Guidebook on Mouse and

Rat Colony Management

Kathleen R. Pritchett-Corning, DVM, DACLAM

Sonja T. Chou, VMD, MS, DACLAM

Laura A. Conour, DVM, DACLAM

Bruce J. Elder, PhD

Guidebook on Mouse and
Rat Colony Management
Contributors and affiliations:

Kathleen R. Pritchett-Corning, DVM, DACLAM

Director, Research and Professional Services
Research Models and Services
Charles River

Sonja T. Chou, VMD, MS, DACLAM

Executive Director, Veterinary Science
and Animal Welfare
WuXi AppTec (Suzhou) Co. Ltd.

Laura A. Conour, DVM, DACLAM

Director, Laboratory Animal Resources
and University Attending Veterinarian
Princeton University

Bruce J. Elder, PhD

Data Curation Scientist
Rancho Biosciences

Published by Charles River Laboratories, November 2015

 Table of contents
Table of
contents

96 Part 5
Laboratory rat and mouse nomenclature
2 Introduction 97 Outbreds
98 Inbreds
6 Part 1 98 Substrains
Origin, history and behavior 100 F1 and F2 hybrids
6 Origin and history 100 Gene nomenclature
8 Behavior 102 Transgenics
103 Targeted mutations
20 Part 2 104 Congenics
Biology and reproductive biology
20 Temperature regulation 110 Part 6
20 Urinary system Production and maintenance of colonies
21 Digestive system 110 Production planning
22 Musculoskeletal system 110 Breeding system and mating scheme
22 Special senses 113 Meeting production expectations
27 Reproductive biology 119 Breeder selection and replacement
33 Male anatomy 120 Recordkeeping and colony organization
34 Female anatomy 121 Animal identification
47 Mating 123 Cage level identification
47 Length of gestation 124 Laboratory records
47 Parturition
48 Parental behavior and rearing pups 132 Part 7
50 Reproductive lifespan and breeding unit Clinical assessment
replacement criteria
138 Part 8
60 Part 3 Troubleshooting colony performance
Genetics for colony management 138 Where to start
60 The start of modern genetics 142 Strain effects
64 Modes of inheritance 142 Genetics
67 Practical genetics for the mouse room 144 Phenotype
145 Other factors
76 Part 4 150 Solutions
Genetic modification technologies 152 Conclusion
76 Transgenesis
81 Targeted mutagenesis
86 Inducible mutagenesis
88 Targeted endonucleases
 Introduction

Introduction

The mouse’s reproductive biology is another factor in their

utility in research. Mice are polyestrous, litter-bearing animals,
It is estimated that mice and rats comprise more than 80% of with a short gestation period. Since they are polyestrous,
the animals used in research in the United States, with mice they will reproduce year-round and the fact that they are
far outnumbering rats. In countries where detailed statistics litter-bearing allows for the potential for littermate controls
are kept, such as the UK, in 2014, mice were involved in 76% within each litter and quickly engenders many animals
of all animal scientific procedures, and rats 7%.1 Why have for scientific study. The short gestation period means that
rodents come to dominate science? There are many reasons, multiple generations can be produced rapidly and followed
some of which are outlined below. for experimental purposes. Given ideal conditions, mice
can produce at least four generations in a year. Mice are
Mice are the model mammalian system for scientific enquiry. also quick to reach sexual maturity and able to reproduce
This follows from their initial use as the model mammalian at 4-8 weeks of age. Their fertility with subspecies such
genetics organism. Mice were the first mammals after humans as Mus musculus castaneus allows for genetic mapping
to have their genome sequenced.2 Sequencing followed and study of the influence of the surrounding genome on
over 80 years of empirical genetics research in mice, and at specific genes. A further explanation for the dominance of the
least 1,000 years of practical genetics research by mouse mouse in research is the robustness of their embryos. These
fanciers from ancient China to today. As mammals, mice have may be cryopreserved and cultured from one-cell to post-
more similarities to than differences from humans. There is implantation stages. Tools have been developed that allow
approximately 85% homology between mouse and human for sophisticated manipulations of the mouse’s genome, and
genes, which means that a particular gene is most likely this allows for the study of the functions of genes within the
present in both the mouse and human and will generally entire organism. Genes in mice have been removed, replaced,
have a similar function and protein product.2 This allows mice duplicated, and mutated.
to serve as models of many human conditions, and, more
importantly, allows us to study basic mammalian genetics and Sometimes, rats are the more appropriate model. Rats
other conserved systems in mammalian cells. share many of the same characteristics as mice, but have
the advantage of size, which makes them more suitable for
As research subjects, mice have other advantages as well. some studies. Although rats share many similarities with
Compared to other laboratory animals, mice require relatively mice, rats are not large mice and breeding rats can be its
little space. They are easy to physically manipulate, can own challenge. This volume will focus predominantly on mice,
be gentled to human handling, and do not have complex since they comprise by far the largest number of animals bred
dietary needs. Again, compared to other laboratory for research, but rats will be addressed as well. The culture of
animals, they are relatively inexpensive, although individual rat embryonic stem cells and other newly-developed genetic
genetically manipulated mice can be costly. As small manipulation technologies allowing for manipulation of the rat
mammals, they have a limited lifespan, which makes aging genome may increase the popularity of rats in research.3,4,5
and multigenerational studies easier. Mice can be inbred,
something many species do not tolerate well. Many mice that Combined, the authors have nearly 100 years experience
we work with today are as alike as possible without being working with both wild and laboratory rats and mice in
clones, which can be useful in studies where variation is not laboratories, pharmaceutical companies, commercial rodent
desired. production, academia, and field studies. We hope that you
will find this volume useful in managing your colonies.

2 3
 Notes

Introduction References

1. Home Office. Annual Statistics of Scientific Procedures on Living

Animals: Great Britain 2014. (The Stationery Office, 2014).
2. Waterston, R. H. et al. Initial sequencing and comparative analysis of
the mouse genome. Nature 420, 520-562 (2002).
3. Buehr, M. et al. Capture of authentic embryonic stem cells from rat
blastocysts. Cell 135, 1287-1298 (2008).
4. Geurts, A. M. et al. Knockout rats via embryo microinjection of zinc-
finger nucleases. Science 325, 433 (2009).
5. Voigt, B. & Serikawa, T. Pluripotent stem cells and other technologies
will eventually open the door for straightforward gene targeting in the rat. Dis
Model Mech 2, 341-343 (2009).

4 5
 Origin, history,
PART 1 Origin, history,
and behavior

and behavior

perpetuated by other, later mouse fanciers.5 These included

waltzing mice, spotted mice, chocolate mice, non-agouti
Origin and history mice, and yellow mice. These variations caught the eye of
Laboratory mice and rats are domesticated animals, as a scientists in the late 19th century who wanted to study the new
comparison with wild-caught mice or rats will quickly show. science of genetics and the possible heritability of cancer.
Laboratory mice and rats are fatter, slower, less aggressive,
and more amenable to handling than their wild-caught The source of many of the mouse strains currently in use,
counterparts. As an organism that lives commensally with including the most popular mouse, the C57BL/6, is the mouse
humans, there have been many opportunities through time for colony established by Miss Abigail Lathrop in Granby, Mass.6
people to establish relationships, good or otherwise, with the Miss Lathrop was a retired schoolteacher, an enthusiastic
small beings living in their homes and fields. Mice originated mouse fancier, and a scientist in her own right.7 She imported
in the Indian subcontinent and spread throughout the world mice from Europe to breed with her mice, as well as mating
with agriculture and human movement.1 The original habitat of them to wild-caught mice from Vermont and Michigan. She
the Norway rat is the steppes of northern China and Mongolia, supplied mice and collaborated with Dr. C. C. Little, the
and, like mice, rats have spread throughout the world with founder of the Jackson Laboratory, as well as with Dr. William
human migration2 (Figure 1). Castle, another pioneer in mouse genetics. Miss Lathrop’s
colony was not the sole contributor to modern laboratory
strains, however. Others included Dr. Clara Lynch, who
imported Swiss mice, and Halsey Bagg, who inbred the Bagg
albino (later to become the BALB/c) from mice acquired from
a mouse dealer in Ohio.

Wild Norway rats were captured en masse for the blood sport
of rat baiting, popular in England, France and the United
States in the 18th and 19th centuries. In rat baiting, a terrier is
put in a pit with wild rats and the number of rats the terrier
kills in a certain time is recorded. After being trapped, rats
were held in “pounds” in anticipation of the next contest.
Albinos were removed from those pounds and held for
show or breeding purposes. It is a reasonable assumption
in the domestication of laboratory rats that the show rats
Figure 1. The spread of mice throughout the world from their origin in Asia. were sold to people who realized that the rat’s intelligence,
Figure after Silver, 1995.1
tractability and easy keeping would make it a suitable subject
In ancient Asia Minor and Greece, albino mice were sacred for research.8 It is generally accepted that the rat was the
to Apollo Smintheus, who was the Greek god of many things, first species domesticated primarily for research purposes.9
including mice and, by extension, plague. Mice bred and lived Rats were first used for experiments in the United States in
freely in his temple and were used for divination purposes.3,4 the 1890s, at the University of Chicago, and it is likely those
Japanese and Chinese mouse fanciers, who were keeping animals were introduced by a newly-arrived faculty member,
mice from at least 1100 BCE, and perhaps earlier, are Dr. Adolf Meyer.9
responsible for many of the coat color and behavior variations
6 7
 Origin, history,
and behavior

While the history of the laboratory mouse is entwined with the hierarchies among both males and females. These stable
Jackson Laboratory, that of the laboratory rat is linked to the units are called demes and are usually comprised of related
Wistar Institute. The Wistar Institute is where the laboratory rat females and males unrelated to these females. Demes
rose to prominence as a research system, and where many occupy territories that both males and females scent mark
developments were made in housing, husbandry and health. and defend from interlopers. Gene flow does occur across
Wistar origin rats include the WI, BN, LEW, SHR, and BDIX, demes, however.15 Mice and rats choose mates based on
among others.9 Wistar Institute scientists gave scientists the scent and behavior, and mice, given mate choice, have more
foundation for the use of the rat in many aspects of research, reproductive success with mates they have chosen.16,17
including endocrinology, nutrition and behavior. Dr. William
Castle of Harvard and the University of California, Berkeley, a Fighting, especially among males, is a normal part of
pioneer in mouse genetic research, also played a large role in establishing a dominance hierarchy. Although juvenile mice do
the foundation of genetic research in rats. not seem to exhibit much play behavior, juvenile rats can be
observed mock-fighting and wrestling as part of their normal
Behavior play. Aggressive interactions between adults, however, usually
When evaluating the normal behavior and biology of cease before injury occurs. When aggression is escalated,
laboratory mice and rats, serious consideration must be meaning one animal does not acknowledge the dominance
given to the fact that domesticated animals retain behaviors of another, wounding and death may occur. Environmental
seen in their wild ancestors. It must also be noted that the modifications such as shelters and running wheels can
descriptions of behavior provided below are meant as general affect the intracage hierarchy and their use requires careful
guidelines. Behavior can be modified by environment, and evaluation, especially when working with highly aggressive
strain differences in behavior are widely documented in the male mice.18,19,20,21,22 Even nesting material, thought generally
literature. to promote affiliative behavior in mice, has been shown to
promote aggression in some strains.23
As small, nocturnal prey species, both mice and rats find
open spaces aversive, since crossing these open spaces Grooming is a normal part of mouse and rat behavior,
leaves them vulnerable to predators. They are thigmotactic and large portions of time are allotted to both auto- and
species, meaning that they generally want to be in contact allogrooming.24,25 When grooming behavior goes awry,
with surfaces, especially vertical ones.10,11 This predilection is however, fur barbering, whisker pulling, or ulcerative dermatitis
exploited by pest control companies, who place bait stations may result (Figure 2). Fur barbering and whisker pulling may
and traps along “runways” used by rodents and at entrances be seen in all strains and stocks of mice and rats, but is
to burrows, both of which are usually located along walls. It most frequently noted in C57BL/6-derived animals, perhaps
is also exploited by certain types of behavioral testing, which because they are the most prevalent background used in
measure time to cross open spaces, or whether animals research.26,27 Barbering may be an abnormal compulsive
will leave dark, enclosed spaces and enter open spaces. behavior initiated by stress (the most likely explanation),
In open cages, mice and rats prefer to use the periphery.12 part of dominance-related behavior (unlikely), or part of
Both species naturally burrow into the earth, and at least one maternal behavior.27,28,29 As vibrissae (whiskers) serve as active
behavioral test, the visible burrow system, is based on this.13,14 tactile sensory organs, animals with barbered whiskers may
exhibit abnormal neurobehavioral phenotypes.30 Barbering
Mice and rats are social animals that form stable breeding behavior may be ameliorated by dietary supplementation or
group units through the establishment of dominance environmental enrichment.31,32

8 9
 Origin, history,
and behavior

Figure 2. A) A normal complement of vibrissae in a mouse Figure 2. C) A severely barbered mouse. Due to the distribution of the hair
loss, this mouse was probably barbered by its mother.

Nest-building is an innate affiliative behavior expressed

by both male and female mice. Nests allow mice to live at
temperatures that would otherwise prove rapidly fatal, such
as in meat lockers. Rats will also build nests, especially dams
near term, but nest-building seems to be a learned behavior
in rats.33 Nest-building ability in mice is linked both to ambient
temperature and genetic components.34 Nests can be
anything from a shallow cup to an elaborate, domed structure
with multiple entrances (Figure 3). In the wild, the outer
structure of nests is made of coarse, long-fiber materials,
while the inner structure is lined with a softer material. If mice
are given more naturalistic nesting materials (something that
contains long fibers, such as hay) they will construct a more
naturalistic nest.32,35 Rats may also benefit from the provision
Figure 2. B) An animal whose cagemates have pulled its whiskers out or of nesting material, especially if they are given an opportunity
gnawed them off. This animal may have behavioral and neural changes to learn how to use it.36
due to the change in sensory input.
Stereotypic behavior is repetitive, pointless behavior exhibited
by animals, often in response to stress. Stereotypic behavior
is seen relatively often in laboratory mice with unenriched
environments, but its prevalence varies by strain. Since mice
and rats show greater activity levels at night (i.e., dark phase

10 11
 Origin, history,
and behavior

Table 1. Normal behaviors and their problematic expression

in captivity
Normal or wild behaviors Problematic presentation
of these behaviors seen
in captivity
Grooming Barbering, whisker pulling,
and ulcerative dermatitis
Aggression Escalated aggression
resulting in severe
wounding or death
Nest-building Huddling in corners
Burrowing Digging at the cage side
Exploring, foraging and Bar mouthing and corner
patrolling territory jumping, stereotypical
Figure 3. A) A complex mouse nest, built with 8g of long-fiber nesting movements in the
material (Enviro-dri®, Shepherd Specialty Papers) by a pair of breeding
cage such as flipping,
females and a male. The nesting material was provided to the cage 6 days
prior to the photo. circling, or tail carrying
Eating and gnawing Food grinding

of the light cycle), their behavior should occasionally be

observed during the dark cycle. If some animals are showing
stereotypic behaviors during the day, when they should be
asleep, many more animals may be showing stereotypies at
night, when they are normally active. Although environmental
enrichment may work to mitigate or prevent some types
of aberrant behavior, it may not always be successful.37
Stereotypic behaviors described in laboratory mice include
barbering, food grinding, running on wheels, and patterned
movements such as twirling, flipping, corner jumping,
bar mouthing, and digging (Table 1). Fewer spontaneous
stereotypical behaviors are described in rats; these behaviors
in rats are generally induced by administration of drugs. Rats
Figure 3. B) A nest built from aspen shavings by a single mouse in transit may be less prone to exhibit spontaneous sterotypies, or rat
for approximately 24 hours spontaneous sterotypies may be more subtle.

Pheromones, animal genotype, and housing environment can

greatly affect animal behavior.38,39 Stereotypic behavior and
other problem behaviors that may occur in barren cages, or
when animals are singly housed, can affect not only breeding

12 13
 Part 1 References

performance but also research results. The best cure for

“bad behavior” is prevention, which is usually accomplished
by environmental enrichment. Some suggestions are found 1. Silver, L. M. Mouse Genetics: Concepts and Applications. 1st edn, 3-31
in Table 2. Mice and rats have different drives and needs for (Oxford University Press, 1995).
enrichment, and this should be considered when planning an 2. Hedrich, H. J. in The Laboratory Rat (ed Georg J. Krinke) 3-16
(Academic Press, 2000).
enrichment program.40,41,42,43 In some situations, interaction
3. Keeler, C. E. The Laboratory Mouse: Its Origin, Heredity, and Culture.
with humans can be considered environmental enrichment 7-18 (Harvard University Press, 1931).
and some rats appear to enjoy such contact.44 Mice, in
4. Lang, A. Custom and Myth. (Longmans, Green, and Co., 1893).
contrast, do not seem to seek out social interactions with
5. Keeler, C. E. & Fuji, S. The antiquity of mouse variations in the Orient.
humans to the same extent as rats, but can be conditioned Journal of Heredity 28, 93-96 (1937).
to tolerate handling.45 The behavior of both species toward 6. Festing, M. F. W. & Lovell, D. P. in Symposium of the Zoological Society
humans benefits from gentle, repeated handling. of London, No. 47: Biology of the house mouse (ed R. J. Berry) 43-62
(Academic Press, 1981).
Table 2. Enrichment suggestions ranked in order that animals 7. Lathrop, A. E. & Loeb, L. Further investigations on the origin of tumors
in mice: I. Tumor incidence and tumor age in various strains of mice. J Exp
seem to prefer Med 22, 646-673 (1915).
Mice Rats 8. Richter, C. P. The effects of domestication and selection on the behavior
Conspecific Conspecific of the Norway rat. Journal of the National Cancer Institute 15, 727-738 (1954).
Nesting material Complex space 9. Lindsey, J. R. & Baker, H. J. in The Laboratory Rat (eds Mark A. Suckow,
Complex space Shelters Steven H. Weisbroth, & C. L. Franklin) 1-52 (Academic Press, 2006).
Shelters Gnawing items 10. Calhoun, J. B. The Ecology and Sociology of the Norway Rat. (US
Running wheels* Nesting material** Public Health Service, 1963).

Human interaction Human interaction 11. Crowcroft, P. Mice All Over. (Chicago Zoological Society, 1966).
* Running wheels may promote stereotypic behavior in some strains. 12. Gray, S. J., Jensen, S. P. & Hurst, J. L. Structural complexity of
** Rats will make greater use of nesting material if exposed early in life. territories: preference, use of space and defence in commensal house mice,
Mus domesticus. Anim Behav 60, 765-772 (2000).
13. Arakawa, H., Blanchard, D. C. & Blanchard, R. J. Colony formation of
C57BL/6J mice in visible burrow system: identification of eusocial behaviors
in a background strain for genetic animal models of autism. Behav Brain Res
176, 27-39 (2007).
14. Blanchard, R. J. & Blanchard, D. C. Antipredator defensive behaviors in
a visible burrow system. J Comp Psychol 103, 70-82 (1989).
15. Baker, A. E. M. Gene flow in house mice: Behavior in a population
cage. Behavioral Ecology and Sociobiology 8, 83-90 (1981).
16. Drickamer, L. C., Gowaty, P. A. & Wagner, D. M. Free mutual mate
preferences in house mice affect reproductive success and offspring
performance. Animal Behaviour 65, 105-114 (2003).
17. Yamazaki, K. & Beauchamp, G. K. Genetic basis for MHC-dependent
mate choice. Adv Genet 59, 129-145 (2007).
18. Haemisch, A. & Gartner, K. The cage design affects intermale
aggression in small groups of male laboratory mice: strain specific
consequences on social organization, and endocrine activations in two inbred
strains (DBA/2J and CBA/J). Journal of Experimental Animal Science 36, 101-
116 (1994).

14 15
 Part 1 References

19. Nevison, C. M., Hurst, J. L. & Barnard, C. J. Strain-specific effects of 36. Vitalo, A. et al. Nest making and oxytocin comparably promote wound
cage enrichment in male laboratory mice (Mus musculus). Animal Welfare 8, healing in isolation reared rats. PLoS One 4, e5523 DOI 5510.1371/ journal.
361-379 (1999). pone.0005523 (2009).
20. Van Loo, P. L. et al. Influence of cage enrichment on aggressive 37. Tilly, S. C., Dallaire, J. & Mason, G. J. Middle-aged mice with
behaviour and physiological parameters in male mice. Applied Animal enrichment-resistant stereotypic behaviour show reduced motivation for
Behaviour Science 76, 65-81 (2002). enrichment. Animal Behaviour 80, 363-373 (2010).
21. Van Loo, P. L., Van Zutphen, L. F. & Baumans, V. Male management: 38. Lathe, R. The individuality of mice. Genes, brain, and behavior 3, 317-
Coping with aggression problems in male laboratory mice. Lab Anim 37, 300- 327 (2004).
313 (2003). 39. Oliva, A. M. et al. Toward a mouse neuroethology in the laboratory
22. Howerton, C. L., Garner, J. P. & Mench, J. A. Effects of a running environment. PLoS One 5, e11359 DOI 11310.11371/journal. pone.0011359
wheel-igloo enrichment on aggression, hierarchy linearity, and stereotypy in (2010).
group-housed male CD-1 (ICR) mice. Applied Animal Behaviour Science 115, 40. Hutchinson, E., Avery, A. & Vandewoude, S. Environmental enrichment
90-103 (2008). for laboratory rodents. ILAR J 46, 148-161 (2005).
23. Kaliste, E. K., Mering, S. M. & Huuskonen, H. K. Environmental 41. Simpson, J. & Kelly, J. P. The impact of environmental enrichment in
modification and agonistic behavior in NIH/S male mice: nesting material laboratory rats--behavioural and neurochemical aspects. Behav Brain Res
enhances fighting but shelters prevent it. Comp Med 56, 202-208 (2006). 222, 246-264 (2011).
24. Berridge, K. C., Fentress, J. C. & Parr, H. Natural syntax rules control 42. Gonder, J. C. & Laber, K. A renewed look at laboratory rodent housing
action sequence of rats. Behav Brain Res 23, 59-68 (1987). and management. ILAR J 48, 29-36 (2007).
25. Fentress, J. C. Expressive contexts, fine structure, and central 43. Latham, N. & Mason, G. From house mouse to mouse house: the
mediation of rodent grooming. Ann N Y Acad Sci 525, 18-26 (1988). behavioural biology of free-living Mus musculus and its implications in the
26. Garner, J. P., Weisker, S. M., Dufour, B. & Mench, J. A. Barbering laboratory. Applied Animal Behaviour Science 86, 261-289 (2004).
(fur and whisker trimming) by laboratory mice as a model of human 44. Panksepp, J. Neuroevolutionary sources of laughter and social joy:
trichotillomania and obsessive-compulsive spectrum disorders. Comp Med modeling primal human laughter in laboratory rats. Behav Brain Res 182, 231-
54, 216-224 (2004). 244 (2007).
27. Garner, J. P., Dufour, B., Gregg, L. E., Weisker, S. M. & Mench, J. 45. Hurst, J. L. & West, R. S. Taming anxiety in laboratory mice. Nat
A. Social and husbandry factors affecting the prevalence and severity of Methods 7, 825-826 (2010).
barbering (‘whisker trimming’) by laboratory mice. Applied Animal Behaviour
Science 89, 263-282 (2004).
28. Nicholson, A. et al. The response of C57BL/6J and BALB/cJ mice to
increased housing density. J Am Assoc Lab Anim Sci 48, 740-753 (2009).
29. Kalueff, A. V., Minasyan, A., Keisala, T., Shah, Z. H. & Tuohimaa, P.
Hair barbering in mice: implications for neurobehavioural research. Behav
Processes 71, 8-15 (2006).
30. Durham, D. & Woolsey, T. A. Acute whisker removal reduces neuronal
activity in barrels of mouse SmL cortex. J Comp Neurol 178, 629-644 (1978).
31. Bechard, A., Meagher, R. & Mason, G. Environmental enrichment
reduces the likelihood of alopecia in adult C57BL/6J mice. J Am Assoc Lab
Anim Sci 50, 171-174 (2011).
32. Dufour, B. D. et al. Nutritional up-regulation of serotonin paradoxically
induces compulsive behavior. Nutr Neurosci 13, 256-264 (2010).
33. Van Loo, P. L. & Baumans, V. The importance of learning young: the
use of nesting material in laboratory rats. Lab Anim 38, 17-24 (2004).
34. Gaskill, B. N., Rohr, S. A., Pajor, E. A., Lucas, J. R. & Garner, J. P. Some
like it hot: Mouse temperature preferences in laboratory housing Applied
Animal Behaviour Science 116, 279-285 (2009).
35. Hess, S. E. et al. Home improvement: C57BL/6J mice given more
naturalistic nesting materials build better nests. J Am Assoc Lab Anim Sci 47,
25-31 (2008).
16 17
 Notes

