Topic 4 Genetic Control My Notes

GENETIC CONTROL: Nucleic Acids and Protein Synthesis
‘A’ LEVEL BIOLOGY MADE SIMPLE compiled by TARUVINGA G   +263 772 980 253
Page 1
8.4 TOPIC 4 GENETIC CONTROL

KEY OBJECTIVES CONTENT SUGGESTED SUGGESTED
CONCEPT Learners should be (ATTITUDES, LEARNING RESOURCES
able to: SKILLS AND ACTIVITIES
KNOWLEDGE) AND NOTES
8.4.1  describe the structure - Nucleoside  Illustrating the  Models
Nucleic of a nucleotide - Nucleotide structure of a  ICT tools
Acids nucleotide.  Braille
 describe formation of - Dinucleotide software/Jaws
a dinucleotide - Phosphodiester  Demonstrating
bonds the formation of
a
 distinguish between - RNA nucleotides phosphodiester
Ribonucleic acid bond.
(RNA) and - DNA nucleotides
Deoxyribonucleic  Discussing the
acid (DNA) differences
nucleotides between RNA
and DNA
nucleotides.
8.4.2  describe the - DNA structure  Constructing  ICT tools
Structure structure of DNA models of  Braille
and DNA. software/Jaws
replication  explain how DNA - semi -
of DNA replicates conservative  Making DNA  Print media
replication of DNA models  Models (zips,
illustrating beads, soft
- Messelson and replication. wires)
Stahl experiment
Nucleic acids and protein synthesis
 Nucleic acids have roles in the storage and retrieval of genetic information and
in the use of this information to synthesise polypeptides.
 Within the structure of nucleic acid is a genetic code used by cells for assembling
amino acids in correct sequences to make polypeptides/proteins.
Structure and replication of DNA

Understanding the structure of nucleic acids allows an understanding of their role in the
storage of genetic information and how that information is used in the synthesis of
proteins.
By the end of this section you should be able to:

a) describe the structure of nucleotides, including the phosphorylated nucleotide ATP
Page 2
b) describe the structure of RNA and DNA and explain the importance of base pairing
and the different hydrogen bonding between bases
c) describe the semi-conservative replication of DNA during interphase
Nucleic acids – the information molecules
— Nucleic acids are the information molecules of cells; they are the genetic material
of all living organisms and also of viruses. Within the structure of nucleic acid are
coded the „instructions‟ that govern all cellular activities. This code (known as
the genetic code) is a universal one – it makes sense in all organisms.
— There are two types of nucleic acids found in living cells, deoxyribonucleic acid
(DNA), and ribonucleic acid (RNA).
— DNA is the genetic material and occurs in the chromosomes of the nucleus. some
RNA also occurs in the nucleus, but most is found in the cytoplasm – particularly in
the ribosomes.
The three components of a nucleotide
— DNA and RNA are both nucleic acids.
— Nucleic acids are polymers called polynucleotides.
— Each polynucleotide is made of monomers called nucleotides.
— Each nucleotide consist of three components combined together:
1. phosphoric acid (H3PO4) [in its charged form it is referred to as a phosphate
group (PO43-)].
2. a pentose sugar, either deoxyribose (C5H10O4) in DNA or ribose (C5H10O5)
in RNA.
3. a nitrogenous base (organic base which contains nitrogen), either cytosine
(C), guanine (G), adenine (A), thymine (T) or uracil (U).
— The base thymine is found in DNA only and the base uracil is found in RNA
only.
— The nitrogenous bases are categorised into two as purine bases or pyrimidine
bases.
 The purines have a double ring structure and pyrimidines have a single ring
structure.
 Purines (adenine and guanine) have a six-membered ring fused to a five-
membered ring (=double ring, therefore bigger).
 Pyrimidines (cytosine, thymine, and uracil) have a single six-membered
ring (=single ring, therefore smaller).
Purine Pyrimidine
 Double rings of carbon and nitrogen atoms.  Single ring of carbon and nitrogen atoms.
 Bigger than purines.  Smaller than purines.
 Adenine  Thymine
 Guanine  Cytosine
 Uracil
Page 3
DIAGRAM: The 3 components of a nucleotide.
What is the difference between ribose and deoxyribose sugars?
Page 4
A nucleotide is formed by condensation reactions

— The three components, nitrogenous base, pentose sugar and phosphoric acid, are
combined by condensation reactions to form one nucleotide
(mononucleotide) with the release of two molecules of water.
— Hydrolysis of the nucleotide by nuclease enzymes will break it down back into its
components.
— The structure of these components and how they are combined together are
illustrated in the following diagram.
DIAGRAM illustrating the formation of a nucleotide by condensation and its breakdown

by hydrolysis.
 The portion of the nucleotide without the phosphate group/phosphoric

acid is called the nucleoside.
 That is, Nucleoside = Nitrogenous base + Pentose sugar (linked through
N−glycosidic bond). Examples of nucleosides − adenosine,
deoxyadenosine, cytidine, etc.
Page 5
 Nucleotide (mononucleotide) = Nucleoside + Phosphate group
Nucleotides combine through condensation to form polynucleotides (nucleic

acids)
— Nucleotides bond by condensation reactions forming phosphodiester bonds
between pentose sugars and phosphate groups to form nucleic acids (a.k.a.
polynucleotides) namely DNA and RNA.
 This continuous chain of alternating pentose sugars and phosphate groups is the
sugar-phosphate backbone.
 Many nucleotides link together through 3′−5′ phosphodiester bond to form a
polynucleotide chain (as in DNA and RNA).
— The diagram that follows shows the condensation reaction between two
nucleotides (two mononucleotides) to form a dinucleotide.
Page 6
— More nucleotides added to the dinucleotide by condensation reaction results in a

polynucleotide. See the diagram that follows.
Page 7
— Alternating sugar and phosphate molecules form the „backbone‟. This part of the
nucleic acid molecule is uniform and unvarying.
— Attached to each sugar is one of the bases, and these project sideways. Since the
bases vary, they represent a unique sequence that carries the coded information held
by the nucleic acid.
DNA STRUCTURE AND FUNCTION
Page 8
DNA STRUCTURE
— DNA => Deoxyribonucleic Acid.
— The sugar in DNA is deoxyribose.
— Long-chain polymer of nucleotide monomers.
— Stable polynucleotide.
— Usually double stranded except viral DNA which is single stranded.
Base Pairing in DNA:
— The two DNA strands are antiparallel which is essential for gene coding and
replication.
— The strands are anti-parallel means they run in opposite directions to each other.
The sugar-phosphate backbone of one strand runs in the direction 3‟-5‟ while the
other in the opposite direction of 5‟-3‟.
— Bases project inwards from the backbone.
— Chains are always the same distance apart as bases pair in a specific way:
 A-T
 G-C
 When a purine appears on one side, a pyridimine appears on the other.
— As the strands come together, hydrogen bonds form between the base pairs
 Base pairing by weak hydrogen bonds
 Adenine-Thymine 2 H- bonds: A=T
 Cytosine-Guanine 3 H- bonds: C G
— Differing structure of the bases, means that base pairing rules always apply: a
purine in one strand must be opposite a pyrimidine in the other, and vice versa.
 This form of pairing is described as complementary base pairing:
 A is complementary to T
 G is complementary to C
 This is because there is just enough space between the two sugar–phosphate
backbones for one purine and one pyrimidine molecule.
— The 2 strands twist to form a double helix, which is the final structure;
 Held together by hydrogen bonds which are strong enough to maintain DNA
structure but weak enough to be overcome during DNA replication.
Page 9
The stability of DNA
 The phosphodiester backbone protects the more chemically reactive organic

