Vol. 16(4), pp.

167-177, April 2022

DOI: 10.5897/AJMR2021.9610
Article Number: 436D2E669026
ISSN: 1996-0808
Copyright©2022 African Journal of Microbiology
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJMR Research

Full Length Research Paper

Isolation and identification of phytopathogenic bacteria

in vegetable crops in West Africa (Côte D’ivoire)
Akoua Emmanuella Adioumani1,2*, Solange Kakou-Ngazoa1, Trebissou Jonhson Noel David2,
Thibaud Martin3, Audrey Addablah1,2, Aristide Koudou1, Kan Stephane Kouassi1, Sina K.
Mireille1, N’golo Coulibaly1, S. Aoussi1 and Mireille Dosso1
1
institute Pasteur De Cote D’ivoire, Plateforme de Biologie Moléculaire, 01 BP 490 Abidjan 01, Côte d’Ivoire.
2
Universite Felix Houphouet Boigny, Laboratoire de Biologie Fonctionnelle et Moléculaire, 01 BP V 34, 01 Abidjan,
Côte d’Ivoire.
3
Cirad, Universite Felix Houphouet Boigny, Cea-Ccbad, Abidjan, Côte d’Ivoire.
Received 29 December, 2021; Accepted 11 March, 2022

Yield losses in food crops due to plant pathogenic bacteria are significant and increasing over the
years. The increasing losses caused by bacterial plant pathology are explained by the emerging
resistance of bacteria to the chemical agents used in plant protection. Moreover, these chemical agents
harm the environment through residue accumulation leading to soil pollution and the perturbation of
the soil's inner ecosystem. The most important bacteria causing plant pathology belong to the genera
of Pseudomonas, Ralstonia, Agrobacterium, Xanthomonas, Erwinia, Xylella, Pectobacterium, and
Dickeya. However, in Côte d'Ivoire, only the Ralstonia species have been identified. Therefore, this
study aims to identify plant pathogenic bacteria present in market garden plants in Côte d'Ivoire. Three
sites in the cities of Anyama, Abidjan, and Bingerville were selected for the sampling and the detection
of Pseudomonas syringea, Erwinia carotovora, Clavibacter michiganensis, Ralstonia solanacerum, and
Xanthomonas campestris. The samples consisted of healthy and affected plant leaves and soils. In
brief, 70 bacterial strains were isolated and phenotypically identified in this study. Among them, we
noticed that 20% were isolated from the leaves and 80% from the soil. Regarding the bacterial species,
C. michiganensis (37.14%), E. carotovora (18.57%), R. solanacerum (15.71%), X. campestris (14.28%),
and P. syringae (11.42%) were identified. The molecular identification has confirmed the identification of
the 5 plant pathogenic bacteria within all the studied sites. To the researchers’ knowledge, this study is
the first to describe the identification of P. syringea, E. carotovora, C. michiganensis, and X. campestris
isolated in plant crops in Côte d’Ivoire.

Key words: Phytobacteria, vegetable plants, PCR

INTRODUCTION

Vegetables contribute to more than 33% of world (Kanda et al., 2014). Tomato (Solanum lycopersicum),
agricultural production and employ 800 million people red pepper (Capsicum spp.), and, eggplant (Solanum

*Corresponding author. E-mail: [email protected]. Tel. 002250708490990.

Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution
License 4.0 International License
168 Afr. J. Microbiol. Res.

