Plant Physiology and Biochemistry 123 (2018) 1–7

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Research article

Mutagenesis of the FAE1 genes significantly changes fatty acid composition T

in seeds of Camelina sativa
Mehmet E. Ozseyhana, Jinling Kanga, Xiaopeng Mua,b, Chaofu Lua,∗
a
Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT 59717, USA
b
College of Horticulture, Shanxi Agricultural University, Taigu, Shanxi 030801, China

A R T I C L E I N F O A B S T R A C T

Keywords: Camelina sativa is a re-emerging low-input oilseed crop that has great potentials. It is necessary to ameliorate
Camelina sativa camelina oils for optimized fatty acid composition that can meet different application requirements. Camelina
CRISPR/Cas9 seed contains significant amounts of C20-C24 very long-chain fatty acids (VLCFAs) that may not be desirable. We
Ethyl methanesulfonate demonstrated that these VLCFAs can be effectively reduced by deactivating the Fatty Acid Elongase1 (FAE1) in
FAE1
camelina. The allohexaploid camelina contains three alleles of FAE1 genes. Ethyl methanesulfonate (EMS) in-
Fatty acids
duced mutation at the FAE1-B gene caused over 60% reduction of VLCFAs in seed. Homozygous knockout
Mutagenesis
mutants were successfully created in a single generation by simultaneously targeting three FAE1 alleles using the
CRISPR technology with an egg cell-specific Cas9 expression. VLCFAs were reduced to less than 2% of total fatty
acids compared to over 22% in the wild type, and the C18 unsaturated fatty acids were concomitantly increased.
The fae1 mutants were indistinguishable from wild type in seed physiology and plant growth. This study de-
monstrated that the CRISPR/Cas9 technology can be effectively applied to the polyploid crop camelina to rapidly
obtain desired traits such as optimal fatty acid composition in its seed oil. Knocking out FAE1 also provides a
means to increase the levels of oleic acid or α-linolenic acid in camelina oils that are desirable for industrial or
food/feed uses.

1. Introduction less than ideal for either food or non-food uses. For example, for use as
biofuel and other products such as lubricants, it would be beneficial to
Vegetable oils constitute one of the most important agricultural increase the oxidative stability by reducing the content of highly un-
commodities. Vegetable oils are mainly consumed by humans, but saturated fatty acids (Jaworski and Cahoon, 2003). In contrast, these
considerable amounts are also used in industrial applications for man- PUFAs are highly desirable from a nutritional standpoint. Currently, the
ufacturing numerous products such as lubricants and biofuels main source of omega-3 vegetable oils is from flax. Camelina provides
(Gunstone, 1998). The final use of oils is dependent on their nutritional, an attractive alternative to this type of oil in the food and feed markets
physical and chemical properties. Camelina (Camelina sativa (L.) Crtz.), (Pilgeram et al., 2007). Camelina seeds contain significant amounts of
also known as false flax or gold-of-pleasure, is a member of the Bras- C20-24 very long-chain fatty acids (VLCFAs), primarily eicosenoic acid
sicaceae family and was an established oilseed crop in parts of Eastern (20:1) and lesser amounts of erucic acid (22:1). These VLCFAs need to
and Central Europe prior to World War II (Putnam et al., 1993). More be reduced for food/feed uses.
recently, a strong interest has arisen in camelina as a potential biofuel Camelina is an allohexaploid species, which could potentially
crop in North America and other parts of the world due to its favorable complicate the process of breeding for desired traits due to gene re-
attributes such as low-input production and tolerance to drought and dundancy and their complementary effects (Kagale et al., 2014;
cold temperatures (Pilgeram et al., 2007). Camelina seed has an oil Hutcheon et al., 2010; Kang et al., 2011). Plant biotechnology, espe-
content of ∼35% of dry mass for current varieties. Camelina oils are cially the recent advent of the highly efficient and facile CRISPR/Cas9
high (∼50%) in polyunsaturated fatty acids (PUFA), especially α-li- (clustered regularly interspaced short palindromic repeats/CRISPR-as-
nolenic (18:3), an omega-3 fatty acid, and are thus also attracting at- sociated protein 9) system for precision gene modifications, provides an
tention for use in the production of health-promoting foods and feeds. effective tool (Lowder et al., 2015). Camelina can be easily transformed
However, the oil profiles of available camelina varieties (Table 1) are by agrobacterium using a floral vacuum infiltration method, with

∗
Corresponding author. Department of Plant Sciences and Plant Pathology, 119 Plant Bioscience Building, Montana State University, Bozeman, MT 59717-3150, USA.
E-mail address: [email protected] (C. Lu).

https://doi.org/10.1016/j.plaphy.2017.11.021
Received 12 September 2017; Received in revised form 8 November 2017; Accepted 30 November 2017
Available online 02 December 2017
0981-9428/ Published by Elsevier Masson SAS.
M.E. Ozseyhan et al. Plant Physiology and Biochemistry 123 (2018) 1–7