18 19
 Biology and
PART 2 Biology and
reproductive biology

reproductive biology

(Mus m 1 in mice and Rat n 1 in rats).5 Mouse and rat urine

also fluoresces in ultraviolet light, which may be used by the
As noted earlier, mice and rats are mammals, and as such animals for navigation and by predators to spot rodent trails.
share many traits in common with other mammalian species.
Below we will discuss where mice and rats diverge from other Digestive system
mammals, and special characteristics that differ between the Both rats and mice are monophydont hypsodonts, meaning
two species. that they have one set of open-rooted teeth. Their dental
formula is identical: (1/1 0/0 0/0 3/3), with two upper incisors,
Temperature regulation two lower incisors, and three pairs of upper and lower molars.
Both mice and rats, but especially mice, have a relatively The enamel of rodent incisors incorporates iron, making
large surface area per gram of body weight. This makes them it very durable and giving it an orange-yellow cast. Mouse
more sensitive to cold than larger animals. For mice, their and rat teeth grow continuously, due to their open roots,
typical response to cold is non-shivering thermogenesis using and although much of the tooth wear occurs at the occlusal
brown fat, or behavioral modification, such as burrowing or surfaces, gnawing by animals also serves to wear teeth.
nest-building. When not given the means to adapt to cold Enamel is present on the labial surfaces of the teeth, while
conditions, mice will show stress at temperatures below the lingual surfaces are primarily dentin. Mouse incisors grow
18 °C. Note that mice and rats are typically housed in ambient at a rate of approximately 2 mm/week for upper incisors and
temperatures between 20-24 oC, which are comfortable for 2.8 mm/week for lower incisors.6 Rat tooth growth rates are
people working in animal rooms. A wide estimation of the quite similar: 2.2 mm/week for maxillary and 3.0 mm/week for
mouse’s thermoneutral zone is 26-34 °C based on published mandibular incisors.7 The incisors erupt at postnatal day 9-12
literature addressing many mouse strains and with a wide in both species.
variety of methodologies.1 The lower end of this thermoneutral
zone for any particular mouse is probably closer to 30 oC,2 Although rodents in general are often classified as a group
which means that mice are chronically cold-stressed in as herbivorous animals, rats and mice are omnivores. For
typical laboratory housing. One relatively recent study example, wild mice and rats will supplement a diet of grains
suggests a similar situation for rats, with their chosen housing and seeds with human rubbish, fruit, insects, amphibians,
temperature being 25-27 °C when housed on a thermocline of birds, eggs, carrion and other mice or rats. This may mean
15-40 °C.3 Neither rats nor mice pant, nor do they sweat. Their that they have nutritional requirements that are not being
only recourse when temperatures become too hot are again, adequately met by commercial rodent diets. Cannibalism
behavioral adaptations, such as burrowing or wetting their fur does occur and is a normal response to dead pups in the nest
with saliva for evaporative cooling. or normal investigative behavior when confronted with a dead
cagemate. Both mice and rats have the large cecum typically
Urinary system present in hindgut fermenters that allows them to digest
Although they can conserve water through urine cellulose. Mice have gallbladders; rats do not. Both species
concentration, mice and rats produce a large amount of dilute are coprophagic, and this behavior is seen especially when
urine when compared to true desert dwellers such as gerbils. young animals begin to eat solid food. This may help the
Mice and rats normally excrete protein in their urine. These young establish necessary gut flora.8
proteins are lipocalin proteins that transport pheromones as
well as acting as pheromones in their own right,4 and are the
primary allergens produced by mice and rats
20 21
 Biology and
reproductive biology

Muskuloskeletal system
A typical vertebral formula for a mouse or rat is: C7 T13 L6 S4
C28. Strain variations occur, especially in the thoracic, lumbar,
and caudal regions.

Special senses
To better understand the behavior of mice and rats, it helps
to understand how they experience the world. Their senses
differ from those of humans in sensitivity and primary sensory
modality. Although quite different from the human experience,
understanding how mice and rats process their interactions
with us through their senses provides valuable input as to how
we can adapt environments to suit them (Figure 1).
Figure 1. B) If the sensory input into a mouse’s cortex is drawn as a figure,
with the size of the body part represented by the size of the cortex devoted
to that body part, this is how the mouse would appear. The dominant
sensory modalities for a mouse are very different than those of a human.
(Drawing after an illustration by Steve Moskowitz, Advanced Medical
Graphics.)

Vision: As nocturnal prey species, rats and mice have vision

adapted to see in dim light and they are more sensitive to
motion than to form, meaning they have poor visual acuity but
a great depth of field. Rats and mice are two to three times
more sensitive to motion than humans.10 Rods, the retinal cells
that distinguish light from dark, predominate in both species,
comprising ~99% of the cells in the retina, compared with
~95% in humans. Both species are dichromats, meaning they
have two types of cones (color vision cells) in their retinas. In
comparison, humans have three types of cones. This gives
mice and rats different color vision than humans and vision
sensitivities at different parts of the spectrum. For example,
Figure 1. A) An illustration of the mouse’s sensory cortex. This figure
shows the flattened left hemisphere of a GAP-43 wildtype mouse cortex they see wavelengths we cannot in the ultraviolet, but are
immunostained with serotonin transporter. The layer IV thalamocortical significantly less sensitive to light greater than 600 nm, which
afferents show a complete body map: V: visual, A: auditory, a-e: large is red light to humans. Their vision is most sensitive at ~505
whiskers, arranged in 5 rows on the snout, SW: small whiskers, LL: lower nm (between blue and green)(Figure 2). When compared to
lip, FL: forelimb, HL: hindlimb, T: trunk. Note the huge component of the
sensory cortex devoted to the whiskers. Photo used courtesy of Dr. S. humans, rats and mice have what we would consider very
Donovan and Dr. J. McCasland.9 poor eyesight.11,12,13 Thus, many of the cues used in behavioral
tests may be neither visible nor interpretable by animals.
Albino rats and most sighted mice have a visual acuity of 0.5
cycle/degrees (c/d) and pigmented rats ~1 cycle/degree.

22 23
 Biology and
reproductive biology

degeneration, meaning animals lose their rod cells by 35

days of age. Blind strains include C3H/HeJ, CBA, FVB, SJL,
P and PL, and blind stocks include Black Swiss, some ICR,
Swiss Webster and NIH.15,16 A review of the literature does
not reveal any retinal degeneration alleles fixed in a wide
variety of laboratory rat populations, although RCS rats are
known to carry a mutation for retinal dystrophy.17 Albino
animals may also be susceptible to blindness from light
levels in animal rooms. Their lack of pigmentation, as well as
reduced numbers of rod receptors associated with the albino
mutation, leaves them uniquely vulnerable to inadvertent light
damage.17,19

Hearing: Many rodents have peak auditory sensitivities in the

range of 15-30 kHz , which is much higher than the human
ear’s peak sensitivity at 2-4 kHz. Ultrasonic frequencies, as
defined by human hearing, begin at greater than 20 kHz. A
mouse’s hearing range is from ~1 kHz to 90 kHz, with peak
sensitivity at 10-22 kHz, while rats can hear from 0.5 to 64
kHz, with peak sensitivity between 6-42 kHz20 (Figure 3). Mice
and rats communicate in ultrasonic frequencies. Pups call
to dams,21 rats laugh22 and male mice sing mating songs to

Figure 2. An approximate representation of how human sensitivity to light

differs from that of mice. The solid lines illustrate the light sensitivity of rod
cells and the dashed lines represent cone cells. Note that mice only have
two types of cones and that their rods are sensitive over a longer portion
of the spectrum than humans. This also illustrates the ability of mice to see
into the ultraviolet.

To convert that to typical measures of human vision, they are

extremely nearsighted. Human 20/20 vision under standard
testing conditions converts to 30 c/d. Using that conversion
factor, mice and albino rats have 20/1200 vision and
pigmented rats have 20/600 vision.

For mice to have poor vision, they must have sight at all. Figure 3. A comparison of mouse, rat, and human hearing ranges. The thin
Many retinal degeneration alleles are fixed in laboratory lines indicate total hearing range (usually considered to be frequencies
mouse populations.14 The most widespread is the allele that can be heard at 60dB) and the thick lines show the peak sensitivities,
formerly known as retinal degeneration (rd or rd1; now which are those frequencies audible at 10dB. Figure after Heffner and
Heffner, 2007.20
called Pde6brd1). This gene causes an early-onset retinal
24 25
 Biology and
reproductive biology

females.23,24 This ultrasonic sensitivity means that mice and behavior. Whisking is an active activity29 and animals can
rats can be disturbed by noises beyond human hearing, discriminate between subtle tactile differences with their
and conversely, noises we find irritating, they may not hear vibrissae.30,31 Rodent vibrissae are probably best considered
at all. Potential noise disturbances in the ultrasonic include as equivalent to human fingertips in terms of their sensitivity
cage washers, oscilloscopes, computers, video display and cortical input.
terminals, running water taps, and nearby construction.
Some mouse strains, including A/J, DBA/2J, and NOD/ShiLtJ, Reproductive biology
carry a recessive mutation that causes age-related hearing Mice and rats are litter-bearing mammals. They are
loss that may occur as early as 2 months of age.25 Since spontaneous ovulators, have short gestation periods, and may
high-frequency hearing is lost first, these strains may be at reproduce year round. The overall reproductive performance
a disadvantage when it comes to communication with other of mice and rats varies widely, with some stocks and strains
mice. reproducing poorly due to problems with one or both sexes,
and others fertile for their entire lifespan. Most stocks and
Smell: Rodents have a keen sense of smell. Their olfactory strains are somewhere in between, with some background
cortex makes up a large proportion of their sensory cortex level of infertility in both males and females, and most
and is contained in two bulbs at the rostral end of the brain. animals reaching reproductive senescence before the end of
Olfactory cues are important components of social, sexual, their lifespan. It is important to remember that reproductive
and parental behaviors. Urinary, fecal, salivary, preputial performance is highly dependent on genetic background, with
gland, and plantar gland odors communicate relatedness, outbred animals generally being more fecund than inbred.
health, and dominance, as well as recent fright. Pheromones Detailed information on the reproductive biology of mice
are detected by the vomeronasal organ, part of the accessory and rats may be found in Pritchett and Taft,32 Lohmiller and
olfactory system. This system does not feed through the Swing,33 Hardy,34 Maeda et al.,35 and Zimmerman et al.36
olfactory bulbs to the olfactory cortex, but rather connects
via the accessory olfactory bulbs to the amygdala, the Basic reproductive hormonal function follows a typical
stria nucleus, and the hypothalamus. For laboratory mice, mammalian pattern, with multiple hormones produced by
scent marking of cages is probably an important part of the the brain and the reproductive tissues, all of which interact in
behavioral repertoire after cage change, although laboratory complex ways (Figures 4 and 5). The hypothalamus releases
rats do not seem to be disturbed by cage changing.26 In mice, gonadotropin-releasing hormone (GnRH) that acts on the
the transfer of nesting material with its affiliative pheromones anterior pituitary. The anterior pituitary then releases follicle-
at cage change has been shown to decrease fighting when stimulating hormone (FSH) and lutenizing hormone (LH).
animals are placed in clean cages.27 These two hormones act on the gonadal tissues that in turn
produce testosterone, estrogen, and progesterone. These
Touch: Besides the usual mechanoreceptors present in feed back to the hypothalamus. In the female, FSH released
haired skin,28 mice and rats have specially adapted hairs, by the pituitary stimulates the development of ova in the
called whiskers or vibrissae. Located primarily on the ovaries. The ovary produces estrogen in response to FSH,
rostrum, vibrissae may also be found on the head, in the and this results in estrous changes in the animal. Estrogen
cervical region, and on the feet. The part of the sensory is responsible for the LH surge that then results in the
cortex associated with inputs from whiskers is enormous in maturation and release of ova. After ova are released, corpora
comparison to other sensory afferents. Interacting with the lutea (CL) form. CL produce progesterone, which maintains
environment via their whiskers is integral to mouse and rat pregnancy. Mice and rats are spontaneous ovulators but a
26 27
 Biology and
reproductive biology

copulatory stimulus is necessary to support the CL regardless

of fertilization status. Without this copulatory stimulus, the CL
will degenerate. With it, the animal will sustain a pregnancy or
remain pseudopregnant for 10-13 days.

In males, GnRH is released by the hypothalamus, and

the pituitary also releases FSH and LH. Both hormones
are required for the initiation of spermatogenesis, but not
necessarily for the continuation of spermatogenesis once it
is initiated. FSH and LH act to establish a full complement
of cells (Sertoli, Leydig, and spermatogonia) that are
necessary to the proper functioning of a mature testis. Both
testosterone and FSH are necessary for further development
of spermatogonia into spermatids.37

Figure 4. Hormonal control of female reproductive function. Lines indicate Chromosomal sex is determined in the embryo at conception,
hormonal loops between the structures, with solid lines indicating positive
feedback loops and dashed lines indicating negative feedback loops.
but gonadal sex is apparent at mid-gestation in the mouse
Figure after Dr. R. Taft. and rat. Gonadal sex is determined by the presence or
absence of certain genes, and the default phenotypic
presentation is female, regardless of chromosomal
composition. Animals can be sexed at birth, if a particular litter
composition is desired or animals of one sex are experimental
subjects (Figure 6). Before the descent of the testes, sex is
most easily determined based on the distance between the
genital papilla and the anal opening (anogenital distance). As
the hair coat erupts at approximately day 5, it becomes easier
to see the nipples in females. Anogenital distance in males
is about two times that of females. Factors that can affect
anogenital distance include position of the pups in utero and
exposure to endocrine-disrupting chemicals.38,39 Males with an
in utero position between two females have a more feminine
anogenital distance than those between two males, while
females between two males in utero are masculinized.40

Figure 5. Hormonal control of male reproductive function. Lines indicate

hormonal loops between the structures, with solid lines indicating positive
feedback loops and dashed lines indicating negative feedback loops.
Figure after Dr. R. Taft.

28 29
 Biology and
reproductive biology

Figure 6. Photographs of mice and rats at various ages, illustrating the

differences between the sexes. In every photograph, males are on the left.

Figure 6. C) Weanling mice

Figure 6. A) Newborn mice

Figure 6. D) Weanling rats

Figure 6. B) Newborn rats

30 31
 Biology and
reproductive biology

Male anatomy
Mice and rats have practically identical male anatomy (Figure
7). Male animals have paired testes and their associated
structures, the epididymides and vasa deferentia, a single
penis, paired seminal vesicles (or vesicular glands) with
coagulating glands tightly adherent to them, a dorsoventral
prostate, bulbourethral glands, and preputial glands, located
subcutaneously in the ventral abdomen. Male mice and
rats have open inguinal rings, so if castration is necessary,
the rings must be closed. Neither male mice nor rats have
nipples, due to androgen-mediated destruction of the
mammary bud at E14.41

Figure 6. E) Adult mice

Figure 6. F) Adult rats

Figure 7. Male mouse reproductive anatomy. Figure from Pritchett and Taft,
2007,32 used with permission.

32 33
 Biology and
reproductive biology

A normal mouse or rat has continuous germ cell differentiation

in the seminiferous tubules of the testes. There are four
stages of sperm development with a maximum interval
of approximately 35 days for the differentiation process.
Spermatogonia (diploid germ cells) become spermatocytes
(diploid cells) that in turn become spermatids (haploid cells)
and further differentiate into spermatozoa (morphologically
mature haploid germ cells, “sperm”).42 From the testis,
spermatozoa are released into the epididymis to undergo
further biochemical changes and become fully functional
sperm. Sperm are stored in the epididymis until ejaculation
(Figure 8).
Figure 8. A) A normal spermatozoon from a mouse
Sperm production and quality varies by strain.43 Libido
recovery (willingness to breed again after successful coitus)
also varies by strain.44 Recovery of an animal’s libido can
occur in as short as 2-4 hours or may take as long as two
weeks.45 Sperm production does not correlate with libido
recovery, so it is possible to have animals that are willing to
mate, but have very few sperm. A good guideline is to allow at
least four days between mating events for outbred males used
intensively and seven days for inbred males. The copulation
plug is a yellow to white plug produced by secretions of the Figure 8. B) A normal spermatozoon from a rat
coagulating gland, seminal vesicles, and prostate. It typically
fills the vagina and provides a mechanical barrier, although not
an absolute one, to mating by another male.46 The presence of
a copulation plug indicates successful mating and ejaculation,
but does not necessarily indicate pregnancy.47 Copulation
plugs are retained longer in mice than in rats and it is wise to
check the bedding of rats for the presence of a plug
(Figure 9).

Female anatomy
The overall anatomy of the female mouse and rat is very
similar (Figure 10). The female reproductive tract is comprised
of ovaries and their related structures, the oviducts, the uterus,
the vagina, and the vulva. The paired ovaries are surrounded
by ovarian bursae and attached to the uterus by the oviducts.
The uterus is bicornuate with a single cervical os in the vagina.
The vulva is composed of the vaginal introitus, the clitoral

34 35
 Biology and
reproductive biology

Figure 9. A) Copulation plug in a mouse

Figure 9. C) Copulation plugs on the floor of a rat cage. Copulation plugs

do not tend to remain fixed in rats for as long as they do in mice, so if
examining rats for copulation plugs, check the bedding as well.

Figure 9. B) Copulation plug in a rat

36 37
 Biology and
reproductive biology

Oocytes remain quiescent until sexual maturation. During

each natural cycle, only 6-16 oocytes are hormonally
stimulated to undergo ovulation. After mating takes place
(during late proestrus and early estrus), the fertilization of
eggs takes place in the oviduct. The egg remains viable for
10-15 hours after ovulation. The vast majority of the oocytes

Figure 11. A) A nursing mouse, illustrating typical mammary development

and the number of mammae

Figure 10. Female mouse reproductive anatomy. Figure from Pritchett and
Taft, 2007,32 used with permission.

glands, and the urinary papilla. Mammary tissue is present

in two distinct regions: cervicothoracic, where it can extend
around to the dorsum, and inguinoabdominal. Mice have
five pairs of mammary glands and teats; three pairs in the
cervicothoracic region and two pairs in the inguinoabdominal
region. Rats have six pairs of mammary glands and teats;
three pairs in the cervicothoracic region and three pairs in the
inguinoabdominal region (Figure 11).
Figure 11. B) A nursing rat, illustrating typical mammary development and
A female mouse or rat is born with all of the oocytes that she the number of mammae
will ever have, a total of approximately 30,000-75,000.
38 39
 Biology and
reproductive biology

are never ovulated and degenerate throughout the life of time since parturition.52,53,54 Delayed implantation of fertilized
the animal. ova is possible; this phenomenon is known as embryonic
diapause.55 If a pregnant female is stressed, such as by heavy
Mice and rats are polyestrous spontaneous ovulators that lactation, embryos can be held as hatched blastocysts in the
cycle every 4-5 days.48 The estrous cycle follows a typical uterine lumen for as long as 12 days.56
pattern, beginning with diestrus, followed by proestrus, then
estrus, then metestrus. Estrous stage can be assessed by Control of the estrous cycle in mice and rats can be achieved
visible changes in the vulva and introitus as well as by smears in many ways. Exogenous hormones are the simplest way and
of vaginal epithelium49,50,51 (Tables 1 and 2 and Figures 12 and this method is used extensively in genetically modified animal
13). Both mice and rats have a fertile postpartum estrus that production. Response to exogenous hormones depends on
occurs approximately 12 hours after giving birth. The exact genetic background as well as timing of administration.57,58
time of estrus is dependent on both circadian rhythms and Both rats and mice will synchronize estrous cycles with other
females.59,60 Individual housing of mice will suppress the
Table 1. Classification of the stages of the estrous cycle by cell
morphology in vaginal smears. Table adapted from Nelson,
1982.50
Cell type Cell type
Stage of cycle Leukocytes Nucleated epithelia Cornified epithelia Smear density
Diestrus/proestrus + to ++ + 0 to + Thin
(Predominant) Well-formed
Proestrus 0 to + + to +++ 0 to + Medium
Well-formed
(Predominant)
Proestrus/estrus 0 + to ++ ++ to +++ Medium
(Predominant)
Estrus 0 0 ++ to +++ Medium to heavy
Relatively small cells
(Predominant)
Metestrus 1 0 to ++ 0 ++ to +++ Medium to heavy
Larger, more flat and
clumped than in estrus
(Predominant)
Metestrus 2 ++ to +++ + to ++ + to ++ Medium to heavy
(Predominant) Often irregularly shaped
and vacuolated
Diestrus + to +++ + 0 Thin
(Predominant) Often irregularly shaped
and vacuolated
Cell density:
0 = none, + = few, ++ = moderate, +++ = heavy
40 41
 Biology and
reproductive biology

Figure 12. Cytologic illustration of the estrous cycle in the mouse. All
photomicrographs are taken at 400x and all are stained with Diff-Quik®
(a modified Wright’s stain).

Figure 12. A) Diestrus, characterized by nucleated epithelial cells and large Figure 12. C) Estrus, characterized by cornified epithelial cells as the
numbers of neutrophils dominant cell type

Figure 12. B) Proestrus, characterized by nucleated epithelial cells as the Figure 12. D) Metestrus, characterized by the presence of all three cell
primary cell types, nucleated epithelial cells, neutrophils, and cornified epithelial cells

42 43
 Biology and
reproductive biology

Table 2. Appearance of the vagina at various stages of the estrous cycle.

Table adapted from Champlin, Dorr, and Gates, 1973.49
Estrus stage Appearance
Diestrus Vagina has a small opening and the tissues are bluish-
purple in color and very moist.
Proestrus Vagina is gaping and the tissues are reddish-pink and
moist. Numerous longitudinal folds or striations
are visible on both the dorsal and ventral lips.
Estrus Vaginal signs are similar to proestrus, but the tissues are
lighter pink and less moist, and the striations are
more pronounced.
Metestrus 1 Vaginal tissues are pale and dry. Dorsal lip is not as
edematous as in estrus.
Metestrus 2 Vaginal signs are similar to metestrus-1, but the lip is
less edematous and has receded. Whitish cellular Figure 13. A) The appearance of the vulva of a mouse in proestrus. The
debris may line the inner walls or partially fill the vagina. introitus is gaping and the tissues are reddish-pink and appear swollen.
Longitudinal folds are visible on both the dorsal and ventral lips.

estrous cycle, as female mice need exposure to pheromones

present in male urine to cycle regularly. Overcrowding will
also suppress estrus in mice, and this is known as the Lee-
Boot effect.61 The estrous cycle lengthens and the animals
remain in diestrus. The Whitten effect is the induction of estrus
in female mice by exposure to the urine of male mice.62 The
Whitten effect works best when combined with the Lee-Boot
effect. Overcrowding mice to suppress the estrous cycle,
then separating them and exposing them to male urine, is
a low-tech way to synchronize estrus in a group of mice.
Finally, the Bruce effect is the failure of implantation in female
mice exposed to unfamiliar males.63 The effect only occurs
if exposure to the new male happens before implantation
(before E5).64 Since the effect is mediated via pheromonal
components of the urine,65 it works best when the strange
male is of a different strain.66 Many of these effects do not
work in rats, however. The Bruce and Whitten effects are
absent and the Lee-Boot effect is milder. A summary of the Figure 13. B) A mouse in diestrus has a small introitus and the tissues are
basic reproductive parameters of mice and rats can be found blue or purple. There is little to no swelling.
as Tables 3 and 4.