bases inside the double helix. The genetic code is in the sequence of the bases.
By having the genetic code embedded into the phosphate backbone, it protects
the material from being corrupted by outside chemicals or physical forces.
 The hydrogen bonds between the organic base pairs form bridges (rungs)
between the phosphodiester uprights.
 Between the cytosine and guanine are 3 hydrogen bonds, therefore increasing
the stability of the molecule as a whole compared to the adenine and thymine
which has 2 hydrogen bonds.
 As the molecule is so stable, it is rare for mutations to occur which makes it ideal
for carrying hereditary material that is passed on from generation to generation.
Page 10
Functions of DNA
 Acts as an information store
 Bases projecting from backbone act as a coded sequence
 Organisms differ in their DNA only because they contain different sequences of
bases in DNA
 Carry the genetic code („information‟) that determines the order of amino acids
(primary structure) of proteins
 Needs to be replicable
 Produce copies that preserve the base sequences
 Preserve information
 Base-pairing rules allow for this
 Long molecule
 Lots of information can be stored
 Double helix provides stability
RNA structure and function
Page 11
 RNA = Ribonucleic acid.

 Contain ribose instead of deoxyribose.
 Single strand/chain (shorter than DNA - lower molecular mass).
 Base difference: Uracil instead of Thymine. Adenine, Guanine and Cytosine are
the same as in DNA.
Three types of RNA:

 Ribosomal RNA (rRNA)
 Located in the cytoplasm - ER
 Reads mRNA code and assembles amino acids in their correct sequence to
make a functional protein (translation)
 Messenger RNA (mRNA)
 Commutes between nucleus and cytoplasm
 Copies the code for a single protein from DNA (transcription)
 Carries the code to ribosomes in the cytoplasm
 Transfer RNA (tRNA)
 Clover-shaped molecule.
 Found in the cytoplasm.
 Transfer amino acids from the cytoplasm to the ribosomes.
Page 12
Table: The differences between DNA and RNA

DNA RNA
Location Found in the nucleus, chloroplast and Found in the nucleus and
mitochondria. cytoplasm
Length Very long strands, several million Relatively short strands

nucleotides long
Pentose Deoxyribose Ribose

Sugar
Bases G, C, A and T (not U) G, C, A and U (not T)

Double strand of nucleotides in the Single strand of nucleotides which
Type of
form of a double helix with can be folded into different shapes
strand
complementary base pairs: C with G
and A with T held by hydrogen bonds.
One basic form Three main forms: messenger RNA
Forms
(mRNA), transfer RNA (tRNA),
ribosomal RNA (rRNA).
Ratio of 1:1 for adenine: thymine, and Ratio of adenine: uracil, and
Base
cytosine: guanine cytosine: guanine variable
ratio
The similarities between DNA and RNA

 Both are formed in the nucleus.
 Both contain pentose sugar alternating with phosphate.
 Both contain the nitrogenous bases A, G and C.
 Both play a role in protein synthesis.
TABLE: Comparison of DNA, mRNA and tRNA.
Page 13
The discovery of the DNA double helix

 The existence of the DNA double helix and the way DNA holds information was
suggested by Francis Crick and James Watson in 1953, for which a Nobel Prize was
awarded.
 Francis Crick (1916–2004) and James Watson (1928–) laid the foundations of a
new branch of biology – cell biology – and achieved this while still young men. Within
two years of their meeting in the Cavendish Laboratory, Cambridge (1951), Crick and
Watson had achieved their understanding of the nature of the gene in chemical
terms.
 Crick and Watson brought together the experimental results of many other workers,
and from this evidence they deduced the likely structure of the DNA molecule.
Page 14
 Erwin Chargaff measured the exact amount of the four organic bases in samples of
DNA, and found the ratio of A:T and of C:G was always close to 1. Chargaff‟s results
suggest consistent base pairing in DNA from different organisms.
Organism Ratio of bases in DNA samples
Adenine : Thymine Guanine : Cytosine
Cow 1.04 1.00
Human 1.00 1.00
Salmon 1.02 1.02
Escherichia coli 1.09 0.99
 Rosalind Franklin and Maurice Wilkins produced X-ray diffraction patterns by

bombarding crystalline DNA with X-rays.
 Crick and Watson concluded that DNA is a double helix consisting of:
 two polynucleotide strands with nitrogenous bases stacked on the inside of the
helix (like rungs on a twisted ladder)
 parallel strands held together by hydrogen bonds between the paired bases
(A–T, C–G)
 ten per turn of the helix
 two antiparallel strands of a double helix.
Page 15
Phosphorylated nucleotides-ATP and ADP

ATP, ADP and AMP are phosphorylated nucleotides - nucleotides with phosphate
groups attached. Adenosine can be combined with one, two or three phosphate
groups to give, in turn, adenosine monophosphate (AMP), adenosine
diphosphate (ADP) or adenosine triphosphate (ATP).
ATP is called the universal energy currency as it is used in energy transfer inside almost
all living organisms. During its use, it becomes dephosphorylated and turned into ADP.
The structure of ATP is shown in the diagrams below.
A simpler representation of ATP using block diagrams:
 The detail on ATP and ADP is given in Energetics-topic 7.
Page 16
DNA REPLICATION
What is DNA replication?
The process by which DNA makes an identical copy of itself.
When does it occur?
DNA replication occurs just before cell division (mitosis and meiosis). It occurs during
interphase „S‟.
Why does it occur?
Identical copies of DNA are made so that it could be shared amongst the daughter cells
during cell division so that each daughter cell has the same number of chromosomes as
the original.
It allows the daughter cells after mitosis to be identical to each other and to the cell
from which they were formed.
How does it occur?
DNA replication takes place by a process called semi-conservative replication as
follows:
1. Double helix DNA unwinds.
2. Weak hydrogen bonds between complementary nitrogenous bases break.
And the two DNA strands unzip/separate.
3. Each original DNA strand serves as a template to form a new strand (semi-
conservative replication); by attaching to free nucleotides from the nucleoplasm;
4. to form complementary strands (A to C and C to G).
5. Each DNA molecule now consists of 1 original strand and 1 new strand.
6. The result is two genetically identical DNA molecules.
7. This process is called semi-conservative replication because half of each
molecule is kept and used as a template for the formation of the other half.
8. The entire process is controlled by enzymes as outlined below:
SEMI-CONSERVATIVE REPLICATION OF DNA AND THE ENZYMES THAT

