Biochimie 181 (2021) 169e175

Contents lists available at ScienceDirect

Biochimie
journal homepage: www.elsevier.com/locate/biochi

DHA induces Jurkat T-cell arrest in G2/M phase of cell cycle and
modulates the plasma membrane expression of TRPC3/6 channels
Hamza Saidi a, b, 1, Babar Murtaza a, 1, Amira Sayed Khan a, Elhadj Ahmed Koceir b,
Aziz Hichami a, Naim Akhtar Khan a, *
a
Physiologie de la Nutrition & Toxicologie (NUTox), UMR INSERM U1231 Lipides, Nutrition & Cancer, Universit

e de Bourgogne Franche-Comt

e, 21000, Dijon,
France
b
Bioenergetics and Intermediary Metabolism Team, Laboratory of Biology and Organisms Physiology, University of Sciences and Technology Houari
Boumediene, Algiers, Algeria

a r t i c l e i n f o a b s t r a c t

Article history: We investigated whether docosahexaenoic acid (DHA), a dietary n-3 fatty acid, modulates calcium (Ca2þ)
Received 18 May 2020 signaling and cell cycle progression in human Jurkat T-cells. Our study demonstrates that DHA inhibited
Received in revised form Jurkat T-cell cycle progression by blocking their passage from S phase to G2/M phase. In addition, DHA
28 November 2020
decreased the plasma membrane expression of TRPC3 and TRPC6 calcium channels during T-cell pro-
Accepted 12 December 2020
liferation. Interestingly, this fatty acid increased plasma membrane expression of TRPC6 after 24 h of
Available online 14 December 2020
mitogenic stimulation by phorbol-13-myristate-12-acetate (PMA) and ionomycin. These variations in the
membrane expression of TRPC3 and TRPC6 channels were not directly correlated with the mRNA
Keywords:
Jurkat T-cells
expression, indicating that it was a post-translational phenomenon. DHA increased free intracellular
DHA calcium concentrations, [Ca2þ]i, via opening TRPC3 and TRPC6 channels. We conclude that the anti-
Cell cycle proliferative effect of DHA might involve the modulation of TRPC3 and TRPC6 channels in human T-cells.
TRPC3 © 2020 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights
TRPC6 reserved.

1. Introduction Trebak et al. [4] have indicated that SOC channels, composed of
Orai1, Orai2, and Orai3 proteins, are major players for the activation
The immune response is initiated by the interaction of a T-cell of T-cells; however, transient receptor potential (TRP) channels
with an antigen-presenting cell (APC), which can be either a might also play a crucial role as the regulators of T-cell Ca2þ
macrophage or a dendritic cell [1]. The cellular T-immune response signaling. In mammals, at least 28 different TRP channels have been
is triggered via the aggregation of T-cell receptor (TCR) by an reported that are further divided into six subfamilies, based on
exogenous or endogenous antigen. Thus, the activation of Phos- their primary amino acid structures, as follows: TRPA (ankyrin),
pholipase-Cg1 (PLCg1) via TCR induces the hydrolysis of phospha- TRPC (canonical), TRPM (melastatin), TRPML (mucolipin), TRPP
tidylinositol 4, 5-biphosphate (PIP2) into inositol 1,4,5- (polycystin) and TRPV (vanilloid) [5e7]. Out of them, TRPC3/6/7
trisphosphate (IP3) and diacylglycerol (DAG) [1]. The IP3 produced channels are of particular interest, as these channels have been
subsequently results in Ca2þ release from endoplasmic reticulum shown to be activated by diacylglycerol (DAG). Previous studies
(ER) via InsP3 receptor (InsP3R) channels. Decreased Ca2þ inside the have shown that TRPC3 channels are expressed in T-cells and their
ER is sensed by the EF-hand of STIM1, which translocates and ac- deletion was associated with a reduction in SOC entry and T-cell
tivates Orai1 Ca2þ channels in the plasma membrane and initiates proliferation [3]. In another study, it was shown that human T-cell
store-operated calcium (SOC) influx [2]. This rise in free intracel- mutants exhibiting a defect in Ca2þ influx had altered TRPC3 gene
lular calcium concentration, [Ca2þ]i, leads to short term (formation expression. Interestingly, Ca2þ currents as well as TCR-dependent
of immunological synapse) and long-term consequences (tran- Ca2þ signals were rescued after the introduction of the complete
scription of cytokine genes and their release) [3]. human TRPC3 cDNA into these mutants [8].
Polyunsaturated fatty acids (PUFAs) are the fundamental con-
* Corresponding author. stituents of dietary lipids. Advanced organisms, like mammals, do
E-mail address: [email protected] (N.A. Khan). not have the capacity to synthesize the precursors of PUFAs of the
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.biochi.2020.12.005
0300-9084/© 2020 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
H. Saidi, B. Murtaza, A.S. Khan et al. Biochimie 181 (2021) 169e175