44 45
 Biology and
reproductive biology

Table 3. Summary of mouse reproductive data Mating

Weight at birth 1g The courtship and mating behavior of mice and rats generally
Weight at weaning 10-15 g follows a consistent pattern. There is a distinct sequence of
Weight of adult 20-40 g approach by the male, acceptance by the female, mating,
Age at weaning 18-28 days ejaculation, and a refractory period.45,67,68 Males generally
Puberty 5 weeks investigate females by sniffing the genitals. If females are
Full sexual maturity 7-9 weeks not receptive, they avoid contact with males, and if mounting
Estrous cycle length 4-5 days is attempted, they may assume defensive postures. In
Sexual receptivity during estrus 12 hours female rats, receptivity to the male is indicated by ultrasonic
Fertilization 2 hours after mating vocalizations, hopping, ear wiggling, and lordosis.69 This
Formation of blastocele 2-4 days is followed by the male mounting the female, intromission,
Implantation 4-5 days ejaculation, dismounting, grooming of the genitals, and a
Pseudopregnancy duration 10-13 days refractory period. This sequence may repeat multiple times
Gestation period 19-21 days during proestrus and estrus. Generally, the female is not
Fertile postpartum estrus Yes receptive to the male except during estrus.
Litter size 6-12
Incisors erupt 9-10 days Length of gestation
First solid food intake 11-12 days Gestation length is controlled by both genetic and
environmental factors. For example, due to the phenomenon
of embryonic diapause, the gestation period may appear to
Table 4. Summary of rat reproductive data be as long as 34-38 days. However, it is generally 18-21 days
Weight at birth 5-6 g for mice and 20-23 days for rats. In inbred mice, gestation
Weight at weaning 40-50 g length has been found to be highly strain-dependent.70 There
Weight of adult 150-500 g is at least some component of the length of gestation that is
Age at weaning 21-28 days litter-size-dependent, with large litters born earlier.71 Fetuses
Vaginal opening 33-42 days may be palpable by 10-12 days post-conception in mice
(approximately 100 g) and 9-10 days in rats — gently feel for growing “beads” in
Puberty ~7 weeks the lower abdomen. Firm palpation can result in lysis of the
Full sexual maturity 8-10 weeks embryo, terminating the pregnancy.
Estrous cycle length 4-5 days
Sexual receptivity during estrus 12 hours Parturition
Fertilization 2 hours after mating Parturition occurs when the fetuses indicate their readiness.
Formation of blastocele 2-4 days Corticosteroid hormones secreted by the placenta induce
Implantation 4-5 days luteolysis and begin the parturition sequence. The female
Pseudopregnancy duration 12-14 days exhibits nesting behavior before parturition, and the nests built
Gestation period 20-24 days at that time are complex and differ from nests built at other
Fertile postpartum estrus Yes times.72 Parturition usually occurs at night for mice, but during
Litter size 4-15 the day for rats.73,74 Parturition takes place over a variable span
Incisors erupt 9-10 days of time, with a pup being delivered every few minutes and the
First solid food intake 11-12 days entire litter delivered over the course of 1-3.5 hours.68,75
46 47
 Biology and
reproductive biology

If undisturbed, the female will lick and clean the pups between
each birth and remain in the nest. If disturbed, she may exit
the nest between births.

Parental behavior and rearing pups

Infanticide is a normal reproductive strategy in mice and
rats.76,77,78,79,80 Both males and females, virgin or experienced,
will commit infanticide. It is commonly seen as a male
reproductive strategy, however, since killing a litter removes
the lactational block to estrus and also removes a rival’s
genes. Females will also kill pups if stressed or if resources
are limited.81 In mice and rats, male behavior is influenced
by the timing of copulation, and remaining in contact with
a female after a copulation event results in a change in
male behavior from infanticidal to parental at about the time Figure 14. An example of a relaxed nursing posture in a rat. One pup is
offspring from that mating would be born.77,80 nursing and the rest of the litter is resting in the foreground.

Effective nursing of pups requires synthesis of milk in the commonly seen in mice because female rats are generally not
mammary glands, parental retrieval of the pups to the nest, housed in pairs or groups. Female mice will make a common
crouching behavior by the mother, attachment of the pups to nest where all pups are housed. The females enter the nest,
the teats, suckling behavior by the pups, and milk ejection.72,82 nurse the pups that signal a desire to nurse, and then exit
Lactation is a physiological stressor for animals which can the nest. Females will preferentially nest with and nurse the
suppress estrus or prevent blastocysts from implanting. offspring of related mice, but familiarity with another mouse
Nursing positions in mice and rats are related to stress levels. can substitute for relatedness.87
Animals that are fearful or disturbed will nurse in a position
that covers all their pups with their body, while animals that For information on the postnatal development of mice and rats
are not stressed will nurse in a variety of positions including and how development can be used to age pups, see Tables
standing, side-lying, and semi-sitting (Figure 14). Retrieval 5 and 6. Mice and rats are generally weaned at approximately
behavior requires participation and feedback from the pups. 21 days of age. Some genetically modified animals and
Infant rodents emit high-frequency vocalizations that guide the inbred strains are smaller and animals may benefit from a later
mother to their location and facilitate retrieval to the nest.83 weaning date, especially if the facility has automatic watering.
However, this can lead to overcrowding in the cage, since a
For successful growth of pups, adequate milk production subsequent litter is likely to follow along ~19-22 days after
must occur. A certain number of suckling offspring is the first. Some facilities recommend weaning young mice into
necessary for adequate milk production for all offspring. cages with “aunts” (retired female breeders). These females
This number appears to be related to suckling stimulus must be removed from the cage before young males reach
provided to the mother during the first day of lactation. sexual maturity. Some hybrid and outbred mice are quite large
Peak lactation in rats and mice occurs between days 10- and reach sexual maturity closer to 4 weeks than 6.
16.35,84,85 Female mice and rats will nest communally and
also communally nurse their pups.86 This behavior is more
48 49
 Biology and
reproductive biology

It may be best to wean these animals at 2.5 weeks or to Table 5. Developmental milestones of the mouse, day 0-14
remove the adult male from the cage to avoid inadvertent Age Appearance
parent/offspring matings. 0 to 24 hours Deep red
Possible milk spot
Reproductive lifespan and breeding unit replacement criteria Pigmented mice have dark eyes
Age at sexual maturity can vary depending on strain and Umbilicus visible as scab
environmental conditions. In general, female mice and rats Day 1 Deep pink
attain puberty, as defined by vaginal opening, between 4-6 Milk spot visible
weeks of age, and sexual maturity at 6-8 weeks of age. Male Whiskers more visible
mice and rats reach puberty, as defined by sperm found in the Umbilicus visible as scab
tail of the epididymis, at approximately 5-7 weeks.88,89 Many Day 2 Ears appear as nubs
investigators give animals an extra week or two to mature to Milk spot visible
attempt to maximize pup survival. This would mean breeding Pigment in skin begins to appear
pairs are set up at 7 weeks for mice and 9 weeks for rats. Umbilicus visible as scab
In general, it is best to retire animals 6-8 months after they Day 3 External ear flap begins to lift from head*
are placed together to breed. Male reproductive lifespan is Milk spot visible
longer, especially if they are housed with females,90,91 but in Umbilicus visible as scab
commercial production settings and when animals are kept Day 4 External ear flap fully lifted from head and
using strict rules of pedigreed mating, this means retiring both perpendicular to head*
the female and the male. Retiring the breeding unit 6-8 months Skin fully pigmented
after set-up will make the animals 8-10 months old, an age at Milk spot visible
which fertility, as measured by litter size, tends to decline for Umbilicus healed
females.92,93 During a typical 6- to 8-month mating span, most Day 5 External ear flap completely vertical
inbred strains will have 5-6 litters and most outbred stocks (as opposed to perpendicular)*
will have 6 litters. Average inbred litter size is 6 for mice and 8 Skin appears much thicker (milk spot
for rats, while the average outbred mouse litter size is 10 and begins to disappear)
outbred rat litter size is 12. If the mating date of a particular Incisors visible as white spots under gums
pair or trio is unknown, consider retiring the pair if the previous Day 6 Milk spot gone or only faintly visible
litter size was 3 or fewer. Smaller litters are associated with a Colored fuzz appears behind ears or on dorsal neck
higher incidence of dystocia, especially in older dams. Some Incisors erupted
backgrounds and phenotypes (e.g., embryonic lethal or some Day 7 Colored fuzz begins to cover pup fully (this is more
specific inbred backgrounds such as BN and DBA/2) are visible in albino animals, as dark animals may
associated with smaller litters on average. appear “linty” from cage dust)
Day 10 External ear opens
Pup fully haired
Day 13 or 14 Eyes begin to open; eye opening is a slit and only
becomes oval, then round, over several days after
opening
*These events may occur 12-24 hours earlier in CD1 mice (outbred mice appear more
developed at birth).
50 51
 Part 2 References

Table 6. Developmental milestones of the rat, day 0-14

Age Appearance 1. Gordon, C. J. Temperature Regulation in Laboratory Rodents.
0 to 24 hours Deep red (Cambridge University Press, 1993).
Should see milk spot (if animals have fed) 2. Gordon, C. J. Effect of cage bedding on temperature regulation and
Pigmented rats have dark eyes metabolism of group-housed female mice. Comp Med 54, 63-68 (2004).
Umbilicus visible as a scab 3. Le, N.-M. & Brown, J. W. Characterization of the thermoneutral zone of
the laboratory rat. FASEB Journal 22, 956.919 (2008).
Day 1 Deep pink
Milk spot visible 4. P. Chamero et al., Identification of protein pheromones that promote
aggressive behaviour. Nature 450, 899-902 (2007).
Whiskers are visible
5. Flower, D. R. The lipocalin protein family: structure and function.
Umbilicus visible as a small scab Biochem J 318 ( Pt 1), 1-14 (1996).
Day 2 Ears appear as nubs 6. Zegarelli, E. V. Adamantoblastomas in the Slye stock of mice. American
Milk spot visible Journal of Pathology 20, 23-87 (1944).
Pigment in skin begins to appear 7. Weinreb, M. M., Assif, D. & Michaeli, Y. Role of attrition in the physiology
Umbilicus still visible as small scab of the rat incisor. I. The relative value of different components of attrition and
their effect on eruption. Journal of Dental Research 46, 527-531 (1967).
Day 3 Ears appear as nubs, although some may have
8. Ebino, K. Y. Studies on coprophagy in experimental animals. Jikken
begun to lift Dobutsu 42, 1-9 (1993).
Milk spot visible
9. D. L. Maier et al., Disrupted cortical map and absence of cortical
Umbilicus visible as small scab barrels in growth-associated protein (GAP)-43 knockout mice. Proc Natl Acad
Day 4 External ear flap begins to lift from head Sci U S A 96, 9397-9402 (1999).
Skin fully pigmented 10. R Gordon. M. Douglas, A. Neve, J. P. Quittenbaum, N. M. Alam, G.
Milk spot still visible T. Prusky, Perception of visual motion coherence by rats and mice. Vision
Research 46, 2842-2847 (2006).
Umbilicus healed
11. Brown, R. E. & Wong, A. A. The influence of visual ability on learning
Day 5 External ear flap fully lifted from head and memory performance in 13 strains of mice. Learn Mem 14, 134-144
(may be perpendicular to head) (2007).
Skin appears much thicker (milk spot is more difficult 12. Wong, A. A. & Brown, R. E. Visual detection, pattern discrimination
to see; may not be seen in pigmented animals) and visual acuity in 14 strains of mice. Genes, Brain, and Behavior 5, 389-403
(2006).
Incisors visible as white spots under gums
13. Prusky, G. T., Harker, K. T., Douglas, R. M. & Whishaw, I. Q. Variation in
Colored fuzz appears behind ears or on dorsal neck visual acuity within pigmented, and between pigmented and albino rat strains.
Day 6 External ear flap completely vertical Behav Brain Res 136, 339-348 (2002).
Milk spot gone or only faintly visible, even in albino 14. Amleh, A. & Dean, J. Mouse genetics provides insight into
animals folliculogenesis, fertilization and early embryonic development. Hum. Reprod
Update. 8, 395-403 (2002).
Colored fuzz begins to cover pup fully (this is more
15. Serfilippi, L. M., Pallman, D. R., Gruebbel, M. M., Kern, T. J. &
visible in albino animals, as dark animals may appear Spainhour, C. B. Assessment of retinal degeneration in outbred albino mice.
“linty” from cage dust) Comp Med 54, 69-76 (2004).
Incisors erupted 16. Clapcote, S. J., Lazar, N. L., Bechard, A. R., Wood, G. A. & Roder, J. C.
Day 9 Pup fully haired — skin is not visible through haircoat NIH Swiss and Black Swiss mice have retinal degeneration and performance
deficits in cognitive tests. Comp Med 55, 310-316 (2005).
Day 13 or 14 Eyes begin to open; eye opening is a slit when it first
17. LaVail, M. M., Sidman, R. L. & Gerhardt, C. O. Congenic strains of RCS
opens, only becoming round over 24-48 hours rats with inherited retinal dystrophy. J Hered 66, 242-244 (1975).

52 53
 Part 2 References

18. Balkema, G. W. & Drager, U. C. Impaired visual thresholds in 35. Maeda, K., Ohkura, S. & Tsukamura, H. in The Handbook of
hypopigmented animals. Vis Neurosci 6, 577-585 (1991). Experimental Animals: The Laboratory Rat (ed Georg G. Krinke) 145- 176
(Academic Press, 2000).
19. Pecci Saavedra, J. & Pellegrino de Iraldi, A. Retinal alterations induced
by continuous light in immature rats. I. Fine structure and electroretinography. 36. Zimmerman, F., Weiss, J. & Reifenberg, K. in The Handbook of
Cell Tissue Res 166, 201-211 (1976). Experimental Animals: The Laboratory Rat (ed Georg G. Krinke) 177- 198
(Academic Press, 2000).
20. Heffner, H. E. & Heffner, R. S. Hearing ranges of laboratory animals. J
Am Assoc Lab Anim Sci 46, 20-22 (2007). 37. Ruwanpura, S. M., McLachlan, R. I. & Meachem, S. J. Hormonal
regulation of male germ cell development. J Endocrinol 205, 117-131 (2010).
21. Hahn, M. E. & Lavooy, M. J. A review of the methods of studies on
infant ultrasound production and maternal retrieval in small rodents. Behav 38. Honma, S. et al. Low dose effect of in utero exposure to bisphenol A
Genet 35, 31-52 (2005). and diethylstilbestrol on female mouse reproduction. Reprod Toxicol 16, 117-
122 (2002).
22. Panksepp, J. & Burgdorf, J. 50-kHz chirping (laughter?) in response to
conditioned and unconditioned tickle-induced reward in rats: effects of social 39. Hotchkiss, A. K. & Vandenbergh, J. G. The anogenital distance index
housing and genetic variables. Behav Brain Res 115, 25-38 (2000). of mice (Mus musculus domesticus): an analysis. Contemp Top Lab Anim Sci
44, 46-48 (2005).
23. Holy, T. E. & Guo, Z. Ultrasonic songs of male mice. PLoS Biol 3, e386
DOI 310.1371/journal.pbio.0030386 (2005). 40. Ryan, B. C. & Vandenbergh, J. G. Intrauterine position effects. Neurosci
Biobehav Rev 26, 665-678 (2002).
24. Musolf, K., Hoffman, F. & Penn, D. J. Ultrasonic courtship vocalizations
in wild house mice, Mus musculus musculus. Animal Behavior 79, 757-764 41. Dunbar, M. E. et al. Parathyroid hormone-related protein signaling is
(2010) necessary for sexual dimorphism during embryonic mammary development.
Development 126, 3485-3493 (1999).
25. Johnson, K. R., Zheng, Q. Y. & Erway, L. C. A major gene affecting
age-related hearing loss is common to at least ten inbred strains of mice. 42. Roosen-Runge, E. C. Process of spermatogenesis in mammals. Biol
Genomics 70, 171-180 (2000). Rev 37, 343-377 (1962).
26. Burn, C. C., Peters, A., Day, M. J. & Mason, G. J. Long-term effects of 43. Sztein, J. M., Farley, J. S. & Mobraaten, L. E. In vitro fertilization with
cage-cleaning frequency and bedding type on laboratory rat health, welfare, cryopreserved inbred mouse sperm. Biol Reprod 63, 1774-1780 (2000).
and handleability: a cross-laboratory study. Laboratory Animals 40, 353-370 44. McGill, T. E. & Blight, W. C. Effects of genotype on the recovery of the
(2006). sex drive in the male mouse. J Comp Physiol Psychol 56, 887- 888 (1963).
27. Van Loo, P. L., Kruitwagen, C. L. J. J., Van Zutphen, B. F., Koolhaas, J. 45. Karen, L. M. & Barfield, R. J. Differential rates of exhaustion and
M. & Baumans, V. Modulation of aggression in male mice: influence of cage recovery of several parameters of male rat sexual behavior. J Comp Physiol
cleaning regime and scent marks. Animal Welfare 9, 281-295 (2000). Psychol 88, 693-703 (1975).
28. Koltzenburg, M., Stucky, C. L. & Lewin, G. R. Receptive properties of 46. Dean, M. D., Ardlie, K. G. & Nachman, M. W. The frequency of multiple
mouse sensory neurons innervating hairy skin. J Neurophysiol 78, 1841-1850 paternity suggests that sperm competition is common in house mice (Mus
(1997). domesticus). Mol Ecol 15, 4141-4151 (2006).
29. Berg, R. W. & Kleinfeld, D. Rhythmic whisking by rat: retraction as well 47. Szabo, K. T., Free, S. M., Birkhead, H. A. & Gay, P. E. Predictability of
as protraction of the vibrissae is under active muscular control. J Neurophysiol pregnancy from various signs of mating in mice and rats. Lab Anim Care 19,
89, 104-117 (2003). 822-825 (1969).
30. Carvell, G. E. & Simons, D. J. Biometric analyses of vibrissal tactile 48. Parkes, A. S. The length of the oestrous cycle in the unmated normal
discrimination in the rat. J Neurosci 10, 2638-2648 (1990). mouse: records of one thousand cycles. Br J Exp Biol 5, 371-377 (1928).
31. Cybulska-Klosowicz, A. & Kossut, M. Mice can learn roughness 49. Champlin, A. K., Dorr, D. L. & Gates, A. H. Determining the stage of
discrimination with vibrissae in a jump stand apparatus. Acta Neurobiol Exp the estrous cycle in the mouse by the appearance of the vagina. Biology of
(Wars) 61, 73-76 (2001). Reproduction 8, 491-494 (1973).
32. Pritchett, K. R. & Taft, R. A. in The Mouse in Biomedical Research: 50. Nelson, J. F., Felicio, L. S., Randall, P. K., Sims, C. & Finch, C. E.
Normative Biology, Husbandry, and Models Vol. 3 The Mouse in Biomedical A longitudinal study of estrous cyclicity in aging C57BL/6J mice: I. Cycle
Research (eds J. Fox et al.) Ch. 3, 91-122 (Academic Press, 2007). frequency, length and vaginal cytology. Biol Reprod 27, 327-339 (1982).
33. Lohmiller, J. J. & Swing, S. P. in The Laboratory Rat (eds Mark A. 51. Marcondes, F. K., Bianchi, F. J. & Tanno, A. P. Determination of the
Suckow, Steven H. Weisbroth, & C. L. Franklin) 147-164 (Academic Press, estrous cycle phases of rats: some helpful considerations. Braz J Biol 62,
2006). 609-614 (2002).
34. Hardy, P. in The Handbook of Experimental Animals: The Laboratory 52. Runner, M. N. & Ladman, A. J. The time of ovulation and its diurnal
Mouse (eds Hans J. Hedrich & Gillian Bullock) 409-434 (Elsevier, 2004). regulation in the post-parturitional mouse. Anat Rec 108, 343-361 (1950).

54 55
 Part 2 References

53. Bingel, A. S. Further studies of post-partum ovulation timing in mice. J 72. Weber, E. M. & Olsson, I. A. S. Maternal behaviour in Mus musculus
Reprod Fertil 65, 313-318 (1982). sp.: An ethological review. Applied Animal Behaviour Science 114, 1-22
(2008).
54. Gilbert, A. N., Rosenwasser, A. M. & Adler, N. T. Timing of parturition
and postpartum mating in Norway rats: interaction of an interval timer and a 73. Flint, A. P., Heap, R. B., Ingram, D. L. & Walters, D. E. The effect of day
circadian gate. Physiol Behav 34, 61-63 (1985). length on the duration of pregnancy and the onset of parturition in the rat. Q J
Exp Physiol 71, 285-293 (1986).
55. Lopes, F. L., Desmarais, J. A. & Murphy, B. D. Embryonic diapause and
its regulation. Reproduction 128, 669-678 (2004). 74. Berry, R. J. The natural history of the house mouse. Field Studies 3,
219-262 (1970).
56. Renfree, M. B. & Shaw, G. Diapause. Annu Rev Physiol 62, 353-375
(2000). 75. Fuller, G. B., McGee, G. E., Nelson, J. C., Willis, D. C. & Culpepper, R.
D. Birth sequence in mice. Lab Anim Sci 26, 198-200 (1976).
57. Byers, S. L., Payson, S. J. & Taft, R. A. Performance of ten inbred
mouse strains following assisted reproductive technologies (ARTs). 76. Labov, J. B. Factors influencing infanticidal behavior in wild male
Theriogenology 65, 1716-1726 (2006). house mice (Mus musculus). Behavioral Ecology and Sociobiology 6, 297-303
(1980).
58. Popova, E., Bader, M. & Krivokharchenko, A. Strain differences in
superovulatory response, embryo development and efficiency of transgenic 77. Perrigo, G., Belvin, L. & Vom Saal, F. S. Time and sex in the male
rat production. Transgenic Res 14, 729-738 (2005). mouse: temporal regulation of infanticide and parental behavior. Chronobiol
Int 9, 421-433 (1992).
59. Marsden, H. M. & Bronson, F. H. The synchrony of oestrus in mice:
relative roles of the male and female environments. J Endocrin 32, 313-319 78. Mennella, J. A. & Moltz, H. Pheromonal emission by pregnant rats
(1965). protects against infanticide by nulliparous conspecifics. Physiol Behav 46,
591-595 (1989).
60. McClintock, M. K. Estrous synchrony: modulation of ovarian cycle
length by female pheromones. Physiol Behav 32, 701-705 (1984). 79. Mennella, J. A. & Moltz, H. Infanticide in rats: male strategy and female
counter-strategy. Physiol Behav 42, 19-28 (1988).
61. van der Lee, S. & Boot, L. M. Spontaneous pseudopregnancy in mice.
Acta Physiol Pharmacol 4, 442-444 (1955). 80. Jakubowski, M. & Terkel, J. Transition from pup killing to parental
behavior in male and virgin female albino rats. Physiol Behav 34, 683-686
62. Whitten, W. K. Modification of the oestrous cycle of the mouse by (1985).
external stimuli associated with the male. J Endocrinol 13, 399-404 (1956).
81. Mann, M. A., Kinsley, C., Broida, J. & Svare, B. Infanticide exhibited by
63. Bruce, H. M. A block to pregnancy in the mouse caused by proximity of female mice: genetic, developmental and hormonal influences. Physiol Behav
strange males. J Reprod Fert 1, 96-103 (1960). 30, 697-702 (1983).
64. Parkes, A. S. & Bruce, H. M. Olfactory stimuli in mammalian 82. Shoji, H. & Kato, K. Maternal behavior of primiparous females in inbred
reproduction. Science 134, 1049-1054 (1961). strains of mice: a detailed descriptive analysis. Physiol Behav 89, 320- 328
65. Peele, P., Salazar, I., Mimmack, M., Keverne, E. B. & Brennan, P. A. Low (2006).
molecular weight constituents of male mouse urine mediate the pregnancy 83. Branchi, I., Santucci, D. & Alleva, E. Ultrasonic vocalisation emitted
block effect and convey information about the identity of the mating male. by infant rodents: a tool for assessment of neurobehavioural development.
Eur.J Neurosci. 18, 622-628 (2003). Behavioural Brain Research 125, 49-56 (2001).
66. Hurst, J. L. Female recognition and assessment of males through 84. Russell, J. A. Milk yield, suckling behaviour and milk ejection in the
scent. Behav Brain Res 200, 295-303 (2009). lactating rat nursing litters of different sizes. J Physiol 303, 403-415 (1980).
67. McGill, T. E. Sexual behavior in three inbred strains of mice. Behaviour 85. Knight, C. H., Maltz, E. & Docherty, A. H. Milk yield and composition
19, 341-350 (1962). in mice: effects of litter size and lactation number. Comp Biochem Physiol A
68. Bennett, J. P. & Vickery, B. H. in Reproduction and Breeding Techniques Comp Physiol 84, 127-133 (1986).
for Laboratory Animals (ed E. S. E. Hafez) 299-315 (Lea and Febiger, 1970). 86. Hayes, L. D. To nest communally or not to nest communally: a review of
69. Diakow, C. A. Motion picture analysis of rat mating behavior. Journal of rodent communal nesting and nursing. Anim Behav 59, 677-688 (2000).
Comparative and Physiological Psychology 88, 704-712 (1975). 87. Manning, C. J., Dewsbury, D. A., Wakeland, E. K. & Potts, W. K.
70. Murray, S. A. et al. Mouse gestation length is genetically determined. Communal nesting and communal nursing in house mice, Mus musculus
PLoS One 5, e12418 DOI 12410.11371/journal.pone.0012418 (2010). domesticus. Animal Behaviour 50, 741-751 (1995).
71. McLaren, A. & Michie, D. Nature of the systemic effect of litter size on 88. Albert, M. & Roussel, C. Changes from puberty to adulthood in the
gestation period in mice. J Reprod Fertil 6, 139-141 (1963). concentration, motility and morphology of mouse epididymal spermatozoa. Int
J Androl 6, 446-460 (1983).