Table 1 was designed by using gRNA prediction algorithms of Harvard CHOP-

Fatty acid composition of a low-VLCFA camelina mutant compared with Suneson. CHOP website (http://chopchop.cbu.uib.no) (Labun et al., 2016). The
gRNA was selected according to the following criteria: (1) The proxi-
16:0 18:0 18:1 18:2 18:3 20:0 20:1 20:2 20:3 22:0 22:1
mity to the 5′ end, (2) the coverage of all three CsFAE1 genes, (3) the
Suneson 5.8 1.8 17.3 20.7 33.0 1.4 14.4 1.4 1.0 0.4 2.8 higher efficiency score, (4) the absence of predicted possible off-targets,
LE1914 6.7 3.0 22.4 24.1 35.1 0.8 6.1 0.7 0.5 0.3 0.4 (5) minimum self-complementary regions, (6) higher GC content, pre-
ferably, between 40 and 70% (Wang et al., 2014; Tsai et al., 2015). The
Data show averages of seeds harvested from 6 plants.
best gRNA that obeys the criteria above was then tested with Cas-OF-
Finder web-based software (http://www.rgenome.net/cas-offinder) for
transgenic seeds obtained in a relatively short period of time after in-
off-target possibility (Bae et al., 2014). CsFAE1 sgRNA was synthesized
filtration (4–6 weeks) (Lu and Kang, 2008). This has made camelina a
by Eurofins MWG Operon USA (Louisville, KY) as two oligonucleotides:
useful crop platform for biotechnology and translational research
gRNA-F, 5′-ATTGTTGGAGATGGGAATAGAAG-3′, and gRNA-R, 5′-
(Collins-Silva et al., 2011; Hines and Travis, 2016). Recent attempts of
AAACCTTCTATTCCCATCTC CAA-3’ (sgRNA is underlined). Two oligos
CRISPR/Cas9-induced gene mutagenesis in camelina have been suc-
were mixed and incubated in a thermocycler at 95 °C for 5 min and then
cessful (Jiang et al., 2017; Aznar-Moreno and Durrett, 2017; Morineau
cooled down to 4 °C for 5 min. The FAE1 gRNA was then cloned into the
et al., 2017). Understanding genetic and biochemical mechanisms of oil
binary transformation vector pHEE401E (Xing et al., 2014; Wang et al.,
biosynthesis is necessary to effectively modify plant oils for a wide
2015) (obtained from Addgene; www.addgene.org/71827) by the
range of applications (Napier and Graham, 2010).
Golden Gate cloning method (Engler et al., 2008). Finally, the sgRNA-
In oilseeds, fatty acids synthesized from acetyl-CoA in the plastids
Cas9 cassette was digested with HindIII and EcoRI, then the entire
are exported into the cytosol for triacylglycerol (TAG) assembly in the
sgRNA-Cas9 cassette was ligated into the pBinGlyRed2 vector (Lu and
endoplasmic reticulum (ER) (Browse and Somerville, 1991). The newly
Kang, 2008). In the final construct, sgRNA is driven by Arabidopsis U6-
made fatty acids, mainly oleic acid (18:1) and a small amount of pal-
26 promoter (Li et al., 2007), then followed by gRNA scaffold and U6-
mitic acid (16:0) and stearic acid (18:0), are first incorporated into
26 terminator. Maize codon optimized Cas9 (zCas9) gene is under the
phosphatidylcholine (PC) by the de novo pathway (Kennedy, 1961).
control of the egg-cell specific enhancer (EC1.2en) and promoter
They may also be incorporated into PC by an acyl exchange mechanism
(EC1.1pro), and transcription ends with Pisum sativum rbcS-9E termi-
known as “acyl editing” mediated primarily by the lysophospholipid
nator (Wang et al., 2015) (Fig. 1).
acyl-CoA: acyltransferases (Bates et al., 2009, 2012). The oleic acid is
further desaturated to form the polyunsaturated linoleic (18:2) and α-
2.3. Camelina transformation
linolenic (18:3) acids by the fatty acid desaturases FAD2 and FAD3 in
the endoplasmic reticulum (ER) using the phosphatidylcholine (PC)
The above construct was transformed into Agrobacterium strain
substrate, or elongated into 20:1 and 22:1 by the fatty acid elongase
GV3101 (pMP90) by electroporation with 0.2 cm cuvettes (Bio-Rad,
FAE1 (Li-Beisson et al., 2013). Several other biosynthetic enzymes such
Hercules, CA, USA) at a field strength of 2.5 kv/cm, restorors of 600Ω
as phosphatidylcholine diacylglycerol cholinephosphotransferase
and a capacitance of 25 μF. Selection of transformed bacteria was
(PDCT), lysophosphatidylcholine acyltransferases (LPCAT), and dia-
carried out on LB plates containing 50 μg/ml kanamycin and 40 μg/ml
cylglycerol acyltransferases (DGAT) may also affect the fatty acid
gentamycin. Camelina plants were grown in 6” pots (5 plants/per pot)
composition of TAG by regulating the acyl flux through its precursors
filled with 1:1 mix of MSU soil (equal parts by volume of loam soil:
including PC and diacylglycerols (Bates et al., 2012; Lu et al., 2009,
washed concrete sand: Canadian sphagnum peat moss with AquaGro,
2011; Marmon et al., 2017). In this study, we demonstrated that mu-
2000 G wetting agent blended in at 1 lb/cubic yard of soil, aerated
tations at the FAE1 genes in camelina significantly changed fatty acid
steam pasteurized at 70 °C for 1 h) and Sunshine Mix #1 (Bellevue, WA,
composition by decreasing the VLCFA content. Knocking out all alleles
USA). Greenhouse conditions were 22/18 ± 1 °C for day/night tem-
of the FAE1 genes by the CRISPR-Cas9 technology almost eliminated
peratures, a relative humidity of 30%, and a 16 h photoperiod of nat-
the accumulation of these fatty acids in camelina seeds.
ural lighting supplemented when necessary by season. A well-estab-
lished camelina transformation protocol developed at our laboratory
2. Methods was followed to generate transgenic plants (Lu and Kang, 2008).
Transgenic DsRed-expressing seeds were screened by illuminating ma-
2.1. Mutant isolation and characterization ture seeds with green LED lights and viewing through a red filter.
Transgenic plants were confirmed by PCR using the U6-specific primers
Camelina (Camelina sativa) cv. Suneson was used in this study. (Suppl. Table 1) and genomic DNA extracted from leaves of 15-day old
Camelina seeds were treated with ethyl methanesulfonate (EMS) to plants by the CTAB method (Lukowitz et al., 2000).
induce mutations as described previously (Büchsenschütz-Nothdurft
et al., 1998). The M2 generation of the treatments was grown in the 2.4. Seed and fatty acid analyses
field at the Arthur Post Agronomy Farm at Bozeman, MT. Seeds har-
vested from individual M2 plants were analyzed for fatty acid compo- For fatty acid analysis, camelina seeds were crushed and lipids were
sition in a high-throughput fashion as described (Lu et al., 2006). Mu- transmethylated according to procedures described previously
tant lines showing altered fatty acid composition were collected and (Lukowitz et al., 2000). The resulting fatty acid methyl esters (FAMEs)
grown for another generation. Lines of homogeneity for the low 20:1 were analyzed in a gas chromatograph (GC) (Shimadzu Scientific In-
content were determined by analyzing at least 10 plants. These lines struments, Columbia, MD) fitted with a 15 m × 0.25 mm column (DB-
were chosen for further investigation and sequencing of the FAE1 al- 23; Agilent, Lexington, MA) and a flame ionization detector (FID). The
leles. Genomic DNA was isolated from young camelina leaves using the GC was programmed for an initial temperature of 180 °C for 1 min
method as described (Lukowitz et al., 2000). followed by an increase of 10 °C/min to 230 °C and maintained for a
further 1 min.
2.2. CRISPR/Cas9 vector construction Seed weight was determined by weighing 100 seeds. Seed oil con-
tent was determined by a bench-top nuclear magnetic resonance (NMR)
The single guide RNA (sgRNA) targeting all three alleles of Camelina seed analyzer (MQC23, Oxford Instruments, Concord, MA, USA) and by
sativa Fatty Acid Elongase (CsFAE1-A, Csa11g007400; CsFAE1-B, GC analysis using heptadecanoic acid (17:0) as internal standard
Csa10g007610; and CsFAE1-C, Csa12g009060) (Hutcheon et al., 2010) (10 mg/ml), which was added to test tubes prior to FAMEs