n-6 (arachidonic acid, AA) and n-3 (docosahexaenoic acid, DHA) TRPC3 shRNA plasmid was as follow: AAGGACCTAGGGAATACATTT
series. While, n-6 PUFAs, and their derivatives, have pro- and the negative control was GGAATCTCATTCGATGCATAC. The DNA
inflammatory and pro-atherogenic effects, n-3 PUFAs exert anti- sequence of TRPC6 shRNA plasmid used was as follow: ATTGCGA-
inflammatory and immunosuppressive effects [9,10]. Hence, n-3 GATTCATGGCATTT and the negative control was
PUFAs may be used in the treatment of autoimmune diseases, such GGAATCTCATTCGATGCATAC.
as rheumatoid arthritis, psoriasis, dermatitis and multiple sclerosis The plasmids (10 ng) were transformed into competent
[11]. Our team has previously shown that n-3 PUFAs modulate cell Escherichia coli as per manufacturer’s instructions. The bacteria
signaling cascade, particularly the activation of protein kinase C were cultured in Petri dishes, containing LB agar (35 g/l) and
(PKC), mitogen-activated protein (MAP) kinases and RasGRP, and ampicillin (50 mg/ml) for overnight at 37  C. The next day, the
exert immunomodulatory effects [12,13]. In addition, n-3 PUFAs plasmids were purified from a picked colony as per protocol of
have been shown to activate calcium channels in different cell EndoFree Plasmid Maxi Kit (Quiagen). After elution, the DNA was
types, including T-cells [14,15]. All of these observations indicate precipitated by using isopropanol. The Jurkat T-cells were trans-
that n-3 PUFAs may modulate cell signaling cascade including fected by using Amaxa nucleofaction kit and further cultured for
calcium signaling. 24 h. RT-qPCR analysis was used to confirm the effectiveness of the
Although n-3 PUFAs are immunomodulatory, their mechanisms TRPC3 and TRPC6 knockdown.
of action remain to be elucidated. Most of the studies have focused
on the effect of DHA on cell cycle, or DAG containing n-3 PUFAs such 2.4. Effect of DHA on mitogenic activation of T-cell cycle
as DHA in sn-2 position on calcium signaling. To our knowledge,
little is known about the signaling pathway by which DHA medi- Cells were treated for 12h or 24h by phorbol-13-myristate 12-
ates cell cycle arrest. Therefore, it was thought worthwhile to un- acetate (PMA at 200 nM) and ionomycin (at 500 nM) with or
dertake the present study in order to investigate the effect of DHA without DHA (at 10 mM). The fatty acids were freshly prepared each
on cell cycle and the involvement of TRPC3/6 calcium channels day from sealed stocks by dissolving them in ethanol; the final
during cell cycle progression in Jurkat leukemic T-cells. As we have concentration of ethanol in the culture medium did not exceed
previously demonstrated that the TRPC3/6 channels are activated 0.05%. Control experiments were carried out by adding ethanol to
by DAGs, it is also possible that DHA might modulate the activation Jurkat T-cells. Following treatment, the cells (1e2 million per point)
of these channels in T-cells. No study is available that explores the were washed with cold PBS (centrifugation at 850g  5 min) and
role of free fatty acids as DHA and the opening of TRPC3 and TRPC6 resuspended in 100 ml of PBS. The cells were then fixed by adding
channels in human T-cells. In addition, no study is available on the 1 ml of a cold ethanol solution (70%, v/v) drop-wise, followed by an
effect of DHA on plasma membrane and mRNA expression of these incubation for 24 h at 20  C. The cells were centrifuged again
channels during cell cycle progression. To address these issues, the (850 g, 5 min) and the cell pellet was resuspended in 200 ml of PBS,
effect of DHA on Jurkat T-cells was probed at transcriptional and supplemented with 5 mg/ml of RNase and 40 mg/ml of propidium
protein expression levels of TRPC3 and TRPC6 calcium channels and iodide and then further incubated for 30 min at 4  C before the
the impact of their knockdown on cell cycle progression. passage of the tubes to the cytometer (FACS Calibur, Becton Dick-
inson, USA). The data were collected and processed using the
2. Materials and methods ModFit LT FACS analysis software (version 5.0, Becton Dickinson,
USA), results were expressed as % of cells.
2.1. Materials
2.5. Plasma membrane expression of TRPC3/6 channels
RPMI1640 culture medium, L-glutamine, HEPES buffer, strepto-
mycin/penicillin were purchased from Lonza Verviers SPRL (Verv- Cells were treated for 12 h or 24 h by phorbol-13-myristate 12-
iers, Belgium). fetal calf serum was obtained from Abcys SA (Paris, acetate (PMA at 200 nM) and ionomycin (at 500 nM) with or
France). Fura-2/AM was obtained from Invitrogen (Carlsbad, CA). without DHA (at 10 mM). They were then washed with PBS by
Inhibitors and all other chemicals were purchased from Sigma- centrifugation (at 850g  5 min, at 4  C). The supernatant was then
Aldrich (St. Louis, MO, USA). The antibodies were purchased from gently removed and the cells were further incubated for 45 min, at
Everest (United Kingdom). The co-immunoprecipitation kit was 4  C, with primary antibody diluted by PBS-BSA (1%, v/v) containing
purchased from Pierce® (Rockford, USA). sodium azide (1%, v/v) at 4  C. For each primary antibody, a dilution
range (1/1000 to 1/5) was used to determine the optimal dilution.
2.2. Cell culture In our study, we diluted anti-TRPC3 and anti-TRPC6 antibodies,
respectively, at 1/20 and 1/20. For each condition, a control was
The human Jurkat T-cells (American Type Culture Collection, prepared with an isotype antibody.
Rockville, MD, USA) were cultured in RPMI1640 medium, supple- At the end of incubation with primary antibody, the cells were
mented with 10% foetal calf serum, 2 mM Glutamine, 50 mg/ml of washed with 4 ml of PBS-Azide (0.1%, v/v) and centrifuged (4  C,
penicillin/streptomycin and 20 mM HEPES. Cells were maintained 405g  5 minutes). The supernatant was gently removed and the
at 37  C in an incubator supplied with 95% O2 and 5% CO2. Cell cells were incubated again for 45 min at 4  C with 100 ml of sec-
viability was determined by a trypan blue exclusion test. To keep ondary antibody coupled to a fluorochrome, i.e., Alexa633 or FITC.
the cells in exponential phase, they were resuspended at a density The cells were washed with 4 ml of PBS-Azide (0.1%, v/v) and
of 0.5  106 cells/mL, in RPMI1640 medium, at-least for 24 h before centrifuged at 850gx5 min, 4  C, resuspended again in 500 mL of PBS
any treatment. and passed through a cytometer (FACS Calibur, Becton Dickinson,
USA). The data were analyzed using Flowjo software version 10
2.3. Knocking-down of TRPC3 and TRPC6 in jurkat T-cells (Tree Star). The results were expressed as % of marked cells.

