Journal of Functional Foods 52 (2019) 603–610

Contents lists available at ScienceDirect

Journal of Functional Foods

journal homepage: www.elsevier.com/locate/jff

Mechanisms underlying the protective effects of blueberry extract against T

ultraviolet radiation in a skin cell co-culture system
⁎ ⁎
Huailing Wanga, , Jie Liub, Daorui Panga, Tong Lic, Rui Hai Liuc,
a
School of Food Sciences and Engineering, South China University of Technology, Guangzhou 510641, China
b
Department of Allergy, The Third Affiliated Hospital of Shenzhen University, Shenzhen 518020, China
c
Department of Food Science, Stocking Hall, Cornell University, Ithaca, NY 14853, USA

A R T I C LE I N FO A B S T R A C T

Keywords: Ultraviolet radiation induces skin damage, inflammation, and aging. To explore the protective effects of blue-
Blueberry extracts berry extract (BE) against ultraviolet-C (UV-C) radiation, we analysed human skin keratinocyte (HaCaT) and
UVC human foreskin fibroblast (HFF) cells alone or in a co-culture, treated or not with BE, after exposure to UV-C.
Co-culture models Surprisingly, MMP-1 was significantly up-regulated in HFF cells and in the co-cultured cell group in response to
MAPK signals
UV-C irradiation (8 mJ/cm2), but not in HaCaT cells. As expected, BE had a significantly protective effects; it
Anti-ultraviolet
decreased DNA fragmentation and inhibited MMP-1 and inflammatory factors expression in response to UV-C
radiation. In addition, BE reduced the accumulation of proteins (MMP-1, c-fos, and c-jnu) in the MAPK (mitogen-
activated protein kinase) pathway after UV-C radiation. Taken together, these results showed that BE exerted a
protective effect against UV-C irradiation, and modulated MMP-1 production through MAPK signalling by direct
and indirect pathways in HaCaT and HFF cells.

1. Introduction collagen fiber degeneration, and changes in the proportions of different

types of collagen (Brinckmann, Acil, Wolff, & Muller, 1995). In human
Ultraviolet (UV) radiation from the sun consists of UV-C skin, transcript levels of genes encoding matrix metalloproteinases
(270–290 nm), UV-B (290–320 nm), and UV-A (320–340 nm, (MMPs) were shown to increase after UV-B exposure (Fisher et al.,
340–400 nm) (Kullavanijaya & Lim, 2005). The UV-A and UV-B radia- 1996). In addition, Brenneisen reported that UV-B could induce MMP-1
tion emitted by the sun can penetrate the atmosphere and reach the production in dermal fibroblasts in vitro (Brenneisen et al., 1999). Those
skin’s surface, causing oxidative stress that triggers acute and chronic observations indicated that the abundance and activity of matrix-de-
damage. Ultraviolet-C radiation, also known as short-wave ultraviolet grading proteases changed after sun exposure. However, the cellular
sterilization, has the weakest penetration through the atmosphere. origin of the enzymes induced in human skin by UV-C radiation has not
However, it can cause serious harm to the human body because of its been clearly identified.
high energy. Acute or chronic UV exposure may cause damage in- Health risks related to UV radiation are becoming more severe with
cluding oxidative stress, DNA damage, and cell inflammation in or- the thinning of the stratospheric ozone layer. It is important to identify
ganisms (He, Li, Huang, Hwang, & Jiang, 2013). It can be absorbed by ways to protect against excessive UV radiation such as UV screening or
different chromospheres in the skin, such as melanin, but it is very other direct or indirect approaches (Gonzalez, Fernandez-Lorente, &
harmful if it is absorbed by DNA, proteins, and lipids (Ye, Sun- Gilaberte-Calzada, 2008). Recently, a number of naturally occurring
Waterhouse, You, & Abbasi, 2017). Excess UV-C radiation can result in active substances have been shown to protect against UV radiation.
depletion of cellular antioxidants, DNA damage, and immune sup- Their modes of action include the reduction of inflammation, oxidative
pression, leading to photo dermatomes, aging, allergies, disfigurement, stress, and DNA damage (Goswami & Haldar, 2015). Another effective
skin cancer, and blindness (Pillai, Oresajo, & Hayward, 2005). approach to protect humans against the detrimental effects of excessive
Clinically, photo-damaged skin exhibits some changes in the dermis UV radiation is to increase the consumption of antioxidant compounds
such as alterations of the extra-cellular matrix, especially in epidermal such as flavones, peptides, polysaccharides, and terpenoids.
cells (Mitchell, 1967). Changes related to UV exposure include the ac- There is an increasing body of evidence from in vitro and in vivo
cumulation of degenerative elastotic material and glycosaminoglycan, studies that fruit and vegetable extracts can protect against UV-

⁎
Corresponding authors.
E-mail addresses: [email protected] (H. Wang), [email protected] (R.H. Liu).

https://doi.org/10.1016/j.jff.2018.11.037
Received 29 September 2018; Received in revised form 17 November 2018; Accepted 18 November 2018
Available online 04 December 2018
1756-4646/ © 2018 Elsevier Ltd. All rights reserved.
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

