the following table. The defaults
for these parameters are optimized for most scenarios and in most cases the default settings are
recommended.

Parameter Default Description

-d, or off When on, disables all filtering and

trimming and overrides other filtering and
--disable-all-filters
trimming settings.

-k, or on When on, filters out reads that do not

both produce a signal and match the
--keypass-filter
library key (or the test fragment key).

--min-read-length 25 Filters out reads less than this minimum

read length.
(integer)
This filter screens out poor reads early
on to avoid wasting processing time on
them.
See also --trim-min-read-len, which
sets the minimum length threshold that is
applied after trimming.

--prefix-mol-tag Empty Base structure of 5’ unique molecular tag

(ACGTN bases) to be trimmed after the
barcode adapter.
In Torrent Suite™ Software 5.10 and 5.12,
specify the read structure via a read
structure input file. While this option
still exists in the code base and could
potentially be used, none of our run plans
do so.

Torrent Suite™ Software 5.18 User Guide 301

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

(continued)

Parameter Default Description

--suffix-mol-tag Empty Base structure of 5’ unique molecular tag

(ACGTN bases) to be trimmed before P1
adapter.
In Torrent Suite™ Software 5.10 and 5.12,
specify the read structure via a read
structure input file. While this option
still exists in the code base and could
potentially be used, none of our run plans
do so.

--extra-trim-left 0 Trims this number of bases beyond

the barcode adapter and the 5' unique
(integer)
molecular tag (if applicable).

--extra-trim-right 0 Trims this number of bases at the 3'

end of the template before the 3' unique
molecular tag (if applicable) and the P1
adapter. Only done if the P1 adapter was
found.

--trim-adapter-cutoff 16 A score cutoff value.

(float) Smaller values correspond to more
stringent adapter search and larger values
to less stringent adapter search.
Set to 0 to turn off.

--trim-adapter-min-match 6 The minimum number of P1 adapter

bases required in order to trim the P1
(integer)
adapter.

--trim-qual-window-size 30 Window size for quality trimming.

(integer)

--trim-qual-cutoff 16 Cutoff for quality trimming.

(float) Set to 100 to turn off. When set to 100,
no reads are filtered out due to this
parameter.

--trim-min-read-len 25 Filters out any reads that fall below this

minimum read length after any trimming
(integer)
step. By default it is initialized with the
value of min-read-length.

302 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

About barcodes
Barcodes are short base sequences that during library preparation are placed between the library key
and the read. The barcode sequences provide a mechanism to distinguish and identify reads from
different samples during data analysis.
The use of barcodes allows multiple samples to be sequenced together on one chip during a
sequencing run, and still have the read data for the run be analyzed separately afterward as distinct
samples.
This diagram shows the placement of the barcode sequence, and the library key and adapters, with the
read sequence (labeled "Template Bases"). The key is on the 5' end.

This example shows the location of the barcode sequence in both base space and flow space, using
barcode IonPress_001 as an example:

Troubleshooting barcode classification issues

Use the BaseCaller JSON output file to troubleshoot barcode classification issues. Barcode
classification metrics are available in the basecaller_results/datasets_basecaller.json file
in the Torrent Suite™ Software analysis directory. This file contains information about all barcodes,
whether they appear in the run report or are filtered out.
A sample of this file is shown here, and is used in later examples.

{
"0NCWC.IonHDdual_0101": {
"Q20_bases": 25,
"barcode": {
"barcode_adapter": "",
"barcode_adapter_filtered": 0,
"barcode_bias": [
0.209209978580475,
-0.0654730796813965,
-0.0002632737159729,
0.0154760638251901,
0.177288889884949,
0.2724369764328,
0.00381212681531906,
0.105516441166401,
-0.292163729667664,
0.0684881433844566,
-0.000637046992778778,
-0.0821478366851807,
-0.0467215031385422,
0.0904117226600647

Torrent Suite™ Software 5.18 User Guide 303

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

],
"barcode_distance_hist": [
0,
1,
0,
0,
0
],
"barcode_errors_hist": [
1,
0,
0
],
"barcode_match_filtered": 0,
"barcode_name": "IonHDdual_0101",
"barcode_sequence": "CTAAGGTAAC"
},
"barcode_name": "IonHDdual_0101",
"description": "KHAresPanV5bidirhUnewdesignMETCNVladder3",
"end_barcode": {
"adapter_filtered": 0,
"barcode_adapter": "",
"barcode_errors_hist": [
1,
0,
0,
0
],
"barcode_filtered": 757,
"barcode_name": "IonHDdual_0101",
"barcode_sequence": "TGACTCTATTCG",
"no_bead_adapter": 17
},
"filtered": true,
"handle": {
"bc_handle_distribution": [
0,
1,
0
],
"bc_handle_errors_hist": [
1,
0,
0,
0
],
"bc_handle_filtered": 82,
"end_handle_distribution": [
0,
0,
1
],
"end_handle_errors_hist": [
1,
0,
0,
0
],
"end_handle_filtered": 0
},
"index": 1,

304 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
BaseCaller module and barcode classification overview 12

"mol_tag_prefix": "TNNNACTNNNTGAT",
"mol_tag_suffix": "ATCANNNAGTNNNA",
"num_blocks_filtered": 96,
"platform_unit": "s5/540/QPT035/18/DADL00693/IonHDdual_0101",
"read_count": 1,
"reference": "hg19",
"sample": "none",
"total_bases": 25
}
}

Explanation of fields in the BaseCaller JSON file

The information that follows describes the numbers of barcodes that would be included or discarded if
you reanalyze a run with certain changed BaseCaller module settings.

Barcode bias
The barcode_bias values show the mean signal deviation by flow: how much the observed signal is
off from the expected signal. Low bias values, for example with the value shown here, are indications of
good signal.
Bias values around 0.33 indicate a signal that is about a third of a base off. Values near 0.5 indicate a
signal that is half a base off. Values in this range indicate a problem with the sequencing run or with the
barcode classification.

"barcode_bias": [ 0.026, -0.028, -0.034, 0.011, -0.019, -0.001, 0.072,?

-0.061, 0.103, -0.008, -0.062, 0.110, -0.021, 0.001],

Barcode distance histogram

The barcode distance histogram shows, in signal space, the number of reads at various squared
residual distances between the predicted signal and the observed signal.
The distance fields are given in 0.2 increments:
• The first field gives the number of reads with a squared residual distance of between 0 and 0.2.
• The second field gives the number of reads with a squared residual distance of between 0.2 and
0.4.
• The third field gives the number of reads with a squared residual distance of between 0.4 and 0.6,
and so on.

Smaller distances reflect better matches of the read to barcode. Larger distances reflect poorer
matches.
This example reflects the pattern that is typical of a real barcode:
• The most reads have shorted distance residuals.
• Fewer reads have larger distance residuals.
• The entry 5342 in the fifth field tells us that reducing --barcode-cutoff to 0.8 would cause
those 5342 reads not to be assigned to a barcode.

"barcode_distance_hist": [ 907546, 50122, 10793, 4498, 5342 ],

Torrent Suite™ Software 5.18 User Guide 305

 Chapter 12 Supported software modules
12 BaseCaller module and barcode classification overview

Barcode errors histogram

The barcode errors histogram shows the number of reads with difference levels of basecalling errors in
this barcode:
• The first field gives the number of reads that have 0 basecalling errors (949782 in this example).
This is the number of reads that perfectly match this barcode (in base space).
• The second field gives the number of reads that have one basecalling error (24584 in this example).
• The third field gives the number of reads that have two basecalling errors (3935 in this example).

From the 3935 value with 2 basecalling errors, we know that if we reanalyze with the number of allowed
errors set to 1 instead of 2, then 3935 fewer reads are assigned to this barcode.

"barcode_errors_hist": [ 949782, 24584, 3935 ],

This histogram is typical of a real barcode. A large majority of reads are perfect matches, a few have
one error, and a smaller number have two errors.
If the pattern is reversed (with very few perfect matches, some reads with one error, and many reads
with 2 errors), we suspect that this is probably a fake barcode.

Barcode match filtered

The barcode_match_filtered field gives the number of reads that perfectly match the barcode in
base space, and also are filtered out because they do not meet the separation criteria in signal space.
The signal for these reads is in between two barcodes and is not close enough to either barcode to be
assigned.

"barcode_match_filtered": 162,

Filtered
The filtered field is true if this barcode is filtered out and false if the barcode appears on the run
report.

"filtered": false,

Read count
The read_count field shows how many reads were assigned to this barcode.

"read_count": 978301,

306 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
TMAP modules 12

TMAP modules
The Torrent Mapping Alignment Program (TMAP) is a sequence alignment software program that is
optimized specifically for Ion Torrent™ data.
TMAP generally operates in two phases:
• Initial mapping, when the read sequences are located within the reference genome.
• Alignment refinement, when each particular position of the read is aligned to the corresponding
position in the reference.
TMAP can run mapping/alignment cycles iteratively, applying different algorithms and parameters to
the reads that were not aligned at earlier iterations. In a typical workflow, just one mapping/alignment
iteration is used.
TMAP provides several mapping algorithms by using the map1, map2, map3, map4, and mapvsw
modules, each with its own best application. The default algorithm is the map4 module.
The alignment refinement phase includes initial alignment using Smith-Waterman or Needleman-Wunch
algorithms, and some optional alignment refinement stages that are designed to compensate for
specific systematic biases of the sequencing process. Thus:
• The reads can be realigned for better homopolymer alignment (the --context option).
• The portions with likely phasing errors can be realigned with low indel scores (the --do realign
option).
• The long indels at the edges of amplicons can be salvaged (the --end-repair option).
• The tandem repeats can be clipped from the read 3' tail (the --do-repeat-clip option).
• The alignment can be performed in flowspace instead of basespace (the --final-flowspace
option). In this case the flow signal obtained from the sequencer is aligned with the estimated flow
signal from corresponding zone in the reference genome.

When you reanalyze a run, you can change both the TMAP module and the module parameters.
Usually, you do not need to modify the default parameter settings. The default TMAP parameters are
tuned for Ion Torrent™ data. Modifying these parameters is for advanced users.

Mapping modules
The mapping alternatives supported by TMAP are listed and described in the following table. The
map4 module is the default. Other modules are not run unless specifically called, for instance on the
Reanalyze screen.
Click the module name link to see the options supported for that module.

Module Description

“TMAP map1 options” BWA-short reads mapping.

on page 309 • Very fast at finding perfect matches.
• Very slow at finding a set of matches with up to two mismatches.

Torrent Suite™ Software 5.18 User Guide 307

 Chapter 12 Supported software modules
12 TMAP modules

(continued)

Module Description

“TMAP map2 options” BWA-long / BWASW reads mapping.

on page 311

“TMAP map3 options” Simplified SSAHA, based on a k-mer lookup table.

on page 312

“TMAP map4 options” Based on the BWA fastmap routine.

on page 313
Searches for the maximum exact matches between the reads and reference.

“TMAP mapvsw A vectorized implementation of Smith-Waterman.

options” on page 314 • A single mapping strategy that is twice as fast as the other modules.
• Modified to improve specificity.

mapall A tool that allows algorithms from the map1, map2, map3, map4, and mapvsw
modules to be combined into read processing pipelines.
The tool allows the read mapping process to be organized into a sequence of up
to 9 stages that are sequentially applied to each read. If the read is successfully
mapped at one stage, the further stages are not applied to it. At each stage, one
or more algorithms can be applied. All hits found by any mapping algorithm are
processed together.
The syntax for mapall invocation is: tmap <global options>
mapall stage1 <stage 1 spec> [stage2 <stage2_spec>
[stage3 ....]]], where stageX_spec takes the form: "<stage
parameters> mapping_method1 <mapping_method1_params>
[mapping_method2 <mapping_method2_params>...]".

Find the TMAP command for a specific analysis

For steps to open the run report log and search for the TMAP command, see “TMAP examples” on
page 308. The analysis must be completed before you can find the command.

TMAP examples
This example uses TMAP map4 mapping algorithm with default settings.

tmap mapall -f /results/referenceLibrary/tmap-f3/hg19/hg19.fasta

-r /<server_path>/results/analysis/output/Home/Auto_user_G35-685--
R65832-110mM_K2SO4-OT_salts-0630_24057_58335/IonXpress_057_rawlib.bam
-v
-Y
-u --prefix-exclude 5
-o 2 stage1 map4

The next example is the previous TMAP default setting. This example uses the map1, map2, and map3
modules in that order. Progressively more reads are mapped by each module.

tmap mapall -f <FASTA_file>

-v

308 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
TMAP modules 12

-Y
-u --prefix-exclude 5 stage1 map1 map2 map3

Global options used by all TMAP modules

Option Alternate option Type Default Description

-f --fn-fasta File [ no default ] FASTA reference file.

-r --fn-reads File Standardinput (stdin) The reads file name.

-i --reads-format String Unknown The reads file format

(fastq | fq | fasta | fa |
sam | bam).

-s ---fn-sam File Standardoutput (stdout) The SAM file name.

--bam- none Integer 0 Sets the starting virtual

start- file offsets that limit the
vfo range of BAM reads to
process.

-A --score-match Integer 1 Score for a match.

--pen-mismatch Integer 3 Mismatch penalty.

-M

-O --pen-gap-open Integer 5 INDEL start penalty.

-E --pen-gap-extension Integer 2 INDEL extension

penalty.

-G --pen-gap-long Integer -1 Long INDEL penalty.

Global pairing options

Option Alternate option Type Default Description

-Q --pairing Integer 0 The insert pairing.

• 0 = Do not perform pairing.
• 1 = Mate pairs (-S 0 -P 1).
• 2= Paired end (-S 1 -P 0).

TMAP map1 options

The TMAP map1 module implements BWA-short reads mapping and has these characteristics:
• map1 is very fast at finding perfect matches.
• map1 is very slow at finding a set of matches with up to two mismatches.

The map1 module is not the default for TMAP, map4 is the default.
The following options are supported with the TMAP map1 module (all are optional).

Torrent Suite™ Software 5.18 User Guide 309

 Chapter 12 Supported software modules
12 TMAP modules

Option Type Default Description

--seed-length Integer 32 The k-mer length to seed CALs.

-1 to disable.

--seed-max-diff Integer 2 The maximum number of edits in the

seed.

--seed2-length Integer 48 The secondary seed length.

-1 to disable

--max-diff Float 0.04 The maximum number of edits or

false-negative probability assuming the
maximum error rate.

--max-error-rate Float 0.02 The assumed per-base maximum error

rate.

--max-mismatches Integer 3 The maximum number of or (read length)

fraction of mismatches.

--max-gap-opens Integer 1 The maximum number of or (read length)

fraction of INDEL starts.

--max-gap- Integer 6 The maximum number of or (read length)

extensions fraction of INDEL extensions.

--max-cals- Integer 10 The maximum number of CALs to extend

deletion a deletion.

--indel-ends-bound Integer 5 The number of bps from the end of the

read.

--max-best-cals Integer 32 Optimal CALs have been found.

--max-nodes Integer 2000000 The maximum number of alignment

nodes.

--min-seq-length Integer -1 The minimum sequence length to

examine.
-1 to disable

--max-seq-length Integer -1 The maximum sequence length to

examine.
-1 to disable

310 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
TMAP modules 12

TMAP map2 options

The TMAP map2 module implements BWA-long / BWASW reads mapping.
The map2 module is not the default for TMAP, map4 is the default.
The following options are supported with the TMAP map2 module (all are optional).

Option Type Default Description

--max-seed-hits Integer 1,024 The maximum number of

hits returned by a seed.

--length-coef Float 5.5 The coefficient of length-

threshold adjustment.

--max-seed-intv Integer 6 The maximum seeding

interval size.

--z-best Integer 1 The maximum number

of top-scoring nodes to
keep on each iteration.

--seeds-rev Integer 5 The number of seeds to

trigger reverse alignment.

--narrow-rmdup Integer false Remove duplicates for

narrow SA hits.

--max-chain-gap Integer 10,000 The maximum gap size

during chaining.

--min-seq-length Integer -1 The minimum sequence

length to examine.
-1 to disable.

--max-seq-length Integer -1 The maximum sequence

length to examine.
-1 to disable

Torrent Suite™ Software 5.18 User Guide 311

 Chapter 12 Supported software modules
12 TMAP modules

TMAP map3 options

The TMAP map3 module implements a simplified SSAHA, based on a k-mer lookup table.
The map3 module is not the default for TMAP, map4 is the default.
The following options are supported with the TMAP map3 module (all are optional).

Option Type Default Description

--seed-length Integer -1 The k-mer length to seed

CALs.
-1 to disable

--max-seed-hits Integer 20 The maximum number of

hits returned by a seed.

--hit-frac Float 0.2 The fraction of seed

positions that are under
the maximum.

--seed-step Integer 8 The number of bases

to increase the seed
for each seed increase
iteration.
-1 to disable

--hp-diff Integer 0 The single homopolymer

error difference for
enumeration.