The knockdown of TRPC3 and TRPC6 was performed as previ- 2.6. TRPC3 and TRPC6 mRNA expression by RT-qPCR
ously described [16]. Briefly, shRNA plasmids targeting TRPC3 and
TRPC6 genes products, under the control of U1 promoter, were The extraction of RNA and the RT-qPCR were performed as
purchased from SuperArray (TebuBio, Paris). The DNA sequence of previously described [17]. The cells were resuspended in 500 ml of
170
H. Saidi, B. Murtaza, A.S. Khan et al. Biochimie 181 (2021) 169e175

Trizol (Life Technology), lysed by passage through a 21G syringe Table 1

chloroform was added to the lysate, vortexed for 15 s, followed by a Gene Primer
further incubation for 3 min. After centrifugation of the cell lysate TRPC3 Sense: 50 GTTTGTGGCTCATCCCAACT 30
(1500gx 15 min, 4  C), the upper aqueous phase containing the RNA Anti-sense: 50 TCATTCCAAGAACCCAGACC 30
was recovered and placed in another tube (the two other phases TRPC6 Sense: 50 TTTTGCTGAAGGCAAGAGGT 30
formed were DNA and protein). The RNA was precipitated by Anti-sense: 50 CACTCTGGAGCGTTTCAACA 30
b-Actin Sense: 50 ATGATATCGCCGCGCTCGTCGTC 30
adding 250 ml of isopropanol and incubated for 2 h at 80  C. After
Anti-sense: 50 AGGTCCCGGCCAGCCAGGTCCAG 30
centrifugation (1400gx 30 min, 4  C), the RNA was recovered in the
form of a whitish pellet, further washed with 1 ml of cold ethanol
and then recentrifuged (1500gx 5 min, 4  C). The RNA pellet was
phase (Fig. 1A and B, D, E).
then dried for a few minutes before being resuspended in 15 ml of
We also used shRNA technology to silence the expression of
TE buffer. To check the purity of mRNA, the optical density (OD) was
these calcium channels. Fig. 1C shows that corresponding shRNA
measured using a spectrometer at 260 and 280 nm 1 mg of RNA was
significantly decreased the expression of TRPC3 and TRPC6 mRNA
reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad,
in Jurkat T-cells. Knocking down TRPC3 and TRPC6 in Jurkat T-cells
USA). cDNA thus synthesized was then subjected to Real-Time q-
triggered a significant decrease of T-cells in S phase and, conversely,
PCR. For this purpose, DNA was amplified using the Step-One Plus
increased the percentage of cells in G2/M phase in the presence of
Detection System and SYBR Green PCR Master Mix (both from
DHA with or without PMA and ionomycin as compared to those
Applied Biosystems, USA). The primers of each gene were desig-
cells with the same treatment, but without the knockdown (Fig. 1D
nated using the Beacon Designer software. b-Actin was used as an
and E). Also, the double knockdown of TRPC3 and TRPC6 abolished
endogenous control. The relative quantity of mRNA was calculated
the inhibitory effect of DHA on cell cycle progression of Jurkat T-
by the 2(-DDCT) method. The primer sequence used for various genes
cells (Fig. 1 D, E).
are shown in Table 1.

2.7. Measurement of free intracellular calcium concentrations, 3.2. DHA alters plasma membrane expression of TRPC3 and TRPC6
[Ca2þ]i channels

The Jurkat T-cells (2  106/ml), seeded onto Willico-Dish wells In order to explore whether the plasma membrane expression of
and cultured for 24h, were washed with a solution of phosphate TRPC3 and TRPC6 channels is altered during cell cycle progression,
buffered saline (PBS), pH 7.4, followed by incubation with Fura-2/ we used the flow cytometric technique. Fig. 2 demonstrates that, to