56 57
 Notes

89. Robb, G. W., Amann, R. P. & Killian, G. J. Daily sperm production and
epididymal sperm reserves of pubertal and adult rats. J Reprod Fertil 54, 103-
107 (1978).
90. Schmidt, J. A., Oatley, J. M. & Brinster, R. L. Female mice delay
reproductive aging in males. Biol Reprod 80, 1009-1014 (2009).
91. Wang, C., Leung, A. & Sinha-Hikim, A. P. Reproductive aging in the
male brown-Norway rat: a model for the human. Endocrinology 133, 2773-
2781 (1993).
92. Matt, D. W., Sarver, P. L. & Lu, J. K. Relation of parity and estrous
cyclicity to the biology of pregnancy in aging female rats. Biol Reprod 37, 421-
430 (1987).
93. Biggers, J. D., Finn, C. A. & McLaren, A. Long-term reproduction
performance of female mice II. variation of litter size with parity. J Reprod Fert
3, 313-330 (1962).

58 59
 Genetics for
PART 3 Genetics for
colony management

colony management

ratios. It is important to note that terms to describe what he

was observing did not exist, so Mendel had no idea what the
Genetics is the study of heritable traits and the genes functional unit of heredity actually was (he referred to these
responsible for the variation observed among living unseen units of heredity as “factors”). We now know that these
organisms. While the field encompasses many types of discrete units are genes, and that variants of a single gene are
genetic analysis, from the molecular level to the genetic called alleles.
structure of populations, this chapter will deal primarily
with basic Mendelian genetics: the patterns and modes of Mendel was fortunate in his choice of organism to study
inheritance from parent to offspring. These principles apply because peas are a diploid plant species. Diploid organisms
to many naturally occurring traits observed in laboratory have two copies of each chromosome and each chromosome
populations of mice and rats (coat color, for example) as has one allele for a given gene. When an individual has the
well as to tracking induced mutations, such as transgenes or same two alleles for the gene in question, they are said to be
knock-out alleles, in engineered populations. Having a basic homozygous for that gene (for example, PP or pp). Individuals
working knowledge of Mendelian genetics will prove helpful to that carry two different alleles for a gene are heterozygous
anyone charged with managing breeding programs of mice (Pp). During sexual reproduction, each parent contributes one
and rats. copy of each chromosome; therefore, the parent contributes
one copy of the alleles that parent carries for each gene. One
The start of modern genetics of the characteristics that Mendel studied was the inheritance
The observation that offspring inherit traits from their pattern of pea flower color (purple and white). In the case
parents had been described long before the establishment of flower color, Mendel noted that the flowers were either
of genetics as a science, which is evidenced by selective purple (P) or white (p), but never an intermediate shade.
breeding of plants and animals to the benefit of human This led to his postulation of the first Law of Heredity, the
populations around the globe. However, the first experiments Principle of Segregation. This law holds that two members
to try to understand the basis of the observed inheritance of the same factor (gene) segregate, one from the other,
of traits did not begin until the mid-19th century.1 At that into separate gametes (different alleles in each gamete).
time, an Augustinian monk named Gregor Mendel began Mendel’s experiments also led to the discovery that alleles of
experimenting in his monastery’s garden on the inheritance a gene often interact in a specific way, such that the outward
of several traits exhibited by garden peas. At the time, several appearance (phenotype) controlled by one allele is much
theories prevailed regarding the inheritance of traits. One more prevalent than that of the other allele. In other words,
popular theory was the concept of blending inheritance, one allele is dominant to the other allele and its phenotype
where offspring inherited a smooth continuum of traits from will be present if an individual has only one copy of that allele.
their parents. Another theory was that of the inheritance of In common genetics convention, dominant alleles are capital
acquired characteristics, sometimes referred to as Lamarckian letters (P), while recessive alleles are lowercase letters (p).
inheritance after its main proponent, Jean-Baptiste Lamarck. Dominant does not necessarily mean common and recessive
This theory held that the experiences of the parents could be does not always mean that an allele is rare in a population.
directly passed to their offspring. Mendel’s work demonstrated The designation “wild-type” is used by classical geneticists to
that the inheritance of certain traits in pea plants could be denote the most common allele in a population, regardless of
predicted and described mathematically. This suggested that its phenotypic expression.
heredity was particulate and that the pattern of inheritance
of many traits could be explained through simple rules and
60 61
 Genetics for
colony management

When Mendel crossed pure-breeding (homozygous) purple- Mendel studied in peas. These ratios are always present in
flowered pea plants with pure-breeding white-flowered pea heterozygous crosses involving a single gene with two alleles
plants, this is what he observed: that are dominant or recessive.

Parental gametes P P In addition to flower color, Mendel also studied pea color and
shape; yellow/green and round/wrinkled, respectively. Since
p Purple offspring Purple offspring both of these traits are found within the same “individual”
(Pp) (Pp) (the pea), results from crosses studying the inheritance of
these characteristics led Mendel to propose his second Law
p Purple offspring Purple offspring of Heredity, the Principle of Independent Assortment. This
(Pp) (Pp) law holds that segregation of one trait is independent of
segregation of the other trait. As with the crosses involving
flower color, Mendel started by intercrossing pure-breeding
When he then intercrossed the offspring produced above, this green (YY) and smooth (RR) parental plants with yellow (yy)
is what he observed: and wrinkled (rr) plants, which produced F1 offspring that
were all green and smooth for phenotype (Rr Yy), indicating
Parental gametes P p that the alleles for green and smooth were dominant to
those for yellow and wrinkled. When the F1 offspring were
P Purple offspring Purple offspring intercrossed, Mendel observed the following:
(PP) (Pp)
Parental YR Yr yR yr
p Purple offspring White offspring gametes
(Pp) (pp)
YR Green, Green, Green, Green,
Smooth Smooth Smooth Smooth
So, for the gene that controls pea flower color, the allele (YYRR) (YYRr) (YyRR) (YyRr)
for purple color (P) is dominant to the allele for white color
(p), thus this allele is called recessive. The charts used Yr Green, Green, Green, Green,
above to show how the gametes segregate and then come Smooth Wrinkled Smooth Wrinkled
together in the offspring are called Punnett squares after their (YYRr) (YYrr) (YyRr) (Yyrr)
originator, British geneticist Reginald Punnett, and are used
by geneticists to illustrate the results of crosses between yR Green, Green, Yellow, Yellow,
individuals of known genotype(s). Several other genetic terms Smooth Smooth Smooth Smooth
are introduced with the above examples. The first cross is (YyRR) (YyRr) (yyRR) (yyRr)
called a “parental cross” and is designated as generation
P1. The offspring produced from that cross are the “first yr Green, Green, Yellow, Yellow,
filial” (F1) generation. Crossing the F1 offspring produces Smooth Wrinkled Smooth Wrinkled
F2 (second filial) offspring in a 3:1 phenotypic ratio (for this (YyRr) (Yyrr) (yyRr) (yyrr)
example) of purple:white flowers. The genotypic ratio is 1:2:1
and these ratios held for many of the single gene traits that
62 63
 Genetics for
colony management

This type of “bigenic” or “dihybrid” cross, where two traits are Figure 1. Pedigrees illustrating various patterns of inheritance for single
assorting independently, produces many more phenotypic gene autosomal and sex-linked traits
classes:
• 9 green/smooth
• 3 yellow/smooth P1

• 3 green/wrinkled
• 1 yellow/wrinkled
Nine different genotypes underly the visible phenotypes.
Although they can become quite complex, Punnett squares
are a useful tool in working out the combinations of alleles that
produce phenotypes and genotypes for any number of traits
that are controlled by independent genes.

Modes of inheritance F1
Punnett squares are the tool of choice for experimental
genetics, but scientists interested in studying the inheritance Figure 1. A) Autosomal dominant; male is a heterozygous carrier.
of human disease often use a different tool called a pedigree There is a 50% chance of producing affected offspring of either sex.
chart. These diagrams are used to track the occurrence,
by sex, of a disease phenotype in all relatives of a family. P1
Since the inheritance pattern is being tracked by sex across
generations, pedigree analysis can be used to determine the
underlying genetic control of a novel phenotype. Of particular
interest are the modes of inheritance. These include the
type of allele (dominant or recessive) responsible for the
F1
phenotype, and whether the gene is on an autosome or sex
chromosome (X or Y). An autosome is simply a chromosome
that is not a sex chromosome, and males and females of a
species have equal numbers of autosomes, although the
number of autosomes differs across species. For example,
mice have 20 pairs of chromosomes (19 autosomal pairs and F2
a pair of sex chromosomes) while rats have 21 chromosomal
pairs (20 autosomal pairs and a pair of sex chromosomes). Figure 1. B) Autosomal recessive; both first-generation male and
Figure 1 gives some examples of pedigree charts illustrating female are carriers. Recessive traits are often described as “skipping
a generation,” and this pedigree chart illustrates why. The mutation
autosomal dominant and recessive modes of inheritance, as is difficult to track unless there is a test for carriers or offspring are
well as examples of sex-linked inheritance. homozygous. The mutation can be eliminated from branches in a
pedigree (2nd generation on the right; all offspring are unaffected).

64 65
 Genetics for
colony management

P1 Practical genetics for the mouse room

Understanding Mendelian genetics and modes of inheritance
provides a good foundation for understanding several aspects
of day-to-day genetics in a working mouse room. For the most
part, animal room populations are composed of “wild-type”
mice and/or genetically engineered mice. The wild-type mice
are typically vendor-derived, inbred strains that have various
characteristics better described elsewhere in this manual.
However, all of the inbred strains in common use have a
F1
particular coat color phenotype that can be used as a tool for
genetic management (in particular, quality control) of a colony.
There are entire books written on the coat colors of mice and
the genes and alleles involved,2 but for most considerations,
Figure 1. C) X-linked dominant; parental male is a carrier. All daughters of the there are four primary coat color genes that influence the
affected male parent will be affected, but no sons will inherit the mutation. variation seen in common inbred strains:
1. Agouti vs. non-agouti, commonly denoted by A and a,
respectively.
P1
2. Black vs. brown, classically denoted B and b,
respectively, but the gene is now known and the alleles
are Tyrp1+ or Tyrp1b.
3. Pigmented vs. albino, classically referred to as C
and c, respectively. This gene is also known and
F1
the most common alleles are Tyr+ or Tyrc.
4. Non-dilute vs. dilute, classically noted as D and d,
respectively. This gene has also been identified and the
alleles are Myo5a+ or Myo5ad.

F2 As is typical with genetic nomenclature, the capitalization of

the letters used to denote these coat color alleles indicate
which allele is dominant (A, for example) and which is
F3
recessive (a). Since inbred strains are homozygous at all
loci, it can be inferred that strains of a particular coat color
Figure 1. D) X-linked recessive; parental female is heterozygous carrier.
Sons of a carrier female have a 50% chance of inheriting the mutation and have a specific allele at the locus that controls that color. For
thus being affected. Daughters of a carrier female have a 50% chance of example, any agouti inbred strain would be AA at the agouti
being carriers, but none will be affected. locus (Agouti 129 strains carry a variant of A, AW, which results
in a light belly). However, since the deposition of pigment is
an interrelated pathway, there are interaction effects across
these four loci that control steps in the pathway and the
ultimate coat color generated. Animals that are AA but are
also BB (normally resulting in a black coat color) will be
66 67
 Genetics for
colony management

agouti, since that locus will directly influence the deposition particular genotypes are detailed elsewhere in this guidebook,
of black pigment. The agouti C3H/HeNCrl is an example of so this section will briefly examine the genetics behind those
this with the coat color alleles AABBCCDD. Animals that are calculations. Note also that we are not concerned with
aa and BB will be black, as the striping pattern of the agouti whether an allele is dominant or recessive (although one may
hair is absent. The classic example of this is the C57BL/6NCrl, need to consider if the mutation is lethal when homozygous,
which is aaBBCCDD. Another example is the “d” allele which for example), so the main considerations for determining the
influences the amount of pigment produced. The strain genetic outcome of specific crosses are:
DBA/2NCrl has aabbCCdd for the major coat color alleles, so
it has a very light brown coat color when compared to a strain 1. Genotype of the parents in the cross for the mutation(s) in
that is aabbCCDD. Albino strains of mice lack any pigment question
due to mutations in the C (Tyr) gene, regardless of what a. Heterozygous
other coat color alleles they carry. The albino locus is said to b. Homozygous
be epistatic to other coat color loci since it is unlinked and c. Wild-type
completely masks their phenotypic expression. BALB/cAnNCrl 2. Location of the mutation(s) in question
and FVB/NCrl are two common albino strains with different a. Autosomal
allelic combinations masked by homozygosity for a mutant b. Sex-linked (almost always X chromosome)
form of the C locus. BALB/cAnNCrl are AAbbccDD while FVB/
NCrl are AABBccDD. Knowledge of the coat color alleles Once the above information is known, it is relatively
present in strains in a colony (Table 1) can help determine the straightforward to calculate the probability of producing
source of genetic contamination if unexpected coat colors specific genotypes in the offspring. Punnett squares are an
suddenly appear in breeding cages. excellent tool for this purpose, particularly if more than one
manipulation is present in the animals being mated, and
Table 1. Coat color alleles of commonly used inbred strains of mice if particular combinations of mutations are desired in the
Agouti Non-agouti Albino Dilute Coat offspring. Two of the most common crosses are illustrated
Strain (A or a) (B or b) (C or c) (D or d) color in Figures 2 and 3, since they form the basis for calculating
129S2/SvPasCrl AWAW BB CC DD Light-bellied genotypic frequencies for more complicated crosses involving
agouti two or more manipulations.
BALB/cAnNCrl AA bb cc DD Albino
C3H/HeNCrl AA BB CC DD Agouti
C57BL/6NCrl aa BB CC DD Black
Figure 2. Heterozygote (Mut/+) by wild-type (+/+), where Mut denotes the
DBA/2NCrl aa bb CC dd Light brown manipulation and + denotes the normal allele
FVB/NCrl AA BB cc DD Albino
Gametes Mut +
While it is good to have an understanding of basic coat
color genes and their interactions from a quality control + Mut/+ +/+
standpoint, one also needs to apply basic genetics to tracking
mutations that are being maintained in a colony. In particular,
this is required if the colonies are producing animals that + Mut/+ +/+
have been genetically engineered, and investigators require
specific genotypes for their experiments. The methods used
for producing cohorts of animals in particular numbers with Offspring are 50% heterozygous and 50% wild-type.
68 69
 Genetics for
colony management

Figure 3. Heterozygote (Mut/+) by heterozygote (Mut/+) These illustrations of X-linked inheritance and probabilities
also introduce a new genetic term, hemizygote. Hemizygosity
Gametes Mut + is the state of having unpaired regions on a chromosomal
pair. Since the X and Y are considered a chromosomal pair,
Mut Mut/Mut Mut/+ genes on the X or Y do not have paired regions in male mice
since they only have one copy of each sex chromosome. This
condition can also be present on the autosomes of random
+ Mut / + +/+ integration transgenic animals, and this type of manipulation
will be discussed in greater detail in the next chapter.

Offspring are 25% homozygous for the Mut allele, 50% heterozygous and
25% homozygous for the wild-type allele.

If the cross involves parents that are carrying two different

unlinked (on separate chromosomes) manipulations, the Figure 4. Inheritance patterns of a sex-linked mutation are determined
probabilities for various combinations of the two mutations in based on both the carrier status of parents and the sex of resulting
a single offspring can be calculated with or without Punnett offspring. Since males have one X chromosome, they either have the
square diagrams as long as the zygosity of the parents for mutant allele (hemizygous) or not. Females, with two X chromosomes,
may be homozygous, heterozygous, or may have no copies of the allele.
each mutation is known. Taking Figure 3 above, but with
each parent being double heterozygotes for the same pair
of unlinked mutations, the calculation for a given genotypic
combination in a single offspring is the product of the two
individual probabilities for a particular combination. For
example, the probability for either mutation being homozygous
in an individual is 25% for each mutation. So, the probability
of both mutations being homozygous in the same individual
is 0.25 x 0.25 = 0.0625 or about 6%. Likewise the probability
of a given offspring being homozygous for one mutation and
heterozygous for the other is 0.25 x 0.5 = 0.125 or about
12.5%. The probability of any combination possible can be
calculated in this manner or can be visualized in a Punnett
square like that of the bi-genic cross shown earlier (the double
homozygote, YYRR, has a frequency of 1/16 or 0.0625). Figure 4. A) A cross of a hemizygous male with a wild-type female

Predicting genetic outcomes from crosses involving sex-

linked mutations is very similar to the examples given above.
However, the probability of a specific genetic combination
will also depend upon the genotypes of the male and female
parents, as well as the sex of the offspring produced. Figure 2
illustrates examples of sex-linked inheritance.

70 71
 Genetics for
colony management

Figure 4. B) A cross of a hemizygous male with a female heterozygote

Figure 4. D) Cross of a wild-type male with a homozygous female

Figure 4. C) A cross of a wild-type male with a heterozygous female

72 73
 Notes

Part 3 References

1. Weiling, F. Historical study: Johann Gregor Mendel 1822-1884. Am J

Med Genet 40, 1-25; discussion 26 (1991).
2. Silvers, W. K. The Coat Colors of Mice: A model for mammalian gene
action and interaction. (Springer-Verlag, 1979).

74 75
 Genetic modification
PART 4 Genetic modification
technologies

technologies

neuron-specific, etc.), and they can be made to respond to

factors that turn on expression at a specific time (inducible
The study of mutant mice has evolved from collections of promoters).7 Regardless of the type of promoter, these
spontaneous coat color mutants held by 19th century mouse regions in the construct allow for expression of the transgene
fanciers, to the shotgun mutagenesis provided by radiation independent of genomic location (Figure 1). If a transgene
or chemicals, to the advent of directed manipulation of is assembled in this manner, protein may be expressed in
the mouse genome by several methods. Today, there are tissues it would not normally occupy and at levels that are
repositories of genetically engineered mice located around higher than normal. These types of changes often lead to
the world that provide scientists with access to many disease phenotypes that can provide clues about the mode of action
models. These mice have been engineered using techniques of specific proteins, or serve as models for disease. It is not
like targeted mutagenesis, inducible mutagenesis, and unusual for the protein coding region to come from species
transgenesis. This chapter will provide an introduction to other than the mouse (human cDNA sequence is often used).
these technical procedures and discuss the advantages and Transgenes can also be made by cloning large regions of
disadvantages to each approach. There are several manuals, genomic DNA that contain the gene of interest complete
such as those by Nagy, Pinkert, Cartwright, Kühn and Wurst, with its natural controlling elements (promoter) and exon-
and Joyner that describe these procedures in great detail, and intron assembly intact. Although these larger constructs are
are an excellent reference for those interested.1,2,3,4,5 a technical challenge, they may allow for better expression of
the gene of interest for reasons explained below.8
Transgenesis
Transgenesis involves introduction of known genes into the Transgenes of either sort are introduced to the mouse genome
mouse genome at random sites with the intent to produce a via pronuclear microinjection of mouse one-cell embryos.
phenotype based on overexpression of the gene. This method Embryos are collected from females early in the day following
was first used in the early 1980s6 and led the way for other mating by flushing them from the reproductive tract into tissue
more directed methods that followed. Transgenes can be culture media. They are then placed on a microscope stage
completely “assembled” in the laboratory by linking together and specialized pipettes are used to hold the embryo or inject
various components that will allow for the cloning (the vector),
the expression (the promoter), and the processing and protein
coding (intron, exons/cDNA, and polyadenylation signal) of
the transgene once it is introduced into the mouse genome.
The cDNA is DNA that is synthesized from messenger RNA
(mRNA) using an enzyme called reverse transcriptase. The
mRNA is a copy of the regions of a gene, the exons, that Figure 1. Schematic diagram of a typical vector for the production of
code for the protein that the gene ultimately produces. In the transgenic mice. 5’ and 3’ untranslated regions (UTR) can contain
elements that promote expression of the transgene after insertion in the
genome, genes are made up of multiple exonic sequences host genome.
with intervening non-coding regions, the introns, between
them. Promoters are regions of DNA that drive and control
gene expression in the cell. They can allow for ubiquitous
expression of a gene in all cell types (sometimes called a
constitutive promoter), they can only allow expression within
a specific cell or tissue type (liver-specific, heart-specific,
76 77
 Genetic modification
technologies

the DNA (Figure 2). Surviving embryos are then transplanted the transgene, and founder lines that produce animals with
into pseudopregnant females and carried to term. Once suitable amounts of transgenic protein production can be
the litter is born, pups are assayed for the presence of the used for further study.
transgene in their genome. This method typically results
in random integration into the genome at only one site per Transgenesis methods can also be used to produce mice
individual (called a transgenic line founder animal), but this that have specific utilities when combined with some of the
integration site may contain a tandem array of transgenes other types of manipulation that will be discussed later. This
linked together in multiples ranging from two to several is particularly the case for transgenes that have inducible
hundred. Multiple founder animals may be produced following promoters. These types of promoters are controlled by
an injection session with a given transgene, and although they an external stimulus that activates them to start driving
contain the same transgene, it is important to note that each expression of the cDNA they are connected to. The most
founder animal is unique. This is due to the fact that the site widely used is a binary transcription transactivation system
of integration and the size of the tandem array will be different called the “tet-on/tet-off” system.9 The transcriptional activator
for each one. Those differences often lead to different levels gene can be regulated reversibly and quantitatively by the
of expression of the transgene and, therefore, to potentially antibiotic tetracycline or a derivative like doxycycline (dox).
different phenotypes in offspring of the founder animal. After Doxycycline can be delivered to the transgenic animals
the founder animals are produced, the next step is to breed via drinking water or chow at a prescribed time to activate
them to wild-type animals to see if the transgene is passed on (or suppress) expression of the transactivator protein. As
to offspring. If germline transmission of the transgene occurs, illustrated in Figure 3, the tet-on system activates transcription
carrier animals can be used to test for level of expression of in the presence of dox, while the tet-off system represses
transcription in the presence of dox. The major drawback to
these systems is their need for fairly high doses of antibiotic
over an extended time period. Tet-off requires continuous
administration of dox, and activation only occurs once dox
is cleared, which can take anywhere from 1-7 days in adult
animals. In addition, dox is cleared more slowly in tissues like
bone and liver. The tet-on system induces transcription rapidly,
but repression depends on the clearing of dox.

Transgenesis performed in this manner has two main

difficulties. The first is that the random integration of the
transgene may result in the disruption of an endogenous
gene. If the disruption is enough to ablate or change
expression of the gene, a phenotype other than the one
desired may result. In a worst-case scenario, researchers
Figure 2. Bright-field photo of a one-cell mouse embryo being may attribute an observed change in their transgenic line
microinjected. The rounded pipette on the left is a holding pipette that
stabilizes the embryo for insertion of the injection pipette on the right. The
to the transgene itself, when it is really due to disruption of
injection pipette contains the linearized transgene vector that is being an unrelated gene. The second difficulty is with transgene
injected into the pronucleus of the embryo. expression levels that can vary considerably from founder
line to founder line for the same construct. Expression
78 79
 Genetic modification
technologies

levels are greatly affected by the genomic insertion site of

the transgene, with heterochromatic regions (areas of the
genome that have few or no active genes) tending to silence
transgene expression altogether.10 One reason for using large,
genomic DNA-based transgenes is to insulate the expression
controlling regions (promoter) from the surrounding genomic
region.