--fwd-search Boolean False Use forward search

instead of a reverse
search.

--skip-seed-frac Float 0.2 The fraction of a seed

to skip when a lookup
succeeds.

--min-seq-length Integer -1 The minimum sequence

length to examine.
-1 to disable

--max-seq-length Integer -1 The maximum sequence

length to examine.
-1 to disable

312 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
TMAP modules 12

TMAP map4 options

The TMAP map 4 module is based on the BWA fastmap routine, and searches for the maximum exact
matches between the reads and reference.
The map4 module is the default for TMAP.
The following options are supported with the TMAP map4 module (all are optional).

Option Type Default Description

--seed-step Integer 8 The number of bases

to increase the seed
for each seed increase
iteration.
-1 to disable.

--hit-frac Float 0.2 The fraction of seed

positions that are under
the maximum.

--min-seed-length Integer -1 The minimum seed length

to accept hits.
-1 to disable

--max-seed-length Integer 48 The maximum seed

length to accept hits.

--max-seed-length- Float 2.0 maximum seed length

adj-coef adjustment coefficient.
-1 to disable

--max-iwidth Integer 20 The maximum interval

size to accept a hit.

--max-repr Integer 3 The maximum

representative hits for
repetitive hits.

--rand-repr Integer false Choose the

representative hits
randomly. Otherwise
uniformly.

--use-min Boolean false When seed stepping, try

seeding when at least
the minimum seed length
is present. Otherwise,
use the maximum seed
length.

Torrent Suite™ Software 5.18 User Guide 313

 Chapter 12 Supported software modules
12 TMAP modules

(continued)

Option Type Default Description

--min-seq-length Integer -1 The minimum sequence

length to examine.
-1 to disable.

--max-seq-length Integer -1 The maximum sequence

length to examine.
-1 to disable

TMAP mapvsw options

The TMAP mapvsw module implements a vectorized implementation of Smith-Waterman.
The mapvsw module is not the default for TMAP, map4 is the default.
The following options are supported with the TMAP mapvsw module (all are optional)

Option Type Default Description

--min-seq-length Integer -1 The minimum sequence

length to examine.
-1 to disable

--max-seq-length Integer -1 The maximum sequence

length to examine.
-1 to disable

TMAP alignment refinement

The TMAP alignment refinement phase is organized as a pipeline of optional processing stages, each
controlled by a specific set of options. The following stages are available (given in the order of their
optional invocation).

Stage Description

Flow space realignment Performs alignment of the sequence of read flow signals to simulated
reference flow signal. Turned on with the --final flowspace flag.

Context-based realignment Realigns read with reduced cost of INDELs within homopolymers.
Turned on with the --context flag.

Local realignment with reduced Realigns specific zones that are likely to contain errors associated with
gap cost signal phasing using reduced gap cost. This helps to reduce false
positive variants in low complexity zones. Turned on with the --do-
realign flag.

314 Torrent Suite™ Software 5.18 User Guide

 Chapter 12 Supported software modules
TMAP modules 12

(continued)

Stage Description

Long INDEL salvage Realigns zones adjacent to the read ends while allowing for longer
indels. Helps to find long indels continued beyond the ends of the
amplicons. Turned on by specifying long INDEL gap penalty using the
(-G option.

End repair Extends the alignment beyond the amplicon edges, where suitable.
Also trims alignment tails below given mismatch ratio. This is a
simplified and often better performing version of the long indel
salvage option. It is turned on by specifying the --end-repair
<MM> option on the TMAP command line, where <MM> is the maximum
allowed mismatch percentage at the alignment edge. End repair is
typically used together with the --J option (max adapter bases for soft
clipping), where recommended usage is --end-repair 25-J 15).

Bed file The BED file specification, given with the --bed-file file_name
option, provides TMAP with the amplicon boundary coordinates. This
is used by end-repair to extend gaps over amplicon edges. It also
alters the way mapping scores are calculated: the reads mapped within
amplicon boundaries are given a 12-point boot in MAPQ, and thus
are preferred over the alternative mapping locations outside of the
amplicon set.

5' softclip removal Removes soft clips from the 5' end of the alignment if introduced
by end-repair. This option is on by default. Turned off with the --
er-5clip flag.

3' tandem repeat clipping Clips tandem repeats from 3' end of the reads. Helps reduce variant
detection errors in tandem repeat zones. Turned on with the --do-
repeat-clip flag.

Torrent Suite™ Software 5.18 User Guide 315

13 Administer Torrent Suite™ Software

■ Open the Site Administration screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 316

■ Install Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 317
■ Update Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 326
■ Install or upgrade plugins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 329
■ Manage disk usage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332
■ Set up flexible workflows . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 345
■ Data backup and restore locations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 348
■ Manage telemetry services . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 349
■ Administration with command-line utilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357

Administrative privileges allow you to configure Torrent Suite™ Software, administer Ion Torrent™ Server
databases, manage user accounts, back up and restore data, and enable remote monitoring.
An ionadmin account is required to perform the procedures in this section. A user account, such as
ionuser, does not include sufficient privileges to perform these procedures.

Open the Site Administration screen

An administrator can use tools in the Site Administration screen in the Ion Web portal to modify
default settings for sequencing runs.

IMPORTANT! Use extreme caution when you modify any of the settings in this screen. Settings with
incorrect values can corrupt the database or produce unpredictable results. Check with your Field
Service Engineer if you want to change any of the settings or complete any of the procedures that are
available through this administrative tool.

1. Click (Settings)4Configure.

2. In the Configure screen, scroll down to the Database Administration section.

3. Click the Admin Interface link to access the database administration functions.

4. If you are prompted to sign in, enter your administrator user name and password, then click Sign
in.
The Site administration screen opens.

5. After you have made changes, click Back to Main Site at the top of the screen to return to the
Torrent Suite™ Software.

316 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install Torrent Suite™ Software 13

Install Torrent Suite™ Software

An administrator can use these steps to install Torrent Suite™ Software for the first time on an Ion
Torrent™ Server or to reimage a server. To upgrade to a new version of Torrent Suite™ Software, see
instead “Update Torrent Suite™ Software” on page 327.

IMPORTANT! During an upgrade, you must use the same user account for both the Ion Torrent™
Server and Ion systems (Ion Chef™ System, Ion S5™ System, Ion S5™ XL System, and Ion GeneStudio™
S5 Systems.)

Torrent Suite™ Software 5.14 is the last software release that can be used with an Ion PGM™ System or
Ion Proton™ System. For more information, see “Update Torrent Suite™ Software” on page 327.

1. Click (Settings). Ensure that there are no active jobs running.

2. Click (Settings)4Configure4Admin Interface.

3. Click Update Server.

4. Click Check for updates.

5. When the Available message displays, click Update Server to start the update process.

6. On the User Agreement (EULA) screen, scroll down to read and then accept terms to begin the
update.

7. When finished, ensure that the "Upgrade completed Successfully!" message displays.

Manage Torrent Suite™ Software user accounts

An administrator can manage Torrent Suite™ Software user accounts from the Site Administration
screen.

1. Click (Settings)4Configure.

2. Scroll to the Database Administration section, then click the Admin Interface link.

If you are prompted to sign in, use your administrator account.

Torrent Suite™ Software 5.18 User Guide 317

 Chapter 13 Administer Torrent Suite™ Software
13 Install Torrent Suite™ Software

3. In the Site administration screen, in the Users row, do one of the following:
Option Description
Add Click Add to add a new user.
Change Check Change to modify a user account.

Approve or reject a new user account

New users can request a user account in the Torrent Suite™ Software sign-in screen. An administrator
must approve each request before the new account is active. An administrator account is required to
approve or reject each request for a new user account.
When an administrator signs in to Torrent Suite™ Software, a message alerts the administrator that
requests are pending for new user accounts.

IMPORTANT! Use extreme caution when you modify any of the settings in this screen. Settings with
incorrect values can corrupt the database or produce unpredictable results. Check with your Field
Service Engineer if you want to change any of the settings or complete any of the procedures that are
available through this administrative tool.

1. In the message for the new pending account registration, click Account Management.
The User Registration section shows the pending requests for new user accounts:

Alternatively you can check for new user registrations if you click (Settings)4Accounts, then
go to the User Registrations section in the User Profile/Account Information screen.

2. Review the new user registration request, then choose one of the following.
• Click Approve to approve the account for the new user, then click Yes, Approve.
• Click Reject to reject the account for the new user, then click Yes, Reject.

3. After you have made changes, click Back to Main Site at the top of the screen to return to the
Torrent Suite™ Software.

The user account is added to the list of user accounts in the Torrent Suite™ Software Site
administration screen. For details, see “Manage Torrent Suite™ Software user accounts” on page 317.

318 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install Torrent Suite™ Software 13

Modify a user account

An administrator can modify the access level for an existing user using tools in the Site administration
screen.

IMPORTANT! Use extreme caution when you modify any of the settings in this screen. Settings with
incorrect values can corrupt the database or produce unpredictable results. Check with your Field
Service Engineer if you want to change any of the settings or complete any of the procedures that are
available through this administrative tool.

1. Click (Settings)4Configure.

2. In the Configure screen, scroll down to the Database Administration section. Click the Admin
Interface link to access the database administration functions.

3. If you are prompted to sign in, enter your administrator user name and password, then click Sign
in.
The screen in the Ion Web portal opens.

4. In the Site administration screen, in the Users row of the main screen, click Change.

5. On the Select user to change screen, click the Username of the user that you want to change.
User names can be filtered, selected to the right, according to: By staff status, By superuser
status or By active status.

6. Use the Change user dialog box to modify user information, such as user name, password, first
and last name, email address, or active/inactive status. Confirm that permissions are selected as
follows for Staff and Superusers.
Option Description
Staff (User) Active
Superuser (Administrator) Active, Staff and Superuser

Torrent Suite™ Software 5.18 User Guide 319

 Chapter 13 Administer Torrent Suite™ Software
13 Install Torrent Suite™ Software

WARNING! Do not modify Groups or User permissions categories. Do not click Staff or
Superuser individually. Staff and Superuser must both be unchecked for Staff user, but both
must be checked for Superuser.

7. Select one of the Save options at the bottom of the screen to save your changes.
The user account is modified.

8. After you have made changes, click Back to Main Site at the top of the screen to return to the
Torrent Suite™ Software.

Delete a single user account

An administrator can delete a user account, using tools in the Site administration screen.

IMPORTANT! Use extreme caution when you modify any of the settings in this screen. Settings with
incorrect values can corrupt the database or produce unpredictable results. Check with your Field
Service Engineer if you want to change any of the settings or complete any of the procedures that are
available through this administrative tool.

1. Click (Settings)4Configure.

2. In the Configure screen, scroll to the Database Administration section. Click the Admin
Interface link to access the database administration functions.

3. If you are prompted to sign in, enter your administrator user name and password, then click Sign
in.
The Site administration screen in the Ion Web portal opens.

4. In the Users line of the main Site administration menu, click Change.

5. On the Select user to change screen, click the Username of the user to be deleted.

6. At the bottom-left of the Change user screen, click Delete.

7. Ensure that you want to delete the user by clicking Yes, I'm sure.

The user is deleted.

8. After you have made changes, click Back to Main Site at the top of the screen to return to the
Torrent Suite™ Software.

320 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install Torrent Suite™ Software 13

Delete multiple user accounts

An administrator can delete multiple users using tools in the Site administration screen.

IMPORTANT! Use extreme caution when you modify any of the settings in this screen. Settings with
incorrect values can corrupt the database or produce unpredictable results. Check with your Field
Service Engineer if you want to change any of the settings or complete any of the procedures that are
available through this administrative tool.

1. Click (Settings)4Configure.

2. In the Configure screen, scroll to the Database Administration section. Click the Admin
Interface link to access the database administration functions.

3. If you are prompted to sign in, enter your administrator user name and password, then click Sign
in.
The Site administration screen in the Ion Web portal opens.

4. In the Users line of the main Site administration menu, click Change.

5. On the Select user to change screen, check the checkbox for each user that you want to delete.

6. In Action, select Delete selected users, then click Go.

7. Ensure that the list of users that you want to delete is correct by clicking Yes, I'm sure.
If you do not want to delete the users, click the back arrow on the browser.

8. Review the Select user to change screen to confirm that the selected users no longer appear on
the list.

Torrent Suite™ Software 5.18 User Guide 321

 Chapter 13 Administer Torrent Suite™ Software
13 Install Torrent Suite™ Software

The accounts are deleted.

9. After you have made changes, click Back to Main Site at the top of the screen to return to the
Torrent Suite™ Software.

Create a new administrator account to change a password

An administrator can change their password by creating an new administrator (superuser) account, then
change the user password for that account.

IMPORTANT! Use extreme caution when you modify any of the settings in this screen. Settings with
incorrect values can corrupt the database or produce unpredictable results. Check with your Field
Service Engineer if you want to change any of the settings or complete any of the procedures that are
available through this administrative tool.

1. At the command line on the Ion Torrent™ Server, run the following command in the command
prompt: cd /opt/ion/iondb ./manage.py createsuperuser.

2. After the new superuser account has been created, in Torrent Suite™ Software click
(Settings)4Configure.

3. In the Configure screen, scroll to the Database Administration section, then click the Admin
Interface link to access the database administration functions.

4. If you are prompted to sign in, enter your newly created user name and password, then click Sign
in.
The Site administration screen in the Ion Web portal opens.

5. Select the Users section under Auth:

6. Select the account that you just created and that you want to change the password for.

322 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install Torrent Suite™ Software 13

7. Click Change password form:

8. Enter the new password, then click Change Password:

9. After you have made changes, click Back to Main Site at the top of the screen to return to the
Torrent Suite™ Software.

You can now use your new password with your user account.

Torrent Suite™ Software 5.18 User Guide 323

 Chapter 13 Administer Torrent Suite™ Software
13 Install Torrent Suite™ Software

Add customer support contacts

When an administrator is setting up the Torrent Suite™ Software, the administrator can complete the
Customer Support Contact dialog box with helpful information about how a user can get technical
support within the organization.

1. Click (Settings)4Configure.

2. Add the information for a customer support contact and an IT contact in your organization, then
click Save Contacts.

Change the time zone for the Ion Torrent™ Server

1. Click (Settings)4Configure.

2. Scroll to Change Timezone, select a region and a time zone, then click Save Time Zone.

3. () Click Auto Detect Timezone, then click Save Time Zone.

324 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install Torrent Suite™ Software 13

The new time zone takes effect immediately on the Ion Torrent™ Server.

Change the displayed server name

You can change the server name that appears in the Torrent Suite™ Software. By default, this name is
Torrent Server. This change affects only the server name that is shown in the Torrent Suite™ Software,
and the default bookmark name that appears in the browser when a bookmark is created.

1. Click (Settings)4Configure, then scroll to the Customize Site Name section.

2. Enter the name of your choice, then click Save Name.

The server name that is displayed in the browser is changed.

Lock current Torrent Suite™ Software version

An administrator can prevent other users from installing updates to Torrent Suite™ Software. Use this
procedure to lock the current version of software and to prevent accidental software updates.
You must be an administrator to perform this procedure.

1. Click (Settings)4Configure.

2. Scroll to the Database Administration section, then click Admin Interface.

3. Scroll to the Management Actions section, then click Update Server.

In the Software Versions list, the software versions that are currently available are listed. You can
click Check to see whether updates are available before you lock the current version. For example,
No updates indicates that updates are not available.

Torrent Suite™ Software 5.18 User Guide 325

 Chapter 13 Administer Torrent Suite™ Software
13 Update Torrent Suite™ Software

4. Under Disable software updates, select the Lock current TS software version checkbox.

The software is locked at the current version.

Update Torrent Suite™ Software

The instructions in this section describe how to update Torrent Suite™ Software to a new version.

IMPORTANT! Additional steps and procedures might be required, depending on the type of Torrent
Suite™ Software upgrade. For complete instructions, see the latest Release Notes on the software
product.

IMPORTANT! To ensure compatibility between the software and your instruments, you must also
upgrade your instruments after the upgrade is complete.

326 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Update Torrent Suite™ Software 13

Update Torrent Suite™ Software

An administrator can use this procedure to update the Torrent Suite™ Software on the Ion Torrent™
Server to Torrent Suite™ Software 5.18. Software updates cause the software web services to restart.

IMPORTANT! You cannot roll back to a previous version of Torrent Suite™ Software and Ion Torrent™
instrument software after you perform the upgrade.

To ensure compatibility between the software and your instruments, you must also upgrade sequencing
instruments after the Torrent Suite™ Software upgrade is complete. During this upgrade, you must use
the same user account for both the Ion Torrent™ Server and the Ion instruments (Ion S5™, Ion S5™ XL,
Ion GeneStudio™ S5 Plus Sequencer, Ion GeneStudio™ S5 Prime System, Ion GeneStudio™ S5 Prime
Sequencer, and the Ion Chef™ Instrument.)