AM probe (1 mM) for 60 min, at 37  C in a calcium buffer contain- our surprise, PMA and ionomycin decreased the expression of
ing: 110 mM NaCl; 5.5 mM KCl; 25 mM NaHCO3; 0.8 mM MgCl2; TRPC3 channels at 12h and 24h of cell proliferation as compared to
0.4 mM KH2 PO4; 0.33 mM NaHPO4. 2H2O; 20 mM Hepes; 1.2 mM control. Moreover, DHA exerted an inhibitory effect on the
CaCl2; pH ¼ 7.4. After the incubation, the cells were washed 3 times expression of TRPC3/6 channels in T-cells, and its action was
(150gx10 min) and resuspended in calcium buffer. Changes in potentiated in the presence of PMA and ionomycin. Interestingly,
[Ca2þ]i were recorded using a Nikon microscope (TiU) equipped the membrane expression of TRPC3 was more reduced at 12 h
with EM-CCD (Luca-S) camera for real-time recording of digital compared to that at 24 h of incubation, whether the cells were
images and an S-fluor 40X oil immersion objective (Nikon, Tokyo, treated with DHA alone or in combination with PMA and ionomycin
Japan). Planes were taken at Z-intervals of 0.3 mm and the images (Fig. 2A). As regards TRPC6 channels, all the treatments reduced the
were analyzed using NIS-Elements software (Nikon, Tokyo, Japan). expression of these channels at 12 h post treatment as compared to
The changes in [Ca2þ]i were expressed as D ratio, calculated as the control (Fig. 2B). Such decreased expression was still evident at 24 h
difference between F340/F380. post all treatments, except for the wells containing the combined
treatment DHA þ PMA þ ionomycin.
2.8. Statistical analysis
3.3. DHA does not alter the expression of TRPC3 and TRPC6 mRNAs
Data are presented as mean ± SEM. The statistical difference
between groups was evaluated by Student’s t-test using GraphPad Since the plasma membrane expression of TRPC3/6 channels
Prism version 6.01 (GraphPad Software, USA). All differences with a was altered during cell activation, we were interested in correlating
p values ˂ 0.05 were considered statistically significant. it with the expression of mRNAs coding for TRPC3/6 channels at
12 h or 24 h of treatment (Fig. 3 A, B). DHA did not exert an
3. Results inhibitory effect on mRNA expression of these two calcium chan-
nels (Fig. 3 A, B).
3.1. DHA blocks T-cell passage from G1/S to G2/M phase of cell cycle
3.4. DHA-induced calcium signaling in T-cells involves TRPC3/6
Cell cycle progression was investigated in Jurkat T-cells, acti- channels
vated by PMA and ionomycin which are commonly used to induce
very powerful mitogenic cell proliferation. We observed that T- Fig. 4 shows that DHA resulted in significant increases in [Ca2þ]i
cells, activated by these agents, exhibited a significant higher entry (Fig. 4 A, B, C). However, DHA-induced increase in [Ca2þ]i was
into S and G2/M phase after 24 h treatment as compared to control. significantly curtailed by TRPC3-shRNA and TRPC6-shRNA. The
DHA treatment in presence or not of PMA þ ionomycin for 12 h or double knockdown of TRPC3 and TRPC6 decreased more strongly
24 h significantly increased cells in S phase and decreased those in the DHA-induced increase in [Ca2þ]i in Jurkat T-cells (Fig. 4C). These
G2/M phase as compared to control and PMA þ ionomycin alone, observations demonstrate that DHA acts via TRPC3 and TRPC6
indicating that DHA blocked the passage from S phase to G2/M channels in Jurkat T-cells.