CATALYSE IT
Helicase
 Helicase unwinds and separates the double-stranded DNA by breaking the hydrogen
bonds between base pairs.
 This occurs at specific regions (origins of replication), creating a replication fork of two
strands running in antiparallel directions.
DNA Gyrase (a.k.a. Topoisomerase)
 DNA gyrase reduces the torsional strain created by the unwinding of DNA by helicase.
 It does this by relaxing positive supercoils (via negative supercoiling) that would
otherwise form during the unwinding of DNA.
Single Stranded Binding Proteins (SSB Proteins)
 SSB proteins bind to the DNA strands after they have been separated and prevent
the strands from re-annealing (re-joining or coiling up on itself).
 These proteins also prevent the single stranded DNA from being digested by
nucleases.
Page 17
 SSB proteins are removed from the strand when a new complementary strand is
synthesised by DNA polymerase III.
DNA Primase
 DNA Primase (a type of RNA polymerase) generates a short RNA primer (~10–15
nucleotides) on each of the template strands.
 The RNA primer provides an initiation point for DNA polymerase III, which can
extend a nucleotide chain but not start one.
DNA Polymerase III
 Free nucleotides align opposite their complementary base partners (A = T ; G Ξ C).
 DNA polymearse III attaches to the 3‟-end of the primer and covalently joins the free
nucleotides together in a 5‟ → 3‟ direction. The free nucleotides in the form of dNTP
act both as a substrate and energy source:
 Free nucleotides exist as deoxynucleoside triphosphates (dNTPs) – they have 3
phosphate groups attached to them which activate them for the reaction.
 dNTP supplies ribose sugar to the DNA backbone.
 DNA polymerase cleaves (removes) the two additional phosphates (as a molecule
of pyrophosphate) and use the energy released to form a phosphodiester bond
with the 3‟ end of a nucleotide chain. This is similar to the action of ATP in
powering cell activity.
— The difference between dNTP and ATP is in their sugars: dNTP has deoxyribose
while ATP has ribose.
 As DNA strands are antiparallel, DNA polymerase III moves in opposite directions on
the two strands.
 DNA polymerase III synthesises the leading strand continuously, moving
towards the replication fork.
 DNA polymerase III synthesises the lagging strand discontinuously in pieces
(called Okazaki fragments) while moving away from the replication fork
DNA Polymerase I
 As the lagging strand is synthesised in a series of short fragments (Okazaki
fragments), it has multiple RNA primers along its length.
 DNA polymerase I removes the RNA primers from the lagging strand and replaces
them with DNA nucleotides.
DNA polymerases also proofread newly made DNA, replacing any incorrect
nucleotides. This ensures that each new DNA double helix is exactly like the original.
 When an incorrect base pair is recognized, DNA polymerase reverses its direction
by one base pair of DNA and excises the mismatched base. Following base
excision, the polymerase can re-insert the correct base and replication can
continue.
DNA Ligase
 DNA ligase joins the Okazaki fragments together to form a continuous strand.
 It does this by covalently joining the sugar-phosphate backbones together with a
phosphodiester bond.
The overall result is that there are now 2 DNA molecules, each with 1 strand of the old
(parent) DNA and 1 newly synthesised DNA strand.
This process is called semi-conservative replication because:
Page 18
— half of each molecule is kept (conserved) and used as a template for the
formation of the other half.
— one strand of each new double helix came from the parent (old) DNA and the
other one is newly synthesised.
DIAGRAM: Summary of semi-conservative replication of DNA.
What are Okazaki fragments?
 DNA polymerase III is unable to work directly on the lagging strand because it lacks
a free 3‟ end on an existing DNA strand
Page 19
 therefore, lagging strand synthesis begins when RNA primase uses the DNA template
to synthesize a short 10 RNA nucleotide sequence known as an RNA primer
 DNA polymerase III then uses the free 3‟ end of the RNA primer to synthesize longer
sequences of DNA, about 100 DNA nucleotides in length, known as Okazaki
fragments.
 DNA polymerase I then removes the RNA primers and replaces them with DNA
nucleotides.
 Finally DNA ligase seals/joins the Okazaki fragments into a continuous strand of DNA.
The Role of deoxynucleoside triphosphates (dNTPs) in DNA replication
 dNTPs are activated phosphorylated nucleosides. They contain 3 phosphates

which activate them for reaction.
 dNTP acts as a substrate: dNTPs are the free nucleotides added to a growing
DNA strand by DNA polymerase III.
 dNTP supplies deoxyribose sugar to the DNA backbone.
 dNTP acts as an energy source: hydrolysis and removal of 2 phosphate groups
from dNTP (to form pyrophosphate) provides the energy to form phosphodiester
bonds between nucleotides.
Page 20
DNA replication is initiated at many points in eukaryotic chromosomes.
 because the eukaryotic genome is so large, it would take days to replicate the
entire length of a chromosome using a single initiation point
 therefore, many initiation points are found in each eukaryotic chromosome,
about 100,000 nucleotides apart, with replication forks moving in opposite
directions away from each initiation point, until they meet in the middle between
two initiation points
TRY THIS QUESTION

What is the role of free nucleotides during DNA replication?
Answer
 Free nucleotides are activated phosphorylated nucleosides called deoxynucleoside
triphosphates (dNTPs).
 Act as substrate by being added (by DNA polymerase III) to a growing DNA strand.
 dNTP supply deoxyribose sugar to the DNA backbone.
 Act as an energy source for phosphodiester (covalent) bond formation between
nucleotides/Hydrolysis of dNTP into pyrophosphate provides energy for bond formation
between nucleotides.
TRY THIS QUESTION

List the enzymes and proteins involved in DNA replication. Describe the function of
each. [Answer: see summary below].
Page 21
SUMMARY OF DNA REPLICATION AND THE ENZYMES THAT CATALYSE IT.
1. Helicase unwinds and separates the double-stranded DNA. This creates a

replication fork (Y-shaped region) of two strands running in antiparallel directions.
2. DNA gyrase relieves strain created by the unwinding of DNA by helicase.
3. SSB proteins (single stranded binding proteins) prevents separated strands from
re-annealing. SSB proteins also prevent the single stranded DNA from being
digested by nucleases.
4. DNA Primase generates a short RNA sequence (called a primer) to initiate DNA
synthesis.
5. DNA polymerase III extends new strand in the 5‟→3‟ direction by joining
nucleotides together using energy from hydrolysis (breaking down) of dNTP.
6. DNA polymerases also proofread newly made DNA, replacing any incorrect
nucleotides. This ensures that each new DNA double helix is exactly like the original.
7. The leading strand is synthesised continuously towards the replication fork.
8. The lagging strand is synthesised away from the replication fork in short pieces
called Okazaki fragments.
9. DNA polymerase I removes RNA primers on lagging strand and replaces them with
DNA nucleotides.
10. DNA ligase joins Okazaki fragments together with phosphodiester bonds.
11. The overall result is that there are now 2 DNA molecules, each with 1 strand of
the old (parent) DNA and 1 newly synthesised DNA strand. Hence the
replication of DNA is semi-conservative.
How do we know DNA replication is semi-conservative?
 Originally, there were three proposed methods:

1) Conservative replication – parental strand rejoins after replication. Produces one
helix made entirely of old DNA and one helix made entirely of new DNA.
2) Dispersive replication – parental DNA double helix is broken into segments that
act as templates. Produces two helices in which the individual strands are
patchworks of old and new DNA i.e. the two DNA molecules that are mixtures, or
“hybrids,” of parental and daughter DNA.
3) Semi-conservative replication – two parental DNA strands separate and each of
those strands then serves as a template for the synthesis of a new DNA strand.
Produces two helices that contain one old and one new DNA strand.
Page 22
DIAGRAM: THREE POSTULATED MODELS OF DNA REPLICATION.
Page 23
Schematic representation of models of DNA replication.
How Meselson and Stahl proved the semiconservative replication of DNA as

correct and ruled out the conservative and dispersive models as biologically
incorrect.
 In 1957, Meselson and Stahl conducted an experiment providing evidence for semi-
conservative replication using E. coli bacterium as model system. This experiment
proved that DNA replication was semi-conservative and ruled out conservative and
dispersive replication modes.
Requirements for the experiment:
 E. coli bacterium was used as a model system. It provided the DNA and the system
in which the DNA replication took place.
 Two nitrogen nutrient broths: one containing nitrogen-15 (15N) – a heavy isotope
of nitrogen; and the other containing nitrogen-14 (14N) – a light isotope of nitrogen.
 The nitrogen isotopes were the sources of nitrogen for DNA synthesis.
Page 24
 DNAs labelled differently by culturing E. coli in 15N nutrient broth and in 14N
nutrient broth.
 Cesium chloride density gradient medium.
 Density gradient centrifugation used to distinguish 14N-labelled DNA and
15
N-labelled DNA based on density.
 When 14N-labelled DNA and 15N-labelled DNA are spun/centrifuged in Caesium
chloride (CsCl) at very high speeds, they settle at different levels and their small
differences in density are detected.
 The 14N-labeled DNA being lighter forms a band which settles close to the
top of the test tube, while the 15N -labeled DNA being heavier forms a band
which settles closer to the bottom of the test tube. This means hybrid DNA
(containing a mix of 14N and 15N) will form a band which will settle in the
middle of the test tube since it is of intermediate density.
DIAGRAM: Density gradient centrifugation: 14N-labeled DNA settles

at the top and 15N -labeled DNA settles at the bottom.
PROCEDURE
Page 25
1. E. coli bacteria were grown in a medium or nutrient broth, containing nitrogen-15

(15N), a "heavy" isotope of nitrogen.
 The bacteria took up the nitrogen and used it to synthesize new DNA.
 After many generations growing in the 15N, the nitrogenous bases of the
bacteria's DNA were all labeled with heavy 15N.
2. Then, the bacteria were transferred to a medium containing a "light" 14N isotope and
allowed to grow for several generations.
 DNA made after the transfer would contain 14N, as this was the only nitrogen
available for DNA synthesis.
Page 26
3. Meselson and Stahl knew that E. coli cells divided every 20 minutes which means
each generation lasted 20 minutes. Therefore they extracted DNA samples every 20
minutes and purified the DNA.
4. The DNA samples were centrifuged in Caesium chloride (CsCl) at very high speeds
to measure their densities (and, indirectly, their 15N and 14N content).
RESULTS
(See previous diagram)
 Generation 0 (parent DNA): 100% (all) of DNA in 15N band that settles at the
bottom. This shows that all parent DNA was heavy 15N DNA.
14
 Generation 1: 100% (all) of DNA in a band intermediate in position between N and
15 14 15
N bands. This shows that all DNA was hybrid N/ N DNA of intermediate
density.
14
 Generation 2: 50% (half) of DNA in a band intermediate in position between N and
15 14
N bands. Another 50% (half) of DNA in N band at the top. This means that half of
the DNA was hybrid 14N/15N DNA and the other half was light 14N/14N DNA
respectively.
EXPLANATION
 The starting (parent) DNA double helix is fully labeled by 15N (generation 0).
Replication of this helix produces two helices that each contain one 15N (old) and one
14
N (new) strand (generation 1). This rules out the conservative replication model
which predicts that both heavy density DNA and light density DNA will be present, but
none of intermediate density DNA will be present. This result is consistent with the
semiconservative replication model, which predicts that all DNA molecules will consist
of one 15N-labeled DNA (old) strand and one 14N-labeled DNA (new) strand. The
result does not rule out the dispersive replication model, which also predicts that all
DNA will be of intermediate density, consisting of interspersed double-stranded 15N-
labeled and 14N-labeled segments.
 Further replication of these two helices produces four helices, two which are 14N/15N
hybrids and two which are purely made of 14N (generation 2). This result is exactly
what the semiconservative model predicts: half should be 15N/14N intermediate
density DNA and half should be 14N-14N light density DNA. This result rules out the
dispersive replication model, which predicts that after generation 1 (replication cycle
1), the DNA density of all DNA molecules will gradually become lower, so no
intermediate density DNA should remain after generation 2 (replication cycle 2). The
semiconservative model is therefore correct.
CONCLUSION
The first replication (generation 1) produced a band of hybrid DNA, eliminating the
conservative model.
The second replication produced both light and hybrid DNA, eliminating the dispersive
model and supporting the semiconservative model.
Page 27
Therefore the semiconservative model was proved to be the way DNA replicated.
Conservative and dispersive models were disapproved as not being biologically
significant.
TRY THIS QUESTION
a Predict the experimental results you would expect to see if the Meselson–Stahl
experiment was carried on for three generations.
b If replication was by a „conservative‟ process, what would be the result of this
experiment after one generation in 14N?
SUMMARY-DNA Replication
 Nuclear division is the process by which the nucleus divides. There are two
types of nuclear division, mitosis and meiosis
 Cytokinesis follows the nuclear division and is the process where the rest of the
cell divides
 Before the nucleus can divide the DNA must be replicated to ensure that the
resulting daughter cells have the same genetic code for to produce the correct
enzymes and other proteins
 Originally there were three methods of replication that were proposed namely
conservative replication, semi-conservative replication and dispersive replication.
Conservative Replication
 The conservative replication model suggests that the original DNA molecule
remains intact and that a separate daughter DNA copy was built from new
molecules of deoxyribose, phosphate and organic bases. Of the two molecules
produced, one would be mode of entirely new materials whilst the other would
be entirely original material.
Semi Conservative Replication
 The semi conservative model suggests that the original DNA molecule splits into
two separate strands that new nucleotides fill in the opposite chain. The result is
one strand of new polynucleotide chains and one strand of the original
polynucleotide chain.
 The semi conservative replication to occur it needs 4 requirements
1. The 4 types of nucleotides (adenine, guanine, thymine and cytosine)