Targeted mutagenesis
As the name implies, targeted mutagenesis is the purposeful
manipulation of a specific gene target (or genomic region)
to produce a desired effect. The two most common types
of targeted mutagenesis are knockouts and knockins.11
Knockouts are designed to eliminate gene function and can
be either constitutive (gene function is eliminated in all tissues)
or conditional (gene function is eliminated in an inducible
or tissue-specific manner).12,13 Knockins are produced by
targeting a construct (for example, a transgene) to a specific
location in the genome. They may also be constitutive or
conditional in terms of gene expression control. Details about
the advantages and disadvantages of a constitutive versus
conditional approach will be covered later in this chapter.
For both knockouts and knockins, targeting of the gene or
genomic region is carried out in embryonic stem (ES) cells
using vectors that are capable of “finding” the region they
are specifically meant to target. Embryonic stem cells are
derived from the inner cell mass (ICM) of 4.5-5 day old mouse
embryos (blastocysts). Blastocysts consist of a hollow ball
of cells that will become both the embryo and its supporting
tissue once the embryo embeds in the uterine wall. The ICM
is contained within this ball and is composed of ES cells that
are capable of becoming any tissue in the developing mouse
(they are pluripotent).14,15,16 Mouse ES cells were first derived
from the 129 inbred strain, but have since been cultured from
other inbred lines (e.g., C57BL/6) as well as from rats, and
Figure 3. Diagram of the function of tet-on and tet-off approaches for the a number of different cell lines are currently available to the
regulation of transgene expression
scientific community.17,18,19

Production of knockout animals begins with the selection

of the target and the isolation (cloning) of a portion of the
80 81
 Genetic modification
technologies

genomic copy of the gene. That section becomes the basis for transgenes) and these cells will survive Neo selection in
for building a targeting vector that will ultimately be introduced culture as well. Use of the TK vector helps reduce the total
into ES cells. Targeting vectors can be quite complicated in number of surviving cells, since many of the cells that have
their design, but the basic vectors are intended to disrupt random integrations will also have an intact TK cassette.
a portion of the normal coding region of a gene. They also Selection with agents that kill thymidine kinase-positive
contain a selectable marker such as neomycin resistance cells will eliminate the cells with random integrations, further
(Neo) that helps select for ES cells that have taken up the enriching correctly targeted cells. Since use of the positive
targeting vector, hopefully at the appropriate site. They may and negative selection system does not work as planned
also contain a negative selection cassette such as thymidine 100% of the time, some cells will survive and grow even
kinase (TK)20,21 to help eliminate cells where the targeting though they are not correctly targeted. The selection methods
vector has integrated at a random site. Figure 4 is a diagram described just reduce the total number of ES cell clones that
of a basic targeting vector containing the Neo-positive need to be examined for correct targeting. Given that targeting
selection cassette along with a TK-negative selection cassette efficiencies can be lower than 1% for certain regions, positive-
compared to the wild-type allele.22 For correct targeting to negative selection can go a long way toward reducing the
occur, the targeting vector must recombine with the wild- total number of ES clones that have to be examined for that
type locus via the process of homologous recombination. rare homologous event.24
Homologous recombination involves the physical exchange
(sometimes called crossing-over) of DNA between two regions
of similar or identical nucleotide sequence.23 In this way, the
mutated region from the targeting vector is “swapped” for
the corresponding region in the wild-type allele, resulting in a
disruption of gene function as illustrated in Figure 5. Cells that
are correctly targeted will have the Neo cassette integrated,
but the TK cassette will be lost since it is outside of the region
of homology between the targeting vector and endogenous
locus. Subsequent selection with neomycin in culture will kill
cells that do not have a neomycin cassette and enrich those
cells that do. However, the targeting vector may integrate
into the ES cell genome at random (as described above

Figure 5. Diagram of targeting vector replacement of an endogenous locus

via homologous recombination. Homologous recombination between the
targeting vector and the endogenous allele results in the introduction of
the Neo cassette into the locus and the deletion of the TK cassette. This
allows for screening of ES cell clones for homologous recombination by
the addition of G418, an antibiotic related to gentamycin, to the cell culture
medium. Incorrectly targeted clones retain the TK cassette and can be
eliminated through the addition of acyclovir or gancyclovir to the culture
Figure 4. Diagram of a basic targeting vector, used to replace a gene by
medium. Use of both positive and negative selection methods greatly
homologous recombination, and the complementary wild-type allele for
reduces the number of clones that must be screened using more labor
comparison
intensive methods such as Southern blotting.

82 83
 Genetic modification
technologies

Once correctly targeted cells are identified, they are expanded derived from the targeted ES cells if the mutation is to be
and then prepared for injection into host blastocysts. passed on to the next generation. Figure 7 is a diagram of the
overall process to produce gene-targeted mice.
As shown in Figure 6, this process is analogous to that
described for random integration transgenesis, with only the
stage of the embryo (blastocyst versus one-cell), the size of
the injection pipette (large-bore versus small-bore needle) and
the material being injected (ES cells versus DNA) being the
major differences. After injection, the surviving blastocysts are
transplanted into pseudopregnant recipient females; however,
the resulting offspring may not be wholly derived from a single
cellular origin as they are in random integration transgenesis.
The reason is that only a small number of targeted ES cells
are injected into the host blastocyst. Blastocysts contain a
large number of wild-type (host-derived) ES cells in the ICM,
and the hope is that the injected ES cells will be incorporated
as various tissue types in the developing embryo. If that
occurs, the resulting animals will be chimeric; some tissues
will be derived from the host ES cells and some from the
targeted ES cells. Those tissues derived from injected cells
will also contain the mutation, so it is essential for germinal
tissue (cells that will become sperm in most cases) to be

Figure 6. Bright-field photo of blastocyst injection with manipulated ES Figure 7. Overview of the processes involved in targeted mouse model
cells. The rounded pipette on the left is a holding pipette that stabilizes the creation. From targeting vector construction to F1 knockout animals
embryo for insertion of the injection pipette on the right. usually takes 6-8 months.
84 85
 Genetic modification
technologies

The final two steps introduce another “trick” that is used by disease, were targeted in an attempt to make a mouse model
scientists to help identify animals that are high-percentage to study the disease. In other cases, genes of unknown but
chimeras (most of the tissues being derived from injected suspected function were targeted and the resulting animals
ES cells) through visible inspection. If the host blastocyst is were examined for phenotypes of interest. While both are
selected from a strain that has different coat color alleles than seemingly straightforward approaches, it was soon realized
those of the ES cell strain origin, the resulting chimeras will that many targeted genes had no obvious phenotype,
show a mix of the two coat colors because some hair cells are produced a phenotype that was unexpected, or were lethal.
derived from each strain. A high percentage of the coat color Since these were null mutants, all cells in the body contained
expected for the injected ES cells is a good indication that the mutation; thus, the gene would not function regardless of
much of the other tissues were derived from mutant ES cells. tissue type. This type of manipulation is called a constitutive
These high-percentage chimeras can then be bred to wild- mutation because the knockout is always “on.” If the gene
type animals to test for germline transmission of the mutant in question is necessary for embryonic development, no
allele. Once again, animals that are derived from targeted live animals will be produced, making subsequent analysis
ES cell sperm origin can be identified in litters based on difficult at best. To avoid this problem, scientists developed a
coat color if thought is given to the various coat color alleles system that would allow for the production of targeted alleles.
involved. For example, ES cells derived from an agouti 129 Those alleles function normally until a special signal was
inbred strain will be AWAWBBCCDD (see Part 3, Table 1 for coat given to create a null allele. These types of models are called
color allele information) and produce sperm that is AWBCD. conditional (or inducible) knockouts, since the disruption of
If the host blastocysts are derived from the black C57BL/6 the gene only occurs under certain conditions. Table 1 lists
inbred strain (aaBBCCDD), sperm produced from host ES the characteristics of constitutive and conditional approaches
cells will be aBCD. If chimeras composed of these two strains to targeted mutagenesis. The last row of that table introduces
are mated with C57BL/6 animals, the resulting offspring can the primary mechanism used to manipulate conditional alleles,
be either black (aaBBCCDD) or agouti (AWaBBCCDD). Any the use of recombinase mediated gene editing.
agouti animal will have been produced by sperm from the
manipulated ES cell and will have a 50% chance of carrying Recombinases are a class of enzymes capable of rearranging
the mutation, so one only needs to screen agouti animals to sections of DNA if specific recognition sequences are
identify carriers. Multiple litters of all black offspring indicate present in the genome. The most widely used of these for
that the manipulated ES cells did not contribute to the engineering targeted alleles in the mouse is Cre recombinase
germline (sometimes this happens even in high-percentage from P1 bacteriophage.25 This enzyme catalyzes site-specific
coat color chimeras) and more chimeras will need to be made recombination of DNA between sequences of DNA called
and bred. Once germline transmission is confirmed, animals “loxP” sites so that the sequence between two loxP sites is
can be bred in the usual fashion to expand the colony and
produce genotypes (mutant homozygotes in particular) for
Table 1. Constitutive versus conditional strategies
further study of the expected phenotype.
Constitutive Conditional
ES cell mutated ES cell wild type
Inducible mutagenesis
KO/KI present in all cells Cell-specific
Early in the development of targeted mutants, most if not
Promoter independent Promoter dependent
all of the vectors were designed to produce null (loss of
No regulation of mutation Mutation can be regulated
gene function) mutations. In some cases, genes that were
No recombinase transgenic Recombinase transgenic
known to produce a particular phenotype, such as a human
line required line required
86 87
 Genetic modification
technologies

removed. Since these sequences are not normally found

in mammalian genomes, they can be artificially introduced
into targeting vectors to flank regions that are intended to
be removed later. With clever design, their presence will
not perturb normal gene function so the targeted locus will
behave as a wild-type locus until the Cre recombinase is
present. In addition to the Cre-loxP system, the analogous
Flp-FRT recombinase system originally isolated from yeast
can also be added to targeting constructs.26 When present,
Flp recombinase will find its FRT recognition sites and remove
DNA regions that lie between them. Combining the Cre-loxP
with Flp-FRT in the same targeting vector has allowed for the
construction of a very complex, targeted allele, where regions
of the mouse genome can be rearranged in a stepwise
manner to create multiple knockout alleles.

Further refinement to targeted allele generation in mice is

accomplished by using random integration transgenic lines
that have Cre or Flp recombinase expression under the control
of inducible and/or tissue specific promoters.27 Presently there
are many transgenic lines available that have recombinase
expression controlled by promoters, each active in a specific
tissue or cell type that allows spatial control of targeted
allele generation.28,29 In addition, lines that have inducible
promoters driving recombinase expression can be employed
for temporal control of knockout alleles. Crossing these Figure 8. Diagram of Cre-mediated excision of a loxP flanked region.
transgenic lines with mice that have recombinase recognition The Cre protein is produced by a tissue-specific promoter. It acts on the
loxP sites, first circularizing, then excising them, leaving a circular portion
sites engineered into a gene allows for the production of of DNA containing the flanked gene and the recombined genomic DNA.
animals with disruptions in genes that would otherwise cause
embryonic lethality in a constitutive knockout.30 Figure 8 is a
end joining (NHEJ), reattaches the broken DNA ends using
schematic of a system where cre expression is driven by a
a process that tends to introduce errors known as indels
tissue-specific promoter so that the excision of the targeted
(insertions and/or deletions) at the break site. The second
locus occurs only in cells where the promoter is active. Post-
repair mechanism, homology-directed repair (HDR), uses the
recombination, a single loxP site remains in the endogenous
homologous chromosome as a template for error-free repair
locus, while the region that was flanked by loxP sites is
using the recombination machinery. If these DSB could be
circularized and lost.
targeted, either repair mechanism could be used to induce
mutations with NHEJ repair or knockin genes with HDR. The
Targeted nucleases
development of the programmable or targeted nucleases
Cells repair double-stranded DNA breaks (DSB) with one
made this targeting a reality that has revolutionized genome
of two mechanisms. The first, known as nonhomologous
engineering.
88 89
 Genetic modification
technologies

The first of these targeted nucleases to be developed and (transcription activator-like effectors) of Xanthomonas spp., a
widely used was the zinc-finger nucleases (ZFNs). ZFNs are bacterial plant pathogen.34 Because TALENs cut with a higher
enzymes composed of a sequence-specific DNA-binding target density and are simpler to generate, TALENs quickly
zinc-finger domain joined to the restriction endonuclease became more popular than ZFNs for pronuclear targeting.
Fok1.31 Each zinc-finger recognizes a specific 3-base-pair
DNA sequence, and zinc-fingers are bound together to form The most recent of the targeted nucleases are RNA-guided
a domain that binds to 9-18 base pairs, but the site of binding nucleases, known as RGNs or by the names CRISPR/Cas.
is context-dependent.32 A ZFN pair is designed to comprise These were derived from a bacterial immune system that
a pair of binding sites that flank a spacer sequence; when the uses RNA homologous to invading phage or plasmids to
ZFN binds to DNA, the Fok1 nucleases cleave the DNA in the target digestion of foreign DNA.35 In a CRISPR/Cas system,
spacer. ZFN binding sites may be present in several places in there is an endonuclease protein, Cas9, and a guide RNA
the genome, so ZFNs are prone to cutting at places other than (gRNA) that both binds Cas9 and guides it to the DNA to bind
the target sequence in the genome (Figure 9).33 at a stretch of complementary target sequence. The DNA
cleavage is directed by the associated CRISPR (clustered,
TALENs were the second artificial nuclease developed. regularly interspaced, short palindromic repeat). CRISPR is
They also contain a sequence-specific DNA-binding domain more active in mice than ZFN or TALENs, but may have more
bound to a Fok1 nuclease domain, but they differ from ZFNs off-target cutting. CRISPR is currently the most widely-used
in their DNA-binding domains. The DNA binding domains of programmable nuclease.
TALEN originate from DNA binding proteins known as TALEs
The main advantage to the programmable nucleases is their
simplicity, specificity and versatility when compared to other
genome engineering methods.36 Because the programmable
nucleases cut so efficiently, this means of gene targeting has
~GCCATGTGACGCTAAGTCT
TCCGTGGATAGAATGGTCTG~
~CGGTACACTGCGATTCAGA
AGGCACCTATCTTACCAGTC~

~GCCATGTGACGCTAAGTCT
Cleavage by nucleases
T CCGTGGATAGAATGGTCTG~
widely replaced homologous recombination in embryonic
A GGCACCTATCTTACCAGTC~
~CGGTACACTGCGATTCAGA

DS
SB stem cells as the route to targeted mutagenesis in mice
HDR
NHEJ
and rats. Using programmable endonucleases allows for
~ACACTGCGATTCAGA
ACACTGCGATTCAGA TAT ~ ~ ~ CTTA CCGTGGATAGAATGG
CCGTGGATAGAATGG~ ~TGTGACGCTAAGTCT C CCGT
TGGATAGAATGG~ ~GCCATGTGACGCTAAGTCT ATG CCGTGGATAGAATGGTCTG~ microinjection of the nucleases into the pronucleus and a
~ACACTGCGATTCAGA G GGCA

targeting efficiency (knockout creation) as high as 80-90%.

~TGTGACGCTAAGTCT ATA~ ~ ~ GAAT GGCACCTATCTTACC~ ACCTATCTTACC~ ~CGGTACACTGCGATTCAGA TAC GGCACCTATCTTACCAGTC~

Donor DNA Donor DN

NA
~GCCATGTGACGCTAAGTCT T CCGTGGATAGAATGGTCTG~
Or
There is no chimera production or breeding step required.
~CGGTACACTGCGATTCAGA A GGCACCTATCTTACCAGTC~
~TGTGACGCTAAGTCT C CCGT
TGGATAGAATGG~
~GCCATGTGACGCTAAGTCT GTGGATAGAATGGTCTG~
ssODN
In addition, any strain or stock can be modified, since the
~CGGTACACTGCGATTCAGA CACCTATCTTACCAGTC~

~GCCATGTGACGCTAAGTGT GTGGATAGAATGGTCTG~

~GCCATGTGACGCTAAGTCT TAT ~ ~ ~ CTTA CCGTGGATAGAATGGTCTG~ ~GCCATGTGACGCTAAGTCT

T C CCGTGGATAGAATGGTCTG~
~CGGTACACTGCGATTCACA CACCTATCTTACCAGTC~

~GCCATGTGACGCT GGATAGAATGGTCTG~
creation of ESC is unnecessary.
~CGGTACACTGCGATTCAGA ATA~ ~ ~ GAAT GGCACCTATCTTACCAGTC~ A G GGCACCTATCTTACCAGTC~
~CGGTACACTGCGATTCAGA
~CGGTACACTGCGA CCTATCTTACCAGTC~
Gene or tag insertion Gene correction orr point mutagenesis
Small indels

Figure 9. Genome editing by programmable nucleases. Nuclease-induced

Taken together, the methods described above have allowed
double-strand breaks (DSBs) can lead to sequence insertion, nucleotide for the production of mouse models of human disease that
ome editing or
correction bychange
programmable nuclea
(red box) throughases
ases. Nuclease-induced
Nuclease
homology-directedinduced
repair (HDR). are extremely refined and useful for the study of potential
If donor DNA with homologous sequence is present, it can be inserted therapies. Although the mouse is not a perfect model
le-strand breaks
using HDR. (DSBs) canoligonucleotide
If single-strand lead to seequence insertion,
(ssODN) nucleotide
is present, correction
it may also
be incorporated, resulting in a single base alteration of the target DNA.
organism for some human conditions, recent advances in
geDSBs(red box) through
can also homology-directed
be repaired d repair (HDR).
through error-prone If donor DNA
nonhomologous end-with gene targeting in the rat will allow for the production of better
joining (NHEJ), which often leads to small insertions and deletions (indels). models for certain diseases.37,38,39,40
ologous
Examplesequence is present,
indel sequences andit can be inserted
the number using HDR.
of inserted If single
(+3 and +1) orstrand
deleted (–2, –4 and –10) bases are illustrated.
nucleotide (ssODN) is present, it may also
a be incorporated, resulting in a sing
90 91
alteration of the target DNA. DSBs can also be repaired through error-prone
 Part 4 References

Part 4 References

18. Auerbach, W. et al. Establishment and chimera analysis of 129/SvEv-

and C57BL/6-derived mouse embryonic stem cell lines. Biotechniques 29,
1024-1028, 1030, 1032 (2000).
1. Nagy, A., Gertsenstein, M., Vintersten, K. & Behringer, R. Manipulating
the Mouse Embryo: A Laboratory Manual. 3rd edn, (Cold Spring Harbor 19. M. Hirabayashi et al., Establishment of rat embryonic stem cell lines
Laboratory Press, 2002). that can participate in germline chimerae at high efficiency. Molecular
Reproduction and Development 77, 94-94 (2010).
2. Pinkert, C. A. Transgenic Animal Technology: A Laboratory Handbook.
2nd edn, (Academic Press, 2002). 20. Lupton, S. D., Brunton, L. L., Kalberg, V. A. & Overell, R. W. Dominant
positive and negative selection using a hygromycin phosphotransferase-
3. Cartwright, E. J. Transgenesis Techniques: Principles and Protocols. thymidine kinase fusion gene. Mol Cell Biol 11, 3374-3378 (1991).
3rd edn, Methods in Molecular Biology 348 p. (Humana Press, 2009).
21. Schwartz, F. et al. A dominant positive and negative selectable gene for
4. Kühn, R. & Wurst, W. Gene Knockout Protocols. 2nd edn, Methods in use in mammalian cells. Proc Natl Acad Sci U S A 88, 10416-10420 (1991).
Molecular Biology 532 p. (Humana Press, 2009).
22. Mansour, S. L., Thomas, K. R. & Capecchi, M. R. Disruption of the
5. Joyner, A. L. Gene Targeting: A Practical Approach. The Practical proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy
Approach Series 293 p. (Oxford University Press, 2000). for targeting mutations to non-selectable genes. Nature 336, 348-352 (1988).
6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A. & Ruddle, 23. Wong, E. A. & Capecchi, M. R. Homologous recombination between
F. H. Genetic transformation of mouse embryos by microinjection of purified coinjected DNA sequences peaks in early to mid-S phase. Mol Cell Biol 7,
DNA. Proc Natl Acad Sci U S A 77, 7380-7384 (1980). 2294-2295 (1987).
7. Chung, S. et al. Analysis of different promoter systems for efficient 24. Zimmer, A. & Reynolds, K. Gene targeting constructs: effects of vector
transgene expression in mouse embryonic stem cell lines. Stem Cells 20, topology on co-expression efficiency of positive and negative selectable
139-145 (2002). marker genes. Biochem Biophys Res Commun 201, 943- 949 (1994).
8. Probst, F. J. et al. Correction of deafness in shaker-2 mice by an 25. Hoess, R. H. & Abremski, K. Interaction of the bacteriophage P1
unconventional myosin in a BAC transgene. Science 280, 1444-1447 (1998). recombinase Cre with the recombining site loxP. Proc Natl Acad Sci U S A 81,
9. Gossen, M. & Bujard, H. Tight control of gene expression in 1026-1029 (1984).
mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci U 26. Rank, G. H., Arndt, G. M. & Xiao, W. FLP-FRT mediated
S A 89, 5547-5551 (1992). intrachromosomal recombination on a tandemly duplicated YEp integrant at
10. Macarthur, C. et al. Chromatin insulator elements block transgene the ILV2 locus of chromosome XIII in Saccharomyces cerevisiae. Curr Genet
silencing in engineered hESC lines at a defined chromosome 13 locus. Stem 15, 107-112 (1989).
Cells Dev DOI 10.1089/scd.2011.0163 (2011). 27. Schwenk, F., Baron, U. & Rajewsky, K. A cre-transgenic mouse strain
11. Doyle, A., McGarry, M. P., Lee, N. A. & Lee, J. J. The construction of for the ubiquitous deletion of loxP-flanked gene segments including deletion in
transgenic and gene knockout/knockin mouse models of human disease. germ cells. Nucleic Acids Res 23, 5080-5081 (1995).
Transgenic Res DOI 10.1007/s11248-11011- 19537- 11243 (2011). 28. Schindehutte, J. et al. In vivo and in vitro tissue-specific expression of
12. Thomas, K. R. & Capecchi, M. R. Site-directed mutagenesis by gene green fluorescent protein using the cre-lox system in mouse embryonic stem
targeting in mouse embryo-derived stem cells. Cell 51, 503-512 (1987). cells. Stem Cells 23, 10-15 (2005).

13. Doetschman, T. C. Gene targeting in embryonic stem cells. 29. Leneuve, P. et al. Cre-mediated germline mosaicism: a new transgenic
Biotechnology 16, 89-101 (1991). mouse for the selective removal of residual markers from tri-lox conditional
alleles. Nucleic Acids Res 31, e21 (2003).
14. Martin, G. R. Isolation of a pluripotent cell line from early mouse
embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc 30. Berton, T. R. et al. Characterization of an inducible, epidermal-specific
Natl Acad Sci U S A 78, 7634-7638 (1981). knockout system: differential expression of lacZ in different Cre reporter
mouse strains. Genesis 26, 160-161 (2000).
15. Evans, M. J. & Kaufman, M. H. Establishment in culture of pluripotential
cells from mouse embryos. Nature 292, 154-156 (1981). 31. Y. G. Kim, J. Cha, S. Chandrasegaran, Hybrid restriction enzymes: Zinc
finger fusions to Fok I cleavage domain. Proceedings of the National Academy
16. Martin, G. R., Silver, L. M., Fox, H. S. & Joyner, A. L. Establishment of of Sciences of the United States of America 93, 1156-1160 (1996).
embryonic stem cell lines from preimplantation mouse embryos homozygous
for lethal mutations in the t-complex. Dev Biol 121, 20-28 (1987). 32. S. A. Wolfe, L. Nekludova, C. O. Pabo, DNA recognition by Cys(2)His(2)
zinc finger proteins. Annual Review of Biophysics and Biomolecular Structure
17. Kawase, E. et al. Strain difference in establishment of mouse 29, 183-212 (2000).
embryonic stem (ES) cell lines. Int J Dev Biol 38, 385-390 (1994).
33. H. Kim, J. S. Kim, A guide to genome engineering with programmable
nucleases. Nature reviews. Genetics 15, 321-334 (2014).

92 93
 Notes

34. C. Mussolino, T. Cathomen, TALE nucleases: tailored genome

engineering made easy. Current opinion in biotechnology 23, 644-650 (2012).
35. R. Barrangou et al., CRISPR provides acquired resistance against
viruses in prokaryotes. Science 315, 1709-1712 (2007).
36. Wang H. et al. One step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 2013
May 9;153(4):910-8.
37. Li, P. et al. Germline competent embryonic stem cells derived from rat
blastocysts. Cell 135, 1299-1310 (2008).
38. Tong, C., Li, P., Wu, N. L., Yan, Y. & Ying, Q. L. Production of p53 gene
knockout rats by homologous recombination in embryonic stem cells. Nature
467, 211-213 (2010).
39. Buehr, M. et al. Capture of authentic embryonic stem cells from rat
blastocysts. Cell 135, 1287-1298 (2008).
40. Geurts, A. M. et al. Knockout rats via embryo microinjection of zinc-
finger nucleases. Science 325, 433 (2009).