2
M.E. Ozseyhan et al. Plant Physiology and Biochemistry 123 (2018) 1–7

Fig. 1. Mutagenesis in the FAE1 alleles in Camelina sativa.

(A) An EMS-induced mutation is shown on top at nucleotide
no. 448 from the start codon ATG in the FAE1-B gene.
Single-letter amino acids are encoded by FAE1-B. The
sgRNA sequence targeting all three FAE1 genes (on the re-
verse strands) is shown at the bottom. Asterisks indicate
identical nucleotides. PAM: protospacer adjacent motif. (B)
T-DNA region (between the left/right borders) of the
CRISPR/cas9 construct. The FAE1 sgRNA gene is bracketed
by the Arabidopsis thaliana U6-26 small nuclear RNA pro-
moter (U6-26 pro) and terminator (U6-26 term). zCas9 (Zea
mays codon optimized) is driven by an egg cell-specific 1.2
enhancer (EC1.2 en) and an egg cell-specific 1.1 promoter
(EC1.1 pro), and the translation stopped by a Pea sativum
Rubisco small subunit 9E terminator (RbcS-9E term). The
selection marker DsRed is driven by the cassava vein mosaic
virus promoter (CVMV pro).

derivatization. All seeds used for comparison of oil content and seed Glutamine (Gln) into a stop codon TAA (Fig. 1). This result suggested
traits were harvested from plants grown at the same time in the that a single FAE1 gene mutation caused over 60% reduction in the
greenhouse. 20:1 + 22:1 content compared to the wildtype. There was no mutation
detected at the other two FAE1 genes, which are presumably re-
3. Results and discussion sponsible for the remaining VLCFAs in the mutant seed.