melongena) are among the 40 most cultivated plant collected and at the base of each plant, soil samples were also
species in the world (FAO, 2008). In sub-Saharan Africa, collected. All in all, for each site, 3 soil samples and 3 leaves
samples were collected per plant. Soil samples (10 g) were taken at
market gardening represents an important sector of 15cm depth (Popoola et al., 2015). The leaves were cut off at the
activity because of the nutritional material produced, but base of the petiole. Healthy and diseased leaves were collected at
also because of the source of income that it provides the rate of 10 leaves per plant (Gracein et al., 2012). Plant samples
(Djiéto-Lordon, 2007). In Côte d'Ivoire, the market collected were carefully bagged, shipped to the laboratory, and
gardening of vegetables represents an average of 27% of processed immediately or stored at 4°C and processed within 48 h.
the gross national product (GDP). In addition, the
demand for vegetables such as tomatoes, eggplants, and Pre-treatment
pepper is increasing due to population growth. Then,
farmers are intensifying their production to cover the Small pieces of leaves were cut aseptically; the surface of the leaf
needs. However, this production faces many biotic was sterilized in 70% alcohol and washed in three series of sterile
constraints such as bacterial diseases causing high distilled water to remove traces of alcohol. The leaves were
suspended in tubes containing 3 ml sterile distilled water for 15 to
losses, especially in tropical climates (Lebeau, 2010).
20 min (Gracein et al., 2012; Nakahara et al., 2021). One gram of
The plant pathogenic diseases led to the decrease in soil sample was weighed and added to a test tube containing 10 ml
agricultural yield and the increase in the prices of the of physiological water (9% NaCl). Then, the tubes were shaken for
products on the market. Therefore, there is need to 30 min, 50 rpm at room temperature to allow the separation of
identify bacteria responsible for plant pathogenic bacteria from the soil (Popoola et al., 2015 modified).
diseases in Côte d’Ivoire to propose a solution to
overcome the problem. According to their scientific and Isolation and characterization of phytobacteria
economic importance in the world, five bacterial species
were highlighted (Mansfield et al., 2012). Firstly, Isolation
Ralsotonia solanacearum is responsible for bacterial wilt
in tomatoes, eggplants, and potatoes. The bacterium, A serial decimal dilution of the bacterial suspensions obtained after
initially, infects the roots and then, invades the vascular pretreatment was carried out in 9 ml of sterile distilled water when
the water contained in the tubes became slightly cloudy. Then, 1 ml
system of the plants (Nakahara et al., 2021). Next, of the diluted bacterial cell suspension was poured onto sterilized
Pseudomonas syringae an epiphytic bacterium that Petri plates containing nutrient agar King B or YPGA. The
survives on weed roots, asymptomatic plants as well as inoculated plates were incubated at 28° for 24 to 48 h. Depending
seeds is known to cause symptoms of bacterial speckling on the appearance, coloring, and morphology of the bacterial
(black dot surrounded by a yellow halo) (Canzoniere et colony; an isolated colony was picked and plated again on nutrient
al., 2021). Xanthomonas campestris, for its part, is agar using a Pasteur pipette (Table 1). This step was repeated
three times to allow purification of the isolated strain (Chartier,
responsible for black rot and causes vascular disease in 2005; Amkraz et al., 2010; Gracein et al., 2012; Huynh et al., 2019).
some plants or leaf spots in others (Vicente and Holub,
2013). Following this, Clavibacter michiganensis spreads
through plant vessels and causes symptoms such as Bacterial detection by polymerase chain reaction
wilting, stem canker, vascular discoloration, and cell habit
(Yim et al., 2012). The contaminated seeds by C. The DNA extraction of isolated bacteria was performed using
michiganensis remain the main mean of bacterial Qiagen® DNA extraction kit following the manufacturer’s
recommendations. Fives colonies of bacteria were diluted in 100µl
propagation. Finally, Erwinia carotovora enters the plant water (Qiagen, 2003).
through wounds. The plant walls are then degraded and The PCR analysis was performed to amplify conserved genes for
the tissues are macerated by pectolytic enzymes causing each phytobacterium. The reaction mix contained
soft rotting of stems and fruits (Boumaaza et al., 2018). 1XFirepolMasterMix (SolisBiodyne), 16 µl molecular water, 5 µl of
Regarding the economical and nutritional implications of DNA extract, and 0.5 µM specific primers for each bacterium (Table
bacterial plant diseases, this study aimed to detect the 2). For amplification, initial denaturation was carried out at 95 °C for
10 min, followed by 32 cycles of denaturation at 95°C (30 s),
presence of cited bacteria that can cause infections in annealing at 54°C (30 s), and elongation at 72°C (1 min). Finally,
tomato, eggplant, and chili pepper. the elongation of 5 mn was carried out. The amplification program
was conducted on Applied Biosystems (9700 PCR System
thermocycler). PCR products were visualized using 1.5% (wt/vol)
MATERIALS AND METHODS agarose gel electrophoresis and a 100-bp DNA ladder (Promega).