171
H. Saidi, B. Murtaza, A.S. Khan et al. Biochimie 181 (2021) 169e175

Fig. 1. Effect of DHA on cell cycle progression. The Jurkat T-cells were incubated with or without PMA (at 200 nM) and ionomycin (at 500 nM) with or without knocking down of
TRPC3 or/and TRPC6, containing or not DHA (10 mM), as described in the Materials and Methods. The y axis of the figures represents the percentage of marked cells. Cytograms are
representative of three independent experiments (n ¼ 3). (A) shows cell cycle distribution as measured by cytometry after 12 h of stimulation, while (B) demonstrates the
stimulation period of 24 h. (C) represents the quantitative analysis of mRNA expression of TRPC3 and TRPC6. (D) and (E) represent cell cycle distribution as represented by bar chart
after 12 h and 24 h of treatment, respectively. The p values were evaluated according to the student’s t-test.* and ** represent p < 0.05 and p < 0.01, respectively, as compared to
control, # and ## represent p < 0.05 and p < 0.01, respectively, as compared to cells treated with PMA þ ionomycin; $ and $$ represent p < 0.05 and p < 0.01, respectively, as
compared to cells treated with DHA þ PMA þ ionomycin; ¥ and ¥¥ represent p < 0.05 and p < 0.01, respectively, as compared to cells treated with DHA. Abbreviations: DHA,
Docosahexaenoic acid; PI, Phorbol-13-myristate-12-acetate þ ionomycin.

4. Discussion previous reports wherein, DHA has been shown to induce cell cycle
arrest in different cell types [24e26]. The knocking down of cal-
Epidemiological studies have shown that n-3 PUFAs might exert cium channels TRPC3 and/or TRPC6 in Jurkat T-cells abolished the
inhibitory effects on T-cell proliferation [18]. Hence, DHA has DHA-induced cell cycle arrest in S phase after 24 h of treatment (see
received great attention for its anti-proliferative, pro-apoptotic and below).
anti-metastatic properties during the past couple of years [19,20]. The results obtained on cell proliferation led us to study the
In this study, we wanted to explore the effect of DHA on T-cell cycle expression of TRPC3 and TRPC6 channels as a function of time. It
and the potential role of TRPC3/6 channels in calcium signaling. We was observed that the plasma membrane expression of TRPC3 and
demonstrate that DHA inhibits cell proliferation by blocking the TRPC6 channels was decreased by PMA and ionomycin. This
passage of Jurkat T-cells from S to G2/M phase. Previous studies observation was surprising as it was expected that the activators of
have demonstrated that DHA exerts an immunosuppressive effect cell proliferation would increase cellular processes, including the
by acting on T-cell proliferation and the inhibition of transcription activity of calcium channels. However, inhibition of the expression
of interleukin-2 gene [14,15]. Our results corroborate the observa- of these channels at 12 h and 24 h by PMA and ionomycin dem-
tion of Siddiqui et al. [21] who have demonstrated that DHA blocks onstrates that these channels might play a key role in the early, but
Jurkat T-cells in the S phase of cell cycle after 24 h of incubation. not in late, phase of cell activation. In addition, DHA seemed to
This effect was more pronounced in the presence of the activators exert an additive inhibitory effect on the expression of TRPC3
of cell proliferation, such as PMA and ionomycin. They have also channels at 12 h and at 24 h. The inhibitory effect of DHA on cell
demonstrated that DHA, at a dose of 10 mM (the concentration that proliferation may be due to its action on TRPC3 channels. Indeed,
we used in our study) also decreased the phosphorylation of reti- certain cancer cells abundantly express TRPC3 channels and the
noblastoma protein and the expression of cyclins associated with S inhibition of these channels has been shown to reduce their pro-
phase of cell cycle [21]. It is possible that, in our study, DHA exerts liferation [27,28]. However, increased plasma membrane expres-
an action in the same way on the phosphorylation of some proteins, sion of TRPC6 at 24 h after DHA is surprising. It may be speculated
involved in the transition of cell cycle [22]. We have also previously that TRPC3 and TRPC6 may have functional interaction in Jurkat T-
demonstrated that DHA reduced the proliferation of mammalian cells and the drop in the membrane expression of one channel
mammary cancer cells by acting on the cell cycle and signaling might be compensated by the increased expression of the other
cascade [23]. Our observation is further corroborated by several one. This argument requires further investigations. It was also