radiation via modulation of detoxification enzymes (Costa, Gallego, & pre-treated with BE for 2 h before exposure to UV-C radiation (8 mJ/
Tomaro, 2002; Pratheeshkumar, Raphael, & Kuttan, 2010) and cm2). After incubation for 12 h, DNA was extracted from HaCaT and
scavenging oxidative agents (Galindo, Jacques, & Kalt, 2000), and sti- HFF cells using a Hipure Tissue DNA Mini kit (Magen, Guangzhou,
mulation of the immune system (Hart, Gorman, & Finlay-JonesO, 2011; China) according to the manufacturer’s instructions. The DNA frag-
Ullrich, 2005). Grape seed extract is a potential chemo-preventive ments were separated by electrophoresis in 1.2% agarose gels con-
candidate to reduce oxidative stress induced by UV-B in skin (Filip taining GenGreen (55 V/cm, 150 min). Ladder formation of oligonu-
et al., 2011). Green tea products demonstrated photo-protective effi- cleosomal DNA was detected under UV light (Bio-Rad ChemiDoc MP).
cacy against UV radiation (Silva et al., 2013). Ultraviolet-C radiation
can induce pro-inflammatory cytokines including TNF-α, IL-1ß, IL-6, 2.5. Detection of antioxidant enzyme activity and MMP-1 contents in cells
and IL-8, and activate NF-κB or mitogen-activated protein kinases treated with BE and UV-C radiation
(MAPKs), which play important roles in various inflammatory skin
diseases (Barr & Bogoyevitch, 2001; Roduit & Schorderet, 2008; Shim, We detected superoxide dismutase (SOD) activity and the mal-
Kwon, Han, & Hwang, 2008). ondialdehyde (MDA) content in cells using kits (Beyotime
Many studies have documented the deleterious effects of UV ra- Biotechnology, Jiangsu, China). Cells were seeded in 6-well plates, and
diation on the skin. Skin oncology research has highlighted that UV then cultured for 24 h. The HaCaT and HFF cells were pretreated with
radiation is the main etiological factor in the development of skin BE for 2 h before exposure to UV-C radiation (8 mJ/cm2). After in-
cancer. It is crucial to identify compounds that can reduce the damage cubation for 12 h, supernatants and cells were collected, and then the
caused by harmful UV radiation, and to find a balance between bene- SOD activity and MDA content were determined. The MMP-1 content
ficial and harmful solar UV effects. In this study, we evaluated the was determined by ELISA (Neobioscience, China) according to the
protective effects of a blueberry extract (BE) against UV-C radiation manufacturer’s instructions.
(8 mJ/cm2) in two types of human skin cells: HaCaT cells (keratino-
cytes) and HFF cells (fibroblasts). To uncover the mechanism of the 2.6. Relative gene transcript levels in HaCaT and HFF cells exposed to UV-C
protective effect, we detected inflammatory factors and components of radiation
MAPK signaling pathways in the skin cell models, and quantified the
transcript levels of their encoding genes. Total RNA was isolated from cells in the control and BE-treated
groups using Trizol reagent (Life Technologies, USA). Quantitative real-
2. Materials and methods time PCR was carried out using SYBR Green Super-mix (Bio-Rad,
Hercules, CA, USA). The real-time PCR analyses were performed in
2.1. Chemicals and reagents triplicate using the Bio-Rad MiniOption™ Real Time PCR Detection
System. The HaCaT and HFF cells were pretreated with BE for 2 h be-
Phosphate-buffered saline (PBS), cell culture medium (DMEM), and fore exposure to UV-C radiation (8 mJ/cm2). After incubation for 24 h,
fetal bovine serum (FBS) were purchased from GIBCO (Life cells were harvested. The primer sequences for RT-qPCR are shown in
Technologies, Grand Island, NY, USA). We purchased iTaq Universal Table 1. The relative transcript level of each gene was calculated using
SYBR Green Super-mix and gene-specific primers from Bio-RAD the comparative threshold cycle method normalized to that of Homo-
(Hercules, CA, USA). Primers for the genes p38MAPK, c-fos, c-Jnu, GAPDH (reference gene). Relative gene expression data were obtained
MMP-1, IL-1β, IL-8, TNF-a, and IL-6 were synthesized by the Shanghai from Real-Time quantitative PCR results using the 2−ΔΔCt method. All
Sangon Biotech Co. Ltd. (Shanghai, China). Antibodies to p38MAPK, c- results are shown as mean ± SD (n = 3).
fos, c-Jnu, MMP-1 were purchased from Cell Signaling Technologies
(Beverly, MA, USA). 2.7. Western blot analyses

2.2. Blueberry sample and standards preparation Proteins were extracted for analysis by western blotting as reported
previously (Liu, Jacob, & Tennant, 1997). The HaCaT and HFF cells
“Bluecrop” blueberry was purchased from Jikang Co. (Jilin
Province, China). The blueberry extract was prepared as reported pre- Table 1
viously (Wang et al., 2017). The primer sequences for RT-qPCR.
Gene GeneID Direction Primer sequences (5′–3′)
2.3. Cell viability assay and protective effects of BE against UV-C radiation
HomoGAPDH 2597 Forward GTCAGTGGTGGACCTGACCT
The cytotoxicity of BE against HaCaT and HFF cells was evaluated Reverse AGGGGTCTACATGGCAACTG
as previously described (Felice, Sun, & Liu, 2009). Cells were plated in HomoMMP-1 4312 Forward TTCAGCCAGGCCCAGGTA
96 well plates (1 × 105 cells/well), and incubated with BE for 24 h at Reverse TGAGCAGCCACACGATACAAGT
37 °C. The cells were stained with methylene blue to determine the Homoc-fos 2353 Forward CTCGGGCTTCAACGCAGACTA
survival rate as described previously (Felice et al., 2009). The protec- Reverse GGAATGAAGTTGGCACTGGAGAC
tive effect of BE against UV-C radiation was detected by measuring the HomoIL-1β 3553 Forward AAAAGCTTGGTGATGTCTGG
cell survival rate. We use the UV crosslinker instrument to carry out Reverse TTTCAACACGCAGGACAGG
experiments at room temperature and the instrument was placed on the Homoc-jnu 3725 Forward AGAATCCGAAGGGAAAGGAA
aseptic workbench. after alcohol disinfection. Emission spectrum re- Reverse CTTCTCCTTCAGCAGGTTGG
gion: UV-C (270–290 nm), time of illumination: 5 s, and the distance HomoNF-κB 4790 Forward CAAAGTAGACCTGCCCAGAC
between ultraviolet light source and sample is about 3.5 cm. The total Reverse GACCTCTCTCTAATCAGCCC
light output was 8 mJ/cm2.
HomoIL-6 3569 Forward GTGTGAAAGCAGCAAAGAGGC
Reverse CTGGAGGTACTCTAGGTATAC
2.4. Determination of DNA damage
HomoIL-8 3576 Forward ATGATCTCCAAGCTGGGCCGTG
Reverse TATGAATTCTCAGCCCTCTTCAAAA
To investigate in vitro DNA degradation, we used the DNA ladder
Homop38-MAPK 3576 Forward ATGATCTCCAAGCTGGGCCGTG
assay to measure DNA strand breaks in cells as previously reported (Lu Reverse TATGAATTCTCAGCCCTCTTCAAAA
et al., 2006). Cells were seeded in 6-well plates as described above, and

604
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

were pretreated with BE for 2 h before exposure to UV-C radiation compounds.