94 95
 Laboratory mouse
PART 5 Laboratory mouse
and rat nomenclature

and rat nomenclature

two subspecies.1 Mus is derived from the Sanskrit “mush” (to

steal), while the origin of Rattus is unclear (possibly post-
As new and different ways to manipulate the mouse classical Latin). Other wild-derived mice may be seen in
and rat genome are developed, new mouse and rat use in the laboratory setting: M. musculus castaneous (from
variants are created. Each of those variants, whether the Thailand), M. m. molossinus (from Japan), and Mus spretus
variation was spontaneous or induced, has a standard (from North Africa).
nomenclature to clearly communicate what has happened
to that animal’s genome. Mouse and rat animal and gene There are three basic types of mice and rats in use in
nomenclature follows the rules and guidelines established research today: wild-caught or wild-derived animals, outbred
by the International Committee on Standardized Genetic stocks and inbred strains. Wild mice and rats are generally
Nomenclature for Mice and the Rat Genome Nomenclature simply called by their scientific name. Care should be taken
Committee. As new technologies are developed, these to use correct binomial nomenclature (standard scientific
must be accommodated by nomenclature, so the rules and nomenclature; Genus species) and current species names.
examples below are only the most basic, and do not include For example, Peromyscus maniculatus, or Rattus rattus may
an exhaustive list of all nomenclature rules for all possible be used to refer to deer mice or black rats, respectively.
manipulations. This chapter will assume a basic knowledge
of genetics (see Part 3 of this book for more information). Before venturing further into nomenclature, laboratory codes
must be addressed, since they are seen in every subsequent
There are four rules to remember when deciphering the type of nomenclature explained here. Laboratory codes are
nomenclature of mice and rats. First, look for the name unique 1-5 letter identifiers that individuals, laboratories,
of the animal, which can be found at the beginning of the or institutions can register with the Institute for Laboratory
nomenclature. Second, look for the gene and/or allele. Gene Animal Research (ILAR). These laboratory codes become an
or allele information will be found after the information on important part of the nomenclature of laboratory mice and rats
the genetics of the mouse. Third, if it can happen to or be because they serve both as identification and as a history of
performed on a rodent genome, there is a formal rule of where the animals were bred or kept. More information may
nomenclature to address the genomic change. And finally, be found at: http://dels.nas.edu/global/ilar/Lab-Codes.
always remember these rules can change. The most current
information on mouse and rat nomenclature is available at Outbreds
http://www.informatics.jax.org/mgihome/nomen/index.shtml Outbred stocks of mice or rats are closed colonies of
and http://rgd.mcw.edu/nomen/rules-for-nomen.shtml. On animals, perpetuated by deliberate breeding to maintain the
both sites, information on submitting new animal, gene or maximum possible heterozygosity within the colony. Outbred
allele names may also be found. mice and rats are named with capital Roman letters and
Arabic numerals. A laboratory code precedes the capital
The scientific classification of mice and rats is the same to letters and is separated from them by a colon. There are no
the genus level: order Rodentia (from the Latin rodere; to spaces between any part of the nomenclature, and trademark
gnaw), superfamily Muroidea; family Muridae; subfamily: symbols are not part of official nomenclature.
Murinae. The scientific name of the domestic laboratory rat
is Rattus norvegicus, while the proper scientific name of the Examples of outbred stock names:
laboratory mouse is Mus musculus musculus x domesticus, Crl:CD1(ICR), Crl:CD(SD).
or the laboratory mouse, indicating their status as hybrids of
96 97
 Laboratory mouse
and rat nomenclature

Inbreds in current use, not all parent strains are still extant. Currently, if
Inbred strains of mice or rats are animals that can be traced more than one substrain is created by a laboratory, a number
to a single ancestral pair and have been produced by at should be appended after the strain name and before the
least 20 generations of sibling matings. Most inbred strains lab code, although this convention was not always followed.
currently in use have been maintained via brother x sister For example, C57BL/6 and C57BL/10 are both substrains
matings for much longer. Inbred mice and rats from the same of the inbred strain C57BL. C3H/HeJ is a different substrain
strain (for example, all C57BL/6NCrl) are as genetically alike than C3H/HeN. It should be noted that this nomenclature
as possible, given normal rates of mutation and genetic drift. convention also has its historical exceptions. For example,
Generations of inbred animals are tracked by “F” (or filial DBA/1 and DBA/2 are separate strains and BALB/c is not a
generation) numbers, such as F234. Although these are not substrain.
part of the official nomenclature, records of the number of
generations animals have been inbred should be maintained Substrain formation is theoretically infinite, because each time
as part of normal colony record keeping. Inbred strains of an animal moves to a different laboratory, a new substrain
mice and rats are named with a short string of capital, Roman might be formed, purposefully or inadvertently. Laboratory
letters. Names should start with a letter, but the inclusion of codes should be accumulated at the end of the substrain
numbers is acceptable. For every rule, there is an exception, designation with each move to a different laboratory. Below
and some mouse and rat names currently used do not meet is a hypothetical example using the authors and imaginary
these criteria because their names were established before strains and lab codes. These four substrains are different rats
the current rules were in force (e.g., BALB/c, 129P2). Care and care should be taken not to confuse them.
should be taken when naming rats and mice that names do
not overlap with extant strains or stocks, although there are ZZZ/9Stc
historical examples of this occurring.
The parental strain of this rat is ZZZ. It is the 9th substrain of
Examples of inbred strain names: the ZZZ rat strain inbred by Scout Chou
C57BL, BN, NZW, SS. ZZZ/9StcBje

Substrains She then shared them with Bruce Elder

Branches of an inbred strain that have genetic differences
(either known or probable) are called substrains. Substrain ZZZ/9StcBjeKrpc
formation occurs under three conditions. Substrain formation
occurs when branches of a strain are separated after the 20th He then shared these rats with Kathleen Pritchett-Corning
and before the 40th generation of inbreeding, since some
ZZZ/9StcBjeKrpcLac
residual genetic difference may be present in animals at the
20th generation. If animals are separated for 20 generations Who next shared them with Laura Conour
from a common ancestor, the normal rates of mutation and
genetic drift will result in substrain formation. Finally, when
previously unknown genetic differences are discovered within
a strain, this may also result in substrain formation. Substrains
are identified by a forward slash following the name of parent
strain and then either a number or a lab code. For substrains

98 99
 Laboratory mouse
and rat nomenclature

F1 and F2 hybrids Table 1. Standard abbreviations of mouse strains

Another mouse or rat commonly found in the laboratory is an Strain Abbreviation
F1 hybrid. F1 hybrids are made by mating two inbred strains. 129 129 strains
F1 mice have 50% of each parental genome. They can receive A A strains
tissue transplants from either of the parental strains and are AK AKR strains
identical to each other, as long as the same cross is used. B C57BL
However, the resultant offspring are not self-perpetuating. B6 C57BL/6 strains
Crosses of two inbred strains can be formed with either B10 C57BL/10 strains
parent being of either strain, and the nomenclature reflects BR C57BR/CD
this. In F1 hybrids, the female parent is listed before the male C BALB/c strains
parent. Complete nomenclature for F1 hybrids uses full strain C3 C3H strains
names, for example: (C3H/HeN x BALB/cAnN) F1. Typically, CB CBA
however, they are named using the standard abbreviations D1 DBA/1 strains
of inbred strains, followed by F1. The lab code is appended D2 DBA/2 strains
after F1 and may also need to be included in the abbreviation. HR HRS/J
For example, these are different mice: B6D2F1 and D2B6F1. L C57L/J
In the first case, the offspring named had a C57BL/6 dam R3 RIIIS/J
and in the second, they had a DBA/2 dam. These are also J SJL
different mice: B6ND2F1 and B6JD2F1. The first mouse had a SW SWR
C57BL/6N dam and the second, a C57BL/6J dam. (from http://www.informatics.jax.org/mgihome/nomen/strains.shtml)

F2 hybrids are made by intercrossing two F1 hybrids. With name of the animals. Following that is the name of any genes
this cross, the allelic contribution from each parent begins in the animal that differ from wild-type, whether the genes
to vary since there is now random assortment of alleles were spontaneously or deliberately modified. In most cases,
from each parental strain. They are not self-perpetuating the wild-type allele of a gene is simply the most common
and cannot necessarily take tissue transplants from either one in the population. As noted in the basic genetics section,
contributing strain. Their naming continues the F1 theme, with mouse and rat genes are identified in a similar fashion, which
the contributing strain abbreviations followed by F2. Example: is different than human gene nomenclature. Formal gene
B6D2F2 is the offspring of two (C57BL/6 x DBA/2) F1 animals. names differ from gene symbols and we will not discuss
formal gene names further. Mouse and rat genes are given
As with all other aspects of mouse nomenclature, the short (three to ten) symbols containing Roman letters and
abbreviations of inbred strains are standardized (Table 1). Arabic numerals. These symbols should not begin with a
Where necessary, append substrain information after number, and the letter that begins the symbol should be
the standard abbreviation. For example, C57 is not the capitalized. When gene symbols are printed, they should be
abbreviation for C57BL/6 mice and B6J mice are different in italics.
from B6Crl mice, which differ from B6Ei mice.
Gene names: Kit, Kitl, Tyr, Dock7
Gene nomenclature
When we dissect the nomenclature of genetically modified Alleles, or different variants of genes, are identified with
mice and rats, the first part of the nomenclature is always the superscripts to gene symbols. If the allele superscript is

100 101
 Laboratory mouse
and rat nomenclature

lowercase, the allele is recessive. If the allele superscript is should be no spaces between the parts. Substrain rules also
capitalized, the allele is dominant, semi-dominant, or co- apply here, so substrain designations may be seen more than
dominant. In general, gene names and symbols should once. Only transgenic lines that are maintained need formal
stay the same over time; although as genes are cloned nomenclature, and nomenclature may be abbreviated in
and assigned to gene families, they may gain new names. publications after its initial use.
If a gene is first identified based on phenotype, it is usually
given a name based on the observed phenotype. Once the Example:
gene is cloned, the old functional description is appended C3H/HeN–Tg(DISC1)43Krpc
to the gene symbol as the allele name, with appropriate
capitalization. Genes can be discovered in many ways, Explanation:
including identification of DNA sequence, protein product, Mouse C3H/HeN
or a phenotype. Kind of genetic modification Tg
Gene DISC1 (human gene)
Examples of mouse gene and symbol names changing Lab identifier 43
through time (there may have been other, intermediate names Lab code Krpc
in between the two chosen):
Targeted mutations
c = albino Mice or rats with targeted mutations in their genomes are also
Tyrc = tyrosinase (note the lowercase “c”) known as knockouts. These animals are typically produced
by injection of genetically modified embryonic stem cells (ES
m = misty cells) into gestational day 3.5 embryos. If the ES cells are a
Dock7m = dedicator of cytokinesis 7 different background than the embryo, the contribution of two
genomes is noted in the nomenclature. The host (embryo)
Dws = dominant white spotting strain is listed first by its standard abbreviation. The host
KitW = kit oncogene (note the uppercase “W”) strain is separated from the ES cell strain with a semicolon
or period. Animals will have a semicolon at generations 1-4
Transgenics of backcrossing to the embryo donor strain, and a period
Animals with a stable, experimentally introduced foreign DNA at 5 or greater generations of backcrossing to the embryo
sequence are known as transgenics. They are named as donor strain (incipient congenic, or congenic; see the
follows: the name of the strain into which the foreign DNA following examples). The targeted gene symbol and the rest
was inserted is listed first, followed by a dash. After the dash of the information on the targeted mutation is separated
comes information on the gene inserted into the animal; in from the mouse strain information with a dash and italicized.
this case, the gene name is preceded by “Tg.” The inserted The remaining identification is superscripted to the gene
gene follows in parentheses. The inserted gene should be name (because it is an allele of the gene): “tm” for targeted
named using the official gene symbol for the gene in the mutation, a numeric designation given by the laboratory, and
species of origin. Promoter designations are encouraged in the laboratory code.
transgenic lines that differ by tissue expression. Following
the gene is a laboratory assigned number, which is often just Knockout animals are now also produced using
the nth founder (germline transmission) produced by the programmable nucleases, such as zinc-finger nucleases
lab. Everything after the dash should be in italics and there (ZFN), transcription activator-like effector nucleases (TALENs),
102 103
 Laboratory mouse
and rat nomenclature

or clustered regularly interspaced short palindromic repeat- the host strain by one or more alleles donated from another
associated systems (CRISPR). In this means of knockout strain(s). Congenics can be useful to study how genes and
production, DNA-manipulating enzyme systems are used to alleles behave when transferred from one genetic background
target a portion of the animal’s genome in the pronucleus to another. In congenic nomenclature, strain abbreviations
of the embryo, and then that embryo is implanted in a are typically used to identify the strains involved — both the
recipient female. Embryonic stem cells are not involved. The background of the recipient animal as well as the strain(s)
nomenclature for animals produced using programmable donating genes. The recipient strain is listed first, with the
nucleases is similar to that of animals produced using gene donor strain(s) abbreviation listed next, but separated
embryonic stem cells, but there is usually only one genetic from the recipient by either a semicolon or period. Animals will
background of mouse or rat in the nomenclature, and “tm” is have a semicolon between the two background abbreviations
replaced with “em” (for “endonuclease-mediated”). at backcross generations 1-4 and will have a period at 5 or
greater generations of backcrossing (incipient congenic).
Example: Mouse strain information is separated from the transferred
C3N;129P2–Disc1tm83Krpc gene information by a dash. The transferred alle(s) is in italics,
and transfer of any allele, not just genetically manipulated
Explanation: alleles, makes the animal a congenic. A substrain designation
Embryo C3H/HeN may follow the gene after a forward slash. Backcross
ES cell background 129P2/OlaHsd generation numbers are not part of the formal nomenclature,
Gene Disc1 (mouse gene) but should be included to assess the potential for residual
Kind of genetic modification tm heterozygosity produced by the backcrossing. Congenic
Lab identifier 83 animals will have two different generation numbers, an “N,”
Lab code Krpc indicating the number of backcrosses, and an “F,” indicating
the number of intercrosses after the backcrossing was
Example: finished. For example, an animal may be N5 + F32, meaning
C3H/HeN–Disc1em85Krpc that it has been intercrossed for 32 generations after the 5th
backcross.
Explanation:
Mouse strain C3H/HeN Congenic:
Gene Disc1 (mouse gene)
Kind of genetic modification em Example:
Lab identifier 85 C3N;D2–H2d
Lab code Krpc
Explanation:
Background C3H/HeN
Congenics Punctuation semicolon (N1-4)
Congenics are animals produced by repeated backcrosses Donor DBA/2
to an inbred strain. The first cross between two strains of Gene H2d
inbred animals is called an “outcross” and a subsequent
mating of animals generated by an intercross to one of the
parental strains is called a “backcross.” They differ from

104 105
 Laboratory mouse
and rat nomenclature

Spontaneous mutation congenic: More information to clarify mouse or rat background strains
may be included in nomenclature. These include the
Example: notations “Cg” and a strain abbreviation in parentheses [e.g.,
C3N.129P2–Disc1rcm (B6)]. When Cg is noted in the nomenclature, the gene or
genes being introgressed are on a mixed or complicated
Explanation: background. For example, a rat congenic for a mutation
Background C3H/HeN arising in an outbred stock would have Cg as its second
Punctuation period (N≥5) background symbol. When parentheses are used, there is a
Donor 129P2/OlaHsd known contribution from a third strain.
Gene Disc1rcm
Examples: BN.Cg-Lolwut,C3H.C(B6)-Disc1tm83Krpc
Transgenic congenic:
There are three other types of genetically altered mice that
Example: are found in laboratories with relative frequency. These include
B6Crl;D2–Tg(DISC1)43Krpc coisogenic, consomic and conplastic animals. A coisogenic
mouse or rat is formed by the occurrence of a mutation at a
Explanation: single locus within an inbred strain. Coisogenic animals are
Background C57BL/6NCrl named with the strain name (and substrain symbol where
Punctuation semicolon (N1-4) appropriate), followed by a hyphen and the gene symbol of
Donor (original background) DBA/2 the mutated allele in italics.
Kind of genetic modification Tg
Gene DISC1 (human gene) Example: C57BL/6NCrl–Lolbbq
Lab identifier 43
Lab code Krpc Consomic animals are also known as chromosome
substitution strains. They are created by repeated
Targeted mutation congenic: backcrossing of a whole chromosome onto an inbred strain.
As with congenics, a minimum of 10 backcross generation
Example: is required. The generic designation is HOST STRAIN–
C3N.129P2–Disc1tm83Krpc Chr #DONOR STRAIN. There is a space between Chr and the
chromosome number.
Explanation:
Embryo C3H/HeN Examples: C57BL/6J–Chr 13DBA/2J, SS–Chr 4BN
Punctuation period (N≥5)
ES cell background 129P2/OlaHsd In conplastic animals, the nuclear genome (i.e., mitochondrial
Gene Disc1 (mouse gene) genome) from one strain has been crossed onto the
Kind of genetic modification tm cytoplasm of another. Their generic designation is NUCLEAR
Lab identifier 83 GENOME–mtCYTOPLASMIC GENOME.
Lab code Krpc
Example: C57BL/6N–mtBALB/c

106 107
 Notes

Part 5 References

1. Yang, H. et al. Subspecific origin and haplotype diversity in the

laboratory mouse. Nat Genet 43, 648-655 (2011).

108 109
 Production and
PART 6 Production and
maintenance of colonies

maintenance of colonies

the monogamous breeding system will result in the greatest

number of pups born per female over her reproductive
Production planning lifespan. On the other hand, harem breeding will result in more
Colony production and management starts with production pups born per breeder cage, but at the expense of decreased
planning; thus, it is important to understand both the purpose individual female output.2,3 While multiple breeder females
and the goals of the breeding colonies. A colony whose housed in the same cage may share pup rearing tasks, it
purpose is to supply females for embryo or blastocyst harvest will also make record keeping more challenging without
will be constituted differently from one designed to supply vigilant monitoring. Polygamous mating is the least male-
small- or large-scale production for specific experiments, or intensive breeding system, but because pregnant females
to serve as a back-up colony as part of disaster planning. are separated from the male (or, more rarely, the males) to
Knowing the goals for the breeding colony in terms of litter in separate cages, it leads to the fewest number of pups
number of animals that must be produced over a specific born per female, because females are not re-bred during the
period of time, and the characteristics of the animals needed, postpartum estrous cycle, and record keeping can be difficult
such as sex, age range and genotype, also aids in colony because male parentage is not certain if multiple males are
size and construction. Finally, other factors that influence present in the breed cage. To maximize the productivity of a
reproductive performance should be considered during the single male mouse, it may be best to rotate different receptive
planning process. Factors such as the background strain females into his cage. This can allow for accurate staging of
characteristics (e.g., fertility rate, litter size, litter frequency), gestation and is commonly used for generating time-mated
maternal characteristics, breeding systems and mating females for embryo harvest, or with vasectomized males
scheme, number of available breeders, model phenotype, (“duds”), to prime the uterus of females for embryo transfer
model breeding life span, and general health status of the surgeries. Adequate male rest must be factored into this
colony will all affect a breeding colony’s overall productivity. system to maximize male productivity.

Breeding system and mating scheme There are many possible mating schemes for breeding
Breeding systems may be categorized in one of two ways: genetically modified rodents, but not all of them can be used
permanent or temporary. Advantages and disadvantages for the maintenance and propagation of animals carrying a
associated with each system were described by Murray and particular genetic modification. Any mating scheme should
Parker in 2005.1 One category is permanent matings, which take into consideration the genotypes of the breeders so that
includes monogamous and harem (one male with more than the offspring have the desired genotype. This is especially
one female) matings. In permanent mating groups, the male important if a phenotype of interest is expressed only in
is housed continuously with the female(s), which allows him to homozygotes or if expression is sex-dependent. Therefore,
participate in pup care and to take advantage of the female’s having a strong foundation in genetics can be helpful when
postpartum estrus. Alternatively, there are temporary matings, managing rodent breeding colonies.
which include polygamous (multiple males and females) and
observed mating (a.k.a. hand mating or timed-mating). These Breeding two homozygotes will yield 100% homozygous
require separation of the breeders at some point after mating. offspring and is useful if the gene effect is seen only in
homozygotes and if homozygotes are viable and fertile.
To maximize the productivity of female mice, they are best Although there will be no sibling control animals, inbred
kept in permanently mated groups because this allows mating animals of the same strain may be used if the mutants
at the postpartum estrus. Although male intensive, are on an inbred background. Mating of a homozygote

110 111
 Production and
maintenance of colonies

with a heterozygote will yield 50% homozygotes and 50% Here is an example of transferring a homozygous mutant
heterozygotes. This scheme is useful when the phenotype allele from a BALB/c (C) background to a C57BL/6 (B6)
is seen only in homozygotes, and when littermate controls background, followed by maintenance of the mice as
are required. This mating scheme may also be chosen homozygotes:
when one sex of homozygotes is not viable or fertile. Mating
two heterozygotes will produce 25% homozygote, 50% OUTCROSS: BALB/c-Abcpdq x C56BL/6
heterozygote and 25% wild-type offspring. Use this mating yields CB6F1 heterozygous for Abcpdq
scheme when homozygotes show the desired phenotype but
are not fertile. If heterozygotes are of interest for a phenotype BACKCROSS: Abcpdq heterozygotes are mated back
intermediate between wild-types and homozygotes, this to wild-type B6 for 10 generations
mating scheme will often be in use. Mating of a wild-type and N2 – N4: B6;C–Abcpdq
a heterozygote yields 50% wild-type and 50% heterozygous N5 – N10: B6.C–Abcpdq
offspring. Use this mating scheme for animals with sex-linked (incipient congenic)
mutations. When expected percentages of genotypes are
given, it is likely that genotypes will appear in this ratio in INTERCROSS: B6.C–Abcpdq heterozygotes at N10 are
offspring produced over time. It is not a guarantee that every mated with each other to generate
litter will have a particular combination. homozygotes

Classical genetics terminology is also used when describing INCROSS: B6.C–Abcpdq homozygotes are mated
mouse breeding, including outcross, intercross, incross with each other
and backcross matings. An outcross is a cross between
genetically unrelated animals, such as crossing a female Meeting production expectations
C57BL/6 with a male DBA/2 to generate B6D2F1 hybrids. It is important to be able to justify animal needs to ethical
An intercross is a cross between two animals with the same review bodies by logically demonstrating how the requested
heterozygous genotype at designated loci. If we mated the animal number was reached. When calculating animal
B6D2F1 hybrids generated above, we would be intercrossing. numbers for breeding colonies, consider all the genotypes
Incrossing is a cross between two animals with the same available, if necessary, as well as the size of key functional
homozygous genotype at designated loci. If we mated the B6 groups necessary to produce the animals required, including
female above with another B6 male, rather than the DBA/2 donor/recipient females, stud/dud males, breeders/future
male, we would be intercrossing. Backcrossing is the mating breeders, and stock (experiment) animals.
of an animal that is heterozygous for an allele present in the
parental strain and one homozygous for one of those alleles. Historic information regarding the reproductive characteristics
Practically, backcrossing is typically used when congenics are of different basic strains and stocks are readily available.4,5
being produced, so animals are being mated back to parental These data should be considered starting points when
strains to maximize homozygosity. working with animals of various backgrounds. Normal data
also change through time due to changes in health status,
genetic drift, and environmental factors, as evidenced by
Table 1. Ideally, data collected from the actual colony will
allow for accurate calculation of the reproductive performance
of particular stocks or strains. Such data can also be used
112 113
 Production and
maintenance of colonies

Table 1. Litter size of C57BL/6J mice through time. Data there is no historical production data to work from, for general
collected from editions of The Jackson Laboratory estimation purposes, assign a P.I. of 2 to outbred stocks of
Handbook on Genetically Standardized Mice.2 rats and mice, 0.8 to “good” inbred mouse breeders and most
Year reported Litter size born as reported inbred rats (i.e., FVB, LEW), a P.I. of 0.5 to “average” inbred
(years collected) by The Jackson Laboratory mice breeders (i.e., C57BL/6), and a P.I. of 0.3 to “poor”
2009 (05-07) 5.9 breeders (i.e., DBA, BN). More information on mouse and rat
1997 (89-90) 6.6 strains and stocks may be found in Table 2.
1991 (86-87) 6.8
1982 (80-81) 7.0 The production index is used to estimate the number of
1980 (78-79) 6.7 breeding females needed to supply specific cohorts of
1968 (63-65) 5.9* animals for experiments. To assure a continuous supply of
1962 (60-61) 6.1* animals (i.e., weekly or every other week) or if the cohort age
* Information listed as “litter size”. Detail not provided as to whether this is range is narrow, the basic mathematical formula to use may
born or weaned litter size.
be written as:

to help manage production expectations, plan studies and # of breeding females x P.I. = # of pups weaned/week
troubleshoot production problems when needed. Basic
productivity information collected from a colony should When performing colony size calculations, take into
include pregnancy rate (percent females pregnant per week), consideration the characteristics of the animals needed for
average litter size, interval between litters, number of cages
retired due to infertility, pup survival rate (pups weaned/pups
born), observations on the females’ ability to rear pups (e.g., Table 2. Production indices for various Charles River stocks
note incidence of cannibalism, milk production, neglect of and strains of rats and mice
litters, etc.), and any special housing/health considerations.6 Stock/Strain Production index
C57BL/6 0.5
Production Index (P.I.) is calculated by dividing the number C3H 0.8
of weaned animals of both sexes by the number of females BALB/c 0.8
bred in the colony during a fixed time period.6 Mathematically DBA/2 0.35
this may be written as “# pups weaned/#females/week.” The FVB 1.0
following example demonstrates how to calculate the P.I. for a Swiss origin (outbred) 2.0
colony: Outbred nudes 1.0*
Inbred nudes 0.5*
Scenario: A breeding colony comprised of 20 trio (1 male: 2 CB17-scid 0.8
female) breeding cages weans, on average, about 60 pups of CD 2.0
both sexes each month. WH 2.0
P.I. = # pups weaned/# females/week g P.I. = 60/40/4 = F344 0.8
0.375 BN 0.4
LE 2.0
The production index for a particular colony will increase * Production index in nudes is based on nude animals produced, so is half
of the true production index.
in accuracy with the length of the fixed time period used. If

114 115
 Production and
maintenance of colonies

experiments, such as age, sex, and genotype, as well as Scenario

productive mating frequency (or fertility rate), and the need for Now the investigator wants a continuous supply of 20
replacement breeders. The colony must be self-sustaining for males, 6-7 weeks old, every other week, for a series of
continued production. In addition, the calculations below do planned experiments. How many active breeder females are
not take into account the assure bolus of offspring produced needed to maintain this production?
if colony matings are all set up at once. Using information
from Tables 1 through 3, here are additional colony production If 20 males are needed every other week, then 10 males need
calculation examples to demonstrate how to use this basic to be produced every week.
formula:
If 10 males/week are needed, then it is necessary to produce
Scenario at least 20 total pups/week.
An investigator asks for 50 6-week-old female KO mice for a
study. The source colony is homozygous knockout mice on an # of breeding females x P.I. = # of pups weaned/week g #
FVB/N background. How many breeder females are needed? females x 0.8 = 20 pups/week

Productive mating frequency for FVB/N = 90% # females = 20/0.8 = 25 productive females needed.