1. Click (Settings)4Configure.

2. Scroll to the Database Administration section, then click Admin Interface.

If you are prompted to sign in, use your ionadmin account.

3. In the Admin Interface scroll to the Management Actions section, then click Update Server.

The Update Torrent Suite screen opens with information on available software versions, including
whether updates are available.

4. Click Activate to power on website maintenance.

5. Click Check to check for updates.

6. Click Update Server to update software on the server.

7. When the software update is complete, click Back to Main Site, then click (Settings)4About.

8. Review the software version number in the releases list to ensure that it reflects the update that
you completed.

Torrent Suite™ Software 5.18 User Guide 327

 Chapter 13 Administer Torrent Suite™ Software
13 Update Torrent Suite™ Software

9. To ensure that the software upgrade is complete, and

that the software is ready to run analysis programs,
click (Settings)4Services.

10. In Services in the Status column, review all services to

ensure that each is running.

To ensure compatibility between the software and your instruments, upgrade your sequencing
instruments after the software upgrade is complete.

IMPORTANT! The instruments will not retrieve the proper on-instrument analysis if both systems are
not updated.

Check for off-cycle updates

To check if there are any newer updates for your products, plugins, or instrument, use the Updates
screen.
To update Torrent Suite™ Software, see “Update Torrent Suite™ Software” on page 327.

1. Click (Settings)4Updates.

2. On the Updates screen, compare your installed versions with the available versions to determine if
any updates listed are relevant to your work.

3. Perform the desired updates.

• To update products, see “Enable off-cycle product updates” on page 329.
• To update plugins, see “Update off-cycle release plugins” on page 331.
• To manually install update files, see “Install off-cycle bundles without Internet access” on
page 329.

328 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install or upgrade plugins 13

Enable off-cycle product updates

An administrator can add new kits, chips, templates, plugins and Ion Chef™ scripts that are released
outside of the regular software release cycle.
When you learn of a new product that you would like to use, check to see if a software update is
available.

1. Click (Settings)4Updates.

2. Scroll down to the Update Products section at the bottom of the screen.

3. Select the desired new product and click Update.

Your installed version of Torrent Suite™ Software is updated to include the new products that you
selected.

Install off-cycle bundles without Internet access

If the site Ion Torrent™ Server is not connected to the Internet, an administrator can manually install
updates.

1. Request a USB device that contains the updates from your local Field Service Engineer or
Technical Support.

2. Insert the USB device into your Ion Torrent™ Server.

3. In Torrent Suite™ Software, click (Settings)4Updates.

4. On the Updates screen, under Manual Upload, click Click to Upload and Install.

5. Follow the prompts to upload the compressed folder.

Install or upgrade plugins

On Connect, an administrator can install or upgrade the following:
• Upgrades for plugins that are preinstalled in Torrent Suite™ Software. For details about plugins that
are preinstalled with the software, see “Preinstalled plugins” on page 135.
• The RNASeqAnalysis plugin and smallRNA plugin. These plugins are supported by Thermo Fisher
Scientific but are not preinstalled in the Torrent Suite™ Software. You can download the Ion-
supported RNASeqAnalysis plugin and smallRNA plugin if you click View all apps, then click the
Plugins resource library when you are signed into an account on Connect.

1. Sign in to the Thermo Fisher Connect.

2. Click the Apps icon ( ).

3. In AppConnect, under Resource Libraries, click Plugins.

4. (Optional) Click a category at the top of screen.

The list of plugins is narrowed to only the plugins included that are in the selected category.

Torrent Suite™ Software 5.18 User Guide 329

 Chapter 13 Administer Torrent Suite™ Software
13 Install or upgrade plugins

5. Click to download the plugin. Select the checkbox to indicate that you agree to the terms and
conditions, then click Download Plugin.
Either a compressed directory or a debian file that contains the plugin is downloaded to your local
machine.

6. In Torrent Suite™ Software, click (Settings)4Plugins4Install or Upgrade Plugin.

7. Click Select File, browse to the location where you downloaded the plugin file, select the file, then
click Open.

8. In the Install or Upgrade Plugin dialog box, click Upload and Install.

The plugin is now visible in Torrent Suite™ Software.

Enable an installed plugin

After installing a plugin, you must enable the plugin to make the plugin available in Torrent Suite™
Software.

1. Click (Settings)4Plugins.

2. In the Plugins list, select the Enabled checkbox next to any installed plugin, to make it available.
The plugin is immediately available.

330 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Install or upgrade plugins 13

Configure plugins globally

An administrator can change the global configuration of a plugin. The following preinstalled plugins can
be configured globally.
• DataExport plugin
• ERCC_Analysis plugin
• FileExporter plugin
• IonReporterUploader plugin
• RunTransfer plugin

Some plugins that cannot be configured globally can be configured when you set up a Planned Run or
a Planned Run template, or if you run the plugin after a sequencing run.

1. Click (Settings)4Plugins.

2. In the Manage column for the plugin of interest, click (Actions)4Configure.

The settings in the configuration dialog box vary depending on the plugin. See the plugin-specific
configuration topic for more information.

3. To save your changes, click Submit or Save Configuration.

Update off-cycle release plugins

An administrator can add new plugins that are released outside of the regular software release cycle.
When you learn of a new plugin that you would like to use, check to see if an update is available.

1. Click (Settings)4Updates.

2. Scroll to the Update Plugins section at the bottom of the screen.

3. Select the new Torrent Suite™ Software plugin that you want to install, then click Update.
Your installed version of Torrent Suite™ Software is updated to include the new plugin that you
selected.

Uninstall a plugin
You can uninstall a plugin from your Torrent Suite™ Software.

1. Click (Settings)4Plugins.

2. In the row of the plugin that you want to remove, click (Actions)4Uninstall.

3. Click Yes, Uninstall! to confirm that you want to uninstall the selected plugin.

Torrent Suite™ Software 5.18 User Guide 331

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

Manage disk usage

It is critical that sufficient disk space is available on the server to store data files and avoid data loss. If
needed, it is important to have a strategy that periodically monitors disk space and archives or deletes
data to allow for storage of new data files.
To avoid data loss and ensure that sufficient disk space is available on the server, an administrator
can configure Torrent Suite™ Software to automatically archive and delete sequencing data that are no
longer needed. An administrator can also manually archive or delete data from individual run reports
or groups of reports, or export selected data to a mounted external drive. To understand how disk
space is allocated and how files are managed, you can view disk usage, active data management jobs,
statistics, and detailed logs on each of these activities.

View disk usage parameters

In the Data tab, click Data Management, then scroll to the Disk Usage section.

Parameters in the Disk Usage section.

Parameter Definition
Keep File space devoted to files that are to be kept.
Used File space being currently used by data files.
Free Space available for storing data files.
Threshold I Threshold above which intermediate files are deleted or archived, based on the
automatic configuration settings.
Threshold S Threshold above which signal processing input files are deleted or archived,
based on the automatic configuration settings.
Threshold B Threshold above which basecaller input files are deleted or archived, based on
the automatic configuration settings.
Threshold O Threshold above which output files are deleted or archived, based on the
automatic configuration settings.

For details regarding automatic deletion and archive creation, see “Archive or delete data automatically”
on page 333.

Ion instrument data types

Data that are generated from Ion Torrent™ sequencers consists of the following types of files:
• Signal processing input files (DAT)
• Basecalling input files (1.WELLS)
• Output files (BAM, plugin output, and so forth)
• Intermediate files

For more details about these file types, see “Analysis pipeline overview” on page 292.
Recommendations on when to archive each file type are listed in the following table.

332 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage disk usage 13

Data type Details

Signal processing input Signal processing input files (4 files per cycle) consist of the raw voltage
files measurement data collected during the sequencing run.
Keep the signal processing input data if you want to reanalyze the run starting
from raw signal processing data.
However, on Ion S5™ Systems, signal processing input data are used on the
instrument, then deleted. These files are available on Torrent Suite™ Software
only as thumbnails for the Ion S5™ Systems or Ion GeneStudio™ S5 Systems.

Basecalling input files Signal processing input files are converted to a single condensed basecalling
input file representing the processed signal.
Keep or archive basecalling input data if you want to reanalyze the run. This
can save time and resources because reanalysis use the basecalling input data,
rather than the raw signal processing input data.
On Ion S5™ Systems and Ion GeneStudio™ S5 Systems, basecalling input data
are transferred to the Ion Torrent™ Server and are available for reanalysis.

Output files Output files consist of all BAM files, run reports, and plugin results.
It is important to keep and archive these files. Delete output files only if you are
sure that you no longer need the files.

Intermediate files Intermediate files contain information used for debugging runs.
You can delete these files immediately after instrument runs, without affecting
data.

Archive or delete data automatically

To avoid data loss, it is critical that sufficient disk space is available on the Ion Torrent™ Server.
Therefore, it is important to have a strategy to monitor disk space and archive or delete data if needed.
An administrator can configure the Ion Torrent™ Server to archive data to a mounted drive automatically
after a data age threshold is met. Data that is assigned to be automatically archived are copied to the
designated location, then deleted from the Ion Torrent™ Server. Automatic archiving helps to maintain
available disk space and simplifies management of data that you want to save to another volume.
An administrator can also configure the Ion Torrent™ Server to delete data automatically when
thresholds are met for filled disk space and data age. Automatic deletion of files is important to maintain
available disk space and simplifies removal of data that are no longer necessary to keep.

Torrent Suite™ Software 5.18 User Guide 333

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

An administrator can also assign automated archive or delete actions to each data file category
independently of the others.

IMPORTANT! When you configure the Ion Torrent™ Server to delete data automatically, the data are
permanently deleted. You cannot restore data after deletion.

1. In the Data tab, click Data Management, go the Configuration section, then click Configure.

2. On the Data Management Configuration screen, select an auto-action, or select Disabled for
each file category, then configure:
If you select this
Select these options:
auto action
Disabled No selections are necessary—data in the file category must be archived or
deleted manually.
Archive • Data Age Threshold (days): Set the number of days that you want data to
be stored on the server before data are archived.
• Archive Directory: Select the mounted volume where you want to store the
archive, or click Browse, then navigate to the mounted volume where you
want the archive to be stored.

Delete • Data Age Threshold (days): Set the number of days that data are stored on
the server before data are deleted.
• Disk Full Threshold (Percent): Set the percentage of disk space that is filled
on the server before data are deleted.

334 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage disk usage 13

3. Select the Enabled checkbox to enable the automatic data management you have configured.
Deselect the checkbox to suspend automatic action.

4. In Email, enter an email address of where to receive notifications for automatic data management
actions.
If you use a Linux™ mail server, you might have access to Postfix, an open-source Linux™ mail
server. Postfix has many configuration options that IT administrators can use to adjust mail routing
parameters. You can find Postfix documentation at http://www.postfix.org/documentation.html.

5. (Optional) To enable auto-acknowledgement of deletion of signal processing input data, select the
Auto Acknowledge Delete? checkbox. Action is not required for data deletion to occur.
If you deselect Auto Acknowledge Delete, notifications are sent for each signal processing input
deletion. A reviewer must manually acknowledge each deletion action before the signal processing
input data are deleted.

6. After you have completed the configuration, click Save.

7. (Optional) On the Data Management screen, click Configuration Log in the Configuration
section to view a record of configuration changes.

8. (Optional) To view a record of data management actions (archiving and deleting), click History.

Torrent Suite™ Software 5.18 User Guide 335

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

Manually export run data

An administrator can manually export run data to a storage device that is mounted on the Ion Torrent™
Server. When you export the data, it is copied from the Ion Torrent™ Server to the archive location. The
data remains on the Ion Torrent™ Server, and the run results listed in the Completed Runs & Results
screen continue to link to the data on the Ion Torrent™ Server. For more information, see “Increase file
storage and available disk space” on page 338.

1. In the Data tab, click Data Management, then scroll to the Disk Space Management section.

2. Select the checkboxes to the left of the report names that contain the run data that you want to
export, then click Process Selected.
To export data from only one run report, click Settings ( )4Actions to the right of the report
name.

3. In the dialog box, click the checkbox to the left of each File Category for the type of data that you
want to export, then click Export Selected.

4. Click Browse to select an export directory from the list of mounted storage devices.

5. (Optional) Enter a comment.

6. Click Confirm.
The data for the file categories of the selected run reports are copied to the external hard drive.
The data are also available in the local hard drive run results directory.

Manually archive run data

An administrator can manually archive run data from the local drive on the Ion Torrent™ Server to a
connected storage device. When you archive the data, it is moved from the Ion Torrent™ Server to the
archive location. The run results listed in the Completed Runs & Results screen link to the data on the
archive storage device as long as that device remains mounted on the Ion Torrent™ Server. For details,
see “Increase file storage and available disk space” on page 338.

1. In the Data tab, click Data Management, then scroll to the Disk Space Management section.

2. Select the checkboxes to the left of the report names that contain data that you want to archive,
then click Process Selected.
To archive data from only one run report, you can alternatively click Settings ( )4Actions to the
right of the report name.

3. In the dialog box, click the checkbox to the left of each File Category for the type of data that you
want to archive, then click Archive Selected.

336 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage disk usage 13

4. Click Browse to select an archive directory from the list of mounted storage devices.

5. (Optional) Enter a comment.

6. Click Confirm.
The data in the file categories of the selected run reports are moved to the archive location.

Manually delete selected data from a run report

An administrator can manually delete select data from a run report to free up storage space on the
Ion Torrent™ Server. This procedures deletes the files that are associated with the run report that were
created during the run. These file types are:
• Signal processing input files
• Basecalling input files
• Output files
• Intermediate files

For details about automatic deletion of select run data, see “Archive or delete data automatically” on
page 333.

IMPORTANT! Use this procedure only if you are sure that you no longer require access to the selected
run data. If a run is archived, deleting the data will remove the archived copy when the archived drive is
mounted. If a run was previously imported or restored, deleting will remove only the Local copy."

1. In the Data tab, click Data Management, then scroll to the Disk Space Management section.

2. Do one of the following:

• To delete select data from more than one run report, select the checkboxes to the left of the
report names that contain the run data that you want to delete, then click Process Selected.
• To delete data from only one run report, click Settings ( )4Actions to the right of the report
name.

If Keep is enabled, the data cannot be deleted and are kept on the local hard drive. If you try to
delete this data, an error occurs.

3. In the pop-up window, select the checkbox to the left of each File Category for the type of data
that you want to delete, then click Delete Selected.

Torrent Suite™ Software 5.18 User Guide 337

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

4. (Optional) Enter a comment.

5. Click Confirm.
The data for the file categories of the selected run reports is permanently deleted from the Ion
Torrent™ Server.

Increase file storage and available disk space

You can increase file storage space for data and results files with a Torrent Storage™ NAS (Network
Attached Server) device, your own network access storage (NAS) device, or a USB drive.
After one or more of these storage drives has been installed and configured, you can use the drive to
save data locally in the lab, transfer data between servers, store data with disk failure tolerance, and
expand storage space.

Storage method Description

Torrent Storage™ NAS (Network A Field Service Engineer typically installs this device. It attaches
Attached Server) device directly to a Ion Torrent™ Server, Ion S5™ Instrument, or Ion
GeneStudio™ S5 System, or can connect over a local network. After
installation, it must be mounted on the local server as described
in “Connect to a Torrent Storage™ NAS (Network Attached Server)
device” on page 338.

Your own NAS device Similar to the Torrent Storage™ NAS (Network Attached Server) device,
but typically installed by your own system administrator.

USB Drive Attaches directly to a Ion Torrent™ Server or Ion S5™ Instrument. After
installation, it must be mounted on the local server as described in
“Mount a USB drive” on page 341.

Connect to a Torrent Storage™ NAS (Network Attached Server) device

Initial setup of the Torrent Storage™ NAS (Network Attached Server) device is provided by your local
Field Service Engineer. If the device is moved or disconnected for any reason (for example, a power
outage), an administrator can reconnect the device to a Ion Torrent™ Server.
• If the Torrent Storage™ NAS (Network Attached Server) device connects directly to the Ion Torrent™
Server, see “Connect directly to a Torrent Storage™ NAS (Network Attached Server) device” on
page 339.
• If the Torrent Storage™ NAS (Network Attached Server) device connects over a network to the
server, see “Connect over a network to a Torrent Storage™ NAS (Network Attached Server) device”
on page 340.

338 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage disk usage 13

Connect directly to a Torrent Storage™ NAS (Network Attached Server) device

An administrator can connect directly to a Torrent Storage™ NAS (Network Attached Server) device. If
your Ion Torrent™ Server, Ion S5™ Instrument, or Ion GeneStudio™ S5 System is connected directly to
your Torrent Storage™ NAS (Network Attached Server) device, use the following steps to mount the
device.

1. Click Settings ( )4About, then confirm that the Torrent Suite™ Software version is 5.2 or later.
To update your software, see “Update Torrent Suite™ Software” on page 327.