(8 mJ/cm2). After incubation for 24 h, cells were harvested, and then
cells were rinsed twice in ice-cold PBS, and then cell lysis buffer was 3.2. Effects of BE on DNA damage after UV-C radiation
added. The cells were incubated for 5 min, then harvested and kept on
ice for 30 min with constant agitation. Insoluble cell debris was dis- Previous studies have reported that UV radiation can induce oxi-
carded following centrifugation (4 °C, 12,000g × 15 min). The protein dative and DNA damage (Monari, Dumont, & Chatgilialoglu, 2015), and
samples were separated by electrophoresis using the method reported generate free radicals that cause DNA damage. Therefore, we detected
previously (Liu et al., 1997). Immunoblotting was performed for MMP- DNA damage in HaCaT and HFF cells treated or not with BE extract
1, c-fos, c-jnu, and p38MAPK. The internal control was β-actin. before exposure to UV-C radiation. We observed DNA fragmentation in
HaCaT and HFF cells after UVC-exposure. After UV-C radiation, the
2.8. Statistical analysis amount of DNA fragmentation was significantly lower in BE-treated
HaCaT and HFF cells than in control cells (Fig. 2). Overall, the results
Data were analyzed using one-way analysis of variance (ANOVA). showed that BE could protect HaCaT and HFF cells from DNA frag-
Tukey’s multiple comparison test was used to detect differences be- mentation induced by UV-C radiation.
tween means, and statistical significance was set at p < 0.05. All sta- A previous report indicated that polyphenols from green tea have
tistical analyses were performed using SPSS software 21.0 (SPSS Inc., DNA-repair effects under UV radiation, implying that they may be
Chicago, IL, USA). Graphs were generated using INSTAT software useful functional components for sunscreen products (Zhou & Shen,
(GraphPad Software, San Diego, CA, USA). 2013).

3. Results and discussion 3.3. MMP-1 contents in cells treated with BE and UV-C radiation

3.1. Anti-Ultraviolet radiation activity of BE Type I collagen, a major component of the dermis, decreases in
abundance in photoaged skin, and can be specifically cleaved by MMP-
According to the cytotoxicity results, BE at non-cytotoxic con- 1 into specific fragments that are susceptible to further hydrolysis by
centrations showed protective effects against UV-C radiation in both other MMPs such as MMP-2 and MMP-9 (Talwar, Griffiths, Fisher,
cell lines (Fig. 1). After exposure to UV-C radiation, the survival rates of Hamilton, & Voorhees, 1995). In a previous study, U-VB radiation sti-
BE-treated cells were 105.4% ± 7.9% in HaCaT cells and mulated MMP-1 production in mesenchyma cells (Brenneisen et al.,
95.4% ± 4.3% in HFF cells, while the survival rate of untreated cells 1999). We investigated the production of MMP-1 in HaCaT and HFF
(control) was 65.5% ± 4.9%. These results showed that BE could cells after UV-C irradiation (Fig. 3). We found that MMP-1 production
protect both HaCaT and HFF cells from UV-C damage. was increased after UV-C exposure in HFF cells but not in HaCaT cells.
To verify whether the protective effects of BE were related to sti- Surprisingly, MMP-1 increased significantly in a co-culture model
mulation of cell proliferation, we monitored cell proliferation after (HaCaT and HFF cells), to higher levels than those in the HFF group.
treatment with BE at a range of concentrations. The results showed that The level of MMP-1 in the supernatants of HFF cells increased from
BE had no obvious effect on cell proliferation; the survival rates were 2245 ± 31.8 pg/mL to 1610 ± 44.8 pg/mL after irradiation UV-C
97.86% ± 4.271% and 104.2% ± 6.241% in HaCaT cells and HFF (8 mJ/cm2).
cells, respectively. To explore the effects of HaCaT cells on HFF cells, the two cell types
In previous studies, juice extracts from berry fruits including blue- were co-cultured in transwell plates, with the HFF cells in the lower
berry, chokeberry, and mulberry showed protective effects against UV- partition and the HaCaT cells in the upper partition. The MMP-1 con-
B radiation in HaCaT cells (Lee et al., 2014). Bog blueberry ameliorated tent was 8432 ± 97.6 pg/mL in the co-culture group, significantly
the destruction of collagen induced by multiple doses of UV-B and then higher than that in the HFF group (2815 ± 17.0 pg/mL). The results
triggered an inflammatory response through MAPK-dependent path- indicated that fibroblasts, but not keratinocytes, were able to produce
ways, which protected against UV-induced photo-aging (Bae et al., MMP-1 in response to UV-C radiation. Interestingly, the fibroblasts
2009). Grape seed extracts remarkably reduced oxidative stress and (HFF) produced more MMP-1 in the co-culture system, suggesting that
apoptosis triggered by UV-B in the skin of SKH-1 mice (Filip et al., they were affected by HaCaT cells in some way.
2011). Tea polyphenols also protected skin against UV radiation and Previous reports have shown that MMP-1 can be produced by both
enhanced the proliferation of fibroblast cells, indicating that it had epidermal keratinocytes and dermal fibroblasts in response to various
potential as a functional component in cosmetics (Wei, Liu, Xiao, & stimuli (Dayer, Beutler, & Cerami, 1985; Eisen, 1969), and plays a key
Wang, 2009). These substances are potential UV chemo-preventive role in remodeling (Woessner, 1991). Another study found that

HaCaT HFF
120 Proliferative Control Cyto-Control 120 120 Proliferative Control Cyto-Control 120

100 Cell proliferation Cytotoxicity 100 100 Cell proliferation Cytotoxicity 100
Cell proliferation (%)

Cell proliferation (%)

Cytotoxicity (%)

Cytotoxicity (%)

80 80 80 80

60 60 60 60

40 40 40 40

20 20 20 20

0 0 0 0

-20 -20 -20 -20

0 5 10 15 0 5 10 15
Conc.(mg/mL) Conc.(mg/mL)
Fig. 1. Anti-proliferation and cytotoxicity activities of blueberry extracts against HaCaT and HFF cells (Mean ± SD, n = 3), each value represents the mean ± SD of
triplicates.

605
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

Fig. 2. DNA fragmentation of HaCaT and HFF cells after UVC-exposed. (A) Blueberry extracts inhibited the DNA fragmentation exposed to UVC in HaCaT cells; (B)
Blueberry extracts inhibited the DNA fragmentation exposed to UVC in HFF cells.