Average litter size = 9.5 pups With 90% productive mating frequency, need to maintain at
least 28 breeder females in the colony. (25/0.9=27.8)
Colony is being managed as HO x HO

Assume equal offspring sex ratio and minimal pup mortality.

If 50 females are needed, then it is necessary to produce at
least 100 total pups/week.

At 9.5 pups/litter, need to produce at least 11 litters to meet

demand.

With 90% productive mating frequency, 13 breeder females

should be set up at one time.

116 117
 Production and
maintenance of colonies

Scenario Please note: While the investigator could have used 20 of

When should this investigator expect her first batch of study the homozygote males at week #10, there would not be a
animals if there are only 10 breeding-age females and 2 sufficient number of age-appropriate animals for subsequent
males available in the colony? studies during week #12, nor would there be enough males in
the colony to sustain production needs.
Week #1: Rotate breeding-age females through the stud
cages and remove them post-mating. For examples and recommendations on animal number
requirements when breeding mutants for genetic analysis,
Week #4-7: Following 3 weeks’ gestation, 86 pups are born.
please refer to Guidelines for the Care and Use of Mammals
(10 females x 0.9 x 9.5 pups/litter); 50:50 sex ratio, 43 females
in Neuroscience and Behavioral Research by the National
and 43 males are weaned and set aside as breeders.
Research Council.7 Experiments that involve the determination
of genetic inheritance pattern, identification of genes
Week #12: Set up active breeding colony using 8-week-old
involved in a quantitative trait, or fine mapping to determine
sibling animals.
chromosomal location of mutant gene, can be very animal
intensive. For example, approximately 1,200 total animals
Week #15: First batch of study animals is born.
are needed to map a single gene with recessive inheritance
Week #18: First batch of study animals is weaned. pattern and full penetrance. This number includes progeny
animals for developmental, phenotyping and gene linkage
Week #21: First batch of 6-week-old study males delivered analysis studies, and assumes that the breeding colony
to investigator for study. is comprised of 10 to 12 pair-mating cages, with breeders
that exhibit no unusual adverse, life-interfering phenotypes,
have good productive mating frequencies, and possess
an average reproductive life span of six to eight months. In
contrast, approximately 80 to 100 animals may be required to
characterize a line from founder animals, operating under the
assumption that up to five breeder pairs are maintained per
line created and that appropriate numbers of weanlings are
available for genotyping and phenotyping.

Breeder selection and replacement

In general, the productivity efficiency will drop as breeding
animals age, as demonstrated in Table 3. The typical
reproductive life span of mice is approximately six to
eight months, but breeder males may be used for longer,
if necessary. The breeding cycle of mice in commercial
production is set at approximately six months after initial
mating, while published information on the optimum breeding
period of rats is limited (about nine months is usual).2 When
managing a colony, the average breeding and replacement
cycle should be set based on the colony’s production history.

118 119
 Production and
maintenance of colonies

Table 3. Production efficiency index of nine inbred strains of Table 4. Breeder retirement standards. Table adapted
mice paired for different periods. Table adapted from Festing from Guidelines for the Care and Use of Mammals in
and Peters, 1999.2 Neuroscience and Behavioral Research, 2003.7
Strain 10 weeks 17 weeks 23 weeks Effective reproductive % of colony
AKR 0.60 0.63 0.55 lifespan replaced monthly
BALB/c 0.63 0.74 0.79 5 months 20
CBA/Ca 0.98 1.17 1.11 6 months 16.7
C57BL/Lac 0.41 0.62 0.64 7 months 14.3
DBA/1 0.85 0.81 0.69 8 months 12.5
DBA/2 0.58 0.58 0.54 9 months 11.1
NZW 0.58 0.59 0.69 10 months 10
Average value 0.66 0.73 0.71
evaluation, and identify problems or corrective measures
Animals that exhibit the standard phenotype reported should during troubleshooting exercises. Failure to organize colony
be selected as breeders. For example, if maintaining mice data could result in genetic contamination of the colony,
on a B6 background, if possible, avoid selecting animals that decrease in production, difficulty in locating specific animals,
come from large litters, or have parents that are known to or delays in experiments.
have produced offspring with background strain lesions (e.g.,
hydrocephalus, malocclusion or microophthalmia). Make Animal identification
sure a breeder rotation schedule is established to sustain the Individual animal identification may be achieved through
colony size while meeting short- and long-term production multiple different methods. Individually numbered rodent
goals. This rotation schedule will depend on the effective ear tags and tag applicators are commercially available
reproductive lifespan of the animal model. A suggested through companies such as National Band and Tag (www.
rotation schedule is provided in Table 4. Monitor the nationalband.com) and Hasco Tag Co. (www.hascotag.com).
reproductive performance of the breeder animals and replace An ear punch or ear notch method may be used, and special
those that are under-performing (i.e., no litters born after punch applicators for mice or rats may be found in scientific
two to three months of set-up, prolonged interlitter intervals, or surgical instrument catalogs such as Kent Scientific (www.
consecutive loss of three litters due to inability to raise or wean kentscientific.com) and Roboz (www.roboz.com). Example
pups), have obvious health issues, or express unfavorable ear clipping systems are illustrated in Figure 1. Toe clipping
phenotype(s). is a controversial identification method that requires scientific
justification, and it is banned in some institutions. Current
Record keeping and colony organization literature on toe-clipping describes limited effects in mice if
Keeping organized breeding records is vital to the success certain conditions are followed.8,9 It is easy to mark neonates
of colony management. Check breeding cages at least once by this method, but it should be done with clean, sharp
per week, for pup birth and breeder reproductive health. scissors on pups 7-12 days of age, only the distal phalanx
Basic breeding information can be tracked at cage side, and should be cut, and no more than one toe per foot should
collected information is often transferred into an electronic be amputated. Single use, implantable microchips are
database as part of laboratory record maintenance. The commercially available through companies such as Biomedic
database can also be used to calculate and track specific Data Systems (www.bmds.com) or Topaz Technologies (www.
reproductive parameters, facilitate production performance topazti.com). Finally, animals may be tattooed on the tail, paw
120 121
 Production and
maintenance of colonies

Figure 2. Immunodeficient mouse identified via Labstamp®

or individual digits using products sold by companies such

as Ketchum (www.ketchum.ca), and Animal ID and Marking
Systems (http://www.animalid.com/), or SOMARK. See Figure
2 (www.somarkinnovations.com). See Figures 3 and 4 for
examples of tattoo marking systems. These identification
methods may be used alone, or in combination. Figure 5
shows a combined ear punch and tattoo system. Regardless
of the system, remember to be consistent, stay organized,
offer proper training to the animal care staff, and include
information on the method when sharing animals with other
institutions or colleagues. Benefits and drawbacks of each
method are presented as Table 5.

Cage level identification

Specialty cage cards should be used based on the purpose
of the animals in the cages, and proper strain/stock
nomenclature should be used. For a breeding cage’s card,
include: identification and date of birth of the breeders, date
of breeding unit set-up, age of the breeders at first litter, the
Figure 1. Redrawn examples of ear clipping or punching systems for dates of all litters born/weaned, and the expected retirement
numbering mice and rats10,11 age/date for the breeding unit. Once a breeding cage is
retired, the retired breeder cage cards should also be filed
away as part of the colony record.
122 123
 Production and
maintenance of colonies

Laboratory records
It is often best to have multiple places to find and cross-
reference colony information. Complete colony records
should also include genotyping data. Colony information
management solutions range from a simple notebook to
exhaustive electronic database systems. Some examples,
but by no means an exhaustive list, include Microsoft®
Excel®, Microsoft Access®, Colony by Locus Technology
(www.locustechnology.com), Big Bench Mouse (www.
bigbenchsoftware.com), Scion by TopazTracks (www.
topazti.com), Progeny (www.progenygenetics.com), JCMS
(colonymanagement.jax.org), MausDB (http://www.helmholtz-
muenchen.de/en/ieg/services/software-downloadsresources/
mausdb/about-mausdb/index.html) and PyRAT (www.scionics.
de/pyrat).

Figure 3. Redrawn examples of toe and foot tattooing systems for

identification of mice and rats12

124 125
 Production and
maintenance of colonies

Figure 4. More examples (redrawn) of toe and foot tattooing systems for Figure 5. Redrawn examples of a combination ear marking and toe
identification of mice and rats12 tattooing system for mice and rats12

126 127
 Production and
maintenance of colonies

Table 5. Commonly used methods of identification and reasons

for and against their use
Method of identification Pros Cons
Ear tag Inexpensive Can fall out
Easy to apply May become infected13
User can specify number/letter combinations Can potentiate tumor formation14,15
Machine-generated numbers and letters are Cannot be applied before ear is fully developed
usually clear Separate genotyping sample must be taken
Variety of materials, including optical reader May be painful
compatible tags
Ear punch or notch Inexpensive Cannot be applied before ear is fully developed
Quick to apply Can be rendered useless by fighting or normal healing16
Sample for genotyping generated at the same May be difficult to interpret
time as identification May be painful
Many variations on the system available for Requires skill to perform in conscious mice
identification
Toe clip Inexpensive Banned by many institutions
Allows for identification of neonates Should not be applied to animals younger than 3 or older than 7 days9
Sample for genotyping generated at the same May be painful
time as identification Motor defects are possible after phalanx removal9
If performed within certain parameters, recent Valid ethical limitations on number of toes removed per paw limits
literature indicates minimal sequelae numbering system
Toe may grow back17
Microchip (RFID Very difficult to misinterpret or confuse Expensive when compared to other methods
transponders) animal identity Requires reader
Microchip can be retained with samples Number determined by manufacturer
Some microchips can be reused Difficult to apply to neonates
Animals cannot obscure microchip Requires anesthesia
Separate genotype sample must be taken
Can induce tumor formation18,19
Tattoo Permanent Equipment helpful for some types of tattoos
Very clear identification of animals Can be difficult to read in pigmented animals
Animals cannot remove tattoo Separate genotype sample must be taken
Can be performed in neonates May be painful
No special equipment required Tattoos in neonates can fade20
Tattoo pigment can be found in regional lymph nodes21

128 129
 Part 6 References

Part 6 References

18. Le Calvez, S., Perron-Lepage, M. F. & Burnett, R. Subcutaneous

microchip-associated tumours in B6C3F1 mice: a retrospective study to
attempt to determine their histogenesis. Exp Toxicol Pathol 57, 255-265
1. Murray, K. A. & Parker, N. J. Breeding genetically modified rodents: tips (2006).
for tracking and troubleshooting reproductive performance. Lab Animal 34,
36-41 (2005). 19. Tillmann, T. et al. Subcutaneous soft tissue tumours at the site of
implanted microchips in mice. Exp Toxicol Pathol 49, 197-200 (1997).
2. Festing, M. F. W. & Peters, A. G. in The UFAW Handbook on the Care
and Management of Laboratory Animals: Terrestrial vertebrates Vol. 1 (ed 20. Engel, E. et al. Tattooing of skin results in transportation and light-
Trevor Poole) 28-44 (Blackwell Science, 1999). induced decomposition of tattoo pigments--a first quantification in vivo using
a mouse model. Exp Dermatol 19, 54-60 (2010).
3. Schmidt, J. et al. Reproductive asynchrony and infanticide in house
mice breeding communally. Animal Behaviour 101, 201-211 (2015). 21. Gopee, N. V. et al. Response of mouse skin to tattooing: use of SKH-1
mice as a surrogate model for human tattooing. Toxicol Appl Pharmacol 209,
4. Silver, L. M. Mouse Genetics: Concepts and Applications. 1st edn, 145-158 (2005).
(Oxford University Press, 1995).
5. The Jackson Laboratory. in The Jackson Laboratory Handbook on
Genetically Standardized Mice eds Kevin Flurkey, Joanne M. Currer, E. H.
Leiter, & B. A. Witham) (The Jackson Laboratory, 2009).
6. White, W. J. in Normative Biology, Husbandry, and Models Vol. 3 The
Mouse in Biomedical Research (eds J. G. Fox et al.) Ch. 8, (Academic Press,
2006).
7. National Research Council. Guidelines for the Care and Use of
Mammals in Neuroscience and Behavioral Research. (National Academies
Press, 2003).
8. Castelhano-Carlos, M. J., Sousa, N., Ohl, F. & Baumans, V.
Identification methods in newborn C57BL/6 mice: a developmental and
behavioural evaluation. Lab Anim, 88-103 (2009).
9. Schaefer, D. C., Asner, I. N., Seifert, B., Burki, K. & Cinelli, P. Analysis
of physiological and behavioural parameters in mice after toe clipping as
newborns. Lab Anim 44, 7-13 (2010).
10. Dickie, M. M. in Biology of the Laboratory Mouse (ed E. L. Green)
(Dover, 1975).
11. Inglis, J. K. in Introduction to Laboratory Animal Science and Biology.
(Pergamon Press, 1980).
12. Hetherington, C. M., Doe, B. & Hay, D. in Mouse Genetics and
Transgenics: A practical approach. The Practical Approach Series, eds Ian J.
Jackson & Catherine M. Abbott, p1-26 (Oxford University Press, 2000).
13. Cover, C. E., Keenan, C. M. & Bettinger, G. E. Ear-tag induced
Staphylococcus infection in mice. Lab Anim 23, 229-233 (1989).
14. Everitt, J. I. et al. Metal ear tag-induced foreign body tumorigenesis in
p53+/- mice. in AALAS 53rd National Meeting, 87 (AALAS, 2002).
15. Baron, B. W., Langan, G., Huo, D., Baron, J. M. & Montag, A.
Squamous cell carcinomas of the skin at ear tag sites in aged FVB/N mice.
Comp Med 55, 231-235 (2005).
16. Fitzgerald, J. et al. Evidence for articular cartilage regeneration in MRL/
MpJ mice. Osteoarthritis Cartilage 16, 1319-1326 (2008).
17. Han, M., Yang, X., Lee, J., Allan, C. H. & Muneoka, K. Development and
regeneration of the neonatal digit tip in mice. Dev Biol 315, 125- 135 (2008).

130 131
 Clinical
PART 7 Clinical
assessment

assessment

information submitted by scientists from around the world.

Dr. Michael F. W. Festing’s work, Inbred Strains of Mice and
Performing regular clinical observations on colony animals Rats and their Characteristics, can also be searched here
is crucial to effective colony management, especially when (www.informatics.jax.org/external/festing/search_form.cgi).
managing genetically altered animals and characterizing Dr. Festing’s list was last updated in 1996, but remains an
novel animal models. Since genetic manipulations can excellent resource. All of these sources, as well as others,
sometimes lead to unpredictable outcomes (i.e., unexpected can provide rodent colony managers with useful animal
phenotypes), documentation of specific clinical signs followed model information and can help decipher whether an unusual
by proper diagnostic workup on principal and sentinel clinical observation is considered a background lesion, an
animals (if present), pathologic assessments, and elective animal health concern, or a novel phenotype worthy of further
phenotyping assays should be performed to determine characterization. A short list of some normal background
whether specific clinical signs observed are related to animal lesions and known mutations in some inbred mice is provided
health status, animal genetic background, or phenotypes in Table 1.2
resulting from genetic modification.

All animal users should receive training on how to recognize

normal and abnormal rodent behavior and appearance,
and all are encouraged to spend time in animal rooms to
gain a better appreciation of normal rodent appearance and
behavior. In addition to clinical signs recognition training,
a reporting system for abnormal findings should be in place.
Timely reporting of clinical signs or colony performance-
related problems, such as an increase in mortality, decrease in
frequency of expected genotypes or decrease in production,
should be made to both the veterinary and investigator groups
to initiate diagnostic workups and troubleshooting exercises.
As a training tool on how to perform clinical observations
and for examples of clinical signs that may occur in a rodent
colony, please refer to the Charles River Handbook on Clinical
Observations of Rodents and Rabbits.1

Known phenotypes associated with common strains

and stocks of mice and rats are available online. For
rats, information may be found at the Medical College of
Wisconsin’s Rat Genome Database (rgd.mcw.edu/wg/
physiology?100) and at the National Bioresource Project
for the Rat in Japan (www.anim.med.kyoto-u.ac.jp/nbr/
phenome/).The Mouse Phenome Database (phenome.jax.
org) is a searchable database curated by the Mouse Genome
Informatics Group at The Jackson Laboratory and contains
132 133
 Clinical
assessment

Table 1. Background strain characteristics

Strain Characteristics
C57BL/6 Ophthalmologic abnormalities (micro- and anophthalmia, cataracts)3
Malocclusion4
Hydrocephalus5
Ulcerative dermatitis and barbering
Age-related hearing loss (Cdh23ahl)6
Splenic melanosis
Senile amyloidosis7
Susceptible to preputial adenitis
BALB/c Absence of corpus callosum in about 30% of mice8
Dystrophic mineralization9
Accessory adrenal cortical nodules
Age-related hearing loss (Cdh23ahl in the ByJ substrain)6
C3H/He Two main substrains: C3H/HeN and C3H/HeJ
Retinal degeneration caused by Pde6brd1
Dystrophic mineralization, caused by alleles of Abcc69
Alopecia areata in aged C3H/HeJ mice3
C3H/HeJ does not respond to endotoxin due to the Tlr4Lps-d allele.10
129 strains Many substrains; be careful when matching ES cell lines to mouse
backgrounds and of historical name changes11
Mutation in Disc112
Testicular teratomas (common in 129X1 (formerly 129/SvJ); incidence differs
between substrains)
Absence of corpus callosum in about 70% of mice of 129P3 substrain
(formerly 129/J)8
Age-related hearing loss (Cdh23ahl in 129P1/ReJ and 129X1/SvJ)6
FVB Retinal degeneration due to Pde6brd1
Prone to seizures with neuronal necrosis
High tumor incidence in aged mice (pituitary adenomas, alveolar-bronchiolar
tumors, hepatocellular tumors, Harderian gland adenomas, etc.)
Swiss-origin outbred mice, Swiss Webster, ICR, Different stocks have different frequencies of Pde6brd1 allele13,14
NIH, CD1, CFW, Black Swiss CFW have a high prevalence of lymphoma due to endogenous retrovirus15

134 135
 Notes

Part 7 References

1. Pritchett-Corning, K. R. et al. Handbook of Clinical Signs in Rodents

and Rabbits. 2nd edn, (Charles River, 2011).
2. Brayton, C. in Diseases Vol. 2 The Mouse in Biomedical Research (eds
J. Fox et al.) Ch. 25, 623-717 (Academic Press, 2007).
3. Smith, R. S., Roderick, T. H. & Sundberg, J. P. Microphthalmia and
associated abnormalities in inbred black mice. Laboratory Animal Science 44,
551-560 (1994).
4. Malocclusion in the laboratory mouse. JaxNotes 489 (2003).
5. Hydrocephalus in laboratory mice. JaxNotes 490 (2003).
6. Johnson, K. R., Zheng, Q. Y. & Erway, L. C. A major gene affecting
age-related hearing loss is common to at least ten inbred strains of mice.
Genomics 70, 171-180 (2000).
7. Korenaga, T. et al. Tissue distribution, biochemical properties, and
transmission of mouse type A AApoAII amyloid fibrils. Am J Pathol 164, 1597-
1606 (2004).
8. Wahlsten, D. Deficiency of corpus callosum varies with strain and
supplier of the mice. Brain Res 239, 329-347 (1982).
9. Meng, H. et al. Identification of Abcc6 as the major causal gene for
dystrophic cardiac calcification in mice through integrative genomics. Proc
Natl Acad Sci U S A 104, 4530-4535 (2007).
10. Poltorak, A. et al. Defective LPS signaling in C3H/HeJ and
C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085-2088 (1998).
11. Simpson, E. M. et al. Genetic variation among 129 substrains and its
importance for targeted mutagenesis in mice. Nature Genetics 16, 19- 27
(1997).
12. Clapcote, S. J. & Roder, J. C. Deletion polymorphism of Disc1 is
common to all 129 mouse substrains: implications for gene-targeting studies
of brain function. Genetics 173, 2407-2410 (2006).
13. Serfilippi, L. M., Pallman, D. R., Gruebbel, M. M., Kern, T. J. &
Spainhour, C. B. Assessment of retinal degeneration in outbred albino mice.
Comp Med 54, 69-76 (2004).
14. Clapcote, S. J., Lazar, N. L., Bechard, A. R., Wood, G. A. & Roder, J. C.
NIH Swiss and Black Swiss mice have retinal degeneration and performance
deficits in cognitive tests. Comp Med 55, 310-316 (2005).
15. Taddesse-Heath, L. et al. Lymphomas and high-level expression of
murine leukemia viruses in CFW mice. J. Virol, 74, 6832-6837 (2000).