3.1. A low-VLCFA camelina line contains a mutation at the FAE1 locus 3.2. Cas9 transgenic plants targeting FAE1 genes caused decreased
accumulation of VLCFAs
In our previous experiments to isolate high-oleic camelina mutants,
we screened an M2 population derived from ethyl methanesulfonate Characterization of the LE1914 mutant suggests that three FAE1
(EMS)-treated seeds (cultivar Suneson) and obtained several lines that genes may function in an additive fashion in camelina seeds. To better
have altered seed fatty acid profiles (Kang et al., 2011). One mutant understand FAE1 enzymes in the polyploidy camelina seeds, we at-
line, which we designated as LE1914, showed a moderate increase in tempted to create FAE1 mutants by the CRISPR/Cas9 technology tar-
oleic acid (18:1). More significantly, the mutant seed contained reduced geting all three alleles of the CsFAE1 genes.
levels of very long-chain fatty acids comprising primarily of eicosenoic Sequences of the 1518bp-long FAE1 genes (CsFAE1-A, -B, -C) are
acid (20:1) and erucic acid (22:1). Compared to Suneson, which con- highly similar to one other (more than 96% identical) and to their or-
tained 17.2% of these fatty acids, the level decreased to only 6.5% in thologs from Arabidopsis (Hutcheon et al., 2010). To ensure that gene
LE1914 (Table 1). The accumulation of eicosanoic acid (20:0) and other mutations would cause the loss of enzyme activities, we designed the
minor VLCFAs, was also significantly reduced in the mutant. single guide RNA (sgRNA) sequence near the 5′-end of the FAE1 coding
In oilseeds, VLCFA synthesis is catalyzed by the Fatty Acid region (Fig. 1A). The sgRNA sequence was selected based on the ca-
Elongase1 (FAE1) acting on 18:1-CoA (Coenzyme A) (Millar and Kunst, melina genome sequence to avoid potential off-target sites. Nearby
1997). Camelina sativa is a close relative to Arabidopsis thaliana single nucleotide polymorphisms (SNPs) between the three genes were
(Beilstein et al., 2006; Al-Shehbaz et al., 2006). Like Camelina, Arabi- present. These SNPs along with sequence variations within the pro-
dopsis seed contains high amounts of VLCFAs, predominantly 20:1 moter regions (Suppl. Fig. S1) would help determine whether all genes
(about 21% w/w of total fatty acids). The Arabidopsis mutant fae1 were efficiently targeted and mutated by the Cas9/gRNA complex.
contains negligible amount (< 1%) of 20:1 in seed oils (Kunst et al., The sgRNA sequence was synthesized as two complementary oli-
1992). It has been shown previously that camelina contains three FAE1 gonucleotides and inserted into pHEE401E transformation vector. The
genes and they share very high sequence similarity between these two sgRNA-Cas9 cassette was sub-cloned into the pBinGlyRed2 vector to use
species (Hutcheon et al., 2010). We sequenced the homology CsFAE1 the DsRed as the selection marker. This construct was transformed into
genes, FAE1-A (Csa11g007400), FAE1-B (Csa10g007610) and FAE1-C camelina plant (Suneson) using the Agrobacterium-mediated vacuum
(Csa12g009060), in camelina wildtype (Suneson) and the LE1914 infiltration method. We obtained 14 transgenic seeds showing strong
mutant. The FAE1-B locus in the LE1914 had a nucleotide change at DsRed expression, which were successfully germinated in soil for fur-
#448 (C to T), which would convert the codon CAA for amino acid ther analysis.

3
M.E. Ozseyhan et al. Plant Physiology and Biochemistry 123 (2018) 1–7

Fig. 2. Eicosenoic acid (20:1) content in single seeds of wild

type (WT) and transgenic camelina. Seeds no. 1–5 (white
bars) show wild type. Red (A) and brown (B) seeds har-
vested from 14 T1 transgenic lines are shown in black bars.