2. Both strands of the DNA molecule act as a template for the attachment of the
nucleotide
3. The enzyme polymerase
4. A source of chemical energy which is required to fuel the process
Page 28
Process of Semi Conservative Replication
1. The enzyme DNA Helicase breaks the hydrogen bonds linking the base pairs of
DNA. The DNA molecule therefore unwinds into two separate strands
2. Each separate strand has the exposed polynucleotide that acts like a template to
which complementary free nucleotides that are abundant around in the nucleus
bind by specific base pairings
3. The nucleotides are joined through a condensation reaction by the enzyme DNA
polymerase to form the new polynucleotide strand on each of the two original
polynucleotide strands of DNA
4. The result is that there are now 2 DNA molecules, with each have 1 strand of the
old DNA and 1 strand of the new DNA
Proving the Semi Conservative Model
 Meselson and Stahl devised an experiment to discover which model was correct.
They based their experiment on 3 key areas
1) All the bases in DNA contain nitrogen
2) Nitrogen has 2 forms, the lighter nitrogen (14N) and the heavier isotope (15N)
3) Bacteria will incorporate nitrogen from their growing medium into any new DNA that
they make
Method:
 Bacteria was grown in 2 mediums, one in the 14N and the other in 15N
 They grew the 15N bacteria for several generations before transferring them
to 14N for one generation to replicate.
 The mass of this molecule of DNA was measured using a centrifuge, with the
heavier molecules being at the bottom and the lighter at the top.
Result:
 The 14N DNA was at the top.

 The 15N DNA was at the bottom.
 The hybrid 14N and 15N DNA was in the middle.
Conclusion:
 The hybrid 14N and 15N DNA was in the middle proving that half of the DNA
comes from the old DNA and the other half is made of new DNA; thus the semi
conservative model was correct.
Page 29
TRY THESE QUESTIONS
1) The base thymine is always paired with ___.
A. Adenine B. Guanine C. Cytosine D. Thymine
2) The sequence of one strand of DNA is 5‟ TCGATC 3‟. The sequence of the
complementary strand would be
A. 5‟ AGCTAG 3‟ B. 5‟ TCGATC 3‟ C. 5‟ CTAGCT 3‟ D. 5‟ GCTAGC 3‟ E. 5‟ GATCGA 3
3) DNA polymerase III is thought to add nucleotides
A. to the 5' end of the RNA primer

B. to the 3' end of the RNA primer
C. in the place of the primer RNA after it is removed
D. on single stranded templates without need for an RNA primer
E. in the 3' to 5' direction
4) DNA replication in vivo is discontinuous due to
A. polymerase slippage
B. trinucleotide repeats
C. being restricted to synthesis in the 5' to 3' direction
D. topoisomerases cutting the DNA in a random fashion
E. sister chromatid exchange
5) Considering the structure of double stranded DNA, what kinds of bonds hold one
complementary strand to the other?
A. ionic B. covalent C. Van der Waals D. hydrogen E. hydrophobic and hydrophilic
6) The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to
synthesize DNA since no known DNA polymerase is able to initiate chains.
A. origin of replication B. restriction endonuclease

C. palindrome D. primer E. promoter
7) The RNA polymerase that produces the primer necessary for DNA synthesis is called
the ___.
A. origin of replication B. convertase C. primase D. ligase E. topoisomerase
8) ______is an enzyme that catalyzes the formation of a covalent bond between

adjacent 5'-P and 3'-OH termini of separate fragments of DNA.
Page 30
A. origin of replication B. convertase C. primase D. ligase E. topoisomerase
9) __ are enzymes that introduce single strand breaks, change the relationship of
the strands and then seal the break to remove underwinding or overwinding of the
DNA helix.
A. Helicases B. twistases C. nucleases D. topoisomerases E. ligases
10) The chemical bonds in DNA by which the sugar components of adjacent
nucleotides are linked through the phosphate groups are called ____ bonds.
A. phosphodiester B. hydrogen C. hydrophobic D. hydrophilic E. ionic
11) Which of the following is not an essential attribute that a biological molecule would
need to be a useful genetic material?
A. It must carry all of the information needed to direct the specific organization and
metabolic activities of the cell
B. It must replicate accurately so that the information it contains is precisely
inherited by the daughter cells
C. It must be capable of undergoing occasional mutations, such that the
information it carries is altered in a heritable way
D. It must have highly repetitive DNA sequences.
E. All are essential attributes of useful genetic material.
12) Which of the following features is common to both DNA replication and
transcription?
A. Nucleotides are added to the 5' end of the newly synthesized strand
B. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate
C. Deoxyribonucleotides are incorporated into the growing sequence
D. Both RNA and DNA polymerase require oligonucleotide priming
E. Both RNA and DNA polymerase initiate at promoter sequences
13) The following 5 questions refer to the numbers on this figure.
Page 31
a) What end (5' or 3') of the molecule is indicated by arrow number 1?

b) What end (5' or 3') of the molecule is indicated by arrow number 8?
c) What kind of nucleic acid is indicated by arrow number 4?
d) What do you call the short DNA fragments indicated by arrow number 5?
e) What enzyme functions to join the short fragments indicated by arrow number 6?
f) Which enzyme is indicated by arrow number 2?
Page 32
8.4.3 PROTEIN SYNTHESIS