Samples collection
Bacterial activity tests
The sampling sites chosen are fields where organic culture is
practiced. Eggplant and pepper plant samples were collected from Bacterial growth in vitro
site 1, located in a forest of the city of Anyama and near a
waterway. Tomato plant samples were collected from site 2, located The bacterial count makes it possible to know the exponential
in the city of Abidjan. Finally, eggplant and pepper plant samples growth time of the bacteria used. This count is done at different
were also collected on site 3 in the outskirt of Bingerville city (Figure times (0, 2, 4, 6, 8, and 24h). A stock solution of fresh phytobacteria
1). For each plant, samples of diseased and healthy leaves were is serially diluted up to 10-8 and then plated on King B or LPGA
 Adioumani et al. 169

Figure 1. Sites of the sampling of the study.

Table 1. Isolation of bacteria.

Bacterial Bacteria causing the Temperature and

Culture center Aspects of the colonies References
diseases infection incubation time
Bacterial wilt R. solanacearum King B 26°C, 48h Bluish fluorescent Huynh et al., 2019
Bacterial canker C. michiganensis LPGA 26°C, 24 - 48h Cream to yellowish Amkraz et al., 2010
Bacterial scib X. campestri LPGA 26°C, 24 - 72h Pale or yellow Gracein et al., 2012
Bacterial speck P. syringae King B 26°C, 24 - 48h Round white and smooth Amkraz et al., 2010
Soft rot E. carotovora King B 26°C, 24h Convex and bluish Chartier, 2005

Table 2. Oligonucleotides for molecular identification of bacteria.

Species Sequences Lenght (pb) Target References

ATTACGAGAGCAATCGAAAGATT
91 16S-23S
TCGCTTGACCCTATAACGAGTA
R. solanacearum Kumar et al., 2017
GTCGCCGTCAACTCACTTTCC
280 16S-23S
GTCGCCGTCAGCAATGCGGAATCG

TCATTGGTCAATTCTGTCTCCC
C. michiganensis 271 16S-23S Yim et al., 2012
TACTGAGATGTTTCACTTCCCC

AGTTGCAGCAGCTGTTCT
X. campestri 304 rpfH Kiran et al.,2019
ATAGCACGTATTGGCAGGG

TTACCGGACGCCGAGCTGTGGCGT Photchanachai et al.,

E. carotovora 435 ARN 16S
CAGGAAGATCTCGTTATCGCGAGT 2006

ACGAGCTGAAGGAAGACA
P. syringeae 525 HrpZpst Zaccardell et al., 2005
CAGCCTGGTTAGTCTGGTTA
170 Afr. J. Microbiol. Res.

Table 3. Distribution of isolated strains according to the sites.

Isolated strains Positive PCR strains

Variable
Site 1 Site 2 Site 3 Total Site 1 Site 2 Site3 Total
Ralstonia sp 4 2 4 10 1 1 2 4
Clavibacter sp 7 10 10 27 1 2 4 7
Pseudomonas sp 6 3 3 12 4 0 0 4
Erwinia sp 4 4 4 12 1 1 0 2
Xanthomonas sp 2 6 1 9 0 2 2 4

agar. The tests were repeated in triplicate. The dishes were between 1.4 and 2.1. The table shows the concentration
incubated at 28°C for 24 h. and purity of the PCR-positive strains (Table 4).