10000 25
HFF HaCaT HFF+HaCaT HFF HaCaT HFF+HaCaT
e3 bcd1
bc 1 d3
8000 20
b1 c2
MMP-1 (pg/mL)

c3 c3
SOD (U/g)

6000 15 a1 ab2 ab2 ab2 b3

a1
a2
d3 a3
4000 c3 10
a3 b3
e1
d1 c1 a1 b1 a2 a2 a2
2000 a2 a2 5

0 0
UVC - + + + + - + + + + - + + + + UVC - + + + + - + + + + - + + + +
BE (mg/mL) - - 6 8 10 - - 6 8 10 - - 6 8 10 BE (mg/mL) - - 6 8 10 - - 6 8 10 - - 6 8 10

Fig. 3. The expression of the MMP-1 in HaCaT and HFF cells after treatment
with BE. HaCaT represent the contents of SOD and MDA in HaCaT cells group; 10
HFF HaCaT HFF+HaCaT
HFF represent the contents of SOD and MDA in HFF cells group; HFF + HaCaT: abc1
represent the contents of SOD and MDA in co-culture group with HaCaTand 8 ab1 ab1 d2
cells. Values with (Mean ± SD, n = 3), letters in each color column are sig- a1 a1 c2
MDA (pg/mL)

c3
nificantly different (p < 0.05). (For interpretation of the references to colour 6
in this figure legend, the reader is referred to the web version of this article.) a2 ab2 ab3
a2 a3 ab3 a3
4

keratinocytes in culture could not produce MMP-1 in response to UV-B 2

irradiation (Fagot, Asselineau, & Bernerd, 2002). Consistent with those
results, we found that foreskin fibroblasts (HFF) could produce MMP-1, 0
but epidermal keratinocytes (HaCaT) could not.
UVC - + + + + - + + + + - + + + +
BE (mg/mL) - - 6 8 10 - - 6 8 10 - - 6 8 10

Fig. 4. The contents of the SOD and MDA in HaCaT and HFF cells after treat-
3.4. Antioxidant enzyme activity in BE-treated cells exposed to UV-C ment with BE. HaCaT represent the contents of SOD and MDA in HaCaT cells
radiation group; HFF represent the contents of SOD and MDA in HFF cells group;
HFF + HaCaT: represent the contents of SOD and MDA in co-culture group with
One method to ameliorate the effects of UV damage is to increase HaCaTand cells. Values with (Mean ± SD, n = 3), letters in each color column
the intake of antioxidants to reduce inflammation and oxidative stress are significantly different (p < 0.05). (For interpretation of the references to
and prevent DNA damage. This topic has attracted much attention. colour in this figure legend, the reader is referred to the web version of this
Animals and plants have antioxidant systems that can defend against article.)
the adverse effects of UV radiation. We investigated the activities of
antioxidant enzymes and the amount of MDA, a marker of lipid per- decreased after UV-C exposure in all groups, but treatment with BE
oxidation, in HaCaT and HFF cells after UV-C radiation treatments. As increased the activity of SOD by 162.4%, 135.1%, and 237.3% in the
shown in Fig. 4, MDA production increased in HFF and HaCaT cells HFF group, HaCaT group, and co-culture group, respectively.
after UV-C exposure. The BE treatment dramatically inhibited the ac- Previous reports have indicated that pre-treatment with EGCG
cumulation of MDA by 43.7%, 53.5%, and 65.7% in the HaCaT group, (epigallocatechin-3-gallate) from green tea restored the UV-induced
co-culture group, and HFF group, respectively. The activity of SOD was

606
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

decrease in glutathione and stimulated activity of the antioxidant en-

10.210 ± 1.094
zyme glutathione peroxidase (Katiyar, Afaq, Perez, & Mukhtar, 2001).

0.196
0.127
0.741
0.154
0.234

1.000 ± 0.314

0.592 ± 0.286
0.242 ± 0.034
0.177 ± 0.088

1.000 ± 0.138

201.0 ± 53.88
136.4 ± 43.34
33.34 ± 15.49
1145 ± 268.6
Another study reported that tea polyphenols protected against UV ra-

HomoMMP-1

HomoMMP-1

HomoMMP-1
±
±
±
±
±
diation in mice by scavenging free radicals, increasing SOD activity,

1.000
0.373
1.794
1.546
0.546
and decreasing MDA accumulation in the serum (Yang, Zheng, Shen, &
Zhang, 2016). In addition, a green tea seed extract induced a significant
increase in antioxidant enzyme activity under UV-B radiation, com-
pared with that in an untreated control group (Lim et al., 2014). These

0.216
0.234
0.028
0.150
0.171

0.203
0.342
0.084
0.147
0.071

0.205
0.430
0.325
0.220
0.119
results suggest that an important repair mechanism of BE is to promote

±
±
±
±
±

±
±
±
±
±

±
±
±
±
±
Homoc-fos

Homoc-fos

Homoc-fos
the activity of antioxidant enzymes.

1.000
1.084
0.568
0.513
0.555

1.000
2.048
1.849
0.712
0.119

1.000
7.470
3.568
0.950
0.409
3.5. Quantitative Real-time RT-PCR analysis of gene expression

Ultraviolet radiation damages cells by causing DNA damage, which

0.125
0.113
0.182
0.092
0.031

0.061
0.272
0.144
0.308
0.131

0.105
0.453
0.320
0.111
0.017
triggers an inflammatory response (Kennedy et al., 1997; Pillai et al.,

Homoc-jnu

Homoc-jnu

Homoc-jnu
±
±
±
±
±

±
±
±
±
±

±
±
±
±
±
2005). In another study, human retinal pigment epithelial ARPE19 cells

1.000
1.124
0.840
0.736
0.840

1.000
2.713
1.040
1.207
0.182

1.000
5.579
1.481
1.301
0.069
were irradiated with UV-C (100 J/m2), and their MAPK signal pathways
were analyzed. The results showed that activator protein-1 (AP-1) was
activated through phosphorylation of c-Jun and c-Fos by JNK and p38,
respectively (Roduit & Schorderet, 2008). In this study, to investigate

0.225
0.194
0.054
0.088
0.021

0.284
0.106
0.267
0.082
0.055

0.543
104.4
5.319
16.10
64.55
the inflammatory responses to UV-C radiation, HaCaT and HFF cells

HomoIL-1β

HomoIL-1β

HomoIL-1β
±
±
±
±
±

±
±
±
±
±

±
±
±
±
±
were treated or not with various concentrations of BE before exposure

1.000
1.814
0.182
0.312
0.221

1.000
1.289
1.236
0.661
0.445

1.000
621.8
192.7
162.7
92.96
to UV-C radiation, and then we determined the transcript levels of the
following cytokine genes: IL-1β, NF-κB, IL-6, IL-8, MMP-1, p38MAPK, c-
Jnu, and c-fos. The results are shown in Table 2.
The transcript level of the reference gene GAPDH in the control

0.463
0.238
0.025
0.074
0.068

0.248
0.704
0.253
0.093
0.252

1.000 ± 0.464

904.7 ± 244.4
648.2 ± 137.8
Homop38-MAPK

Homop38-MAPK

Homop38-MAPK

1997 ± 252
1102 ± 247
group was set to 1, and the transcript levels of other genes were de-

±
±
±
±
±

±
±
±
±
±
termined relative to this level. The relative transcript level of MMP-1
The relative mRNA gene expression of MMP-1, c-fos, c-Jnu, IL-1β, NF-κB, IL-6 and IL-8 by UVC-induced (Mean ± SD, n = 3).