172
H. Saidi, B. Murtaza, A.S. Khan et al. Biochimie 181 (2021) 169e175

Fig. 2. Effect of different treatments on the expression of the TRPC3 (A) and TRPC6 (B) after 12 h and 24 h. The Jurkat T-cells were incubated for 12 h or 24 h in the presence or
absence of PMA and ionomycin. The cells were also treated with DHA according to the protocol, described in the Materials and Methods (DHA, 10 mM; PMA, 200 nM and ionomycin,
500 nM). The y axis of the figures represents the % of fluorescent cells. The histograms show mean ± SEM (n ¼ 3). (C) and (D) display cytometric scatterplots of the expression, at
protein level, of TRPC3 and TRPC6, respectively, in T-cells subjected to different treatments. The p values were evaluated according to student’s t-test. * represents p < 0.05 as
compared to control. # represents p < 0.05 as compared to PMA þ ionomycin treated cells. Abbreviations: DHA, Docosahexaenoic acid; PMA, Phorbol-13-myristate-12-acetate.

Fig. 3. Effect of different treatments on the expression of TRPC3 (A) and TRPC6 (B) mRNA. The Jurkat T-cells were incubated for 12 h or 24 h in the presence or absence of PMA
and Ionomycin. The cells were also treated with DHA according to the protocol described in the Materials and Methods (DHA 10 mM; PMA, 200 nM and ionomycin, 500 nM). The y
axis of the figures represents the expression of mRNAs relative to b-actin expression. The histograms are mean ± SEM (n ¼ 3). The p values were evaluated according to the student’s
t-test. NS ¼ No significant differences between treated cells and the corresponding controls. Abbreviations: DHA, Docosahexaenoic acid; PMA, Phorbol-13-myristate-12-acetate.

interesting to note that the mRNA expression of TRPC3 and TRPC6 pronounced decrease on DHA-induced [Ca2þ]i rise in jurkat T-cells,
channels was unaltered after 12 h or 24 h of treatment. It is possible suggesting that DHA acts via the opening of TRPC3 and TRPC6
that a decrease in membrane expression is due to a degradation of calcium channels in Jurkat T-cells.
membrane proteins and this would be a post-transcriptional In conclusion, we can state that DHA induces cell cycle arrest by
phenomenon. blocking the passage of Jurkat T-cells from S phase to G2/M phase of
As regards the increases in free intracellular calcium [Ca2þ]i, we cell cycle. In addition, Jurkat T-cells express TRPC3 and TRPC6
observed that DHA increased [Ca2þ]i by the mobilization from channels and their expression is modulated as a function of cell
extracellular environment via the opening of calcium channels, proliferation. Furthermore, DHA opens TRPC3 and TRPC6 calcium
such as TRPC3 and TRPC6. Indeed, this increase in [Ca2þ]i was channels in Jurkat T-cells and their activity might be modulated by
significantly decreased by knocking down of TRPC3 or TRPC6 in this fatty acid. Therefore, we conclude that the anti-proliferative
Jurkat T-cells. This observation corroborates previous reports in effect of DHA might involve the modulation of TRPC3 and TRPC6
which, it has been shown that calcium channels, including Orai1 channels.
and Orai3 are also involved in increases in [Ca2þ]i in Jurkat T-cells
[1]. However, the double knockdown of TRPC3 and TRPC6 had more