2. Click Settings ( )4Configure, then scroll to Torrent Storage.

3. Find the IP address of the Torrent Storage™ NAS (Network Attached Server) device in the Select a
TorrentNAS Device list. It can take several seconds for the list to populate.
If the Torrent Storage™ NAS (Network Attached Server) device is not automatically detected in less
than 1 minute, confirm that the correct network ports are connected, then click Refresh List.

4. In the Select a TorrentNAS Device list, select the IP address of the device .

5. Under Select a Share Volume, select a volume on the device , then click Add Volume.

The storage volume is connected to the server and is listed in the Currently Mounted Volumes list.

Torrent Suite™ Software 5.18 User Guide 339

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

Connect over a network to a Torrent Storage™ NAS (Network Attached Server)

device
If the Ion Torrent™ Server, Ion S5™ Instrument, or Ion GeneStudio™ S5 System is installed on the same
network as the Torrent Storage™ NAS (Network Attached Server) device, an administration can use the
following steps to mount the device.

1. Click Settings ( )4About, then confirm that the Torrent Suite™ Software version is 5.2 or later.
To update your software, see “Update Torrent Suite™ Software” on page 327.

2. Click Settings ( )4Configure, then scroll to Torrent Storage.

3. In or enter an IP or hostname here, enter the IP address of the Torrent Storage™ NAS (Network
Attached Server) device, then press the Enter key.

4. In Select a Share Volume, select a volume on the device, then click Add Volume.

The storage volume is connected to the server and is listed in Currently Mounted Volumes.

340 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage disk usage 13

Monitor the Torrent Storage™ NAS (Network Attached Server) device

You can check the status of a Torrent Storage™ NAS (Network Attached Server) device in Torrent Suite™
Software.

1. Click Settings ( )4Services.

2. Scroll to the Torrent NAS Info section to view information on Torrent Storage™ NAS (Network
Attached Server) devices that are attached to your server through a network, including available
storage capacity, usage, and health of the device.

USB drives
Mount a USB drive
To mount a USB drive (either an external hard drive or large flash drive), a working knowledge of Linux™
command line interface and a basic understanding of disk drives and partitions are necessary.
Ion Torrent™ Server is an Ubuntu™ server, which does not mount external hard drives automatically.
To address this need, the ion-usbmount utility is included with Torrent Suite™ Software. This utility
automatically mounts attached USB drives in the /media directory. If ion-usbmount does not mount
a particular USB drive automatically, follow these steps to mount the drive manually.
These instructions provide only an overview of the required steps, and can be a helpful reminder if you
are new to the Linux™ operating system. For more detailed instructions and background information,
see the Ubuntu™ documentation at https://help.ubuntu.com/community/Mount/USB.
We recommend that a system administrator perform the Linux™ mount and unmount procedures.

1. Before connecting a USB drive, enter the following command to see a list of the drives in the
system: sudo fdisk -l
The local hard drive usually has a name such as /dev/sda, as in the following example:

ionadmin@itw-test01: ~$ sudo fdisk -l

Disk /dev/sda: 500.1 GB,

500107862016 bytes

Torrent Suite™ Software 5.18 User Guide 341

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

255 heads, 63 sectors/track, 60801

cylinders
Units = cylinders of 16065 * 512 =
8225280 bytes
Sector size (logical/physical) : 512
bytes / 512 bytes
Disk identifier: 0x0004366b

Device Boot Start End

Blocks Id System
/dev/sdal * 1 37
291840 83 Linux
Partition 1 does not end on
cylinder boundary.
/dev/sda2 37 60802
488092673 5 Extended
/dev/sda5 37 60802
488092672 8e Linux LVM

2. Connect the USB drive.

3. Wait approximately 10 seconds, then reenter: sudo fdisk -l.

The new USB drive appears in the list. The name of the USB drive is usually /dev/sdb or /dev/
sdc, depending on the number of drives installed. The partition is a number that is added
to the name of the physical drive. For example, the first partition on drive /dev/sdc would
be called /dev/sdc1. In the following example, there is a 2‑GB partition (1953512001 blocks)
attached to the system that is named /dev/sdb1. It is configured with a Linux™ partition. (If the
drive was formatted on Windows™, it is either a FAT or an NTFS partition).

ionadmin@itw-test01:/$ sudo fdisk -l

Disk /dev/sda: 500.1 GB,

500107862016 bytes
255 heads, 63 sectors/track,
60801 cylinders
Units = cylinders of 16065 *
512 = 8225280 bytes
Sector size
(logical/physical): 512 bytes
/ 512 bytes
I/O size (minimum/optimal) :
512 bytes / 512 bytes
Disk identifier: 0x0004366b

Device Boot Start End

Blocks Id System
/dev/sdal * 1 37
291840 83 Linux
Partition 1 does not end on
cylinder boundary.
/dev/sda2 37 60802
488092673 5 Extended
/dev/sda5 37 60802
488092672 8e Linux LVM

Disk /dev/sdb: 2000.4 GB,

2000398934016 bytes
255 heads, 63 sectors/track,

342 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage disk usage 13

243201 cylinders
Units = cylinders of 16065 *
512 = 8225280 bytes
Sector size
(logical/physical): 512 bytes
/ 512 bytes
I/O size (minimum/ optimal) :
512 bytes / 512 bytes
Disk identifier: 0x5786fcfb

Device Boot Start End

Blocks Id System
/dev/sdb1 1 243201
1953512001 83 Linux

4. If the drive has a Windows™ FAT or NTFS partition, reformat the drive as an ext3 partition to
preserve the Linux™ file information.
IMPORTANT! Be careful to format the correct hard drive.

a. Enter sudo mkfs.ext3 <your_device>. For example:

sudo mkfs.ext3 /dev/sde5

b. Label the partition on the external USB drive. To label the partition, enter the following:

sudo e2label <your_device_place> <partition_label>.?

For example, the external drive that is connected in /dev/sdbl is labeled as TS_Backup1:

sudo e2label /dev/sdb1 TS_Backup1

It is important to provide a different label name to each partition to avoid error when multiple
external USB drives are connected to the Ion Torrent™ Server at the same time.

5. Ensure that the external USB drive mounts automatically. Disconnect the external USB drive, then
reconnect it. Wait approximately 10 seconds.
The external USB drive appears under the Services tab in Torrent Suite™ Software

Unmount a USB drive

IMPORTANT! Before disconnecting a USB drive, unmount it first to ensure that all data have been
written to disk. If you pull out the USB connection without unmounting the USB drive first, there is a
high risk of data loss.

To unmount a USB drive, enter the following command in the command line of your Ion Torrent™ Server:
sudo umount /dev/sdb1 /media/external.

Torrent Suite™ Software 5.18 User Guide 343

 Chapter 13 Administer Torrent Suite™ Software
13 Manage disk usage

Dataflow file sizes

The Ion Torrent™ dataflow involves the transfer of raw sequencing data from the Ion GeneStudio™ S5
Prime or Ion S5™ XL sequencer to the Ion Torrent™ Server for analysis and reporting.

The following tables show high-level views of the dataflow from different devices.

Dataflow using the 200-bp kit on the Ion GeneStudio™ S5 Plus System, Ion
GeneStudio™ S5 Prime System, and Ion S5™ XL System
The following table shows a high-level view of the dataflow using the 200-bp kit on the Ion
GeneStudio™ S5 Plus System, Ion GeneStudio™ S5 Prime System, and Ion S5™ XL System. File sizes
for Ion Torrent™ data depend on the Torrent Suite™ Software version, chip type, and kit type.

Resulting file Ion 510™ Ion 520™ Ion 530™ Ion 540™ Ion 550™
Step
type Chip Chip Chip Chip Chip

Read — 2.5 M 5M 15–20 M 60–80 M 100–130 M

capacity

Signal DAT 65 GB 125 GB 310 GB 2 TB 1 TB

processing
input[1]

Signal WELLS 9 GB 18 GB 45 GB 180 GB 330 GB

processing
output

Base calling Unaligned 3 GB 8 GB 23 GB 85 GB 100 GB

output BAM

Aligned Aligned BAM 3 GB 7 GB 20 GB 55 GB 90 GB

output
[1] Signal Processing input files for Ion Torrent™ S5 systems are not transferred from the instrument and are not part of Ion Torrent™
Server data management.

344 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Set up flexible workflows 13

Dataflow using the 400-bp kit on the Ion GeneStudio™ S5 Plus System, Ion
GeneStudio™ S5 Prime System, and Ion S5™ XL System
The following table shows a high-level view of the dataflow using the 400-bp kit on the Ion
GeneStudio™ S5 Plus System, Ion GeneStudio™ S5 Prime System, and Ion S5™ XL System. File sizes
for Ion Torrent™ data depend on the Torrent Suite™ Software version, chip type, and kit type.

Step Resulting file type Ion 510™ Chip Ion 520™ Chip Ion 530™ Chip

Read capacity -- 2.5 M 5M 15–20 M

Signal processing DAT 110 GB 210 GB 530 GB

input[1]

Signal processing WELLS 15 GB 30 GB 75 GB

output

Base calling Unaligned BAM 6 GB 12 GB 30 GB

output

Aligned output Aligned BAM 5 GB 10 GB 25 GB

[1] Signal Processing input files for Ion Torrent™ S5 systems are not transferred from the instrument and are not part of Ion Torrent™
Server data management.

Set up flexible workflows

An administrator can set up flexible workflows by forming a connection between two or more Ion
Torrent™ Servers that are running the same software version.
With flexible workflows, you can:
• View all runs of interest across multiple Ion Torrent™ Servers on the Completed Runs and Reports
screen.
• Transfer Planned Runs between sequencers that are connected to different Ion Torrent™ Servers.
• Track reagent and cartridge usage across Ion Chef™ Instrument flexible workflows from different
Ion Chef™ Instruments connected to different Ion Torrent™ Servers.

1. In any tab, click (Settings), then click Ion Mesh.

Torrent Suite™ Software 5.18 User Guide 345

 Chapter 13 Administer Torrent Suite™ Software
13 Set up flexible workflows

2. Select one of the following options.

Option Description
Link a selected Torrent Server. Select a Ion Torrent™ Server, then click Link Selected TS.
Manually link a Torrent Server. Click Link TS Manually.

3. Enter the following information in the Setup Mesh Computer dialog box.
Option Definition
Hostname/Address Host name or address of the server.
If linking a selected Ion Torrent™ Server, this option is automatically populated
and cannot be edited.
Nickname A common name that is assigned to the Ion Torrent™ Server.
Username Your username.
Password Your password.

4. Click Setup.
The linked and enabled Ion Torrent™ Servers are available to be used in the Planned Runs, and the
data from the linked and enabled Ion Torrent™ Servers can be viewed on the same Data screen.

View sequencing runs on multiple sequencers with Ion Mesh

Before viewing runs on multiple servers, you must first connect the servers using Ion Mesh. For more
information, see “Set up flexible workflows” on page 345.

1. In the Data tab, click Completed Runs and Reports.

2. In Server , select one or more Ion Torrent™ Servers for which you want to view data.
Notice that the server name is now reflected in the Run Name column. Your results across multiple
sequencers are ready for your review.

346 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Set up flexible workflows 13

Transfer a Planned Run to an Ion Torrent™ Server with Ion Mesh

You can transfer Planned Runs that are created on one Ion Torrent™ Server and transfer them to another
Ion Torrent™ Server by using Ion Mesh. This is useful if the sequencer connected directly to the origin
Ion Torrent™ Server is offline or busy.
Before Planned Run transfer, first connect the Ion Torrent™ Server with Ion Mesh. For more information,
see “Set up flexible workflows” on page 345.

IMPORTANT! The Ion Torrent™ Server must have the same version of Torrent Suite™ Software installed
in order for a Planned Run transfer to be successful.

1. Sign in to Torrent Suite™ Software on the original Ion Torrent™ Server.

2. In the Plan tab, click Planned Runs.

3. Find the row of the Planned Run that you want to transfer, then click (Actions)4Transfer.

4. Select the Ion Torrent™ Server that you want to receive the Planned Run.

5. In the confirmation dialog box, confirm the information, then click Transfer.
You can no longer access this Planned Run on the origin server after it has transferred.

A status indicates the results of the transfer.

• A green message lists the Planned Runs that are successfully transferred.

• A red message lists any failed Planned Run transfers.

Torrent Suite™ Software 5.18 User Guide 347

 Chapter 13 Administer Torrent Suite™ Software
13 Data backup and restore locations

Track Ion Chef™ Instrument flexible workflows for Ion 550™ chips with Ion
Mesh
To use the flexible workflow feature and enable cartridge use tracking between Torrent Servers across
multiple Ion Chef™ instruments, Torrent Servers must be linked in an Ion Mesh configuration. For further
information on how to link Torrent Servers in an Ion Mesh setup, see “Set up flexible workflows” on
page 345. For more information on configuring a flexible workflow on the Ion Chef™ Instrument, see the
Ion 550™ Kit − Chef User Guide (Pub No. MAN0017275).

IMPORTANT! If you have Torrent Servers that are connected in an Ion Mesh configuration, and
the connection to one Ion Torrent™ Server is disrupted or lost, cartridge tracking between servers is
disabled. In this situation, an error message appears if you attempt to start a run. The run is not allowed
to start because the cartridge use status is not trackable. Ion Mesh communication must be restored to
verify that cartridge use status before the run can start.

1. In the Data tab, click Completed Runs & Reports.

2. Click a completed report.

3. In the run report, scroll down to the Details section, then select the Chef Summary and S5
Consumable Summary tabs to track the cartridge use.

Data backup and restore locations

The Ion Torrent™ Server maintains the following types of data in separate locations:

Data type Storage location

Ion S5™ Sequencer and Ion GeneStudio™ S5 /results/< instrument_ name> directory, by
Systems data default.

Ion Proton™ Sequencer data /rawdata/<Proton_Name> directory, by default.

Report data /results/analysis/output/Home directory,

by default.

Database records PostgreSQL database

The nightly backup of the database is created automatically, then stored for 30 days.

Restore the PostgreSQL Database

To restore the database, you need a complete working Ion Torrent™ Server installation.
The two scenarios for restoring a database are:
• Installing a new Ion Torrent™ Server from the Ion Torrent™ Server installation disk due to migrating
the database to a new server or needing to reinstall the server.
• Replacing the database on an existing Ion Torrent™ Server, possibly because the database is
corrupted, and you want to restore a previous version.

348 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage telemetry services 13

• To restore the database from the backup file, execute these commands on the Ion Torrent™ Server:

{{# copy the backup file to the server and decompress it

gzip -d iondb.20100711_142442.backup.gz

# stop the Torrent Server background processes

sudo /etc/init.d/ionCrawler stop
sudo /etc/init.d/ionJobServer stop
sudo /etc/init.d/ionPlugin stop
sudo /etc/init.d/celeryd stop

# login as user postgres

sudo su postgres

# restart the service to clear database connections

/etc/init.d/postgresql restart

# drop the existing iondb database

dropdb iondb

# create a new empty database

psql <<-EOFdb CREATE DATABASE iondb;
GRANT ALL PRIVILEGES ON DATABASE iondb to ion;
\q EOFdb

# import data
psql -e iondb < iondb.20100711_142442.backup

# logout of user postgres

exit

# start the Torrent Server background processes

sudo /etc/init.d/ionCrawler start
sudo /etc/init.d/ionJobServer start
sudo /etc/init.d/ionPlugin start
sudo /etc/init.d/celeryd start}}

Occasionally, a Django error occurs after completing the import data step. If this error occurs,
repeat the following steps:
1. Drop database.

2. Create database.

3. Import data.

Manage telemetry services

Torrent Suite™ Software uses telemetry services to provide connectivity to the software that allows
Thermo Fisher Scientific Technical Support personnel to perform remote troubleshooting on request.
Telemetry services also report anonymous usage statistics to Thermo Fisher Scientific.
The telemetry services used with the software are:
• Axeda™ Remote System Monitoring agent (Axeda™ RSM agent)
• Deep Laser

Torrent Suite™ Software 5.18 User Guide 349

 Chapter 13 Administer Torrent Suite™ Software
13 Manage telemetry services

To enable or disable these telemetry services, click (Settings)4Services, then scroll down to the
Telemetry Services section.
Disabling telemetry services stops all Connect integration and makes remote support more difficult.

Axeda™ Remote System Monitoring (RSM)

Remote access for troubleshooting
When there is a problem with a sequencer or the Ion Torrent™ Server, the Axeda™ RSM agent allows
Thermo Fisher Scientific Technical Support personnel to remotely:
• Collect log files from the system for review.
• Restart the device.
• Upgrade software.
• Provide a remote sign in connection to the device for further diagnostic work.

When a problem with an Ion S5™ or Ion GeneStudio™ S5 System, or Torrent Suite™ Software is
reported, Thermo Fisher Scientific service and support tries to solve the problem by telephone or
email. If remote access is required for additional troubleshooting, a member of Thermo Fisher Scientific
Technical Support requires authorization from the technical contact to initialize a remote connection.
Only after getting authorization does Thermo Fisher Scientific Technical Support personnel proceed
with remote troubleshooting. After the problem is resolved, you are notified. Additional authorization is
required before starting any further remote help.