Seeds were harvested from all 14 independent T1 lines that showed in the A, B and C subgenomes of the allohexaploid camelina were
DsRed segregation indicating single-transgene inserts (Suppl. Table 2). amplified by three pairs of gene-specific primers (Suppl. Fig. S1). PCR
To evaluate the Cas9-induced mutations on FAE1 genes, five individual products from transgenic plants for all three genes were indistinguish-
T2 seeds showing DsRed expression from each transgenic line were able in size from those amplified from Suneson, suggesting no large
analyzed for their fatty acid composition by gas chromatography (Lu insertion/deletion occurred at FAE1 alleles by the Cas9/sgRNA ex-
et al., 2006), and compared with non-transgenic seeds of Suneson that pression. Sequencing of the three PCR fragments amplified from the
had been grown together with the transgenic plants in the greenhouse. wildtype plants resulted in sequences identical to the previously pub-
We focused on the content of 20:1 since it's the most abundant VLCFA lished (Kagale et al., 2014; Hutcheon et al., 2010), indicating that the
synthesized by the FAE1 enzyme in camelina. The wild type seeds ac- primers were able to specifically amplify the three pairs of the FAE1
cumulated about 14% 20:1 of total fatty acids (Seeds no. 1–5, Fig. 2). Of alleles in the camelina subgenomes.
the 70 red seeds analyzed, 19 appeared to be wild type that had For each FAE1 gene, 7 of the 14 T1 plants did not contain any nu-
12–14% of 20:1. The other 51 low-20:1 putative mutant seeds were cleotide changes at the target sites. In the remaining 7 transgenic T1
from every transgenic line, showing a wide range of variation (ranging plants, nucleotide deletions or substitutions were detected at the sgRNA
from 0.6 to 11.4% w/w) (Fig. 2A). This result suggested that FAE1 target sites in at least one of the three FAE1 genes (Suppl. Fig. S2). We
genes have possibly been mutated by CRISPR/Cas9 in transgenic plants, planted 10 red seeds from each T1 line to grow into T2 plants. Leaf
and that FAE1 genes are responsible for most of 20:1 accumulation in samples of each plant were collected and stored in −80 °C for later
camelina seed. The transgenic seeds fell into three major groups ac- analysis by extracting genomic DNA and sequencing. Putative homo-
cording to the level of 20:1 (around 5–11%, 2–5%, and < 2%). These zygous T2 lines, determined by all red seeds they produced, were ob-
might reflect the number (1, 2 and 3) of FAE1 genes that were disrupted tained. We selected one homozygous plant from each of the T2 lines to
in their genomes. examine the Cas9-induced mutations at the FAE1 genes. These plants
Germline mutation was expected since the Cas9 gene was driven by were confirmed to have the Cas9 transgenes by PCR using the U6-
an egg cell-specific promoter. We speculated that FAE1 mutations might specific primers (Suppl. Table 1). Sequencing results indicated that
have occurred in brown (Cas9-negative) seeds, as well as in red seeds. nucleotide deletions at the predicted locations near PAM sites occurred
We then analyzed five single brown seeds from each of the above 14 in 13 of the 14 lines for each of the FAE1 genes. Nucleotide substitu-
transgenic lines. As shown in Fig. 2B, low 20:1 seeds were detected tions were also detected in 10 plants for each gene (Suppl. Fig. S3).
from 7 lines, though at a lower frequency (20/70). Specifically, all The high frequency of mutagenesis in the T2 plants compared to T1
seeds from line #3 had less than 1% of 20:1, indicating that this line plants was consistent with previous studies (Jiang et al., 2017;
had already reached homozygosity of the fae1 knockout mutation. Our Morineau et al., 2017), suggesting continued Cas9/sgRNA actions as
results thus demonstrated that homozygous camelina mutants could be transgenic plants were advanced to the next generations. Combining
obtained in a single generation, as previously reported for Arabidopsis with fatty acid analysis (Fig. 2), our sequencing results also indicated
using the same egg cell-specific promoter-driven CRISPR/Cas9 system that homozygous Cas9-transgenic camelina plants carrying mutations
(Wang et al., 2015). at all three FAE1 alleles have already been obtained in the T2 genera-
tion. Although the mutations affected all FAE1 genes in 13 T2 lines,
3.3. Mutations at the FAE1 alleles in the Cas9 transgenic camelina plants results from Fig. 2 suggested that not all mutations would cause FAE1
inactivation. Some of the nucleotide deletions or substitutions (Suppl.
To assess the efficacy of Cas9-induced mutagenesis at the FAE1 gene Fig. S3) that led to deletion or substitution of 1–2 amino acids in the
sequences, genomic sequences near the sgRNA sites were examined in translated FAE1 proteins may not significantly affect their enzyme ac-
transgenic plants. DNA fragments flanking the three FAE1 genes present tivities, therefore near or equal to wild type-level 20:1 contents were

4
M.E. Ozseyhan et al. Plant Physiology and Biochemistry 123 (2018) 1–7

Fig. 3. Comparison of sequences surrounding the sgRNA sequence in the camelina FAE1 genes. In WT sequences, bold letters distinguish nucleotide polymorphism between different FAE1
alleles. The gRNA sequences are underlined. PAM sites on reverse strands are italicized. In transgenic lines, red letters indicate nucleotide substitution; green letters show nucleotide
insertion. Deletions are indicated by dashes and the number of deleted nucleotides, and insertions are indicated by + number. Partial sequences of amino acids of the translated FAE1-A
proteins are also shown under the nucleotide sequences.