KEY OBJECTIVES CONTENT SUGGESTED SUGGESTED
CONCEPT Learners (ATTITUDES, SKILLS AND LEARNING RESOURCES
should be able KNOWLEDGE) ACTIVITIES AND
to: NOTES
8.4.3  outline the - Transcription  Viewing  ICT tools
Protein process of - Translation including simulations  Braille
synthesis protein role of messenger and videos of software/
synthesis RNA, transfer RNA protein Jaws
and ribosomes synthesis.
Notes compiled by TARUVINGA G 0772980253
[email protected]
The 'Central Dogma' of molecular biology
DIAGRAM: The Central Dogma proposed by Francis Crick in 1958.
 The ‘Central Dogma’ is the process by which the instructions in DNA are
converted into a functional product, a protein.
 It was first proposed in 1958 by Francis Crick, discoverer of the structure of DNA.
 The central dogma of molecular biology explains the flow of genetic information,
from DNA to RNA, to make a functional product, a protein.
— The central dogma suggests that DNA contains the information needed to
make all of our proteins, and that RNA is a messenger that carries this
information to the ribosomes.
— The ribosomes serve as factories in the cell where the information is
‘translated’ from a code into a protein.
— The process by which the DNA instructions are converted into the functional product
or protein is called gene expression.
— Gene expression has two key stages - transcription and translation.
Page 33
— In transcription, the information in the DNA of every cell is converted into

small, portable RNA messages.
— During translation, these messages travel from where the DNA is in the cell
nucleus to the ribosomes where they are ‘read’ to make specific proteins.
— The central dogma states that the pattern of information that occurs most frequently
in our cells is:
 From existing DNA to make new DNA (DNA replication).
 From DNA to make new RNA (transcription).
 From RNA to make new proteins (translation).
 Reverse transcription is the transfer of information from RNA to make new DNA,
this occurs in the case of retroviruses, such as HIV. It is the process by which the
genetic information from RNA is assembled into new DNA.
DIAGRAM: The Central Dogma illustration showing the flow of information between
DNA, RNA and protein. Image credit: Genome Research Limited.
Page 34
THE GENETIC CODE
— DNA codes for assembly of amino acids / forms a polypeptide chain (proteins -
enzymes) using the genetic code.
— DEFINITION: The Genetic code is the sequence of nitrogen bases in a
polynucleotide chain of DNA that determines the amino acid sequence of proteins.
— The bases are adenine (A), cytosine (C), guanine (G), and thymine (T) (or uracil, U,
in RNA). The four bases make up the “letters” of the genetic code.
— The genetic code is read in a sequence of three bases called:
 triplets (triplet code) on DNA e.g. CAC TCA

 codons on mRNA e.g. GUG AGU
 anticodons on tRNA e.g. CAC UCA
 (must be complementary to the codon of mRNA)
— Each triplet codes for one amino acid / single amino acid may have up to 6 different
triplets for it due to the redundancy of the code / code is degenerate. Some amino
acids are coded by more than one codon
— Same triplet code will give the same amino acid in virtually all organisms, universal
code.
3
— We have 64 possible combinations of the 4 bases in triplets, 4
 There are 20 common amino acids in proteins. With four bases forming
three-base codons, there are 43= 64 possible codons. This is more than
enough to code for the 20 amino acids.
— No base of one triplet contributes to part of the code next to it, non-overlapping.
— Few triplets code for START and STOP sequences for polypeptide chain formation
e.g. START AUG and STOP UAA UAG UGA.
— The genetic code is shown in the table on the next page.
TRY THIS QUESTION
Describe the characteristics of the genetic code.
Characteristics of the Genetic Code:
1. Codon is triplet. 43 = 64 (61 codons code for amino acids while 3 are stop
codons).
2. The genetic code is universal. 1 codon codes for same amino acid in all species.
 All known living things have the same genetic code, which shows that all
organisms share a common evolutionary history.
Page 35
3. The genetic code is unambiguous. This means that each codon codes for just
one amino acid (or start or stop). This is necessary so there is no question about
which amino acid is correct.
4. The genetic code is redundant or degenerate. This means that each amino acid
is coded for by more than one codon.
 For example, in the table above, four codons code for the amino acid
threonine. Redundancy in the code helps prevent errors in protein synthesis.
If a base in a codon changes by accident, there is a good chance that it will
still code for the same amino acid.
5. The genetic code is non- overlapping, meaning that adjacent codons do not
share bases.
6. Codons are read continuous. They lack punctuations.
7. AUG has dual functions – it codes for Methionine and acts as a start (initiator)
codon.
Page 36
The Genetic Code. To find the amino acid for a particular codon, find the cell in the
table for the first and second bases of the codon. Then, within that cell, find the codon
with the correct third base. For example, CUG codes for leucine, AAG codes for lysine,
and GGG codes for glycine.
Reading the Genetic Code
If you find the codon AUG in the table above, you will see that it codes for the amino
acid methionine. This codon is also the start codon that establishes the reading frame
of the code. The reading frame is the way the bases are divided into codons. It is
illustrated in the figure below. After the AUG start codon, the next three bases are read
as the second codon. The next three bases after that are read as the third codon, and
so on. The sequence of bases is read, codon by codon, until a stop codon is reached.
UAG, UGA, and UAA are all stop codons. They do not code for any amino acids.
Page 37
DIAGRAM: Reading the Genetic Code. The genetic code is read three bases at a time. Codons
are the code words of the genetic code. Which amino acid does codon 2 in the diagram stand
for?
PROTEIN SYNTHESIS
 The code on the DNA molecule is used to determine the sequence of amino
acids in the polypeptide (protein) i.e. a polypeptide is coded for by a gene.
 Gene is length of DNA that codes for a particular peptide/protein.
 A gene is a sequence of DNA which is transcribed into RNA and contains three
main parts namely a promoter, a coding sequence and a terminator.
 Promoter is the non-coding sequence responsible for the initiation of

transcription.
 The promoter functions as a binding site for RNA polymerase (the enzyme
responsible for transcription)
Page 38
 Coding Sequence:
 After RNA polymerase has bound to the promoter, it causes the DNA strands to
unwind and separate.
 The region of DNA that is transcribed by RNA polymerase is called the
coding sequence.
 Terminator:
 RNA polymerase will continue to transcribe the DNA until it reaches a
terminator sequence.
Types of RNA involved in protein synthesis

— mRNA (messenger RNA) − It serves as a template for protein synthesis. DNA is
transcribed to form an mRNA, which in turn is translated to form protein. [Central
dogma of molecular biology]
— tRNA (transfer RNA) − It brings amino acids during translation and reads the
genetic code.
— rRNA (ribosomal RNA) − These are the work benches of translation. They play a
structural and catalytic role during translation.
tRNA structure
DIAGRAM: tRNA clover-leaf structure
 tRNA matches amino acids to their codon.
Page 39
 tRNA is only about 80 nucleotides long, and it folds up by complementary base