1.000
2.193
0.785
0.130
0.221

1.000
2.397
1.318
1.007
0.912
significantly increased after UV-C-exposure, and its transcript levels
were lower with increasing concentrations of the BE in co-culture
model. There was a small increase in MMP-1 transcript levels in the HFF
group, but no increase in the HaCaT group, consistent with the MMP-1
0.211
0.437
0.023
0.032
0.006

0.061
0.279
0.205
0.052
0.222

0.535
4.568
0.063
0.096
0.132
contents results. The other mRNAs (c-fos, c-jnu, and p38MAPK) showed
the same trends. In HaCaT cells, compared with the normal group (not
±
±
±
±
±

±
±
±
±
±

±
±
±
±
±
HomoIL-8

HomoIL-8

HomoIL-8
1.000
2.853
0.089
0.162
0.125

1.000
2.751
2.217
0.460
0.338

1.000
21.89
0.482
0.364
0.462
treated with UV-C), the control group did not show changes in c-fos and
c-jnu transcript levels in response to UV-C radiation. However, in HFF
cells, UV-C radiation resulted in increased transcript levels of c-fos and
c-jnu. The transcript levels of these genes were even higher in the co-
0.216
0.420
0.169
0.175
0.018

0.490
0.172
0.254
0.458
0.159

0.094
7.652
0.331
0.119
0.257
cultured cell group after UV-C exposure. These findings indicated that
fibroblasts, but not keratinocytes, were able to activate the MAPK signal
±
±
±
±
±

±
±
±
±
±

±
±
±
±
±
HomoIL-6

HomoIL-6

HomoIL-6
1.000
5.413
0.663
0.803
0.755

1.000
3.557
2.766
1.698
1.756

1.000
34.28
3.109
0.171
0.593
pathway in response to UVC radiation.
In all groups, the relative transcript levels of all genes encoding
inflammatory factors were high after UV-C exposure, but pre-treatment
with BE reduced the accumulation of these gene transcripts after UV-C
0.281
0.428
0.095
0.532
0.381

0.100
0.338
0.319
0.065
0.166

0.322
1.448
1.521
0.562
0.174
exposure. In the HaCaT group, the ranges of relative transcript levels of
HomoNF-κB

HomoNF-κB

HomoNF-κB

cytokine genes were as follows: IL-1β, 0.182 ± 0.054 to

±
±
±
±
±

±
±
±
±
±

±
±
±
±
±
1.000
4.918
2.081
1.906
1.043

1.000
3.530
1.682
1.223
0.737

1.000
9.324
8.817
4.279
0.822

0.312 ± 0.088; NF-κB, 2.081 ± 0.095 to 1.043 ± 0.381; IL-6,

0.803 ± 0.175 to 0.663 ± 0.169; and IL-8, 0.162 ± 0.032 to
0.089 ± 0.023. In the HFF group, the ranges of relative transcript le-
vels of cytokine genes were as follows: IL-1β, 0.445 ± 0.055 to
BE (10 mg/mL)

BE (10 mg/mL)

BE (10 mg/mL)
BE (6 mg/mL)
BE (8 mg/mL)

BE (6 mg/mL)
BE (8 mg/mL)

BE (6 mg/mL)
BE (8 mg/mL)

1.236 ± 0.267; NF-κB, 0.737 ± 0.166 to 1.682 ± 0.319; IL-6,

1.698 ± 0.458 to 2.766 ± 0.254; and IL-8, 0.338 ± 0.222 to
Normal

Normal

Normal
Control

Control

Control

2.217 ± 0.205. In the co-culture group, the ranges of relative tran-

script levels of cytokine genes were as follows: IL-1β, 92.96 ± 64.55 to
192.7 ± 5.319; NF-κB, 0.822 ± 0.174 to 8.817 ± 1.521; IL-6,
0.593 ± 0.257 to 3.109 ± 0.331; and IL-8 0.462 ± 0.132 to
Co-culture group (HaCaT and HFF)

0.482 ± 0.063. The relative transcript levels of MMP-1, IL-1β, and IL-6
were concentration-dependent, with the following coefficients of cor-
relation: MMP-1 (R2 = 0.9509), IL-1β (R2 = 0.9465), IL-6
(R2 = 0.9774), and NF-κB (R2 = 0.8724) (see Table 3).
The results indicated that the inflammation signaling pathway was
activated in UV-C-exposed HaCaT and HFF cells, and much more
HaCaTgroup