Fig. 4. Comparison of fatty acid composition between the

best performing Cas9 transgenic seeds and the non-trans-
genic wildtype camelina (Suneson). Data are means and
standard errors from 5 single seeds harvested from 3 in-
dividual T3 plants grown in the greenhouse at the same
time.

measured in those lines. intact protein. However, the substitution of the amino acids Tyr-His-
We reasoned that the seeds containing the lowest amounts of Phe in the wildtype FAE1-A with Ser-Leu-Leu might render the mutant
VLCFAs may have been caused by knockout mutations at all FAE1 al- enzyme inactive.
leles. To test this possibility, we selected a putative homozygous T2 line Due to limited number of sequences generated in this study, we did
(#3-3) that all 5 red seeds analyzed contained low amounts of 20:1. We not attempt to assess the overall efficiency or the nature of the mutants
excised small chips from the cotyledons of 20 red seeds for analyzing (such as insertions, deletions, or nucleotide substitutions), which have
fatty acid composition. The seeds contained less than 1% of 20:1 were been extensively evaluated in previous studies in camelina (Jiang et al.,
selected to germinate and gave rise to T3 plants (3-3-1, 3-3-3, 3-3-4 and 2017; Morineau et al., 2017). However, our results clearly indicated
3-3-14) for sequence analysis. As expected, all three alleles of FAE1 that the Cas9/sgRNA effectively induced gene mutations at the FAE1
were mutated at the sgRNA target sites, primarily by deletions near the targets, and the desired fatty acid changes can be obtained from a small
PAM sites that would cause translational frameshift and resulted in number (e.g. 14) of transgenic plants. Homozygous knockout mutants
FAE1 enzyme inactivation (Fig. 3). An exception was in the FAE1-A of multiple genes in the allohexaploid camelina can be obtained as early
gene in line 3-3-4, where the deletion was compensated by the insertion as the T2 generation by using an egg-cell specific promoter for Cas9/
of two nucleotides so that the gene might still be translated into an sgRNA expression.