Axeda™ RSM agent overview

The Axeda™ Remote System Monitoring agent (Axeda™ RSM agent) is a software component that is
installed automatically on the Ion Torrent™ Server, Ion S5™ and Ion GeneStudio™ S5 Systems through
the software update process.
Approximately every 60 seconds, the Axeda™ RSM agent sends a heartbeat message to Thermo Fisher
Scientific. This information is used to track the deployment and software configuration of machines in
the field.
Data is collected in the Axeda™ monitoring database, where Thermo Fisher Scientific Technical Support
personnel can review the information that agents collect. Because the heartbeat message is sent many
times an hour, Technical Support can quickly see the following:
• If a machine is online
• The software versions in use
• Some technical details about the instrument such as temperature and hard drive status.

The agent also allows Thermo Fisher Scientific personnel to remotely access the Ion S5™ and Ion
GeneStudio™ S5 Systems and the Torrent Suite™ Software, which is required for system support.
Without remote access, Thermo Fisher Scientific Field Application Scientists cannot access, view, and
troubleshoot problems regarding machine performance.

350 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage telemetry services 13

Port assignments
To support fully the Ion Torrent™ Server and multiple Ion Torrent™ sequencers, remote monitoring must
be provided using Axeda™ Remote System Monitoring software enabled, and must be able to reverse
SSH into the boxes. This requirement means that the multiple sequencers and the Ion Torrent™ Server
must be connected to the Internet with outbound connections that are permitted on the following ports.

Port Required Use

22 Yes Start reverse SSH tunnel for remote troubleshooting.

80 Yes Download updates from http://updates.iontorrent.com and http://

us.archive.ubuntu.com.

123 Yes (UDP) NTP access to the Internet, incoming and outgoing.

443 Yes Enable sending of basic status information to the remote monitoring server.
The IonReporterUploader plugin also requires port 443 to transfer data to
Ion Reporter™ Software.

5432 No Remote access to the PostgreSQL database.

Deep Laser
When there is a problem with a sequencer or the Ion Torrent™ Server or Torrent Suite™ Software,
Deep Laser telemetry service allows Thermo Fisher Scientific Technical Support personnel to remotely
troubleshoot the problem.
Telemetry services are enabled by default. When enabled, connectivity to Connect is allowed in order
to transfer support archived files to Thermo Fisher Scientific technical support staff to perform remote
troubleshooting. Anonymous usage statistics are also reported to Thermo Fisher Scientific.
Disabling telemetry services stops all Connect integration and may make remote support more difficult.
You can disable telemetry services on the System Services screen in the Telemetry Services section.
Disabling telemetry services disables both Deep Laser and Axeda™ RSM agent.
For assistance, contact your local Field Service Engineer.

Torrent Suite™ Software 5.18 User Guide 351

 Chapter 13 Administer Torrent Suite™ Software
13 Manage telemetry services

Data automatically collected by the telemetry services

Event names, data types, and sample values of the data being collected by Axeda™ RSM agent
and the Deep Laser telemetry service are described in the following tables. This information is sent
automatically from the Ion Torrent™ Server, Ion S5™ and Ion GeneStudio™ S5 Systems back to Thermo
Fisher Scientific.

Ion Torrent™ Server data

The following table lists and describes the Ion Torrent™ Server events that are collected by Axeda™
RSM agent and the Deep Laser telemetry service, then automatically sent to Thermo Fisher Scientific.

Event name Data type Sample value

TS.Config.biosversion String 6.00

TS.Config.configuration String standalone

TS.Config.hostname String Ion-torrent-server

TS.Config.ipaddress String 10.45.3.246

TS.Config.mode String Master

TS.Config.serialnumber String 1SMJFP1 ( DO NOT USE Dell™ service tag)

TS.Contact.IT Contact String email, phone

TS.Contact.Lab Contact String email, phone

TS.Experiment String chip type, flow count, run type, bedfile,

barcode count, seq s/n

TS.GPU String No problems

TS.host String Ion-torrent-server

TS.HW.HD./results String 58.99

TS.Location.City String Rockville

TS.Location.Org-Name String Unknown

TS.Location.Postal-Code String Unknown

TS.Location.State String Unknown

TS.Location.Street-Address String Unknown

TS.Nexenta<n>_lic_days_left String 180

TS.Nexenta<n>_lic_status String license status

TS.Nexenta<n>_machine_sig String 5EDI8L9NA

TS.Nexenta<n>_UUID String 44454c4c-5900-1046-8048-b2c04f533532

352 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage telemetry services 13

(continued)

Event name Data type Sample value

TS.Nexenta<n>_vol<v> String pool1 size=32.5T allocated=860G

free=31.7T capacity=2%
health=ONLINE

TS.Nexenta<n>_vol<v>_d<d> String c0t5d1 health=ONLINE

vendor=SEAGATE
product=ST6000NM0034
serial=Z4D1XT26 size=6TB

TS.Server.celerybeat String ok/offline/error

TS.Server.celery_diskutil String ok/offline/error

TS.Server.celery_periodic String ok/offline/error

TS.Server.celery_plugins String ok/offline/error

TS.Server.celery_slowlane String ok/offline/error

TS.Server.celery_transfer String ok/offline/error

TS.Server.celery_w1 String ok/offline/error

TS.Server.dhcp String ok/offline/error

TS.Server.ionCrawler String ok/offline/error

TS.Server.ionJobServer String ok/offline/error

TS.Server.ionPlugin String ok/offline/error

TS.Server.ntp String ok/offline/error

TS.Server.RabbitMQ String ok/offline/error

TS.Server.RSM_Launch String ok/offline/error

TS.Server.tomcat String ok/offline/error

TS.TYPE String TS1

TS.Version.alignment String 1.42-0

TS.Version.analysis String 1.40-0

TS.Version.dbreports String 1.95-3

TS.Version.docs String 1.15-1

TS.Version.referenceLibrary String 1.6-1

TS.Version.tmap String 0.0.19-1

TS.Version.tsconfig String 1.3-9

Torrent Suite™ Software 5.18 User Guide 353

 Chapter 13 Administer Torrent Suite™ Software
13 Manage telemetry services

Ion S5™, Ion Proton™, and Ion GeneStudio™ S5 System data

Ion S5™ and Ion GeneStudio™ S5 System data are divided into these categories:
• DataCollect—These items come from the instrument configuration file.
• RunData—These items reflect parameters from the last Auto pH or sequencing run.
• Status—These items reflect the current instrument parameters.
• System—These items provide parameters related to the operating system supporting the
instrument.
• Version—These items provide the version numbers for the various software packages installed on
the instrument.

In addition, two items (InstrumentState, Type) are not placed in any category.
The following table lists and describes the Ion S5™, Ion Proton™, and Ion GeneStudio™ S5 System
events that are collected by Axeda™ RSM agent and the Deep Laser telemetry service are automatically
sent to Thermo Fisher Scientific. The number and names of these entries are subject to change across
software releases.

Data item name Data type Sample value

Alarm.* String Various hardware alarm messages

BIOS.BIOS Analog 5350

DataCollect.FlowsSinceClean Analog 400

DataCollect.RunsSinceClean Analog 1

Event.CleanCompleted String Clean completed

Event.DatacollectStarted String Datacollect Started

Event.InstrumentMustBeInitialized String Instrument must be initialized

Event.PostRunCleanHasNotBeenRun String Post Run Clean has not been run

InstrumentState String Idle

RunData.a1a2 String R_2016_02_17_13_01_08_user_F4--145

W1.dat dffffe cntArry 9 0 0 9

RunData.AutoPhFinal Analog 7.660635

RunData.AutoPhInitial Analog 6.321023

RunData.AutoPhIterations Analog 4

RunData.AutoPhResult String Pass

RunData.AutoPhTotalW1Volume Analog 1.0

RunData.ChipGain Analog 1.066389

RunData.ChipPixelAverage Analog 8241

354 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Manage telemetry services 13

(continued)

Data item name Data type Sample value

RunData.ChipPixelsInRange Analog 164698460

RunData.ChipPixelsPinnedHigh Analog 0

RunData.ChipPixelsPinnedLow Analog 676

RunData.ChipTemp Analog 81.826172

RunData.CpuTemp0 Analog 53

RunData.CpuTemp1 Analog 74

RunData.efuse String **********L:Q6C841,W:4,J:WC2012C00086-

C00272,P:16,C:PT4,F:F6,Y:4,X:0,B:3,SB:31,
B:1P,N:343*************************************

RunData.FpgaMasterTemp Analog 113

RunData.FpgaSlaveTemp Analog 118.4

RunData.GpuTempC Analog 82

RunData.LastAutoPhRealPh Analog 766

RunData.LastAutoPhRef Analog 745

RunData.LastAutoPhTarget Analog 770

RunData.R1pH Analog 7.00

RunData.R2pH Analog 7.00

RunData.R3pH Analog 7.00

RunData.R4pH Analog 7.00

RunData.W1pH Analog 8762

RunData.W2pH Analog 7619

RunData.W3RefpH Analog 7.45

Status.HDPctFull Analog 0.823612

Status.SsdPctFull Analog 6.220454

System.CpuUsagePct Analog 7

System.Date String 2013-01-0

System.FreeMemoryKB Analog 129951948

System.Hostname String d1.ite

System.IpAddress String 10.25.3.150

Torrent Suite™ Software 5.18 User Guide 355

 Chapter 13 Administer Torrent Suite™ Software
13 Manage telemetry services

(continued)

Data item name Data type Sample value

System.PhysMemTotalGB Analog 128

System.Time String 03:42:58 PM GMT

TYPE String Proton1

Version.Datacollect String 3371

Version.DiskImage String 2015_06_04

Version.Graphics String 80

Version.KernelRelease String 3.13.9-ionrt1

Version.LiveView String 2166

Version.OIA String 5203

Version.OS String 17

Version.Reader FPGA String 3d400109

Version.Reader FPGA1 Analog 33400109

Version.Reader Woddr FPGA String 3400043

Version.Reader Woddr FPGA1 String 340004b

Version.RSM String 24

Version.Scripts String 2.0.63

Version.S5 Release Analog 5.2

Version.S5 Script String 0.1.13

Version.TSLink String 1.0.2r5

Version.Valve FPGA String c010

356 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Administration with command-line utilities 13

Administration with command-line utilities

Monitor disk space
You can monitor disk space if the Torrent Suite™ Software is not available, or if you want to use a
command-line utility.

1. Sign in to the Ion Torrent™ Server using an ssh client:

$ ssh ionadmin@ion-torrent-server
$ password: ionadmin

2. Enter the df command to display partitions and disk utilization:

Most growth is seen in the /results directories, which is where Ion Reporter™ Software data are
stored.
The Use% column indicates how much space is being used.

You can also monitor disk space through the Ion Reporter™ Software. For details, see “View disk usage
parameters” on page 286.

Torrent Suite™ Software 5.18 User Guide 357

 Chapter 13 Administer Torrent Suite™ Software
13 Administration with command-line utilities

Change the hostname

Use the following command to change the hostname:

sudo TSconfig --change-hostname

You must restart the server after the hostname is changed. This command automatically restarts the
server.

Change the time zone

Use the following command to change the time zone:

sudo TSconfig --configure-timezone

Add an HTTP proxy

Use the following command to add an HTTP proxy:

sudo TSsetproxy

Set the proxy address and authentication according to the following prompts:

1. Enter http proxy address: Enter the proxy address. (If no address is entered, you are
prompted to exit the program.)

2. Enter http proxy port number [3128]: Enter a port number or carriage return to accept
the default, 3128, port number.

3. Enter the username for proxy authentication: Enter a username. If you do not enter a
username, no authentication is set.

4. Enter the password for proxy authentication: Enter a password. If you do not enter a
password, no authentication is set.

A proxy address confirmation message is displayed:

http_proxy is set to http://username:password@proxyAddress

The recommended usage is to enter the command sudo TSsetproxy, as shown above, and be
prompted for each value. You can however use the TSsetproxy arguments instead:

Usage: TSsetproxy [option]... --address Proxy address (example:

'http://proxy.net') --port Proxy port number (default: 3128)
--username
Username for authentication --password Password for
authentication --remove Removes
proxy setting --debug,-d Prints script commands when
executing (set -x) --demo
Prints what changes would be executed only. No changes are
made --help,-h Prints
command line args --version,-v Prints version

358 Torrent Suite™ Software 5.18 User Guide

 Chapter 13 Administer Torrent Suite™ Software
Administration with command-line utilities 13

Alternate checks
1. Connect to your Ion Torrent™ Server host, using ssh, and verify that the Crawler and Job Server
services are running:

ps -aux | grep py

This should show active crawler.py and serve.py processes.

2. Run a test analysis of the provided cropped data set and review the resulting report.

Torrent Suite™ Software 5.18 User Guide 359

14 Screen descriptions

■ User and account settings screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 360

■ Analysis Parameters screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
■ Configure screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
■ Ion Reporter™ configuration screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362
■ Plugins screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362
■ Updates screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363
■ References Sequences screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 364
■ Services screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 364
■ Planned Runs screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
■ Samples screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
■ Templates screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 366
■ Runs in Progress screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 366
■ Ion Chef screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 366
■ Completed Runs & Reports screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
■ Run Report screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 368
■ Projects screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 368
■ Data Management screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 369

User and account settings screen

How to… Learn more about…

“Change a password for Torrent Suite™ Software” on “Password security recommendations for Torrent
page 18 Suite™ Software” on page 13

“Approve or reject a new user account” on page 318

“Link your Ion Torrent™ Server account to

AmpliSeq.com” on page 59

360 Torrent Suite™ Software 5.18 User Guide

 Chapter 14 Screen descriptions
Analysis Parameters screen 14

Analysis Parameters screen

How to… Learn more about…

“Copy an analysis parameter set” on page 61 “Command Line Args (Advanced) screen” on
page 67

Configure screen
How to… Learn more about…

“Add customer support contacts” on page 324 “Update Torrent Suite™ Software” on page 326

“Change the displayed server name” on page 325

“Update Torrent Suite™ Software” on page 327

“Manage Torrent Suite™ Software user accounts” on

page 317

“Modify a user account” on page 319

“Delete multiple user accounts” on page 321

“Delete a single user account” on page 320

“Archive or delete data automatically” on page 333

“Lock current Torrent Suite™ Software version” on

page 325

“Change the time zone for the Ion Torrent™ Server”

on page 324

“Create a new administrator account to change a

password” on page 322

Torrent Suite™ Software 5.18 User Guide 361

 Chapter 14 Screen descriptions
14 Ion Reporter™ configuration screen

Ion Reporter™ configuration screen

How to… Learn more about…

“Set up an account for IonReporterUploader plugin” “IonReporterUploader plugin configuration” on

on page 229 page 236

“Automatically transfer Torrent Suite™ Software “IonReporterUploader plugin file transfer progress”
output to Ion Reporter™ Software” on page 231 on page 238

“Manage the Ion Reporter™ Software analysis Ion Reporter™ account setup troubleshooting
workflow list” on page 234 in “IonReporterUploader plugin account is not
configured.” on page 380

“View IonReporterUploader plugin status details” on “Torrent Suite™ Software output and Ion Reporter™
page 238 Software analysis phases” on page 242

“Tune IonReporterUploader plugin speed

parameters” on page 240

Plugins screen
How to… Learn more about…

“Install or upgrade plugins” on page 329 Chapter 7, “Manage plugins for data analysis”

“Enable an installed plugin” on page 330 “Preinstalled plugins” on page 135

“Configure a plugin to run automatically” on “Plugin configuration” on page 129

page 130

“Run a plugin manually from the sequencing run

report” on page 132

“Uninstall a plugin” on page 331

“Rescan a plugin” on page 134

“Configure plugins globally” on page 130

362 Torrent Suite™ Software 5.18 User Guide

 Chapter 14 Screen descriptions
Updates screen 14

Updates screen
Use the Updates screen to check for product and plugin updates.