strongly activated in the co-culture group than in other groups. Overall,

HFF group

the results indicated that HaCaT cells affected the HFF cells in a para-
Table 2

crine manner, although further research is required to determine the

specific mechanism of this effect. In another study, saponins from the

607
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

Table 3 than in the control and BE-treated cell groups. It may be that BE directly
Correlation of mRNA MMP-1, IL-1β, ASC, NF-κB, IL-6, IL-8, c-fos, c-jnu, p38- inhibits the p38MAPK signal pathway. Alternatively, BE may reduce the
MAPK in BE (p < 0.05). secretion of inflammatory cytokines that activate the p38MAPK sig-
Correlation p38MAPK c-Jnu c-fos MMP-1 NF-κB IL-1β IL-6 IL-8 naling pathway by the paracrine system.
To explore the effects of UV-C radiation, we detected the proteins
p38MAPK 1 0.693 0.741 0.462 0.629 0.824 0.792 0.753 MMP-1, p-p38MAPK, p38MAPK, c-Jnu, and c-fos in the various cell
c-Jnu 1 0.92 0.387 0.442 0.78 0.754 0.798
groups by western blotting. The HFF group and co-culture group were
c-fos 1 0.536 0.593 0.941 0.822 0.928
MMP-1 1 0.823 0.563 0.612 0.669 pre-treated BE at a range of concentrations, and then subjected to a UV-
NF-κB 1 0.74 0.885 0.834 C treatment. Figs. 5 and 6 show the levels of the detected proteins
IL-1β 1 0.902 0.969 normalized to that of β-actin as the reference protein. In the HFF group,
IL-6 1 0.953
the MMP-1 level was much lower in the BE-treated cells than in control
IL-8 1
cells after UV-C radiation (inhibition rate, 5.1–19.6%). The c-fos and c-
Jnu levels also decreased slightly after BE treatment, with inhibition
roots of Platycodon grandiflorum prevented UV-A from reducing the rates of 1.93%–15.1% and 9.9–19.4%, respectively. The inhibition rate
expression of MMP-1 and other inflammation factors (Hwang, Kim, of the BE treatment on p38MAPK levels was 4.9–19.8%. These results
et al., 2011). A phenylpropanoid glycoside (verbascoside) and two indicated that BE regulated the MAPK signaling pathway by inhibiting
flavonoids (rutin and quercetin) showed protective effects against UV- the expression of MMP-1, c-fos, and c-jnu.
C-induced cell damage and pro-inflammatory activation (Pastore, In the co-cultured cell group, the MMP-1 level was also much lower
Potapovich, Kostyuk, Mariani, Lulli, De Luca, & Korkina, 2009). The in BE-treated cells than in control cells after UV-C radiation (inhibition
flavonoids apigenin and luteolin inhibited UV-A-induced collagenolytic rate, 3.9–35.2%). The relative levels of c-jnu were also inhibited by BE
MMP-1 production by interfering with Ca2+-dependent MAPKs and AP- in a concentration-dependent manner (2.7–24.8% inhibition). The BE
1 signaling (Hwang, Oh, Yun, & Jeong, 2011). Saponins from the roots treatment significantly decreased the c-fos level (inhibition rate,
of P. grandiflorum also suppressed UVA-induced activation of NF-κB and 6.4–35%) and p38MAPK level (inhibition rate, 12.9–36.0%). These
the phosphorylation of MAPKs, which are upstream modulators of NF- results indicated that BE regulated the MAPK signal pathway through
κB and AP-1 (Hwang, Kim, et al., 2011). Similarly, curcumin inhibited inhibiting the accumulation of MMP-1, c-fos, and c-jnu proteins.
COX-2 expression in HaCaT after UV-B treatment by inhibiting the Previous reports have shown that UV radiation activates multiple
activation of AP-1, p38 MAP kinase, and JNK as potential upstream signaling cascades such as the p38 MAPK, Jun N-terminal kinase, ex-
targets. tracellular signal-regulated kinase 1/2, and NF-κB pathways in skin
In summary, the results showed that the expression of the in- cells (Muthusamy & Piva, 2010). Saponins were shown to inhibit UV-A-
flammation cytokine genes IL-1β, NF-κB, IL-6, and IL-8 was significantly radiation damage via their effects on MAPKs and NF-κB/AP-1-depen-
higher in the control group (with UVC irradiation) than in the Normal dent signaling in HaCaT cells (Hwang, Kim, et al., 2011). Young et al.
group (without UV-C irradiation). Compared with the control group proposed that UV-induced MMP-1 expression might be mediated in part
(Cell), the groups treated with BE showed lower transcript levels of IL- by PKC-dependent activation of TRPV1 and subsequent Ca2+-influx in
1β, NF-κB, IL-6, and IL-8 after UV-C treatment. The transcript levels of human keratinocytes; these results were obtained by knock-down of
other cytokines including MMP-1, c-fos, and c-jnu were significantly TRPV1 using siRNA transfection (Lee et al., 2009). Previous studies
higher in the co-culture group than in the other groups, and BE treat- have also shown that eicosapentaenoic acid can inhibit UV-induced
ment reduced their transcript levels. Ultraviolet-C radiation can cause MMP-1 expression by inhibiting the MEK1/ERK/c-Fos and SEK1/JNK/
an inflammatory reaction that leads to early skin aging and further c-Jun pathways (Kim et al., 2005). Bog blueberry anthocyanins were
damage to the body. Treatment with BE could reduce the expression of found to alleviate photoaging in UV-B-treated human dermal fibroblasts
inflammatory factors, which play roles in the repair of inflammatory through the MAPK signaling pathway (Bae et al., 2009). Our results are
reactions caused by damage in aging skin. consistent with those of previous studies, and showed that p38MAPK, c-
Jun, c-Fos, and MMP-1 levels significantly increased after UV-C ex-
posure. Our results also showed that BE pre-treatment could inhibit the
3.6. Western blot analysis
accumulation of those proteins. Together, our results showed that cells
release inflammatory cytokines through the autocrine system in the
Our results and those of other studies indicated that inflammatory
presence of UV-C, thereby activating the p38MAPK signaling pathway.
cytokines are induced via the autocrine system in the presence of UV-C.
Our results indicated that the transcript levels of p38MAPK, c-Jun, c-Fos,
and MMP-1 were significantly higher in the UV-C irradiated cell groups

Fig. 5. The Gray detection analysis of

the blueberry extracts on UVC-induced
expression of MMP-1, c-fos, c-jnu, and
p38MAPK in HFF group. To verify the
loading of equal amount of protein
sample, β-actin expression was de-
tected. Western blots were quantified
by densitometry. Results obtained
from three independent experiments
and one representative Western blot is
shown. Bar values of three in-
dependent experiments are shown.
Letters in each color column are sig-
nificantly different (p < 0.05). (For
interpretation of the references to
colour in this figure legend, the reader
is referred to the web version of this
article.)

608
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

Fig. 6. The Gray detection analysis of

the blueberry extracts on UVC-induced
expression of MMP-1, c-fos, c-jnu, and
p38MAPK in HFF + HaCaT co-culture
group. To verify the loading of equal
amount of protein sample, β-actin ex-
pression was detected. Western blots
were quantified by densitometry.
Results obtained from three in-
dependent experiments and one re-
presentative Western blot is shown.
Bar values of three independent ex-
periments are shown. Letters in each
color column are significantly different
(p < 0.05). (For interpretation of the
references to colour in this figure le-
gend, the reader is referred to the web
version of this article.)