pairing to form a clover-leaf structure.
 At one end of the molecule there is an amino acid binding site. On the middle loop
there is a triplet nucleotide sequence called the anticodon.
 There are 64 different tRNA molecules, each with a different anticodon sequence
complementary to the 64 different codons on mRNA.
TRANSCRIPTION
 Transcription is the first stage of protein synthesis.
 Transcription is a process by which the information in DNA is copied into
mRNA for protein production.
 Transcription = DNA → RNA.
 Template Strand (antisense strand) and Coding Strand (sense strand):
 A gene (DNA) consists of two polynucleotide strands, but only one is transcribed
into RNA.
 The template strand (a.k.a. antisense strand) is the strand that is
transcribed into mRNA.
— Its sequence is complementary to the RNA sequence and will be the "DNA
version” of the tRNA anticodon sequence.
— Also Enzyme involved in transcription, RNA polymerase (DNA dependent RNA
polymerase), catalyses in only one direction i.e., 5′ to 3′.
— Therefore, the strand with polarity 3′ → 5′ acts as a template (Template
Strand).
 The strand with polarity 5′ → 3′ acts as coding strand (which is a misnomer
since it does not code for anything).
 The coding strand (a.k.a. sense strand) is the strand that is not transcribed
into RNA
 Coding strand has sequence similar to mRNA formed after transcription except for
the change that thymine is present instead of uracil.
 mRNA carries the code from DNA to the ribosomes where translation into a
protein occurs.
Transcription in detail
 In the nucleus, DNA helicase unwinds and unzips part of a DNA molecule by
breaking the hydrogen bonds between the bases.
 Free activated RNA nucleotides pair up with the exposed bases of one strand only
(See diagram that follows).
Page 40
 As the RNA nucleotides pair up with their complementary ones, their sugar–
phosphate groups are bonded together by RNA polymerase to form a sugar–
phosphate backbone.
 The new single-stranded molecule which has formed is called pre-messenger RNA
(pre-mRNA) or primary messenger RNA (primary mRNA).
 The new mRNA is not yet ready for translation and that is why it is called pre-mRNA.
It must first be processed into a mature mRNA by removing introns before it leaves
the nucleus for translation.
 Introns (non-coding) and exons (coding) DNA sequences are present in the pre-
mRNA (primary mRNA) transcript. Introns are removed before the mRNA is
translated so that exons are only present in the mature mRNA transcript.
 This process of removing introns from pre-mRNA and combining exons to
give a mature RNA is called splicing.
 Mature mRNA now leaves the nucleus for the cytoplasm via a pore in the nuclear
envelope (see diagram that follows).
Page 41
 In the cytoplasm, the mRNA molecule attaches to a ribosome where proteins

are synthesised via tRNA.
TRANSLATION
 Translation is the second stage of protein synthesis.
 Translation is the synthesis of a polypeptide (protein) chain from amino acids
by using codon sequences on mRNA.
 Translation = RNA → Protein.
 Translation is outlines below.
Anticodon and codon:

• In the production of proteins, codons refer to the three-base segments in
mRNA, while anticodons are the three-base segments in tRNA.
 In the cytoplasm, there are free amino acids and tRNA molecules.
 At one end of each tRNA molecule is a site to which an amino acid can bind. At the
other end are three unpaired bases called an anticodon.
Page 42
 Each tRNA molecule bonds with a particular amino acid, under the control of a
specific enzyme and with energy from ATP.
 In the cytoplasm, the mRNA molecule attaches to a ribosome.
 Ribosomes are made of ribosomal RNA (rRNA) and protein. They contain a small
and a large subunit.
 The mRNA binds to the small subunit. Six bases at a time are exposed to the
large subunit.
 The first three exposed bases of mRNA, or codon, are always AUG.
 A tRNA molecule with the complementary anticodon, UAC, forms hydrogen
bonds with this codon.
 This tRNA molecule has the amino acid methionine attached to it.
 A second tRNA molecule bonds with the next RNA codon (three exposed bases).
This tRNA brings a different amino acid.
 The two amino acids are held closely together, and a peptide bond is formed
between them.
 This reaction is catalyzed by the enzyme peptidyl transferase, which is found
in the small subunit of the ribosome.
Page 43
 During translation, the mRNA codons are read in the 5’ to 3’ direction.

That is, the ribosome moves along the mRNA sequence in the 5‟ → 3‟ direction
and joins amino acids together with peptide bonds in a condensation reaction
catalysed by peptidyl transferase.
 The polypeptide (protein) chain continues to grow until a ‘stop’ codon on

mRNA is exposed on the ribosome. This is UAA, UAC or UGA.
 A single piece of mRNA can be translated by many ribosomes

simultaneously. A group of ribosomes all attached to one piece of mRNA is
called a polysome or polyribosome.
Page 44
DIAGRAM: Polysome showing polypeptide chain getting longer as ribosome moves

from 5‟ to 3‟ end of mRNA.
POST-TRANSCRIPTIONAL MODIFICATION (Modification of polypeptides into

fully functional protein)
 In eukaryotes, proteins are altered/modified before they become fully functional.
Page 45
 Modifications are carried out by enzymes and include: chain cutting, adding sugars
(to make glycoproteins) or lipids (to make lipoproteins). These changes occur in the
Golgi Apparatus.
 The synthesised polypeptides are transferred to the Golgi body in vesicles which bud
off from the rough endoplasmic reticulum, migrate through the cytoplasm and fuse
with the cisternae (cavities) of the Golgi body. Here (and also in the rough
endoplasmic reticulum and its vesicles) the polypeptides couple by hydrogen bonding
and sulphur bonding, between amino acid side chain groups, to form proteins.
Examples of proteins formed in this way are lysozyme and catalase. The Golgi
body also allows the assembly of other protein derivatives. For instance,
carbohydrates may be joined to proteins to make glycoproteins such as mucus,
lipids may be joined to proteins to make lipoproteins, iron containing haem groups
may be joined to proteins to make molecules such as haemoglobin, myoglobin
and cytochromes. The products of the Golgi body are budded off as Golgi vesicles.
They either remain in the cytoplasm as, for example, lysosomes (containing
lysozyme) and peroxisomes (containing catalase), or fuse together into secretory
granules. These can then fuse with the plasma membrane to secrete their contents
out of the cell, for example, antibodies, plasma proteins, and digestive system
enzymes. This process is called exocytosis.
 The functions of the Golgi body are shown in the following diagram.
DIAGRAM: Functions of Golgi apparatus.
Page 46
SUMMARY: PROTEIN SYNTHESIS
Transcription
 Transcription is the synthesis of an RNA sequence from a DNA template.
 This process occurs within the nucleus of a cell.
 Transcription is mediated by two enzymes DNA helicase and RNA polymerase:
— DNA helicase separates the DNA strands (breaks H bonds between base
pairs).
— RNA polymerase covalently joins free complementary RNA nucleotides
together.
 After transcription, the RNA is released to the cytoplasm (for translation) and the
DNA remains within the nucleus and reforms a double helix.
Types of RNA
Three main types of RNA may be produced:

• mRNA – Transcript used to make protein
• tRNA – Transfers amino acid to ribosome
• rRNA – Catalytic component of ribosome
Translation
 Translation is the process of polypeptide synthesis by the ribosome.
 Messenger RNA (mRNA) is transported to the ribosome.
 A ribosome reads an mRNA sequence in base triplets called codons.
 Each codon codes for a specific amino acid (as per the genetic code).
 Amino acids are transported to ribosomes by transfer RNA (tRNA).
 Each tRNA aligns opposite a codon via a complementary anticodon.
 During translation, the mRNA base triplets, called codons, are read in the 5‟ to 3‟
direction. That is, the ribosome moves along the mRNA sequence (5‟ → 3‟) and joins
amino acids together with peptide bonds (condensation reaction).
 The synthesis of a polypeptide is initiated at a start codon (AUG) and is completed
when the ribosome reaches a STOP codon.
Post-translational modification is modification of polypeptides in the Golgi

apparatus into fully functional proteins after translation.
A protein may consist of one or many different polypeptide chains