How to… Learn more about…

“Check for off-cycle updates” on page 328 “Update Torrent Suite™ Software” on page 326

“Enable off-cycle product updates” on page 329

“Update off-cycle release plugins” on page 331

“Install off-cycle bundles without Internet access” on

page 329

Torrent Suite™ Software 5.18 User Guide 363

 Chapter 14 Screen descriptions
14 References Sequences screen

References Sequences screen

How to… Learn more about…

“Import a preloaded reference sequence file” on “Reference sequences” on page 246

page 248

“Import a custom reference sequence file” on “hg19 reference” on page 246

page 250

“View a reference sequence file” on page 251 “GRCh38 reference” on page 247

“Edit reference sequence file properties” on “Obsolete reference sequences” on page 254
page 252

“Permanently delete a reference sequence file” on “Target regions and hotspots files” on page 255
page 254

“View and manage target regions files” on page 256 “Guidelines for using target regions and hotspots
files” on page 255

“View and manage hotspots files” on page 257 “Hotspots file format” on page 267

“Upload a target regions file” on page 259 “Test fragments” on page 279

“Upload a hotspots file” on page 261 “Barcodes and barcode sets” on page 280

“View test fragment details” on page 279 “Upload history” on page 284

“Add a custom test fragment” on page 279

“Edit or delete a custom test fragment” on page 280

“View a DNA barcode sequence” on page 281

“Download a DNA barcode set CSV file” on

page 282

“Add a custom DNA barcode set” on page 282

“Delete a custom DNA barcode set” on page 284

Services screen
How to… Learn more about…

“Check crawler and job server status” on page 382 “Alternate checks” on page 359

“Restart services” on page 390

364 Torrent Suite™ Software 5.18 User Guide

 Chapter 14 Screen descriptions
Planned Runs screen 14

Planned Runs screen

How to… Learn more about…

“Manage Planned Runs” on page 79 Chapter 4, “Plan and execute an instrument run”

“Manually change Ion Chef™ Instrument run status” “Planned Run templates” on page 35
on page 81

“Transfer a Planned Run to another Ion Torrent™ “Planned Run status” on page 80
Server” on page 83

“Execute a Planned Run on a sequencer” on

page 82

Samples screen
How to… Learn more about…

“Create a Sample Set manually” on page 20 “Sample attributes” on page 25

“Create a Sample Set by importing samples from a “Sample information” on page 22

CSV file” on page 21

“Create an Ion AmpliSeq™ on Ion Chef™ Sample Set” “Plan by Sample Set” on page 63
on page 32

“View Ion AmpliSeq™ library preparation on an

Ion Chef™ System run” on page 30

“View Sample Set attributes” on page 22

“Add a sample attribute to a sample” on page 23

“Manage sample attributes” on page 24

“Find a Sample Set” on page 30

“Edit a Sample Set” on page 31

“Delete a Sample Set” on page 32

“Sort Sample Sets” on page 31

“Create a Planned Run with Sample Sets” on

page 63

Torrent Suite™ Software 5.18 User Guide 365

 Chapter 14 Screen descriptions
14 Templates screen

Templates screen
How to… Learn more about…

“Create a Planned Run from a Planned Run Chapter 4, “Plan and execute an instrument run”
template” on page 39

“Create a custom Planned Run template” on page 37 “Steps in the workflow bar” on page 44

“Export a Planned Run template” on page 42

“Import a Planned Run template” on page 42

“Import panel files and parameters from

AmpliSeq.com” on page 59

“Search for a Planned Run template” on page 41

“Save a Planned Run template to Favorites” on

page 43

“Create a Planned Run for mixed samples with a

Planned Run template” on page 68

“Create multiple Planned Runs” on page 74

“Transfer a Planned Run to another Ion Torrent™

Server” on page 83

Runs in Progress screen

How to… Learn more about…

“Monitor a sequencing run” on page 86 Sequencing run metrics in “Monitor a sequencing

run” on page 86

“Review the Planned Run settings” on page 89 “View data for runs in progress” on page 87

“Auto Refresh the Monitor tab” on page 88

Ion Chef screen

How to… Learn more about…

“Monitor an Ion Chef™ run” on page 87

“Auto Refresh the Monitor tab” on page 88

366 Torrent Suite™ Software 5.18 User Guide

 Chapter 14 Screen descriptions
Completed Runs & Reports screen 14

Completed Runs & Reports screen

How to… Learn more about…

“Search for a run report” on page 93 “Create an Ion AmpliSeq™ on Ion Chef™ Sample Set”
on page 32

“Change the default alignment reference” on “Test fragments” on page 279

page 126

“Reanalyze a run” on page 124

“Add or change barcoding for a completed run

report” on page 127

“Reanalyze a run” on page 124

“Edit a run report” on page 126

“View plugin run status” on page 132

“Set the Completed Runs & Reports screen to

automatically refresh” on page 128

“Failed status for a run” on page 371

Torrent Suite™ Software 5.18 User Guide 367

 Chapter 14 Screen descriptions
14 Run Report screen

Run Report screen

How to… Learn more about…

“Open a run report” on page 93 “Quality following alignment” on page 97

“Review unaligned reads” on page 94 “Aligned read length calculation” on page 97

“Review aligned reads” on page 97 “Alignment” on page 98

“Download output files” on page 108 “Reads used for alignment” on page 99

“View and download barcode reports” on page 108 “Predicted quality (Q20)” on page 99

“View software versions used in a run” on page 114 “Run report metrics before alignment” on page 95

“Download a run report summary PDF” on page 109 “Run report metrics after alignment” on page 101

“View consumables used in a completed run” on “Output files” on page 107

page 111

“View the summary for an Ion Chef™ Instrument run” “View details about completed runs” on page 109
on page 111

“View analysis details for a completed run” on

page 113

“Get technical support files for a completed run” on

page 371

Projects screen
How to… Learn more about…

“Add a project to a Planned Run” on page 116

“Add selected results to another project” on

page 116

“Download a CSV file of metrics” on page 120

“Remove a result set from a project” on page 124

“Search for projects by name” on page 115

“View result sets in a project” on page 117

“Combine aligned reads from multiple run reports”

on page 119

“Compare reports of runs in a project” on page 117

“Manage data for result sets in projects” on

page 119

368 Torrent Suite™ Software 5.18 User Guide

 Chapter 14 Screen descriptions
Data Management screen 14

Data Management screen

How to… Learn more about…

“Archive or delete data automatically” on page 333 “Ion instrument data types” on page 332

“Import data for data transfers or restoration” on Chapter 11, “Data management”
page 290

“View disk usage parameters” on page 286 “Dataflow file sizes” on page 344

“View category statistics” on page 287

“View active data management jobs” on page 287

“Search for run reports with disk usage status” on

page 289

“Keep run report data” on page 289

“Manually export run data” on page 336

“Manually archive run data” on page 336

“Manually delete selected data from a run report” on

page 337

“View the data management actions log” on

page 290

“Increase file storage and available disk space” on

page 338

“Connect to a Torrent Storage™ NAS (Network

Attached Server) device” on page 338

“Monitor the Torrent Storage™ NAS (Network

Attached Server) device” on page 341

Torrent Suite™ Software 5.18 User Guide 369

 A Troubleshooting

■ Troubleshooting resources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 370

■ Troubleshoot Torrent Suite™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 371
■ Troubleshoot Ion Torrent™ Server . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 381

This appendix includes information on troubleshooting tips, resources, and where to get additional
information or Technical Support assistance for Ion GeneStudio™ S5 and Ion S5™ Systems sequencing
runs. It also includes known recommended actions to observed problems, such as low loading density,
low percentage of live ISPs, and missing test fragments.

Troubleshooting resources
For more troubleshooting information, see the instrument user guides on the Ion S5™, Ion Chef™
Instrument, or Ion GeneStudio™ S5 Series product pages. You can also search for manuals on the
Services & Support tab at www.thermofisher.com.
• Customer Support Archive (CSA)—For problems that require technical help, obtain the CSA. The
sequencing CSA is used by Technical Support to diagnose problems. Due to the large size of the
full analysis CSA, it is necessary to use the thumbnail version for troubleshooting purposes. To
download this CSA:
a. In the Data tab, click Completed Runs & Reports, then click the Report Name link with "_tn"
appended.
b. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click the Support tab.
c. Click Download to download a compressed directory that contains a PDF and HTML version
of the run report, and logs that can be used for troubleshooting.
d. Email the report to Technical Support. If you would like to be able to upload these support files
directly, ask your local Field Service Engineer how to enable the Customer Support Archive
function.
• Instrument log files—Instrument log files from Ion Chef™ instruments can also be sent to
Technical Support for troubleshooting help. Contact Technical Support for instructions to download
instrument log files. The CSA includes instrument log files.
• Turn off 3' quality trimming—In cases of shorter-than-expected library reads, the 3’ quality trimming
can be turned off to help distinguish short reads that originate from the library preparation and
short reads resulting from the 3’ quality trimming by the software. To turn off the 3’ quality
trimming:
a. In the Data tab, click Completed Runs & Reports.
b. Search, filter, or sort the list to find your run report of interest.
c. In Table View mode, in the row of the run of interest, click (Actions)4Reanalzye.
d. Under the Advanced options, on the Start reanalysis from line, select Base Calling.

370 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Torrent Suite™ Software A

e. In the Basecaller args field, change the --trim-qual-cutoff 15 value to 100. The field
should now read, BaseCaller --trim-qual-cutoff 100 --trim-qual-window-size
30 --trim-adapter-cutoff 16.
f. Give the reanalysis report a new name and select Start Analysis.

Troubleshoot Torrent Suite™ Software

Get technical support files for a completed run
You can view the report log when troubleshooting a completed run. If you need further assistance after
viewing the report log, you can generate a customer support archive that you can share with technical
support for assistance.

1. In the Data tab, click Completed Runs & Reports, then click the Report Name link to open the
report of interest.

2. In the left navigation menu, click Details, or scroll to the Details section of the run report, then
click the Support tab.

3. Click View the report log to see a list of errors.

4. If you are unable to resolve an issue using the report log, click Download to download a customer
support archive. This is a compressed directory that contains a PDF and HTML version of the run
report, and logs that can be used for troubleshooting.

5. (Optional) Email the customer support archive to your local Field Service Engineer or Technical
Support representative. If you would like to be able to upload the customer support archive
directly, ask your Field Service Engineer how to enable the Customer Support Archive function.

Troubleshoot a sequencing run

Low loading density, low live ISPs, missing test fragments, primer-dimers, and other issues can affect
sequencing runs.

Observation Possible cause Recommended action

Failed status for a run It is not clear whether the Go to the sequencer Data Management
sequencing run data transfer screen to confirm complete data transfer. If
completed, and if you can you are not sure the data set was transmitted,
access the sequencer. you can re-transfer it.
The run report was successful, In Torrent Suite™ Software, under the Data
but you are not sure whether tab, click Completed Runs & Reports to view
the data was transferred. the run report and ensure that the file transfer
was complete. Also, check if there are any
error messages, such as User Aborted on
the report itself. Look for a status of Error or
Pending.

Torrent Suite™ Software 5.18 User Guide 371

 Appendix A Troubleshooting
A Troubleshoot Torrent Suite™ Software

Observation Possible cause Recommended action

Failed status for a run You cannot determine the Reanalyze the run. For more information, see
(continued) cause of the failed run status. “Reanalyze a run” on page 124.
Send the customer support archive to your
local Field Service Engineer or Technical
Support for review. For more information, see
“Get technical support files for a completed
run” on page 371.
Low loading density from Too little library input into Review Qubit™ QC assay results to determine
Ion Chef™ Instrument runs template preparation. Low if % templated ISPs was low.
enriched ISP recovery is • If % templated ISPs was <10%, increase
caused by unenriched ISPs library input to target 15–25% templated
with <5% templated ISPs. ISPs.
• Requantify the library. If the library yield
was below recommended, rebuild the
library.
Too much library input into Review Qubit™ QC assay results to determine
template preparation. if % templated ISPs was too high after
template preparation.
• If library is >25% but <70% templated
ISPs, rebuild the library. Decrease library
input to target 10-25% templated ISPs,
or continue with sequencing and expect
lower throughput.
• If library is >70% templated ISPs, check
Agilent™ 2100 Bioanalyzer™ traces for
adapter dimer peak (amplicon library
or Ion AmpliSeq™ library peak near
70 bp; miRNA library peak near 60 bp).
Repurify (reduce) library using Agencourt™
AMPure™ XP Kit clean-up steps as
outlined in appropriate user guides.
Chip adapter placement or Inspect chip adapters for any obvious defects
removal was improper. before installation.
The best practice for removing chip adapters
for Ion S5™ chips is to squeeze the adapter
ends at the same time and remove the adapter
by keeping it parallel to the chip.
Bubbles were present during Air bubbles in the reagent tubes can affect
chip loading or during the chip various steps through the sequencing run,
run. including loading density. Let reagents settle
before using.

372 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Torrent Suite™ Software A

Observation Possible cause Recommended action

Low loading density from Too little library input into Review Qubit™ QC assay results to determine
Ion OneTouch™ 2 System runs template preparation. Low if % templated ISPs was low.
enriched ISP recovery is • If % templated ISPs was <10%, increase
caused by unenriched ISPs library input to target 15–25% templated
with <5% templated ISPs. ISPs.
• Requantify the library. If the library yield
was below recommended, rebuild the
library.
Too much library input into Review Qubit™ QC assay results to determine
template preparation. if % templated ISPs was too high.
• If library is >25% but <70% templated
ISPs, rebuild the library. Decrease library
input to target 10-25% templated ISPs,
or continue with sequencing and expect
lower throughput.
• If library is >70% templated ISPs, check
Agilent™ 2100 Bioanalyzer™ traces for
adapter dimer peak (amplicon library
or Ion AmpliSeq™ library peak near
70 bp; miRNA library peak near 60 bp).
Repurify (reduce) library using Agencourt™
AMPure™ XP Kit clean-up steps as
outlined in appropriate user guides.
Low pre-enriched ISP recovery. Review Qubit™ QC assay results to determine
if ISP recovery was low after template
preparation.
Ensure that ISPs are properly vortexed
(1 minute at maximum speed as suggested
in the user guide) before the addition of
amplification mix.
Ensure proper OT2 instrument setup and
performance.
Low enriched ISP recovery. Ensure proper reagent setup for ES
enrichment.
Ensure that enrichment beads (Dynabeads™
MyOne™ beads) are washed and resuspended
in the correct washing solution.
Properly prepare the fresh melt-off solution.

Torrent Suite™ Software 5.18 User Guide 373

 Appendix A Troubleshooting
A Troubleshoot Torrent Suite™ Software

Observation Possible cause Recommended action

Low loading density from Improper addition of Ensure that sequencing primer and
Ion OneTouch™ 2 System runs sequencing primer and polymerase were added.
(continued) polymerase. During the primer annealing step, it is
important to thoroughly resuspend the
enriched ISP pellet before and after adding the
sequencing primer. This helps to break up ISP
clumps and ensure even sequencing primer
distribution to the templates on the ISPs.
Properly mix ISPs during the primer annealing
step. Improper mixing can cause lower
than expected key signal and possible
misidentification of template ISPs.
Wrong loading protocol was Use the recommended protocol for the chip
used. type and sequencing kit.
Low percentage of live ISPs. Improper addition of Review Test Fragment (TF) metrics. If TFs
The Live (% enrichment) metric sequencing primer and are missing or the signal is low: primer or
includes both live TF and polymerase. polymerase can have been added incorrectly.
library ISPs. When evaluating
the percent enrichment metric, Ensure proper addition of sequencing primer
also consider the ratio of test and polymerase.
fragment ISPs to library ISPs. If Poor library amplification onto Review Test Fragment (TF) metrics. If TFs are
the ratio of TF ISPs is higher the ISPs (template preparation). present and have the expected key signal
than expected, the reported and quality, check the Qubit™ QC assay. If
percent of enriched library
results indicate <10% templated unenriched
ISPs is not accurate. Instead,
ISPs, then too little library was added.
calculate the library enrichment
from the values in the run Check Ion OneTouch™ 2 System performance
report table: [Library ISPs/(Live by downloading the log files.
ISPs - TF ISPs)] x 100 = Library
Too little library input into Review Test Fragment (TF) metrics. If TFs are
ISP % Enrichment.
template preparation. present and have the expected key signal
and quality, check the Qubit™ QC assay. If
results indicate <10% templated unenriched
ISPs, then too little library was added.
Check Ion OneTouch™ 2 System performance
by downloading the log files.
Enrichment failure. Check the ES enrichment process to ensure
that fresh melt-off and the correct enrichment
beads (Dynabeads™ MyOne™ beads) and
solutions are used.
If >5-µL residual volume is left in wells 1
through 8, perform a residual volume test.
Test Fragment-1 is not present Poor amplification onto the Review Qubit™ QC assay results to determine
or conversion is low ISPs (template preparation). if % templated ISPs was low after template
There are two test fragment preparation.
controls: TF-C is a sequencing
control and TF-1 is an Ensure that reagents were set up correctly.
amplification control. Starting
in Torrent Suite™ Software 5.4,
only TF-1 is present.