Bacterial pathogenicity test in vivo

Molecular characterization
One-month-old tomato plants were inoculated with a fresh culture of
the following bacteria: R. solanacerum, E. carotovora, X. campestris, Genomic amplification by PCR made it possible to obtain
C. michiganensis, and P. syringea. The bacterial strains used are 271 bp fragments for C. michiganensis representing the
those that have been confirmed by PCR. Inoculation was done by 16S-23S gene. Products of 280 bp for R. solanacearum
adding 500µl of fresh bacterial culture to the leaf surface of each and 435 bp for E. carotovora were both obtained
plant. The inoculated plants are observed until the appearance of targeting the 16S-23S gene. P. syringae targets the
the first symptoms (Table 1, Figure 9). The inoculated plants were
re-isolated on agar and compared to the base strains as follows.
HrpZpst gene with a fragment size of 525 bp, while the X.
Leaves from each plant were cut (3 leaves per plant) and placed in campestris (hrp) gene has a fragment size of 304 bp. For
tubes containing 2ml of sterile distilled water for 1 hour. Dilutions in molecular characterization by PCR, we identified 28.57%
physiological water were then made and 10µl spots were deposited positive phytobacteria. According to the bacterial species,
on the agar incubated at 28°C for 24 h. All the tests were repeated there is 35% of C. michiganensis, 5% E. carotovora, 20%
three times for each bacterium (Kumar et al., 2017 modified). R. solanacearum, X. campestris and P. syringae (Figures
4 to 9).

RESULTS
Bacterial growth curve
Collection of samples and bacterial identification
The number of colony-forming units (CFU) was evaluated
A total of 70 bacteria were isolated. The strains isolated at different dilutions of isolates at different times. The
from site 1 are 23 in number, 25 from site 2, and 22 from isolates used are the PCR positive isolates. The number
site 3. Among them, 20% were isolated from the leaves of colony-forming units (CFU) was assessed at different
and 80% from the soil. According to the bacterial species, dilutions of isolates at different time points. The isolates
there were 38.57% of Clavibacter sp; 17.14% Erwinia sp, used are the positive PCR isolates. The highest bacterial
14.728% Ralstonia sp; 12.85% Xanthomonas sp, and growth was observed in E. carotovora; followed by one of
14.42% Pseudomonas sp. 36% of the bacterial strains the Ralstonia strains. Two of the strains of Clavibacter
were isolated from site 2, while for sites 1 and 3 we had had similar bacterial growth. They could be the same
33 and 31% of isolated bacteria respectively (Table 3), strain or a neighboring strain. Clavibacter strain 18 has
(Figures 2 and 3). The five investigated bacteria were much weaker growth than the previous two strains. All
recovered in the 3 sites. like the two strains of Xanthomonas and Erwinia which
could come from distant strains (Figure 10).

Quantification of genomic DNA

Pathogenicity test
Genomic DNA was extracted from 70 strains. The
amount of nucleic acid was quantified using Nanodrop Pathogenicity tests showed that the selected strains were
oneC instruments. Indeed, the highest amounts of DNA able to induce infection in tomato plants. The first
were identified in X. campestris followed by strains 26 symptoms appeared 14 days after inoculation for R.
and 15 of C. michiganensis then strains 10 and 8 of solanacearum, E. carotovora, and X. campestris. Early
Ralstonia. The highest concentrations are 218, 246, 172, symptoms of R solanacearum were characterized by
165.5 and 165.1 µg/ml. The purity of the samples was yellowing and wilting of leaves. Erwinia induces yellowing
 Adioumani et al. 171

Figure 2. Distribution of bacteria strains.

Figure 3. Bacteriological identication of phytopathogen bacteria. 1. Ralstonia

Solanacearum; 2. Clavibacter michiganensis; 3. Pseudomonas syringeae; 4. Erwinia
carotovora; 5. Xanthomonas campestris

of the leaves while small yellow to brown spots have one month after inoculation in the plant. Symptoms of C.
been observed on the leaves of plants infected with X. michiganensis were manifested by the appearance of a
campestris. C. michiganensis and Pseudomonas appear burning color on some leaves as well as their wilting. One
172 Afr. J. Microbiol. Res.