136 137
 Troubleshooting
PART 8 Troubleshooting
colony performance

colony performance

The following indices should be recorded as part of normal

colony operations:
When trying to determine why a breeding colony is not
performing well, stating the problem can often be the most Necessary for normal organization:
difficult step. What is truly the problem with the colony? Not Disposition of animals (breeding, death, experiment)
having enough animals for experiments may not always be Date of birth of breeders and stock animals
the fault of the animals. Disorganization, inappropriate mating Date of mating for breeders
schemes, health problems, unanticipated phenotypes, and Generation or backcross number for each strain
environmental challenges can all affect colony performance. Proper nomenclature
There are many things that can go wrong during the long, Pedigree management (chart, book or computer
complicated process of getting an animal from a fetus to an program may all be used)
age suitable for experiments. In general, however, domestic
mice and rats in the laboratory have been selected for their Crucial to know how the colony is performing:
ability and willingness to breed in captivity. They breed in spite Average litter size by litter parity
of what we do, not because of it. Time interval between litters
Number of cages retired due to failure to produce
What’s the real problem? Pup survivability rate (% pups weaned/total pups born)
“My mice don’t breed.”
“My mice don’t get pregnant.” Nice to have:
“My mice get pregnant, but I don’t see any pups.” Time to first litter after mating
“My mice deliver pups but the pups die.” Observations on the females’ ability to rear pups
“My mice breed, get pregnant, and raise their pups,
but the pups die before/at weaning.” Knowing the final disposition of an animal is important so no
“I’m not getting enough pups.” effort is wasted determining whether an animal is really alive
“These mice don’t look right.” or only alive in the computer database. Recording deaths
of breeders will permit you to compare the lifespan of the
Where to start animals in your breeding colony to life spans published in the
The first step in defining, investigating and solving the literature or available from the vendor. Additional dispositions
problem is to review the breeding records. Breeding and for mice or rats within the colony should include:
production records must be organized and complete, with • Assigned to study
sufficient details recorded so that analysis of these data can • Found dead
be performed. • Euthanized due to clinical issue
• Euthanized – retired breeder
Good, consistent record keeping will minimize lost animals.

When troubleshooting production problems, take time to go

into the vivarium and look at the animal and its environment.
Often, the cause becomes evident in a brief examination. For
example, are the animals breeding “on paper” really set up in
the cage? Removing animals from their cages and confirming

138 139
 Troubleshooting
colony performance

identification will clear up record keeping problems. Ensuring

that animals of opposite sexes are set up to breed can explain
an unproductive cage. Before setting any pair of animals up
for breeding, a quick physical exam can rule out problems
such as vaginal septum, imperforate vagina or preputial
injury (Figures 1 and 2). Other items easily evaluated during
a colony exam include breeders past their prime, missing
breeders, and lack of young animals set aside for breeding.
Knowledge of reproductive lifespan and expected production
based on background of the animal is important to managing
production expectations. A BN rat will never have a litter size
of 12, and a DBA/2 mouse will never have a litter size of eight.
If your breeding scheme is predicated on unrealistic litter
sizes, you will undersize your colony. Besides background,
Figure 1. A female mouse with an imperforate vagina. In this mouse, the awareness of the effect of phenotype on reproductive lifespan
vaginal closure membrane failed to open at puberty. The normal uterine is critical to managing breeding efficiency in a colony.
and vaginal secretions accumulated behind the membrane, resulting in
distention of the vagina. This animal may appear male at first glance, but
male mice and rats do not have nipples. Easy fixes for production problems:
Male and female(s) mating?
Healthy enough to mate and physical conformation
allows for mating?
Animals too old?
Correct identification of breeding animals?
Correct animals breeding?

Comparison of genotyping results across multiple litters

should approach Mendelian frequencies. If one litter has no
homozygotes, it is probably due to chance. If five litters have
no homozygotes, another explanation should be sought.
Although embryonic lethality in homozygotes is a possibility,
the more prosaic and likely explanation is a mistake in breeder
selection. Causes of this could be the selection of animals
with the wrong genotype or incorrect genotyping results. If no
homozygotes are being produced, litter numbers are smaller
Figure 2. A female mouse with a vaginal septum. This mouse is unsuitable than expected, and the Mendelian distribution of pups is
for breeding because the structure present in the vagina will interfere with correct for a heterozyote x heterozygote mating, this may be a
both mating and parturition.
case where the gene of interest is a homozygous lethal. If the
allele frequencies are typical of a heterozygote by wild-type
mating, check the genotypes and identification of breeders.

140 141
 Troubleshooting
colony performance

Strain effects
Strain effects influence breeding and production. Strain Backcrossing tips:
effects are those features of particular inbred strains that Backcross females first to a male of the new strain to
influence their reproductive performance, whether through fix the Y chromosome performance.
biology or behavior. For example, male SJL/J mice are After the first generation, only select heterozygous
notorious for aggressive behavior. Unlike other aggressive males to backcross.
strains, like FVB/N, which tend to be male-aggressive, SJL F1 mice will be larger and more vigorous than parental
are indiscriminate in their attacks, killing and wounding strains.
mates and pups. Phenotypic differences based solely on N2-N10 mice will begin to take on the characteristics
background can influence behavior, physiology, and breeding of the new strain.
performance. Factors such as litter size and length of Keep breeders from the previous generation until
gestation in inbred mice are influenced by both environment you’re sure that the next generation will breed and
and genetics, but do have some trends related to genetic have the genotype.
background.1,2,3 Consider intercrossing at N5 to see if homozygotes
retain phenotype.
Genetics
Two other phenomena that can have profound effects on
The phenomenon of hybrid vigor is an increase in fertility
production are inbreeding suppression and hybrid vigor.
and fecundity due to increased genetic diversity. An increase
When inbreeding animals or backcrossing an allele (mutant
in litter size and production of robust pups are the defining
or otherwise) onto a pure inbred background, a notable
characteristics of this event. Hybrid vigor is often the first
decrease in litter size and average pup weight and size will
indication of genetic contamination, potentially resulting
occur from one generation to the next. This phenomenon
from inadvertent breeding of multiple transgenic lines or
is most prevalent between F2 and F8 or N2 and N8 and is
animals from different backgrounds. Changes in vigor of
related to the cumulative burden of fixing deleterious alleles.4
animals and litter size will often be noted before coat color
To continue breeding through this normal event, it is important
changes or shifts in expected Mendelian frequencies. If a
to maintain breeders from the previous generation until the
colony of BALB/c mice begins to have an average litter size
reproductive success of the current generation is evident.
of 10, there is likely something wrong. Every facility should
Additionally, each backcrossing generation should contain a
regularly monitor animals for genetic contamination as well as
sufficient number of breeding pairs so that infertile animals
contamination by infectious organisms. For help in designing
may be discarded.
health monitoring programs, the Companion Guide to Rodent
Health Surveillance for Research Facilities can be a valuable
resource.5

142 143
 Troubleshooting
colony performance

or dramatic reduction of homozygote genotypes will be

Protecting the genetic investment: discernible across multiple litters from different breeders.
Institute genetic quality control monitoring using Definitive determination of embryonic lethality may result in the
SNP or microsatellite panels. need to sacrifice pregnant females to determine embryonic
Cryopreserve important strains and stocks. viability and to harvest embryos for genotyping. In the case
Biological controls: of a proven embryonic lethal phenotype, recreation of the
model with an inducible expression system, such as a tet-
Capture and euthanize escapees.
on system, will need to be considered for further study and
Keep foundation or breed stocks separate from production of viable homozygote offspring. True perinatal
experimental colonies.
or neonatal lethality can be difficult to prove. Deficiencies
Personnel training: in maternal rearing capabilities and any adverse impact of
Staff working with breeding colonies should the micro- or macro-environment must first be eliminated.
understand genetics. Once these potential causes of neonatal mortality have been
Staff should know what is normal for that colony eliminated, pups should be closely monitored daily for clinical
and be able to identify deviants. abnormalities and viability to determine the age range where
Staff should understand the record-keeping mortality occurs. Pathologic assessment of pups before the
system. determined age interval is then advised.
Administrative controls:
House strains with different coat colors next to Some genetic alterations have direct effects on fertility. Such
each other. effects can impact copulatory behavior,8 sperm motility and
Use different colored cage cards. morphology,9 fertilization, uterine implantation,10 or ability to
care for pups.11 These phenotypic effects may be predicted,
Keep good breeding records. based on the function of the gene in humans, or unexpected,
leading to a thorough investigation. Documentation of
Phenotype reproductive performance allows for the rapid identification of
The very phenotype being studied can also adversely these phenotypes when they occur.
affect embryonic and neonatal survival as well as fertility.
Embryonic lethality is often difficult to differentiate from Other factors
neonatal lethality, mainly due to the normal cannibalism of
dead pups by parents. Cannibalism can be so extensive Other factors that may affect colony performance:
that carcass remnants are not evident in the cage, making
it difficult to determine if a litter was actually born. Frequent Stress Illness
observation of pups (taking care not to overly disturb the dam) Phenotype Strain background
for transgenic lines that are exhibiting breeding or production Diet Light
problems is imperative to determine if pups are not born at Noise and vibration Staff
all due to embryo death, retention and resorption, if pups are Housing Temperature
born dead, or if pups are born live and then die.6,7 Stillbirth Seasonal changes Odors (human or rodent)
or death immediately postpartum may be underreported
as a cause of lost neonates. With embryonic or perinatal In addition to the factors discussed previously, a host of
lethal recessives, litter sizes will be reduced and an absence other things may also influence breeding performance. An
144 145
 Troubleshooting
colony performance

important fact to remember is that reproduction is a luxury performance, but agents currently prevalent in rodent facilities
function. When an animal is stressed, it is more concerned tend to have effects on research rather than animal health. If
with remaining alive. Ensuring its future through genetic animals cannot breathe due to overwhelming Pneumocystis
contribution to the next generation is hardly possible if the infection, they certainly will not breed. If a clinically ill rodent
animal is dead. If animals are stressed, for whatever reason, does breed, it is at risk for fetal death and resorption.
reproduction will suffer.
Changes in the environment often result in production
Watching the behavior of the animals in their home cage is problems that extend across multiple transgenic lines, and
an underutilized approach to defining the nature of breeding sometimes across multiple rodent rooms within a facility.
difficulties. Stress-induced stereotypies or behaviors related to Disruption of the light cycle can have a profound impact on
neurobehavioral phenotypes may prevent normal copulatory successful breeding and normal animal behavior.18 The usual
behavior or impair maternal rearing abilities. In the case problem is persistent light, as a failure of the lights to turn
of an adverse neurobehavioral phenotype influencing pup on is detected during normal working hours. Most breeding
development and survival, fostering pups is often necessary. behavior takes place during the first few hours of the dark
When evaluating troubles in production or breeding, it is cycle. This is unfortunately, the most frequent time that dark
important to remember that infanticide and cannibalism are cycles are interrupted by manual light override. Regular
normal behaviors in response to stress and dead pups. Efforts manual light override will result in a decrease in the number
should be directed to determine which stressful event may of pregnancies detected and litters produced. Failure of
have resulted in pup killing or pup death. automated light systems to switch off, resulting in 24 hours
of light, will cause persistent estrus in rats.19 Although wild
The nutritional plane of the breeders can influence productivity mice are usually described as “long-day breeders,” in many
of the animals. An obese male is not able to execute normal cases this is more truly related to resource availability rather
mounting behavior and intromissions. He may have a low than day length.20 Many facilities use a 14:10 light:dark cycle
libido or preputial infections because he cannot groom to attempt to positively influence mouse reproduction. In
effectively. His sperm may also be of poor quality, resulting in the authors’ experience, this light cycle neither helps nor
subfertility.12,13 An obese female may not have the hormonal harms rat reproduction. In addition, rodents see into the UV
milieu to support ovulation, let alone pregnancy, depending spectrum, but full-spectrum lights are rarely, if ever, used in
on the level of obesity.14 She may also have difficulties during rodent facilities.
parturition. Obese and underweight females may not be able
to nutritionally support lactating pups. Rodents are some Noise and vibration can also have adverse effects on
of the few animals produced in large numbers that are not pup viability, with a noted increase in stillborn pups and
given nutritional support for breeding and lactation. When cannibalism in cages with pups less than one week of age.21
considering diet, consider that animals may benefit from either Noise may also result in seizures in some strains, such
an increase or decrease in fat. The literature supports that as DBA/2 and FVB/N. Again, in the authors’ experience,
different strains have different macronutrient preferences, and repeated, constant or regular noises allow the animals to
milk quality has been shown to be affected by the type of fat in adapt somewhat (rats and mice breed well in subways, for
the diet.15,16,17 example), but intermittent or unpredictable noises can have
negative effects. Noise and vibration as a result of nearby
The health of an individual animal can influence breeding blasting for construction or use of an air drill or jackhammer
performance. Overall colony health can also affect breeding during renovations can devastate litters in close proximity.
146 147
 Troubleshooting
colony performance

Vibrations within the animal facility as a result of normal,

regular activities also need to be considered as having
potential to adversely affect production and pup viability.
Vibrations within walls from HVAC units, in individually
ventilated racks, and as a result of rack and cage movement
for cleaning may need to be addressed when attempting
to minimize vibrations that might affect fragile colonies.
Consideration should be given, however, to the hearing range
of mice and rats and if nearby activities are audible to them.22
For ultrasonic emissions, commercially available bat detectors
can shift the ambient environmental ultrasonic noise to human
hearing range.

Environmental temperature within the room, as well as within

the cage, must be considered in establishing optimal breeding Figure 3. Rat Nesting
conditions. Temperature is influenced by air movement, and
many animals are housed in individually ventilated cages. mature male. Avoid all possible contact with bedding or
Some types of individually ventilated cages have air moving odors from breeding or male cages. Harem systems can be
through them at rapid speed from small apertures, a situation challenging for some breeding mice, since dominant females
that many mice may find both aversive and chilly. can suppress the reproduction of subordinates in the cage
The thermoneutral zone of mice is from 29.6 °C to 30.5 °C; or commit infanticide to maximize their own reproductive
however, 21-25 °C is comfortable for people working in contributions.24 Try to keep the male in the cage because
protective equipment. Provision of nesting material allows the male pheromones accelerate reproductive maturity in female
animals control over their environment as well as expression offspring. Odors from disinfectants or chemicals associated
of normal behavior. Nesting material or shelters also allow with animal facility renovation may have an impact on fertility,
dams to keep neonates warm, thus improving pup survival. pheromonal recognition associated with copulatory behavior,
Rats will also use nesting material if it’s provided, especially and pheromonal recognition of pups by the dam.25 When
pregnant females, although there may be a learning curve for investigating production-related problems across multiple
rats not reared on nesting material (Figure 3).23 rooms within a facility, consider any recent changes to animal
care and husbandry practices. Additionally, the introduction
The use and function of pheromones in mice and rats has of new animal care or research staff into an animal room may
been discussed, and it is not surprising that odors can affect have a negative effect on production parameters if staff are
rodent breeding behavior and maternal care. Scent is one new to rodent handling or wear strong scents. Training for
of the mouse’s primary sensory modalities, but often little these individuals is important to avoid these influences.
thought is given to managing pheromones in colonies. For
most animals, this will not matter, but for sensitive strains, As tightly as the animals’ environment is controlled today,
it can be very important. Exceptionally poor breeders or changes in production parameters are still evident as a result
strains sensitive to pheromonal input may benefit from the of seasonal changes.26,27 A seasonal breeding depression
following suggestions. Never house breeding cages adjacent is often noted during late fall and winter months. There is
to each other, or adjacent to any cage containing a sexually no remedy for this phenomenon, but advance planning to
148 149
 Troubleshooting
colony performance

increase the number of breeder pairs will permit breeding cage for breeding. Checking for copulatory plugs is also
goals to be met. required to confirm that breeding has been successful. This
approach is also sometimes used to track the specific day of
Solutions gestation for embryonic development studies.
After the problem has been identified, the next step is
examining potential solutions. Solutions should be thoroughly If the problem is related to maternal care, pup fostering
discussed and documented to enable recognition of which should be considered. Again, this paradigm is labor intensive
remedy was pivotal in solving a production-related problem. and requires additional animals to serve as foster dams.
If animals are challenging breeders, documentation of their Fostering is used for lactational problems and for pups that
special needs should accompany them if they are shared with are not thriving due to deficient maternal rearing capabilities.
other investigators. Some solutions for rescue of a transgenic Outbreds or hybrids make excellent foster dams since they
line can be costly and can also require euthanasia of valuable seem to have excellent mothering abilities. These foster
breeders if assisted reproductive technologies are needed. dams must have a coat color different than the fosterlings.
Simple, easy-to-implement changes should be attempted Knowledge of gestation lengths for the foster dam as well
initially before moving on to more complicated fixes. as the donor dam is critical, because the gestation length of
the foster female may be different than that of the transgenic
Retaining older breeding pairs but also establishing as many female and the births of both litters must be timed to have
new pairs as possible should be the first step. If possible, pups as close in age as possible. Pups from each litter
introduction of new breeding stock, such as young, breeding- should ideally be within one to two days of age of each other.
age, inbred females to established breeder males may also Pups can be fostered to dams with older litters (up to 5 days
help. If these two approaches fail, use of a superovulation older) if that is all that is available. The number of fosterlings
hormone protocol (HCG and PMSG) to synchronize the should approximate that of the original foster litter, with foster
estrus cycle of the females is suggested. In older females, pups euthanized to adjust the total litter size. There are many
this protocol will not result in overproduction of oocytes but specific techniques to actually introduce the foster pups to the
will serve to artificially stimulate the gonadal-hypothalamic- dam, and it is often the preference of the individual managing
pituitary axis, bringing females into sexual receptivity. the fostering program in choosing a technique.

During all of these efforts, it is advised to monitor breeders The authors prefer the following technique:
and check the females daily, first thing in the morning, for Gently remove the foster mom from the home cage. Take the
plugs that would indicate successful breeding overnight. dam’s original pups that will be euthanized and set them to
Daily checks should be conducted in the lowest-stress the side. Place the new pups into the foster nest and gently
manner possible, including, perhaps, the provision of a mix the new pups with any remaining pups used to equilibrate
small food treat as a positive reward (i.e., a single black-oil the litter size. Rub the nesting material and dirty bedding for
sunflower seed). If necessary, a timed breeding paradigm can the foster cage over the new pups. Pick up the foster mom by
be used, but recognize that effort, time and skill are required the tail or by scruffing and hold her over the combined litter,
to successfully accomplish this. stimulating the foster mom to urinate on the litter. Then, place
the foster mom into the cage and replace the cage on the
If a limited number of females are available, daily vaginal rack. When monitoring the foster mom for acceptance of the
swabs can be collected and read to determine if females are new pups, do not disturb the cage and its inhabitants.
cycling regularly and when to place a female into a male’s

150 151
 Part 8 References

Other assisted reproductive techniques (ART), such as

in vitro fertilization28,29 and intracytoplasmic sperm injection,30,31
are well-known techniques in mice and rats, but will not be 1. Murray, S. A. et al. Mouse gestation length is genetically determined.
described further. ARTs are generally a last resort for a strain, PLoS One 5, e12418 (2010).
or used to obtain a large number of animals very rapidly. 2. Casellas, J. Medrano, J. F. Within-Generation Mutation Variance for
Litter Size in Inbred Mice. Genetics 179, 2147-2155 (2008).
They also have their place in cryopreservation32 and embryo
3. Suto, J. Genetic analysis of litter size in mice. The Journal of Veterinary
transfer rederivation of colonies. Medical Science 77, 353-358 (2015).
4. Bowman, J. C. & Falconer, D. S. Inbreeding depression and heterosis
Conclusion of litter size in mice. Genet Res Camb 1, 262-274 (1960).
Breeding rodents for research use can be a challenging 5. Pritchett-Corning, K. R., Shek, W. R., Henderson, K. S. & Clifford, C. B.
process with many pitfalls. It is a multi-step process with Companion Guide to Rodent Health Surveillance for Research Facilities. 2nd
edn, (Charles River, 2010).
challenges possible at many different points in the cycle.
Environment, genetics, husbandry can all affect breeding and 6. Weber, E. M., Algers, B., Hultgren, J., Olsson, I. A. S. Pup mortality in
laboratory mice - infanticide or not? Acta Veterinaria Scandinavica 55, (2013).
colony performance.
7. Weber, E. M., Algers, B., Wurbel, H., Hultgren, J. Olsson, I. A. Influence
of strain and parity on the risk of litter loss in laboratory mice. Reprod Domest
If you breed rodents, share information with colleagues and Anim 48, 292-296 (2013).
facility veterinarians. Stay organized so that problems will be 8. Osada, T. et al. Male reproductive defects caused by puromycin-
noticed quickly. If a problem is suspected, be proactive. It is sensitive aminopeptidase deficiency in mice. Mol Endocrinol 15, 960-971
(2001).
unlikely problems will get better on their own, so help is always
9. Nagai, M. et al. Mice lacking Ran binding protein 1 are viable and show
advisable, even if it is just brainstorming with someone about male infertility. FEBS Lett 585, 791-796 (2011).
what might be wrong. The professionals at Charles River are 10. Boden, M. J., Varcoe, T. J., Voultsios, A. & Kennaway, D. J.
ready to help you with your colony management challenges at Reproductive biology of female Bmal1 null mice. Reproduction 139, 1077-
any time. 1090 (2010).
11. Nishimori, K. et al. Oxytocin is required for nursing but is not essential
for parturition or reproductive behavior. Proc Natl Acad Sci U S A 93, 11699-
11704 (1996).
12. Mitchell, M., Bakos, H. W. & Lane, M. Paternal diet-induced obesity
impairs embryo development and implantation in the mouse. Fertil Steril 95,
1349-1353 (2011).
13. Bakos, H. W., Mitchell, M., Setchell, B. P. & Lane, M. The effect of
paternal diet-induced obesity on sperm function and fertilization in a mouse
model. Int J Androl (2010).
14. Robker, R. L., Wu, L. L. & Yang, X. Inflammatory pathways linking
obesity and ovarian dysfunction. J Reprod Immunol 88, 142-148 (2011).
15. Hoag, W. G. & Dickie, M. M. A comparison of five commercial diets in
two inbred strains of mice. Proc Anim Care Panel 10, 109-116 (1960).
16. Smith, B. K., Andrews, P. K. & West, D. B. Macronutrient diet selection
in thirteen mouse strains. Am J Physiol Regul Integr Comp Physiol 278, R797-
805 (2000).
17. Teter, B. B., Sampugna, J. & Keeney, M. Milk fat depression in C57Bl/6J
mice consuming partially hydrogenated fat. J Nutr 120, 818-824 (1990).

152 153
 Notes

18. Van der Meer, E., Van Loo, P. L. & Baumans, V. Short-term effects of a
disturbed light-dark cycle and environmental enrichment on aggression and
stress-related parameters in male mice. Lab Anim 38, 376-383 (2004).
19. Browman, L. G. Light in its relation to activity and estrus rhythms in the
albino rat. Journal of Experimental Zoology 75, 375-388 (1937).
20. Bronson, F. H. Light intensity and reproduction in wild and domestic
house mice. Biol Reprod 21, 235-239 (1979).
21. Rasmussen, S., Glickman, G., Norinsky, R., Quimby, F. W. & Tolwani,
R.J. Construction noise decreases reproductive efficiency in mice. J Am
Assoc Lab Anim Sci 48, 363-370 (2009).
22. Reynolds, R. P., Kinard, W. L., Degraff, J. J., Leverage, N. & Norton,
J. N. Noise in a laboratory animal facility from the human and mouse
perspectives. J Am Assoc Lab Anim Sci 49, 592-597 (2010).
23. Van Loo, P. L. & Baumans, V. The importance of learning young: the
use of nesting material in laboratory rats. Lab Anim 38, 17-24 (2004).
24. Schmidt, J. et al. Reproductive asynchrony and infanticide in house mice
breeding communally. Animal Behaviour 101, 201-211 (2015).
25. Hunt, P. Lab disinfectant harms mouse fertility. Patricia Hunt interviewed
by Brendan Maher. Nature 453, 964 (2008).
26. Drickamer, L. C. Seasonal variation in litter size, bodyweight and sexual
maturation in juvenile female house mice (Mus musculus). Lab Anim 11, 159-
162 (1977).
27. Lee, T. M. & McClintock, M. K. Female rats in a laboratory display
seasonal variation in fecundity. J Reprod Fertil 77, 51-95 (1986).
28. Miyamoto, H. & Chang, M. C. In vitro fertilization of rat eggs. Nature
241, 50-52 (1973).
29. Whittingham, D. G. Fertilization of mouse eggs in vitro. Nature 220,
592-593 (1968).
30. Kimura, Y. & Yanagimachi, R. Intracytoplasmic sperm injection in the
mouse. Biol Reprod 52, 709-720 (1995).
31. Dozortsev, D., Wakaiama, T., Ermilov, A. & Yanagimachi, R.
Intracytoplasmic sperm injection in the rat. Zygote 6, 143-147 (1998).
32. Tsang, W. H. & Chow, K. L. Cryopreservation of mammalian embryos:
Advancement of putting life on hold. Birth Defects Res C Embryo Today-90,
163-175 (2010)

154 155