5
M.E. Ozseyhan et al. Plant Physiology and Biochemistry 123 (2018) 1–7

3.4. Improving fatty acid composition in camelina seeds using FAE1 transgenes. Our results demonstrated the high efficiency of the CRISPR/
mutagenesis Cas9 technology in a hexaploid oilseed crop to simultaneously edit the
homologous genes. The FAE1 knock-out camelina seeds had sig-
Analyses of fatty acid composition of the Cas9-transgenic homo- nificantly changed fatty acid profiles especially increased C18 un-
zygous seeds indicated that knocking out all the FAE1 alleles sig- saturated fatty acids, thus provide ways to breed high oleic acid or high
nificantly reduced the VLCFAs. In one of the best performing lines (#3- α-linolenic acid varieties for food or industrial applications.
3), these C20 fatty acids comprised of less than 1.5% of total fatty acids
compared to over 22% in the wildtype seeds (Fig. 4). This result was Contribution
similar to the Arabidopsis fae1 mutant (Kunst et al., 1992). The small
amounts of VLCFAs in these mutants are possibly due to actions by M.O., X.M., C.L. designed experiments; M.O., X.M., J.K. conducted
other factors that are non-allelic to FAE1 (Kunst et al., 1992). The de- research; M.O and C.L. wrote the manuscript.
crease of VLCFAs caused concomitant increases in other fatty acids
(C16 and C18), especially the unsaturated fatty acids including oleic Acknowledgements
(18:1), linoleic (18:2) and α-linolenic (18:3) acids. This is expected
since the elongation and desaturation are the two major pathways for This project was partly funded by the US Department of Energy
18:1 modification. Knocking out FAE1 would block the elongation Office of Science (BER) grant no. DE-SC0016400, the National Science
pathway and direct fatty acyl flux toward desaturation. Our results Foundation grant no. DBI 1339358, the Department of Agriculture
demonstrate that Cas9/sgRNA targeting the FAE1 genes can be effec- grant no. 2015-67013-22815, and the Montana Agricultural
tively applied to make changes in camelina seed for favorable fatty acid Experimental Station.
compositions. For instance, one of the desirable traits in camelina seeds
is its high concentration of α-linolenic acid (18:3) for food and feed Appendix A. Supplementary data
application. Eliminating VLCFAs increased 18:3 content from 39% in
Suneson to 50% in the best Cas9 transgenic seed grown in our green- Supplementary data related to this article can be found at http://dx.
house conditions (Fig. 4). doi.org/10.1016/j.plaphy.2017.11.021.
Shutting off the 18:1 elongation pathway by knocking out FAE1 may
provide a tool to increase the oleic acid content for food and industrial References
applications. Reduction of 18:1 desaturation may be achieved by de-
creasing the FAD2 activity in camelina seed by RNA interference Al-Shehbaz, I.A., et al., 2006. Systematics and phylogeny of the Brassicaceae (Cruciferae):
(RNAi) (Kang et al., 2011; Nguyen et al., 2013) or CRISPR/Cas9 tech- an overview. Plant Syst. Evol. 259, 89–120.
Aznar-Moreno, J.A., Durrett, T.P., 2017. Simultaneous targeting of multiple gene home-
nologies (Jiang et al., 2017; Morineau et al., 2017). Simultaneously ologs to alter seed oil production in Camelina sativa. Plant Cell Physiol. 58,
knocking out all three FAD2 genes in camelina is however not feasible 1260–1267.
since unsaturated fatty acids are essential for plant growth. The Ara- Bae, S., et al., 2014. Cas-OFFinder: a fast and versatile algorithm that searches for po-
tential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30,
bidopsis fad2 mutant failed to survive at low temperatures (Miquel 1473–1475.
et al., 1993). Camelina fad2 knockout mutants created by CRISPR/Cas9 Bates, P.D., et al., 2009. Analysis of acyl fluxes through multiple pathways of tria-
showed stunted growth (Morineau et al., 2017). It may be possible to cylglycerol synthesis in developing soybean embryos. Plant Physiol. 150, 55–72.
Bates, P.D., et al., 2012. Acyl editing and headgroup exchange are the major mechanisms
target two of the FAD2 genes that are predominately expressed in seeds that direct polyunsaturated fatty acid flux into triacylglycerols. Plant Physiol. 160,
(Lowder et al., 2015) using gene-specific sgRNAs. By contrast, the ca- 1530–1539.
melina FAE1 knockout mutants did not show noticeable undesirable Beilstein, M.A., et al., 2006. Brassicaceae phylogeny and trichome evolution. Amer. J.
Bot. 93, 607–619.
effects on seed physiology and plant growth. Seed germination and
Browse, J., Somerville, C., 1991. Glycerolipid synthesis - biochemistry and regulation.
plant growth were comparable to Suneson when growing in normal Annu. Rev. Plant Physiol. Plant Mol. Biol. 42, 467–506.
greenhouse conditions. We analyzed transgenic T3 seeds for seed Büchsenschütz-Nothdurft, A., et al., 1998. Breeding for modified fatty acid composition
weight and oil content. These traits were similar to wildtype Suneson via experimental mutagenesis in Camelina sativa (L.) Crtz. Ind. Crops Prod. 7,
291–295.
(Suppl. Fig. S4), and the mutant seeds were visually indistinguishable Collins-Silva, J.E., et al., 2011. Camelina: a designer biotech oilseed crop. Inform
from the wild type. It therefore appears that FAE1 genes, which had 610–613.
been shown to be exclusively expressed in seed in Arabidopsis (Rossak Engler, C., et al., 2008. A one pot, one step, precision cloning method with high
throughput capability. PLoS One 3, e3647.
et al., 2001) and camelina (Suppl. Table S3) (Kagale et al., 2016), are Gunstone, F.D., 1998. Movements towards tailor-made fats. Prog. Lipid Res. 37, 277–305.
not essential for plant growth. We will further assess the effects of FAE1 Hines, P.J., Travis, J., 2016. The new harvest. Science 353, 1218.
mutations on plant performance in field conditions using homozygous Hutcheon, C., et al., 2010. Polyploid genome of Camelina sativa revealed by isolation of
fatty acid synthesis genes. BMC Plant Biol. 10, 233.
fae1 knockout plants that are free of Cas9/sgRNA and DsRed trans- Jaworski, J., Cahoon, E.B., 2003. Industrial oils from transgenic plants. Curr. Opin. Plant
genes. Biol. 6, 178–184.
Jiang, W.Z., et al., 2017. Significant enhancement of fatty acid composition in seeds of the
allohexaploid, Camelina sativa, using CRISPR/Cas9 gene editing. Plant Biotechnol. J.
4. Conclusion 15, 648–657.
Kagale, S., et al., 2014. The emerging biofuel crop Camelina sativa retains a highly un-
The oilseed crop camelina has great potentials in food and non-food differentiated hexaploid genome structure. Nat. Commun. 5, 3706.
Kagale, S., et al., 2016. The developmental transcriptome atlas of the biofuel crop
applications. It is necessary to improve fatty acid composition in its oils
Camelina sativa. Plant J. 88, 879–894.
to meet different requirements. In this study, we investigated the usage Kang, J., et al., 2011. Identification of three genes encoding microsomal oleate desa-
of the Fatty Acid Elongase1 (FAE1) in camelina by traditional muta- turases (FAD2) from the oilseed crop Camelina sativa. Plant Physiol. Biochem. 49,
genesis and new CRISPR/Cas9 approaches. A significant decrease in 223–229.
Kennedy, E.P., 1961. Biosynthesis of complex lipids. Fed. Proc. Amer. Soc. Exp. Biol. 20,
very long-chain fatty acids in a FAE1-B mutant suggested that the three 934–940.
FAE1 genes in camelina are responsible for synthesizing these VLCFAs Kunst, L., et al., 1992. Fatty acid elongation in developing seeds of Arabidopsis thaliana.
and they may act in an additive fashion. By designing a sgRNA targeting Plant Physiol. Biochem. 30, 425–434.
Labun, K., et al., 2016. CHOPCHOP v2: a web tool for the next generation of CRISPR
all three FAE1 genes using the CRISPR/Cas9 technology, we obtained genome engineering. Nucleic Acids Res. 44, W272–W276.
the knock-out mutants that accumulated very small amounts of VLCFAs Li, X., et al., 2007. Varied transcriptional efficiencies of multiple Arabidopsis U6 small
without causing deleterious effects on seed traits and plant growth. nuclear RNA genes. J. Integr. Plant Biol. 49, 222–229.
Li-Beisson, Y., et al., 2013. Acyl-lipid Metabolism. The Arabidopsis Book/American
Homozygous mutant plants were successfully obtained in a single Society of Plant Biologists, pp. 11.
generation by using an egg cell-specific expression of the Cas9/sgRNA