Table 4. ADN concentration.

Isolate Concentration (ng/µl) Purity (260/280) Isolate Concentration (ng/µl) Purity (260/280)
Isolate 1 56.6 1.97 Isolate10 165.1 1.94
Isolate 2 163.7 1.79 Isolate11 135.1 2.11
Isolate 3 109.7 1.92 Isolate12 165.5 2
Isolate 4 151.4 1.24 Isolate13 117.7 1.96
Isolate 5 246.7 2.02 Isolate14 33 1.82
Isolate 6 21.4 2 Isolate15 80.2 1.34
Isolate 7 36.3 1.99 Isolate16 218 1.62
Isolate 8 123.7 2.1 Isolate17 16.3 2.09
Isolate 9 68.1 1.96 Isolate18 120.8 2.05

Figure 4. Molecular identification of Ralstonia solanacerum. L: Ladder, 1,2,3,4: Sample of tomato.

Figure 5. Molecular identification of Clavibacter michiganensis. L: Ladder, 1,2,3,4,5,6,7: Sample of eggplant; 8,9,
10,11, 12, 13, 14, 15: Sample of tomato.

appearance of leaves infected by Pseudomonas was was assessed weekly after inoculation. The bacteria
characterized by the appearance of yellowish to brown concentrations obtained were listed in Figures 10 and 11.
spots on the leaves. The bacterial count of each strain The figure showed that from 0 to 4 days, the bacterial
 Adioumani et al. 173

Figure 6. Molecular identification of Pseudomonas syringea. L: Ladder; 1.2.3.4: Sample of

tomato.

Figure 7. Molecular identification of Erwinia carotovora. L: Ladder (Promega 100pb); 1.2.3.4: Bacteria sample of
tomato from site 1.2.3.

concentration of all bacteria was almost zero. Between chemical-free. The constituent elements of the
14 and 10 days, the concentration of bacteria increased rhizosphere have therefore been preserved. And there is
slightly. From day 10, bacterial growth of Clavibacter; a close connection between subsoil microbes and
Xanthomonas, and Erwinia on leaves increased aboveground components of the plant ecosystem (Kumar
exponentially. As for Ralstonia and Pseudomonas, et al., 2017). Previously used as a household waste
growth remained low throughout the experiment. dump 36% of the phytobacteria were isolated from site 2.
Indeed, this waste was the growth biotope of several
microorganisms of bacterial, viral, and parasitic origin.
DISCUSSION And Cissé's study demonstrated that a biotope where
contamination is high presents a high risk for cultivated
This study confirms the presence of phytopathogenic plants (Cissé, 1997). C. michiganensis responsible for
bacteria in leaf and soil samples from the sites. A bacterial canker, was the most isolated phytobacteria on
collection of 70 bacterial strains was isolated. The the three sites with 38.57% confirmation. The results
bacteria isolated from site 1 are 33%. The results coincide with those of Ftayeh and Nandi who state that
corroborate those of Kumar et al, 2017 in their study Clavibacter is a devastating emerging disease for crops.
which shows that the rhizospheric bacteria were a It is a serious disease in the world and new epidemics
mixture of antagonists and neutral and mutualistic have recently been reported in several countries (Ftayeh
pathogens. Site 1's cultivation system was organic and et al., 2011) hence its strong presence in these soils has
174 Afr. J. Microbiol. Res.

Figure 8. Molecular identification of Xanthomonas campestris. L: Ladder; 1.2: Sample of

eggplant; 3.4: Sample of tomato.