173
H. Saidi, B. Murtaza, A.S. Khan et al. Biochimie 181 (2021) 169e175

Fig. 4. Effect of DHA on [Ca2þ]i . The Jurkat T-cells (2  106/ml) were incubated with Fura-2/AM probe as described in the Materials and Methods and further re-suspended in a
calcium medium before the addition of DHA (10 mM). In panel (A), the pseudo-coloured images show changes in [Ca2þ]I, evoked by DHA. In (B), the arrow-head indicates the time
when DHA was added to the cuvette without interruptions in the recording. The histograms in (C) show an experiment which has been reproduced independently (n ¼ 5). Data are
presented as means ± SEM. * represents p < 0.05 as compared to control; # represents p < 0.05 as compared to TRPC6-shRNA; $ represents p < 0.05 as compared to TRPC3-shRNA.
The p values were determined according to the student’s t-test.

Author contributions [9] B.M. Yashodhara, S. Umakanth, J.M. Pappachan, S.K. Bhat, R. Kamath,
B.H. Choo, Omega-3 fatty acids: a comprehensive review of their role in health
and disease, Postgrad. Med. 85 (2009) 84e90.
Aziz Hichami and Naim Akhtar Khan conceived the study. [10] N.D. Riediger, R.A. Othman, M. Suh, M.H. Moghadasian, A systemic review of
Hamza Saidi and Babar Murtaza performed experiments. Hamza the roles of n-3 fatty acids in health and disease, J. Am. Diet Assoc. 109 (2009)
Saidi, Babar Murtaza, Aziz Hichami and Naim Akhtar Khan wrote 668e679.
[11] A.P. Simopoulos, Omega-3 fatty acids in inflammation and autoimmune dis-
and corrected the manuscript. Amira Sayed Khan conducted ex- eases, J. Am. Coll. Nutr. 21 (2002) 495e505.
periments during the revision of the manuscript and Elhadj Ahmed [12] S. Madani, A. Hichami, M. Charkaoui-Malki, N.A. Khan, Diacylglycerols con-
Koceir performed statistical analysis. All authors read and approved taining Omega 3 and Omega 6 fatty acids bind to RasGRP and modulate MAP
kinase activation, J. Biol. Chem. 279 (2004) 1176e1183.
the final manuscript. [13] W. Kim, N.A. Khan, D.N. McMurray, I.A. Prior, N. Wang, R.S. Chapkin, Regu-
latory activity of polyunsaturated fatty acids in T-cell signaling, Prog. Lipid
Res. 49 (2010) 250e261.
Funding
[14] A. Bonin, N.A. Khan, Regulation of calcium signalling by docosahexaenoic acid
in human T-cells: implication of CRAC channels, J. Lipid Res. 41 (2000)
This work was supported by INSERM contingent grants to 277e284.
[15] A. Denys, V. Aires, A. Hichami, N.A. Khan, Thapsigargin-stimulated MAP kinase
NUTOx team.
phosphorylation via CRAC channels and PLD activation: inhibitory action of
docosahexaenoic acid, FEBS Lett. 564 (2004) 177e182.
Declaration of competing interest [16] H. Saidi, A. Bounihi, A. Bouazza, A. Hichami, E.H.A. Koceir, N.A. Khan, Spirulina
reduced diet-induced obesity throught downregulation of lipogenic genes
expression in Psammomys obesus, Arch. Physiol. Biochem. (2020) 1e9.
The authors have declared no conflict of interest whatsoever. [17] C. Carrillo, A. Hichami, P. Andreoletti, M. Cherkaoui-Malki, M.D.M. Cavia,
S. Abdoul-Azize, S.R. Alonso-Torre, N.A. Khan, Diacylglycerol-containing oleic
acid induces increases in [Ca2þ]i via TRPC3/6 channels in human T-cells,
Acknowledgement Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1821 (2012) 618e626.
[18] A.P. Simopoulos, Omega-6/omega-3 essential fatty acid ratio and chronic
One of the authors, Hamza Saidi, acknowledges the receipt of diseases, Food Rev. Int. 20 (2004) 77e90.
[19] N. Merendino, L. Costantini, L. Manzi, R. Molinari, D. D’Eliseo, F. Velotti, Di-
the scholarship (PNE) from the Algerian government. etary u-3 polyunsaturated fatty acid DHA: a potential adjuvant in the treat-