6
M.E. Ozseyhan et al. Plant Physiology and Biochemistry 123 (2018) 1–7

Lowder, L.G., et al., 2015. A CRISPR/Cas9 toolbox for multiplexed plant genome editing Napier, J.A., Graham, I.A., 2010. Tailoring plant lipid composition: designer oilseeds
and transcriptional regulation. Plant Physiol. 169, 971–985. come of age. Curr. Opin. Plant Biol. 13, 330–337.
Lu, C., Kang, J., 2008. Generation of transgenic plants of a potential oilseed crop Camelina Nguyen, H.T., et al., 2013. Camelina seed transcriptome: a tool for meal and oil im-
sativa by Agrobacterium-mediated transformation. Plant Cell Rep. 27, 273–278. provement and translational research. Plant Biotechnol. J. 11, 759–769.
Lu, C., et al., 2006. A high-throughput screen for genes from castor that boost hydroxy Pilgeram, A.L., et al., 2007. Camelina sativa, a Montana omega-3 and fuel crop. In:
fatty acid accumulation in seed oils of transgenic Arabidopsis. Plant J. 45, 847–856. Janick, J., Whipkey, A. (Eds.), Issues in New Crops and New Uses. ASHS Press,
Lu, C., et al., 2009. An enzyme regulating triacylglycerol composition is encoded by the Alexandria, VA, pp. 129–131.
ROD1 gene of Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 106, 18837–18842. Putnam, D.H., et al., 1993. Camelina: a promising low-input oilseed. In: Janick, J., Simon,
Lu, C., et al., 2011. New frontiers in oilseed biotechnology: meeting the global demand for J.E. (Eds.), New Crops. Wiley, New York, pp. 314–322.
vegetable oils for food, feed, biofuel, and industrial applications. Curr. Opin. Rossak, M., et al., 2001. Expression of the FAE1 gene and FAE1 promoter activity in
Biotechnol. 22, 252–259. developing seeds of Arabidopsis thaliana. Plant Mol. Biol. 46, 717–725.
Lukowitz, W., et al., 2000. Positional cloning in arabidopsis. Why it feels good to have a Tsai, S.Q., et al., 2015. GUIDE-seq enables genome-wide profiling of off-target cleavage
genome initiative working for you. Plant Physiol. 123, 795–805. by CRISPR-Cas nucleases. Nat. Biotechnol. 33, 187–197.
Marmon, S., et al., 2017. Two acyltransferases contribute differently to linolenic acid Wang, T., et al., 2014. Genetic screens in human cells using the CRISPR-Cas9 system.
levels in seed oil. Plant Physiol. 173, 2081–2095. Science 343, 80–84.
Millar, A.A., Kunst, L., 1997. Very-long-chain fatty acid biosynthesis is controlled through Wang, Z.P., et al., 2015. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently
the expression and specificity of the condensing enzyme. Plant J. 12, 121–131. generates homozygous mutants for multiple target genes in Arabidopsis in a single
Miquel, M., et al., 1993. Arabidopsis requires polyunsaturated lipids for low-temperature generation. Genome Biol. 16, 144.
survival. Proc. Natl. Acad. Sci. U. S. A. 90, 6208–6212. Xing, H.L., et al., 2014. A CRISPR/Cas9 toolkit for multiplex genome editing in plants.
Morineau, C., et al., 2017. Selective gene dosage by CRISPR-Cas9 genome editing in BMC Plant Biol. 14, 327.
hexaploid Camelina sativa. Plant Biotechnol. J. 15, 729–739.