Figure 9. Tomato plants inoculated with phytobacteria. A1-A2: Plant without bacteria (negative culture); B1:
Tomato plants inoculated with Xanthomonas campestris after 3 days; B2: Tomato plants inoculated with
Ralstonia solanacerum after 3 days; C1: Tomato plants inoculated with Xanthomonas campestris after 15
days; C2: Tomato plants inoculated with Ralstonia solanacerum after 15 days; E: Erwinia carotovora; R:
Ralstonia solanacerum; C: Clavibacter michiganensis; X: Xanthomonas campestris; Cfu: Colony forming
unity.
 Adioumani et al. 175

Figure 10. Bacterial concentration of plant pathogens.

caused significant crop losses. It is also considered one Although the hrp gene is unknown in virulence and
of the most devastating plant diseases of crops (Nandi et pathogenicity, this region is essential for the production of
al., 2018). It is followed by E carotovora preferentially symptoms in the host (Zaccardelli et al., 2005). It is
isolated on site 2 at 17.14%. The results are contrary to considered a stable gene using 16S-DNA. In Côte
the results of a previous study by Benada which showed d'Ivoire in seven agroforestry regions, the study by
that Erwinia sp is a bacterium that preferentially infects Guessan (Guessan et al., 2012) described a high
fruits and potatoes (Benada et al., 2019). Damaged fruits prevalence of 87% for Ralstonia phylotype I. In this study,
and potatoes deposited on the plot of site 2 formerly used 36% of Ralstonia solanacerum were confirmed by PCR.
as a dump could be the cause of the appearance of this The isolates of C. michiganensis (21.42%) are Pcr
bacterium. And the insect vectors par excellence have positive. ITS region sought for molecular confirmation of
allowed the spread of this bacterium in plants (MHMED, Clavibacter is a relatively variable area. Yim et al. (2012)
2019). showed a difference of more than 50% between the ITS
One of the most important bacteria in peppers and regions of tomato and pepper crops. And a diversity of
crucifers is Xanthomonas campestris. It is seed-borne genetic variation exists between Clavibacter populations
and can survive in weeds and plant debris for months. in several countries (De Leon et al., 2009). Our
These matrices are a biotope for surviving Xanthomonas pathogenicity test results showed that R. solanacerum; E.
(Laala et al., 2021). Xanthomonas campestris was carotovora and X. campestris induce symptoms on
isolated with a percentage of 12.85% in tomatoes. A tomato plants. The first symptoms appeared after 14
previous study isolated xanthomas in rice and it was days. And according to the literature the first symptoms
Xanthomonas oryzae pv. Oryzicole in Ivory Coast (Diallo appear after an infection time of 14 days (Iiyama et al.,
et al., 2010). However, strains of Xanthomonas 2021). These bacteria are preferentially present in the
campestris have just been isolated for the first time in rhizosphere. They, therefore, infect the plant through the
Côte d'Ivoire. At the level of molecular characterization, roots and invade the vascular system. The bacteria grow
50% of Pseudomonas isolates were PCR positive. and produce extracellular polysaccharides which cause
176 Afr. J. Microbiol. Res.

Figure 11. Concentration of phytobacteria.