ment of cancer, BioMed Res. Int. 2013 (2013).
[20] I. Brown, J. Lee, A.A. Sneddon, M.G. Cascio, R.G. Pertwee, K.W.J. Wahle,
References D. Rotondo, S.D. Heys, Anticancer effects of n-3 EPA and DHA and their
endocannabinoid derivatives on breast cancer cell growth and invasion,
[1] M. Trebak, J.-P. Kinet, Calcium signalling in T cells, Nat. Rev. Immunol. 19 Prostaglandins, Leukot, Essent. Fat. Acids (2019) 102024.
(2019) 154e169. [21] R.A. Siddiqui, L.J. Jenski, K.A. Harvey, J.D. Wiesehan, W. Stillwell, G.P. Zaloga,
[2] M. Potier, M. Trebak, New developments in the signaling mechanisms of the Cell-cycle arrest in Jurkat leukaemic cells: a possible role for docosahexaenoic
store-operated calcium entry pathway, Pflügers Arch. J. Physiol. 457 (2008) acid, Biochem. J. 371 (2003) 621e629.
405. [22] N.A. Khan, Polyunsaturated fatty acids in the modulation of T-cell signalling,
[3] A.S. Wenning, K. Neblung, B. Strauß, M.-J. Wolfs, A. Sappok, M. Hoth, Prostaglandins Leukot. Essent. Fatty Acids 82 (2010) 179e187.
E.C. Schwarz, TRP expression pattern and the functional importance of TRPC3 [23] N.A. Khan, K. Nishimura, V. Aires, T. Yamashita, D. Oaxaca-Castillo,
in primary human T-cells, Biochim. Biophys. Acta Mol. Cell Res. 1813 (2011) K. Kashiwagi, K. Igarashi, Docosahexaenoic acid inhibits cancer cell growth via
412e423. p27Kip1, CDK2, ERK1/ERK2, and retinoblastoma phosphorylation, J. Lipid Res.
[4] R.J. Bram, G.R. Crabtreet, Calcium signalling in T cells stimulated by a cyclo- 47 (2006) 2306e2313.
philin B-binding protein, Nature 371 (1994) 355e358. [24] A.P. Albino, G. Juan, F. Traganos, L. Reinhart, J. Connolly, D.P. Rose,
[5] M.J. Caterina, D. Julius, The vanilloid receptor: a molecular gateway to the pain Z. Darzynkiewicz, Cell cycle arrest and apoptosis of melanoma cells by do-
pathway, Annu. Rev. Neurosci. 24 (2001) 487e517. cosahexaenoic acid: association with decreased pRb phosphorylation, Canc.
[6] C. Montell, L. Birnbaumer, V. Flockerzi, R.J. Bindels, E.A. Bruford, M.J. Caterina, Res. 60 (2000) 4139e4145.
D.E. Clapham, C. Harteneck, S. Heller, D. Julius, A unified nomenclature for the [25] N. Danbara, T. Yuri, M. Tsujita-Kyutoku, M. Sato, H. Senzaki, H. Takada,
superfamily of TRP cation channels, Mol. Cell. 9 (2002) 229e231. T. Hada, T. Miyazawa, K. Okazaki, A. Tsubura, Conjugated docosahexaenoic
[7] I.S. Ramsey, M. Delling, D.E. Clapham, An introduction to TRP channels, Annu. acid is a potent inducer of cell cycle arrest and apoptosis and inhibits growth
Rev. Physiol. 68 (2006) 619e647. of colo 201 human colon cancer cells, Nutr. Canc. 50 (2004) 71e79.
[8] S. Philipp, B. Strauss, D. Hirnet, U. Wissenbach, L. Me
ry, V. Flockerzi, M. Hoth, [26] S. Crnkovic, M. Riederer, M. Lechleitner, S. Hallstro € m, R. Malli, W.F. Graier,
TRPC3 mediates T-cell receptor-dependent calcium entry in human T-lym- J. Lindenmann, H. Popper, H. Olschewski, A. Olschewski, Docosahexaenoic
phocytes, J. Biol. Chem. 278 (2003) 26629e26638.

174
H. Saidi, B. Murtaza, A.S. Khan et al. Biochimie 181 (2021) 169e175

acid-induced unfolded protein response, cell cycle arrest, and apoptosis in apoptosis resistance of triple negative breast cancer cells through the trpc3/
vascular smooth muscle cells are triggered by Ca2þ-dependent induction of rasa4/mapk pathway, Cancers 11 (2019) 558.
oxidative stress, Free Radic. Biol. Med. 52 (2012) 1786e1795. [28] O. Tiapko, K. Groschner, TRPC3 as a target of novel therapeutic interventions,
[27] Y. Wang, Y.X. Qi, Z. Qi, S.Y. Tsang, Trpc3 regulates the proliferation and Cells 7 (2018) 83.

175