4. Conclusion Brinckmann, J., Acil, Y., Wolff, H. H., & Muller, P. K. (1995). Collagen synthesis in (sun-)
aged human skin and in fibroblasts derived from sun-exposed and sun-protected body
sites. Journal of Photochemistry and Photobiology B, 27(1), 33–38.
In this study, we explored the mechanism by which BE protects Costa, H., Gallego, S. M., & Tomaro, M. A. L. (2002). Effect of UV-B radiation on anti-
against the harmful effects of UV-C radiation. The results showed that, oxidant defense system in sunflower cotyledons. Plant Science, 162(6), 939–945.
in contrast to HFF cells, HaCaT cells did not produce MMP-1 in response Dayer, J. M., Beutler, B., & Cerami, A. (1985). Cachectin/tumor necrosis factor stimulates
collagenase and prostaglandin E2 production by human synovial cells and dermal
to UV-C radiation. These findings identify the fibroblast as the cuta- fibroblasts. Journal of Experimental Medicine, 162(6), 2163–2168.
neous source of the MMP-1 produced in response to UV-C irradiation, Eisen, A. Z. (1969). Human skin collagenase: Localization and distribution in normal
and also indicate that keratinocytes play a major role in this dermal human skin. Journal of Investigative Dermatology, 52(5), 442–448.
Fagot, D., Asselineau, D., & Bernerd, F. (2002). Direct role of human dermal fibroblasts
MMP-1 induction through an indirect paracrine mechanism involving and indirect participation of epidermal keratinocytes in MMP-1 production after UV-
UV-C-induced cytokine release in epidermal cells. The BE treatment B irradiation. Archives of Dermatological Research, 293(11), 576–583.
decreased MMP-1 production to a greater extent in the co-culture group Felice, D. L., Sun, J., & Liu, R. H. (2009). A modified methylene blue assay for accurate
cell counting. Journal of Functional Foods, 1(1), 109–118.
than in the HFF group. The BE treatment resulted in decreased tran-
Filip, A., Daicoviciu, D., Clichici, S., Bolfa, P., Catoi, C., Baldea, I., & Postescu, I. D.
script levels of inflammatory factor genes including TNF-α, IL-1β, IL-8, (2011). The effects of grape seeds polyphenols on SKH-1 mice skin irradiated with
and IL-6. Furthermore, the BE treatment affected the abundance of multiple doses of UV-B. Journal of Photochemistry and Photobiology B-Biology, 105(2),
proteins in the MAPK pathway such as MMP-1, c-fos, and c-jnu in the 133–142.
Fisher, G. J., Datta, S. C., Talwar, H. S., Wang, Z. Q., Varani, J., Kang, S., & Voorhees, J. J.
HFF group and co-culture group, but not in the HaCaT group. In gen- (1996). Molecular basis of sun-induced premature skin ageing and retinoid antag-
eral, these findings suggest that the use of topical antioxidants could be onism. Nature, 379(6563), 335–339.
an effective strategy to decrease UV-related skin damage. Galindo, C., Jacques, P., & Kalt, A. (2000). Photodegradation of the aminoazobenzene
acid orange 52 by three advanced oxidation processes: UV/H2O2, UV/TiO2 and VIS/
TiO2: Comparative mechanistic and kinetic investigations. Journal of Photochemistry
Compliance with ethics requirements and Photobiology A, 130(1), 35–47.
Gonzalez, S., Fernandez-Lorente, M., & Gilaberte-Calzada, Y. (2008). The latest on skin
photoprotection. Clinics in Dermatology, 26(6), 614–626.
This article does not contain any studies with human and animal Goswami, S., & Haldar, C. (2015). Melatonin as a possible antidote to UV radiation in-
participants performed by any of the authors. duced cutaneous damages and immune-suppression: An overview. Journal of
Photochemistry and Photobiology B-Biology, 153, 281–288.
Hart, P. H., Gorman, S., & Finlay-JonesO, J. J. (2011). Modulation of the immune system
Conflict of interest by UV radiation: More than just the effects of vitamin D? Nature Reviews Immunology,
11(9), 584–596.
The authors declare that they have no conflict of interest. He, X., Li, R., Huang, G., Hwang, H.-M., & Jiang, X. (2013). Influence of marine oligo-
saccharides on the response of various biological systems to UV irradiation. Journal of
Functional Foods, 5(2), 858–868.
Acknowledgments Hwang, Y. P., Kim, H. G., Choi, J. H., Han, E. H., Kwon, K. I., Lee, Y. C., & Jeong, H. G.
(2011). Saponins from the roots of Platycodon grandiflorum suppress ultraviolet A-
Authors are greatly thankful to the Leading Talents Program in induced matrix metalloproteinase-1 expression via MAPKs and NF-kappaB/AP-1-
dependent signaling in HaCaT cells. Food and Chemical Toxicology, 49(12),
Guangdong Province, National Natural Science Foundation of China 3374–3382.
(31501765) and Natural Science Foundation of Guangdong Province – Hwang, Y. P., Oh, K. N., Yun, H. J., & Jeong, H. G. (2011). The flavonoids apigenin and
China (2016A030312001) for financial support, valuable suggestions luteolin suppress ultraviolet A-induced matrix metalloproteinase-1 expression via
MAPKs and AP-1-dependent signaling in HaCaT cells. Journal of Dermatological
and guidelines. Authors are greatly thankful that Tonghua He-Yun Science, 61(1), 23–31.
Company (Jilin Province, China) provides these blueberry samples for Katiyar, S. K., Afaq, F., Perez, A., & Mukhtar, H. (2001). Green tea polyphenol (−)-epi-
this research. gallocatechin-3-gallate treatment of human skin inhibits ultraviolet radiation-in-
duced oxidative stress. Carcinogenesis, 22(2), 287.
Kennedy, M., Kim, K. H., Harten, B., Brown, J., Planck, S., Meshul, C., & Ansel, J. C.
References (1997). Ultraviolet irradiation induces the production of multiple cytokines by
human corneal cells. Investigative Ophthalmology & Visual Science, 38(12), 2483–2491.
Kim, H. H., Shin, C. M., Park, C. H., Kim, K. H., Cho, K. H., Eun, H. C., & Chung, J. H.
Bae, J. Y., Lim, S. S., Kim, S. J., Choi, J. S., Park, J., Ju, S. M., & Kang, Y. H. (2009). Bog
(2005). Eicosapentaenoic acid inhibits UV-induced MMP-1 expression in human
blueberry anthocyanins alleviate photoaging in ultraviolet-B irradiation-induced
dermal fibroblasts. Journal of Lipid Research, 46(8), 1712–1720.
human dermal fibroblasts. Molecular Nutrition & Food Research, 53(6), 726–738.
Kullavanijaya, P., & Lim, H. W. (2005). Photoprotection. Journal of the American Academy
Barr, R. K., & Bogoyevitch, M. A. (2001). The c-Jun N-terminal protein kinase family of
of Dermatology, 52(6), 937–958 quiz 959–962.
mitogen-activated protein kinases (JNK MAPKs). The International Journal of
Lee, S. J., Choi, H. R., Lee, J.-C., Park, H. J., Lee, H. K., Jeong, J. T., & Lee, T.-B. (2014).
Biochemistry & Cell Biology, 33(11), 1047–1063.
The anti-aging effects of various berries in the human skin keratinocyte (HaCaT)
Brenneisen, P., Wlaschek, M., Wenk, J., Blaudschun, R., Hinrichs, R., Dissemond, J., &
cells. Korean Journal of Food Science and Technology, 46(2), 198–204.
Scharffetter-Kochanek, K. (1999). Ultraviolet-B induction of interstitial collagenase
Lee, Y. M., Kim, Y. K., Kim, K. H., Park, S. J., Kim, S. J., & Chung, J. H. (2009). A novel
and stromelyin-1 occurs in human dermal fibroblasts via an autocrine interleukin-6-
role for the TRPV1 channel in UV-induced matrix metalloproteinase (MMP)-1 ex-
dependent loop. FEBS Letters, 449(1), 36–40.
pression in HaCaT cells. Journal of Cellular Physiology, 219(3), 766–775.