obstruction of the first symptoms on the plant and the CONFLICT OF INTERESTS
death of the latter (Nakahara et al., 2021). The Ralstonia
strains used induced infection in tomato plants. It could The authors have not declared any conflict of interests
therefore be race 3. Indeed, according to a study by
(Kumar et al., 2017), the strains capable of infecting
REFERENCES
Solanaceae are part of race 3.
After one month of infection, all plants infected with C.
Amkraz N, Boudyach EH, Boubaker H, Bouizgarne B, Aoumar AA
michiganensis and P. syringea showed symptoms. These (2010). Screening for fluorescent pseudomonades, isolated from the
results are consistent with those of Yim et al. (2012) rhizosphere of tomato, for antagonistic activity toward Clavibacter
which show 25 days after inoculation, the plants show michiganensis subsp. michiganensis. World Journal Microbiology and
Biotechnology 26(6):1059-1065.
symptoms and 80% of the plants die. This study
Boumaaza B, Boudalia S, Khaladi O, Guessas B, Bella A (2018).
confirmed the presence of phytobacteria in plants. 70 Variability of aggressiveness and virulence of Erwinia carotovora
strains of phytopathogenic bacteria were isolated in three subsp. carotovorum causing the soft rot on potato tubers in the
sites (rural, semi-rural, and urban sites). And 20 strains western of Algeria. International Journal of Plant Biology 9(1):7568.
Canzoniere P, Francesconi S, Giovando S (2021). Antibacterial activity
have been confirmed by molecular diagnosis. E.
of tannins towards Pseudomonas syringae pv. tomato, and their
carotovora strains X. campestris C. michiganensis and P. potential as biostimulants on tomato plants. The international Journal
syringea were isolated for the first time in this study. C. of the Mediterranean Phytopathological Union 60:23-36.
michiganensis is the most predominant strain in the Cissé (1997). Impact sanitaire de l'utilisation d'eaux polluées en
agriculture urbaine. Cas du maraîchage à Ouagadougou (Burkina
tomato and eggplant plant. E. carotovora and R.
Faso). Ecole polytechnique de losanne. 447p
solanacerum are abundant at all sites. These strains Chartier R (2005). Méthodes d’appréciation du comportement variétal
induced in vivo infection tests with major leaf symptoms. vis-à-vis des bioagresseurs. Cahier des.
Isolated bacteria are responsible for various infections Djiéto-Lordon C, Aléné DC, Reboul JL (2007). Contribution à la
connaissance des insectes associés aux cultures maraichères dans
resulting in huge production losses. To compensate for
les environs de Yaoundé -Caméroun. Cameroun Journal Biological
these losses, the use of biopesticides such as agriphages and Biochemical Sciences 15:1-13.
is a godsend, especially since their isolation is Food and Agriculture Organization (FAO) (2008). La flambée des
inexpensive. The isolation of agriphages would then be a denrées alimentaires: faits, perspectives, effets et actions requises.
Document HLC/08/INF/1 préparé pour la Conférence de haut niveau
considerable alternative to reduce production losses due
sur la sécurité alimentaire mondiale: Les défis du changement
to phytopathogens. climatique et des bioénergies, 3-5 juin 2008, Rome.
 Adioumani et al. 177