What happens to the polypeptide next depends upon the protein being made, but
usually involves the following:
Page 47
 Enzymes may modify protein structure via the introduction of a new chemical
group to specific amino acids in the molecule. This can include phosphorylation,
methylation, acetylation, glycosylation, lipidation etc.
 The polypeptide is coiled or folded, producing a secondary structure
 The secondary structure may be further folded producing a tertiary structure
 Different polypeptide chains, along with any non-protein groups and linked to
form a quaternary structure.
Translation Analogy
 A cell is like a restaurant – differentiated cell types are like restaurants specialising
in different cuisines.
 The DNA is the set of instructions for the cell – like a cook book is the set of
instructions for a restaurant.
 A single DNA instruction is a gene – this is akin to a single recipe in a cook book.
 Transcription is the process of making an RNA copy of a gene – RNA polymerase is
like a photocopy machine.
 The mRNA transcript (i.e. photocopied recipe) is transported to the ribosome –
which functions as the cook.
 The ribosome reads the mRNA one codon at a time – as a cook would read the
recipe one step at a time.
 Each codon corresponds to an amino acid – just like each step in a recipe refers to
a specific ingredient.
 The amino acids are brought to the ribosome by tRNA – these tRNA molecules are
like kitchen hands.
 The ribosome joins the amino acids together to make a polypeptide – just like a
cook mixes ingredients to make food.
Overview of the Translation Analogy
Page 48
SEQUENCE DECODING
1. How to Deducing the DNA base sequence for the mRNA strand
mRNA → DNA
mRNA is a complimentary copy of a DNA segment (gene) and consequently can be

used to deduce the gene sequence
For converting a sequence from mRNA to the original DNA code, apply the rules of
complementary base pairing:
 Cytosine (C) is replaced with Guanine (G) – and vice versa

 Uracil (U) is replaced by Adenine (A)
 Adenine (A) is replaced by Thymine (T)
Example: (mRNA) AUG CCA GUG ACU UCA GGG ACG AAU GAC UUA
Answer: (DNA) TAC GGT CAC TGA AGT CCC TGC TTA CTG AAT
2. How to use a table of mRNA codons and their corresponding amino acids to
deduce the sequence of amino acids coded by a short mRNA strand of
known base sequence
mRNA → Polypeptide
In order to translate an mRNA sequence into a polypeptide chain, it is important to

establish the correct reading frame.
The mRNA transcript is organised into triplets of bases called codons, and as such three
different reading frames exists.
 An open reading frame starts with AUG and will continue in triplets to a
termination codon.
 A blocked reading frame may be frequently interrupted by termination codons.
Once the start codon (AUG) has been located and reading frame established, the
corresponding amino acid sequence can be deduced using the genetic code
Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU
Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U
Answer: (amino acid) Met His Val Thr Phe Leu Met Ser STOP
Page 49
The Genetic Code (Grid)
TRY THESE QUESTIONS
Page 50
3. (a) (i) What is the role of RNA polymerase in transcription? [1]

(ii) Name the organelle involved in translation. [1]
(b) Figure 1 shows some molecules involved in protein synthesis.
Complete Figure 1 to show

(i) the bases on the DNA strand from which the mRNA was transcribed; [1]
(ii) the bases forming the anticodons of the tRNA molecules. [1]
Page 51

Topic 4 Genetic Control My Notes

Uploaded by

Copyright:

Available Formats

Topic 4 Genetic Control My Notes

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Topic 4 Genetic Control My Notes

Uploaded by

Copyright:

Available Formats

GENETIC CONTROL: Nucleic Acids and Protein Synthesis

8.4 TOPIC 4 GENETIC CONTROL

Nucleic acids and protein synthesis

Structure and replication of DNA

By the end of this section you should be able to:

DIAGRAM: The 3 components of a nucleotide.

What is the difference between ribose and deoxyribose sugars?

A nucleotide is formed by condensation reactions

DIAGRAM illustrating the formation of a nucleotide by condensation and its breakdown

 The portion of the nucleotide without the phosphate group/phosphoric

 Nucleotide (mononucleotide) = Nucleoside + Phosphate group

Nucleotides combine through condensation to form polynucleotides (nucleic

— More nucleotides added to the dinucleotide by condensation reaction results in a

DNA STRUCTURE AND FUNCTION

The stability of DNA

 The phosphodiester backbone protects the more chemically reactive organic

RNA structure and function

 RNA = Ribonucleic acid.

Three types of RNA:

Table: The differences between DNA and RNA

Length Very long strands, several million Relatively short strands

Pentose Deoxyribose Ribose

Bases G, C, A and T (not U) G, C, A and U (not T)

The similarities between DNA and RNA

TABLE: Comparison of DNA, mRNA and tRNA.

The discovery of the DNA double helix

Organism Ratio of bases in DNA samples

Adenine : Thymine Guanine : Cytosine

Cow 1.04 1.00

Human 1.00 1.00

Salmon 1.02 1.02

Escherichia coli 1.09 0.99

 Rosalind Franklin and Maurice Wilkins produced X-ray diffraction patterns by

Phosphorylated nucleotides-ATP and ADP

A simpler representation of ATP using block diagrams:

 The detail on ATP and ADP is given in Energetics-topic 7.

SEMI-CONSERVATIVE REPLICATION OF DNA AND THE ENZYMES THAT

DIAGRAM: Summary of semi-conservative replication of DNA.

What are Okazaki fragments?

The Role of deoxynucleoside triphosphates (dNTPs) in DNA replication

 dNTPs are activated phosphorylated nucleosides. They contain 3 phosphates

DNA replication is initiated at many points in eukaryotic chromosomes.

TRY THIS QUESTION

TRY THIS QUESTION

SUMMARY OF DNA REPLICATION AND THE ENZYMES THAT CATALYSE IT.

1. Helicase unwinds and separates the double-stranded DNA. This creates a

 Originally, there were three proposed methods:

DIAGRAM: THREE POSTULATED MODELS OF DNA REPLICATION.

Schematic representation of models of DNA replication.

How Meselson and Stahl proved the semiconservative replication of DNA as

Requirements for the experiment:

DIAGRAM: Density gradient centrifugation: 14N-labeled DNA settles

1. E. coli bacteria were grown in a medium or nutrient broth, containing nitrogen-15

TRY THIS QUESTION

Semi Conservative Replication

1. The 4 types of nucleotides (adenine, guanine, thymine and cytosine)

Process of Semi Conservative Replication

Proving the Semi Conservative Model

1) All the bases in DNA contain nitrogen

 The 14N DNA was at the top.