374 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Torrent Suite™ Software A

Observation Possible cause Recommended action

Test Fragment-1 is not present Sequencing or consumables Ensure that sequencing primer was annealed,
or conversion is low problem occurred. and sample was incubated with polymerase.
There are two test fragment
Ensure that all reagents were from the same
controls: TF-C is a sequencing
control and TF-1 is an sequencing kit type. Do not swap reagents
amplification control. Starting between kit types.
in Torrent Suite™ Software 5.4, Ensure that reagents set up were correctly.
only TF-1 is present.
Send Customer Support Archive (CSA) to
(continued)
Technical Support.
Lower than expected Low loading density reported. See recommendations for low loading density.
number of live library ISPs with
Bad library key used. Ensure that the library was properly prepared.
a key sequencing matching the
This is less likely to be the problem if an Ion
library key (TCAG).
library kit was used for library construction.
Ensure that the template preparation was
successful. Check Qubit QC assay results.
Send Customer Support Archive (CSA) to
Technical Support.
Poor library quality or Ensure that the library was properly prepared.
templating efficiency. This is less likely to be the problem if an Ion
library kit was used for library construction.
Ensure that the template preparation was
successful. Check Qubit QC assay results.
Send Customer Support Archive (CSA) to
Technical Support.
High polyclonal count Too much library input into Verify library quantification and template
template preparation. preparation with QC (Qubit assay).
If the library key signal is lower than expected,
% polyclonal estimate might be inaccurate.
High number of low-quality Poor library quality or Check Agilent™ Bioanalyzer™ Instrument
reads. templating efficiency: bad, or trace to ensure that library is within the
Reads are too short after low, key signal. recommended size range (amplified, non-
quality trimming. equalizer libraries only).
Ensure that library was properly prepared
(correct adapter sequences, adapter ligation).
Review the library ISP QC data Qubit™ data.
High relative primer dimer Library preparation resulted in Check Agilent™ Bioanalyzer™ Instrument trace.
count high number of primer dimers. Non-barcoded adapter dimers ~70 bp.
Barcoded adapter dimers ~80 bp.
Repurify library to remove adapter dimers.
Low Final Library ISPs count Low ISP loading density Review well classification and read filtering
reported. results to narrow troubleshooting focus.
Poor library read filtering Send a Customer Support Archive (CSA) to
reported. Technical Support.

Torrent Suite™ Software 5.18 User Guide 375

 Appendix A Troubleshooting
A Troubleshoot Torrent Suite™ Software

Customer Support Archive (CSA)

You can download an archive that a Technical Support representative can use to diagnose Torrent
Suite™ Software issues. The Customer Support Archive (CSA) contains log files and other technical data
about your Torrent Suite™ Software and analysis runs.
Under some circumstances, you can use the FieldSupport plugin to generate an archive for use by
Technical Support. For details, see “FieldSupport plugin” on page 157.

Generate a customer support archive

1. Under the Data tab, in the Completed Runs & Reports screen, click the link for your completed
analysis run.

2. In the Run Summary, click the Plugin Summary link, or scroll down to the Plugin Summary
section.

3. Click the Support tab, then click Download.

A compressed archive is downloaded to the directory location that you specified to download files from
the browser. This location depends on your browser settings. You can attach this archive to an email to
send to Customer Support.
Ion Torrent™ Server cannot access the customer support server automatically. If you would like to
upload files directly, contact your local Field Service Engineer and ask how to enable the customer
support archive upload for your Ion Torrent™ Server.

Customer support archive contents

The tables in this section describe the files and locations of the files that are included in a customer
support archive. Files for optional modules (such as recalibration) appear only if the optional module is
run.

Files in the top level folder

File Description

Report.pdf A PDF file of the analysis report and plugin results (similar to the
output of the Download as PDF button on a run report).

DefaultTFs.conf Contains a list of known test fragment sequences and their bases.

drmaa_stderr_block.txt The analysis pipeline error log for the block being executed by
Oracle™ Grid Engine.

drmaa_stdout.txt The log of events after primary analysis.

drmaa_stdout_block.txt The analysis pipeline output log for the block being executed by
Oracle™ Grid Engine.

explog.txt The initial run settings needed for Torrent Suite™ Software analysis
when being exported from an instrument.

376 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Torrent Suite™ Software A

Files in the top level folder (continued)

File Description

explog_final.txt The final run settings needed for Torrent Suite™ Software analysis
when being exported from an instrument.

InitLog.txt The instrument auto pH log.

InitValsW2.txt The pH log of the W2 solution.

InitValsW3.txt The pH log of the W3 solution.

ion_params_00.json A JSON-format file that contains the Planned Run related metadata.

<barcode> A JSON-format file with Quality Control metrics.

_rawlib.ionstats_alignment.json

ionstats_alignment.json A JSON-format file with Quality Control metrics.

iontrace_Test_Fragment.png Graphic that shows the peak signal per well in the first key flow.

RawInit.txt Contains initialization data output.

sysinfo.txt Contains Torrent Suite™ Software system settings.

uploadStatus The log of metrics being uploaded to the Torrent Suite™ Software.

version.txt Lists the Torrent Suite™ Software versions used for the analysis
report.

Files in the basecaller_results folder

File Description

basecaller.log A log file for the BaseCaller analysis module.

BaseCaller.json A JSON-format file with Quality Control metrics.

datasets_basecaller.json A JSON-format file of the settings needed for the BaseCaller module
to analyze the sample data.

datasets_pipeline.json A JSON-format file of the settings needed by the pipeline to run the
BaseCaller module.

datasets_tf.json A JSON-format file of the settings needed for the BaseCaller module
to analyze the Test Fragments.

<barcode> A JSON-format file with Quality Control metrics for the barcode.
_rawlib.ionstats_basecaller.json

<barcode>_rawlib.sparkline.png A graphics file with the thumbnail histogram that shows the read
lengths for the barcode.

ionstats_basecaller.json A JSON-format file with Quality Control metrics.

ionstats_tf.json A JSON-format file with Quality Control metrics.

Torrent Suite™ Software 5.18 User Guide 377

 Appendix A Troubleshooting
A Troubleshoot Torrent Suite™ Software

Files in the basecaller_results folder (continued)

File Description

nomatch_rawlib.ionstats_ A JSON-format file with Quality Control metrics for the reads that
basecaller.json cannot be classified as into one of the barcodes (the no-match
group).

nomatch_rawlib.sparkline.png A graphics file with the thumbnail histogram that shows the read
lengths for the no match group.

TFStats.json A JSON-format file of test fragments results statistics.

Files in the basecaller_results/recalibration folder

File Description

BaseCaller.json A log file for the BaseCaller analysis module during base
recalibration.

basecaller.log A JSON-format file with Quality Control metrics for base

recalibration.

datasets_basecaller.json A JSON-format file of the settings needed for the BaseCaller module
to analyze the sample data for base recalibration.

datasets_pipeline.json A JSON-format file of the settings needed by the pipeline to run the
BaseCaller module for base recalibration.

Files in the basecaller_results/unfiltered.trimmed folder

File Description

datasets_basecaller.json A JSON-format file of the settings needed for the BaseCaller module
to analyze the sample data, when generating the raw BAM file.

Files in the basecaller_results/unfiltered.untrimmed folder

File Description

datasets_basecaller.json A JSON-format file of the settings needed for the BaseCaller module
to analyze the sample data, when generating the raw BAM file.

Files in the sigpror_results folder

File Description

analysis.bfmask.stats Contains analysis statistics of wells in the bead find stage (the
bfmask is a set of bit flags for each well, indicating the contents
of each well).

avgNukeTrace_ATCG.txt Contains ATCG key signal measurements.

avgNukeTrace_TCAG.txt Contains TCAG key signal measurements.

bfmask.stats Contains summary statistics of wells in the bead find stage.

378 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Torrent Suite™ Software A

Files in the sigpror_results folder (continued)

File Description

BkgModelFilterData.h5 Contains debug information for the polyclonal filter. In particular, this
file contains PPF (percent positive flows) and SSQ (residual) values
for each read.

pinsPerFlow.txt Contains the number of pixels that are detected as pinned in each
flow. Pinned pixels either contain zero or a very high signal (above
the threshold) in the flow.

processParameters.txt Contains parameter settings for analysis signal processing.

sigproc.log A log file for the analysis module.

Files in the sigpror_results/dcOffset folder

File Description

dcOffset.txt The background model parameter values of dcOffset.

The files in the sigpror_results/NucStep folder contain background model parameter values
based on the location of the well in the chip.

Files in the sigpror_results/NucStep folder

File

NucStep_frametime.txt

NucStep_inlet_bead.txt

NucStep_inlet_empty.txt

NucStep_inlet_empty_sd.txt

NucStep_inlet_step.txt

NucStep_middle_bead.txt

NucStep_middle_empty.txt

NucStep_middle_empty_sd.txt

NucStep_middle_step.txt

NucStep_outlet_bead.txt

NucStep_outlet_empty.txt

NucStep_outlet_empty_sd.txt

NucStep_outlet_step.txt

The files in the sigpror_results/NucStepFromBeadfind folder contain background model

parameter values based on the location of the well in the chip during the bead find stage.

Torrent Suite™ Software 5.18 User Guide 379

 Appendix A Troubleshooting
A Troubleshoot Torrent Suite™ Software

Files in the sigpror_results/NucStepFromBeadfind folder

File

dcOffset.txt

NucStep_frametime.txt

NucStep_inlet_bead.txt

NucStep_inlet_empty.txt

NucStep_inlet_empty_sd.txt

NucStep_inlet_step.txt

NucStep_middle_bead.txt

NucStep_middle_empty.txt

NucStep_middle_empty_sd.txt

NucStep_middle_step.txt

NucStep_outlet_bead.txt

NucStep_outlet_empty.txt

NucStep_outlet_empty_sd.txt

NucStep_outlet_step.txt

Troubleshoot IonReporterUploader plugin account setup

Observation Possible cause Recommended action

IonReporterUploader plugin account is not If you change your account When you change your
configured. password, you see a red dot password, click Edit and
Red status appears on the Ion Reporter™ in the status column of the enter the access code
Software account configuration screen. IonReporterUploader plugin for the account. For more
account. information, see
“Set up an account for
IonReporterUploader plugin”
on page 229.
If you upgrade the account, When you upgrade your
you see a red dot in account to a new version,
the status column of the click Edit, then delete your
IonReporterUploader plugin old account and create a new
account. account for the new version.

380 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Ion Torrent™ Server A

Troubleshooting file import/upload errors

Some types of errors do not appear in the Processing Log section (see the log entry under Upload
History in Reference Sequence). Major problems with files can prevent file uploading.

Observation Possible cause Recommended action

File upload errors. • Incorrect file format Check for possible errors in the source BED or
File validation cannot be • Incorrect file extension VCF file.
attempted.
• The ZIP file contains no Fix the errors, or replace the file, then re-
files or multiple files attempt the upload.
• A corrupted ZIP or GZ file
Reference genome file cannot • An invalid FASTA file was 1. Delete the existing reference sequence
be opened uploaded. entry.
• No FASTA header found at 2. Identify and correct formatting errors in
line 1. the FASTA file.
• Genome information text 3. Upload the corrected file.
file may have been
deleted.

Troubleshoot Ion Torrent™ Server

These troubleshooting recommendations apply to system level issues such as networking, disk space,
and system load.

Torrent Suite™ Software 5.18 User Guide 381

 Appendix A Troubleshooting
A Troubleshoot Ion Torrent™ Server

Check crawler and job server status

Use the Crawler and Jobs Server screen to view information about the background processes that are
running on Torrent Suite™ Software.
If these processes are not running, run information is not updated and analysis reports are not
generated. If this occurs, there is no risk of data loss but the Crawler and Jobs Server processes
should always be running. The Archive process runs only if archiving has been configured.
If a process is not running, a Down or Offline reason displays in the Services screen. An example
message is The crawler is offline.

1. Click (Settings)4Services.

2. In the Crawler and Jobs Server screen, review the information about the background processes
described in the following table.

Process Program Startup script Description

Crawler crawler.py ionCrawler Searches for new runs
from the sequencers
and puts run information
into the database so
that it appears in the
Data > Completed
Runs & Reports screen.
Job Server serve.py ionJobServer Sends analysis jobs
to the Oracle™ Grid
Engine.
Plugin Server ionPlugin.py ionPlugin Sends plugin jobs to the
Oracle™ Grid Engine.
Celeryd manage.py celeryd A background job
processor for Django
(the web application
framework).

382 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Ion Torrent™ Server A

Queue status
Click the Queue Status link in the Active Jobs section to open a table of SGE queue activity:

Verify network connectivity and name resolution

There can be many reasons for network connectivity or name resolution to fail. Use this procedure to try
to resolve connectivity and name resolution problems.
If you cannot reach the Ion Torrent™ Server by using an IP address, you are likely to need help from the
site IT administrator who understands how the local network is configured.

1. Click (Settings) Configure.

2. In the Configure screen, scroll down to the Database Administration section, then click Admin
interface link to access the database administration functions.

3. If you are prompted to sign in, enter your administrator user name and password, then click Sign
in.
The Site administration screen in the Ion Web portal opens.

4. Scroll down to Management Actions, then select the Network Settings line.
The software performs several network checks:

Torrent Suite™ Software 5.18 User Guide 383

 Appendix A Troubleshooting
A Troubleshoot Ion Torrent™ Server

5. Verify that the Ion Torrent™ Server is configured correctly by reviewing the Ion Torrent™ Server
deployment instructions.

6. Find the IP address of the Ion Torrent™ Server as described in “Verify the Ion Torrent™ Server IP
address” on page 384.

After you are finished, click Back to Main Site at the top of the screen to return to the software.

Verify the Ion Torrent™ Server IP address

The Ion Torrent™ Server is configured out-of-the-box to automatically get an IP address from the DHCP
server on the network. Unless the local IT administrator has specifically assigned an IP address in
advance, you may not know the current IP address.
The Ion Torrent™ Server has several Ethernet ports on the back. Make sure that your site network is
connected to the port labeled LAN, called eth0 in Linux™ terminology. The Ethernet ports are identified
as eth0, eth1, ..., for as many ports as are available. On Ion Torrent™ Server, eth0 is the only port
connected to your network and is configured by DHCP.
If the port is set to DHCP the IP address should be permanently assigned to that port after the server IP
address setting is configured.
If you are still concerned about network connectivity, you can test whether different desktops are
able to successfully ping the server IP address. If you are not able to ping the server from the
desktops that need to access the Torrent Suite™ Software running on the server, contact your site IT
administrator.

1. To determine the IP address assigned to eth0, sign in and type: ifconfig eth0. This displays
the following output:

ionadmin@ion-torrent-server:~$ ifconfig eth0

eth0 Link encap:Ethernet HWaddr 00:1b:21:5b:bb:44
inet addr:192.168.1.123 Bcast:192.169.4.255 Mask:255.255.255.0
inet6 addr: fe80::21b:21ff:fe5b:bb44/64 Scope:Link
UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1
RX packets:209970726 errors:0 dropped:0 overruns:0 frame:0
TX packets:419252947 errors:0 dropped:0 overruns:0 carrier:0
collisions:0 txqueuelen:1000
RX bytes:14131928595 (14.1 GB) TX bytes:607398487997 (607.3 GB)
Memory:fbea0000-fbec0000

Your IP address is the inet addr.

inet addr:192.168.1.1 Bcast:192.169.4.255 Mask:255.255.255.0

2. You can configure a static IP address in the Network Settings screen.

a. Click (Settings)4Configure4, , then scroll the Database Administration section and
click the Admin Interface link.

b. In the Admin Interface screen, scroll to the Management Actions section, then click
Network Settings.

384 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Ion Torrent™ Server A

c. Select Static, then enter the IP address into the IP address field and click Update.

3. Another useful check is the line beginning with UP, which indicates the interface is active and
working.

UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1

If the eth0 port is not available, it is possible that the Ethernet cable is not connected to a network,
so you may not see the word UP.

BROADCAST MULTICAST MTU:1500 Metric:1

If an IP address is assigned, the interface is likely to work. If no IP address is assigned and the
interface is not UP, you may need to get help from your site IT administrator.

Troubleshoot and configure the time service

The Ion Torrent™ Server uses the Linux™ Network Time Protocol (NTP) program to synchronize its time
with another time server. By default, the Ion Torrent™ Server is configured to synchronize its time service
to a trusted time service on the Internet. This configuration requires that the network configuration
allows the NTP network protocol to connect to that time service on the Internet.
The Ion Torrent™ Server can also act as a time server for an Ion Chef™ Instrument, and Ion S5™ or Ion
GeneStudio™ S5 Series sequencers.
To ensure that the server is synchronized with connected instruments, Ion Torrent™ Server will serve
as authoritative time server for directly connected instruments when primary time servers cannot be
reached. Ion Torrent™ Server does not forward potentially incorrect information to other machines.
If the network configuration is blocking the NTP protocol from reaching the Internet, the Ion Chef™
Instrument, and Ion S5™ or Ion GeneStudio™ S5 Series sequencers cannot synchronize time. If the
server is restricted from reaching to the external time server, edit the NTP settings to point to your local
NTP server.
Your site network administrator is probably aware of this connectivity restriction, and it is likely that IT
has a time server in the network.

View system support diagnostics

System diagnostics information can help in troubleshooting network, disk space, and system status
problems.