609
H. Wang et al. Journal of Functional Foods 52 (2019) 603–610

Lim, J. Y., Kim, O. K., Lee, J., Lee, M. J., Kang, N., & Hwang, J. K. (2014). Protective effect retinal pigment epithelium ARPE19 cells. Apoptosis, 13(3), 343–353.
of the standardized green tea seed extract on UVB-induced skin photoaging in hairless Shim, J.-S., Kwon, Y.-Y., Han, Y.-S., & Hwang, J.-K. (2008). Inhibitory effect of panduratin
mice. Nutrition Research & Practice, 8(4), 398–403. A on UV-induced activation of mitogen-activated protein kinases (MAPKs) in dermal
Liu, R. H., Jacob, J., & Tennant, B. (1997). Chemiluminescent detection of protein mo- fibroblast cells. Planta Medica, 74(12), 1446–1450.
lecular weight markers in Western blot techniques. BioTechniques, 22(4), 594–595. Silva, A. R., Seidl, C., Furusho, A. S., Boeno, M. M. S., Dieamant, G. C., & Weffort-Santos,
Lu, C., Zhu, F., Cho, Y. Y., Tang, F., Zykova, T., Ma, W. Y., & Dong, Z. (2006). Cell A. M. (2013). In vitro evaluation of the efficacy of commercial green tea extracts in
apoptosis: Requirement of H2AX in DNA ladder formation, but not for the activation UV protection. International Journal of Cosmetic Science, 35(1), 69–77.
of caspase-3. Molecular Cell, 23(1), 121–132. Talwar, H. S., Griffiths, C. E., Fisher, G. J., Hamilton, T. A., & Voorhees, J. J. (1995).
Mitchell, R. E. (1967). Chronic solar dermatosis: A light and electron microscopic study of Reduced type I and type III procollagens in photodamaged adult human skin. Journal
the dermis. Journal of Investigative Dermatology, 48(3), 203–220. of Investigative Dermatology, 105(2), 285–290.
Monari, A., Dumont, E., & Chatgilialoglu, C. (2015). Editorial: Radiation-induced and Ullrich, S. E. (2005). Mechanisms underlying UV-induced immune suppression. Mutation
oxidative DNA damages. Frontiers in Chemistry, 3. Research/Fundamental and Molecular Mechanisms of Mutagenesis, 571(1), 185–205.
Muthusamy, V., & Piva, T. J. (2010). The UV response of the skin: A review of the MAPK, Wang, H., Guo, X., Hu, X., Li, T., Fu, X., & Liu, R. H. (2017). Comparison of phytochemical
NFkappaB and TNFalpha signal transduction pathways. Archives of Dermatological profiles, antioxidant and cellular antioxidant activities of different varieties of blue-
Research, 302(1), 5–17. berry (Vaccinium spp.). Food Chemistry, 217, 773–781.
Pastore, S., Potapovich, A., Kostyuk, V., Mariani, V., Lulli, D., De Luca, C., & Korkina, L. Wei, X., Liu, Y., Xiao, J., & Wang, Y. (2009). Protective effects of tea polysaccharides and
(2009). Plant polyphenols effectively protect HaCaT cells from ultraviolet C-triggered polyphenols on skin. Journal of Agriculture and Food Chemistry, 57(17), 7757–7762.
necrosis and suppress inflammatory chemokine expression. In M. Diederich (Vol. Woessner, J. F., Jr. (1991). Matrix metalloproteinases and their inhibitors in connective
Ed.), Natural compounds and their role in apoptotic cell signaling pathways: Vol. 1171, tissue remodeling. FASEB Journal: Official Publication of the Federation of American
(pp. 305–313). Societies for Experimental Biology, 5(8), 2145–2154.
Pillai, S., Oresajo, C., & Hayward, J. (2005). Ultraviolet radiation and skin aging: Roles of Yang, M. J., Zheng, Y., Shen, H. Y., & Zhang, H. (2016). The effects of tea polyphenols on
reactive oxygen species, inflammation and protease activation, and strategies for the serum SOD activity and MDA content in ultraviolet irradiated mice. Journal of
prevention of inflammation-induced matrix degradation - A review. International Kaili University, 34(6), 68–70.
Journal of Cosmetic Science, 27(1), 17–34. Ye, Y., Sun-Waterhouse, D., You, L., & Abbasi, A. M. (2017). Harnessing food-based
Pratheeshkumar, P., Raphael, T. J., & Kuttan, G. (2010). Protective role of perillic acid bioactive compounds to reduce the effects of ultraviolet radiation: A review exploring
against radiation - Induced oxidative stress, cytokine profile, DNA damage, and in- the link between food and human health. International Journal of Food Science &
testinal toxicity in mice. Journal of Environmental Pathology, Toxicology and Oncology, Technology, 52(3), 595–607.
29(3), 199–212. Zhou, D. H., & Shen, X. (2013). Progress on the anti-UV radiation effects of green tea
Roduit, R., & Schorderet, D. F. (2008). MAP kinase pathways in UV-induced apoptosis of polyphenols. Modern Preventive Medicine, 40(16), 2991–2995.

610