Ftayeh RM, Tiedemann AV, Rudolph KWE (2011). A New Selective Muhamed B (2019). Caractérisation phénotypique et génotypique
Medium for Isolation of Clavibacter michiganensis subsp d’Erwinia sp pathogène et essaie de lutte biologique Soutenue.
michiganensis from Tomato Plants and Seed A New Selective https://theses.univ-oran1.dz/document/TH5096.pdf
Medium for Isolation of Clavibacter michiganensis subsp. Nakahara H, Maehara A, Mori T, Matsuzoe N (2021). Selection of
michiganensis from Tomato Plants and Seed. The American Eggplant Cultivars and Combination with Graft Cultivation for
Phytopathological Society 101(11):1355-1364. Effective Biological Control of Vascular Wilt Diseases Using a
Guessan CAN, Abo K, Fondio L, Chiroleu F, Lebeau A, Poussier S, Phenotypic Conversion Mutant of Ralstonia solanacearum. The
Wicker E, Koné D (2012). So Near and Yet so Far : The Specific Japanese Society for Horticultural Science P 1.
Case of Ralstonia solanacearum Populations from Côte d’ Ivoire in Nandi M, Macdonald J, Liu P, Weselowski B, Yuan ZC (2018).
Africa. Phytopathology 102. https://doi.org/10.1094/PHYTO-11-11- Clavibacter michiganensis ssp. michiganensis: bacterial canker of
0300. tomato, molecular interactions, and disease management. Molecular
Gracein DH, Herin D, De Britto AJ, Kumar R, Jeya PB (2012). Detection Plant Pathology 19(8):2036-2050.
and identification of Xanthomons cempestris pv. centellae on leaves Photchanachai S, Cheevadhanarak S, Phokum C, Jitareerat P (2006).
of Centella asiatica collected in Tamilnadu. Asian Journal of Detection and classification of soft rot Erwinia of vegetables in
Pharmaceutical and Clinical Research 5(1):111-113. Thailand by DNA polymerase chain reaction. In IV International
Huynh NT, LeUyen T, Trinh QP, Tran TT, Luu TD, Nguyen TTN (2019). Conference on Managing Quality in Chains-The Integrated View on
Isolation and Virulent Evaluation of Ralstonia solanacearum cause Fruits and Vegetables Quality 712:917-926.
the Bacterial Wilt in Chrysanthemum (Chrysanthemum Sp.) from Popoola AR, Ganiyu SA, Enikuomehin OA, Bodunde JG, Adedibu OB,
Mekong Delta and Lam Dong Province. Biological Forum an Durosomo HA, Karunwi OA (2015). Isolation and Characterization of
international Journal 11(1):101-106. Ralstonia solanacearum Causing Bacterial Wilt of Tomato in Nigeria.
Iiyama K, Imamura M, Inoue T, Kyaw HWW, Yano K, Horita M, Nigerian Journal of Biotechnologie 29:1-10.
Tsuchiya K, Furuya N (2021). Pathogenicity evaluation of Ralstonia Qiagen (2003). QIAamp ® DNA Mini Kit and QIAamp DNA Blood Mini
pseudosolanacearum race 4 on ginger by leaf-clipping inoculation. Kit Handbook For DNA purification from Whole blood Buffy coat Body
Journal of General Plant Pathology 87(5):269-272. fluids Lymphocytes Cultured cells Tissue Swabs Dried blood spots
Kanda M, Akpavi S, Wala K, Djaneye-Boundjou G, Akpagana K (2014). February 2003.
Diversité des espèces cultivées et contraintes à la production en Vicente JG, Holub EB (2013). Pathogen profile Xanthomonas
agriculture maraichère au Togo. International Journal of Biological campestris pv. campestris (cause of black rot of crucifers) in the
and Chemical Sciences 8(1):115-127. genomic era is still a worldwide threat to brassica crops. Molecular
Kiran R, Kandan A, Kumar P, Singh D, Akhtar J, Singh B, Dubey SC Plant Pathology 14(1):2-18.
(2019). Development of species-specific primers for detection of Yim K, Lee H, Kim J, Lee S, Cho J, Cha J (2012). Characterization of
xanthomonas campestris pv. campestris causing black rot of phenotypic variants of Clavibacter michiganensis subsp.
crucifers. Journal of Environmental Biology 40(1):105-110. michiganensis isolated from Capsicum annuum. European Journal of
Kumar S, Hamsaveni N, Gowda PHR (2017). Isolation and Plant Pathology 133(3):559-575.
Characterization of Ralstonia solanacearum Causing Bacterial Wilt of Zaccardelli M, Spasiano A, Bazzi C, Merighi M (2005). Identification and
Solanaceae Crops. International Journal of Current Microbiology and in planta detection of Pseudomonas syringae pv. tomato using PCR
Applied Sciences 6:1173-1190. amplification of hrpZPst. European Journal of Plant Pathology
Laala S, Cesbron S, Kerkoud M, Valentini F, Bouznad Z, Jacques MA 111(1):85-90.
(2021). Characterization of Xanthomonas campestris pv . campestris
in Algeria. Phytopathologia Mediterranea 60(1):51-62.
Lebeau A (2010). Resistance de la tomate, l’aubergine et le piment à
Ralstonia solanacearum:interactions entre les géniteurs de
résistance et la diversité bactérienne, caractérisation et cartographie
des facteurs génétiques impliqués chez l’aubergine.
Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P,
Dow M, Verdier V, Steven VB, Machado MA, Toth I, Salmond G,
Foster GD (2012). Top 10 plant pathogenic bacteria in molecular
plant pathology. Molecular Plant Pathology 13(6):614-629.