1. To access system diagnostics information, click

(Settings)4About

2. Scroll down to the More Information and Assistance

section, then click System Support Diagnostics.
The diagnostics screen provides Network, System,
and Data sections. A small section of each is shown:

Torrent Suite™ Software 5.18 User Guide 385

 Appendix A Troubleshooting
A Troubleshoot Ion Torrent™ Server

386 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Ion Torrent™ Server A

View instrument diagnostics

Use Instrument Diagnostics to investigate chip and sequencing instrument problems, such as pH
levels.

1. To access the Instrument Diagnostics information, click (Settings)4About:

2. Scroll down to the More Information and Assistance

section, then click the Instrument Diagnostics link:
The Instrument Diagnostics screen lists the
sequencing instruments that are associated with each of your results partitions. Passed and failed
analysis runs are shown for each instrument.
The InitLog.txt file includes diagnostic measurements and if possible presents a probable cause
and suggests next steps.

Torrent Suite™ Software 5.18 User Guide 387

 Appendix A Troubleshooting
A Troubleshoot Ion Torrent™ Server

3. To investigate a failed run, click the View log link for that run:

The InitLog.txt file opens for that run on the instrument:

388 Torrent Suite™ Software 5.18 User Guide

 Appendix A Troubleshooting
Troubleshoot Ion Torrent™ Server A

Torrent Suite™ Software 5.18 User Guide 389

 Appendix A Troubleshooting
A Troubleshoot Ion Torrent™ Server

Restart services
If you need to restart a service, you can not restart the service using the Torrent Suite™ Software. The
easiest approach is to shut down and restart the Ion Torrent™ Server.
After shutting down and restarting the server, all services that were running before shutting down
continue from the point where they were interrupted, and no more user interaction is needed.

1. Shut down and restart the Ion Torrent™ Server.

2. (Optional) Restart the services.

sudo service <name> start

3. Verify that the services are running using the ps ax | grep py command or the Torrent Suite™
Software user interface.
If the services do not continue to run after being restarted, contact your local Field Service
Engineer for assistance.

Further investigation and problem resolution

After the root cause of a major problem is identified, the following more intrusive action may be needed:
• Replace a failed hard disk drive
• Downgrade software packages
• Reinstall software
• Modify configuration files
• Add, modify, or delete database information

Contact your local Field Service Engineer for assistance before you attempt any of these actions.

390 Torrent Suite™ Software 5.18 User Guide

 Documentation and support

Customer and technical support

Visit thermofisher.com/support for the latest service and support information.
• Worldwide contact telephone numbers
• Product support information
– Product FAQs
– Software, patches, and updates
– Training for many applications and instruments
• Order and web support
• Product documentation
– User guides, manuals, and protocols
– Certificates of Analysis
– Safety Data Sheets (SDSs; also known as MSDSs)

Note: For SDSs for reagents and chemicals from other manufacturers, contact the
manufacturer.

Limited product warranty

Life Technologies Corporation and/or its affiliate(s) warrant their products as set forth in the
Life Technologies' General Terms and Conditions of Sale at www.thermofisher.com/us/en/home/
global/terms-and-conditions.html. If you have any questions, please contact Life Technologies at
www.thermofisher.com/support.

Torrent Suite™ Software 5.18 User Guide 391

 Glossary

50Q10 Reads
Number of Ion Sphere™ Particles at 50+ bp at Q10.

50Q17 Reads
Number of Ion Sphere™ Particles at 50+ base pairs at Q17.

adapter dimer (ISPs)

ISPs that carry DNA insert length of less than 8 bp.

aligned read length

The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read
at which the accuracy in the bases up to and including the position meets the accuracy threshold. For
example, the AQ17 length of a read is the greatest length at which the read error rate is 2% or less. The
"perfect" length is the longest perfectly aligned segment. For all of these calculations, the alignment is
constrained to start from position 1 in the read—that is, no 5′ clipping is allowed.

aligned reads
The number of bases covered by reads aligned to the reference sequence.

Ion Torrent™ Server API

Ion Torrent™ Server API (Application Programming Interface) can be used to access database records
on a Ion Torrent™ Server. Ion Torrent™ Server APIs are compliant with REST (Representational State
Transfer) architectural constraints and can be used to retrieve all available information about sequencing
run results and plugin data, and create Planned Runs using third-party software solutions.

AQ score
An alignment quality (AQ) score defines read accuracy when compared to the reference sequence. The
discrepancy can be biological (real variant) or technical (sequencing error). For example, an AQ score of
17 represents 2% aligned read error rate, while an AQ score of 20 represents 1% aligned read error rate
when compared to the reference sequence.

average base coverage depth

The average number of reads of all targeted reference bases.

average base read depth

The average number of reads of all targeted reference bases that were read at least once.

392 Torrent Suite™ Software 5.18 User Guide

 Limited product warranty

BAM file
A BAM (binary alignment map) file (.bam) is the binary version of a SAM (sequence alignment map) file
(.sam). A SAM file is a tab-delimited text file that contains sequence alignment data. A BAM file contains
aligned reads sorted by reference location.

barcode
A barcode is a machine-readable code in the form of numbers and a pattern of parallel lines of varying
widths, printed on and identifying a product.
There are several applications for barcodes. Libraries can be molecularly barcoded with unique nucleic
acid sequence identifiers. Library barcodes are used during data analysis to sort the sequencing results
from sequencing reactions that contain combined libraries. Chips and sample tubes also contain unique
numeric barcodes that aid in the setup of the experimental analysis workflow.

base calling
Base calling is the process by which raw data from the sequencing instrument is converted to nucleo­
tide sequences. This is performed by base calling software that is usually run from the instrument itself.

basecalling input file

Signal processing input files are converted to a single condensed basecalling input file that represents
the processed signal. Basecalling input files are required files for basecalling.

bead loading
The percentage of chip wells that contain live ISPs. The percentage value considers only potentially
addressable wells. Bead loading is calculated as number of loaded ISPs divided by the number of
potentially addressable wells.

bp
Abbreviation for "base pair(s)".

cellularity (%)
The percentage of tumor cells in a given sample.

BED file
Browser Extensible Data file—BED file—defines chromosome positions or regions.

clonal ISP
An ISP is clonal if all of its DNA fragments are cloned from a single original template. All fragments on
such a bead are identical and respond in unison during a nucleotide flow across the chip.

CNV
Copy number variation (CNV) is the variation in copy number of any given gene between two samples.
CNV is a phenomenon in which sections of the genome are repeated and the number of repeats in the
genome varies between individuals in the human population.

Torrent Suite™ Software 5.18 User Guide 393

Limited product warranty

control sequence
Control nucleic acid sequences can be added to DNA or RNA samples to facilitate post-sequencing
data analysis. Two types of control sequences can be used during sample preparation. ERCC RNA
Spike‑In Mix is used with RNA samples to achieve a standard measure for data comparison across
gene expression experiments. Ion AmpliSeq™ Sample ID Panel, comprised of nine specially designed
primers, can be added prior to template amplification to generate a unique ID for each sample during
post-sequencing analysis.

CSV file
A comma-separated values (CSV) file is a delimited text file in which each line represents a data record
with information fields separated by a comma. A CSV file stores tabular data (numbers and text) in plain
text. Each line of the file is a data record.
CSV files are easily opened using spreadsheet software, such as Microsoft™ Excel™ or Apache®
OpenOffice™ Calc, where each comma-separated field is listed in a separate column.

custom template
A user-created Planned Run template. Custom templates can be created based on a preinstalled
Planned Run template and modified to fit specific needs.

DAT file
A DAT file is a generic data file. It contains data that may be opened or referenced by a specific
application. While some DAT files can be opened directly, most contain program data that is referenced
the program when it is running. Therefore, most DAT files are not meant to be opened manually.

de novo assembly
Nucleic acid sequence data that is assembled from sequencing reads without the aid of a reference
genome library sequence.

empty wells
Wells on a chip that do not contain an ISP.

enrichment (%)
Predicted number of live ISPs that have a key signal identical to the library key signal. The percent
enrichment value reported is the number of loaded ISPs that are library ISPs, after taking out the test
fragment ISPs.

FASTA file
A FASTA file is a text-based format for representing either nucleotide sequences or peptide sequences,
in which base pairs or amino acids are represented using single-letter codes. A sequence in FASTA
format begins with a single-line description, followed by lines of sequence data.

FASTQ file
A FASTQ file is a text-based format for storing both a biological sequence (usually nucleotide sequence)
and its corresponding quality scores. Both the sequence letter and quality score are each encoded with
a single ASCII character for brevity.

394 Torrent Suite™ Software 5.18 User Guide

 Limited product warranty

FD (flow disruptiveness)
A data filtering parameter that is used instead of INDEL, SNP, and MNP.

final library reads

Number (and percentage) of reads, passing all filters that are recorded in the unmapped BAM file. This
value may be different from the total number of reads located in the Library Summary Section due to
specifications associated with read trimming beyond a minimal requirement resulting in total number of
reads being slightly less than Final Library Reads.

flow
A flow is the event of exposing a chip to one particular dNTP ( deoxyribonucleotide triphosphate),
followed by a washing step.

flow order
The order in which a chip is exposed to each particular dNTP. The default Samba flow order consists
of a 32-base sequence, repeated. This flow order resists phase errors by providing opportunities for
out-of-phase molecules to catch up and is designed to sample all dimer (nucleotide pair) sequences
efficiently. Samba is the default flow order because it improves sequencing accuracy for longer reads
by resisting phase errors.

flow transfer
Progress of the sequencing run expressed as number of total flows completed. For example, a
sequencing run set to 500 flows shows 250/500 flows in the status column of the Runs in Progress
table when the sequencing run is half completed.

fusions
A target technique used for detection and annotation of gene fusions (or translocation of genetic
material) in samples.

hotspots file
A BED or a VCF file that defines regions in the gene that typically contain variants. Specifying a
hotspots file to use in a run enables the Torrent Variant Caller module to identify if a specific variant is
present or absent. A hotspots file instructs the Torrent Variant Caller module to include these positions
in its output files, including evidence for a variant and the filtering thresholds that disqualified a variant
candidate. A hotspots file does not affect other parts of the analysis pipeline.
If you don't specify a hotspots file, the software tells only the difference between your sequence and the
reference genome.

IA
Isothermal application (IA) is a template preparation technique that uses nonemulsion isothermal
reaction to clonally amplify DNA onto an ISP surface.

INDEL
INDEL is an abbreviation used to designate an insertion or deletion of bases in the genome of an
organism.

Torrent Suite™ Software 5.18 User Guide 395

Limited product warranty

intermediate files
Intermediate files contain information used for debugging runs.

ISPs
Ion Sphere™ Particles (ISPs) are particles that contain bound copies of a single (ideally) DNA fragment
amplified during template preparation.

key signal
Average 1-mer signal in the library key.

library ISPs
Live ISPs that have a key signal identical to the library key signal.

LIMS metadata
Laboratory Information Management System (LIMS) software is used for recording sequencing
metadata. Entered text is associated with the Planned Run and can be extracted using APIs for LIMS
consumption.

live ISP
An ISP with a signal of sufficient strength and composition to be associated with the library or test
fragment key.

low quality ISP

An ISP with a low or unrecognizable signal.

library key
A short known sequence of bases used to distinguish a library fragment from a test fragment (for
example, "TCAG").

mapped reads
Sequencing reads that have been mapped to the reference sequence.

mean raw accuracy

Average raw accuracy of 1-mers at a specific position in the read.

MNP
Multiple nucleotide polymorphism (MNP) is a genetic mutation in an allele that differs from the reference
allele of the same length by >1 nucleotide.

on target reads
Sequencing reads mapped to any target region of the reference. A read is considered to be on target if
at least one aligned base overlaps a target region. A read that overlaps a targeted region but where only
flanking sequence is aligned, for example, due to poor matching of 5′ bases of the read, is not counted.

396 Torrent Suite™ Software 5.18 User Guide

 Limited product warranty

output files
Output files consist of all BAM files, run reports, and plugin results.

preinstalled Planned Run template

A Planned Run template that comes preinstalled with Torrent Suite™ Software on the Ion Torrent™
Server. Preinstalled Planned Run templates are designed to help users create a Planned Run or
a customized Planned Run template for a specific research application. Preinstalled Planned Run
templates cannot be deleted from the server.

Planned Run
A Planned Run is a file that contains executable instructions for individual runs. The file contains all
the specifications, settings, and parameters for template preparation and chip loading on the Ion Chef™
Instrument, and sequencing on an Ion S5™/Ion S5™ XL or Ion GeneStudio™ S5 Series system.

Planned Run template

A reusable experimental design (digital protocol) for the sequencing instrument that holds specifications
for sample preparation, sequencing, data export, and post-sequencing data analysis.

polyclonal ISP
An ISP that carries clones from two or more library sequences.

primer dimer ISP

An ISP that carries an insert length of less than 8 base pairs.

proband
A person or a sample that is serving as a starting point for the genetic study. Denoting the proband aids
in establishing relationships within a group. In medical genetics, the proband is the first affected family
member who seeks medical attention for a genetic disorder.

Q score
Phred quality score (Q score) is used to measure the accuracy of the nucleotide sequence generated by
the sequencing instrument. The Q score represents the probability that a given base is called incorrectly
by the sequencer.

Q10
Predicted error rate of 10%.

Q17
Predicted error rate of 2%.

Q17 bases
The number of bases that have a Q Score of ≥17 in a given sequencing output.

Torrent Suite™ Software 5.18 User Guide 397

Limited product warranty

Q20
Predicted error rate of 1%.

Q20 bases
The number of bases that have a Q Score of ≥20 in a given sequencing output.

read length
The length of called reads measured in base pairs.

read
The sequence of a section of a unique fragment obtained after the end of the sequencing process.

reference library
A consensus nucleotide sequence that represents the genome of a particular species. The results from
a sequencing run are compared to the reference library to identify sequence variants.

relationship group
Defines related samples within a Sample Set. Related samples are designated by the same relationship
group number.

SAM file
A SAM (Sequence Alignment Map) file is a tab-delimited text file that contains sequence alignment
data. It stores biological sequences aligned to a reference sequence.

sample
Genetic material from one source (for example, DNA from one individual).

signal processing input files

Signal processing input files consist of the raw voltage measurement data collected during the
sequencing run. These files are required to reanalyze the run from signal processing.

SNP
Single nucleotide polymorphism (SNP) is a genetic mutation in an allele that differs from the reference
allele of the same length by one nucleotide.

structural variants
Genetic mutations that cause a change in the organism's chromosome structure, such as insertions,
deletions, copy number variations, duplications, inversions, and translocations.

system SNR
System signal-to-noise ratio.

398 Torrent Suite™ Software 5.18 User Guide

 Limited product warranty

target base coverage

Summary statistics for targeted base reads of the reference. A base covered by multiple target regions
is counted only once per sequencing read.

target regions file

A BED file that specifies all of the regions that a panel represents such as the amplified regions that are
used with target sequencing. The complete software analysis pipeline, including plugins, is restricted to
include only these specified regions instead of the entire reference library.

test fragment
A test fragment (TF) is a known nucleotide sequence that is used to monitor system characteristics.

test fragment ISPs

Live ISPs with a key signal that is identical to the test fragment key signal.

test fragment key

A test fragment key (TF key) is the nucleotide sequence that is used to identify test fragment reads.

TF key peak counts

Signal strength of the first three bases of the TF key.

total reads
Total number of filtered and trimmed reads independent of length reported in the output BAM file.

TSV file
A tab-separated values (TSV) file is a tab-delimited file that is used with spreadsheet software. TSV files
are essentially text files, and the raw data can be viewed by text editors, though they are often used
when moving raw data between spreadsheets. See also VCF file

uBAM file
An unmapped BAM (uBAM) file is a variant form of the BAM file format in which the read data does
not contain mapping information. This is basically an "off-label" use of the BAM format (which was
specifically designed to contain mapping information) that is used for data management reasons. It
allows you to attach metadata to the reads from as early on in the analysis process as possible.

unaligned reads
Nucleotide bases covered by reads that are not aligned to the reference.

uniformity of base coverage

The percentage of bases in all targeted regions (or whole genome) covered by at least 0.2X the average
base coverage depth.

usable sequence / usable reads

Usable reads consist of library ISPs that pass the polyclonal, low quality, and primer dimer filter.

Torrent Suite™ Software 5.18 User Guide 399

Limited product warranty

VCF file
A variant call format (VCF) file specifies a variant of interest and its location. This file stores the
differences between the BAM file and the reference file.

wells with ISPs

Number of wells that were determined to be positive for the presence of an ISP within the well. Wells
containing ISPs have a delayed pH change due to the presence of an ISP slowing the detection of the
pH change from the solution.

XLS file
Files that use the .xls extension. XLS files can be created by Microsoft™ Excel™ and other similar
spreadsheet programs.

400 Torrent Suite™ Software 5.18 User Guide

Torrent Suite 5.18 UG_MAN0026163-v3-GUID-6C965CA9-A0B8-4C93-ACB0-BB55F8A05AEA-2023/02/01
17:46:45 en
19:26:43.985Z
thermofisher.com/support | thermofisher.com/askaquestion
thermofisher.com

1 March 2023