Lab 8 - Transcription & Translation Laboratory -

ONLINE VERSION
Cell Biology BIOL-1101

OBJECTIVES
1. Practice using the genetic code to solve genetic problems.
2. Try to synthesize what you are learning about DNA, RNA, and the way things go together.
3. Consider the effect of mutations on the normal processing of genetic information.

Introduction

The flow of genetic information in a biological system is based on the genetic code (Figure 1).
As first described by Francis Crick in 1958, genetic information flows from DNA à RNA à protein.
Transcription is the process of going from DNA to RNA, and translation then uses those RNA
molecules to make proteins. The genetic code is the set of rules used to translate information
encoded within genetic material (DNA and RNA) into proteins (Table 1).
In addition to transcription and translation, genetic information is also transferred during DNA
replication, a process by which a DNA template (old DNA) is copied to produce two identical DNA
molecules (new DNA). Replication is still influenced by the genetic code in that if new pieces of DNA
are made with errors, the cells that contain that DNA will get faulty information and make faulty
proteins. Moreover, genetic information flow can also be reversed from RNA to DNA. In a process
called reverse transcription, an RNA strand can be used as a template to build a complementary DNA
molecule. This process, which also used the genetic code, is commonly used by some viruses (e.g.,
HIV). Our attention in this lab however will be on unidirectional flow of genetic information observed
in transcription and translation (DNA à RNA à protein).

1
 Figure 1. Genetic flow of information in biological systems

Just to get you started, here is a really basic refresher. A DNA molecule is a polymer comprised
of repeating units called nucleotides. A gene is the portion of the DNA molecule (a sequence of
nucleotides) that codes for an actual protein. The word “base” is sometimes used in place of the word
“nucleotide”. Thus, the DNA double helix is said to comprise base-pairs.
During the process of gene transcription, only one side of the DNA called the template strand
is used to create an RNA complement called Table 1: Genetic Code
messenger RNA (mRNA). During transcription
the template strand is read by the enzyme RNA
polymerase in the 3’ to 5’ direction and used to
catalyze the synthesis mRNA in the 5’ to 3’
direction. The other strand of DNA is often called
the coding strand because it will have the same
sequence of nucleotides as the mRNA; with the
only difference being that every thymine (T) in
DNA will be a uracil (U) in RNA.
In the process of translation, we use the
triplet code. The triplet code is composed of sets
of three nucleotides, called sense codons, in the
mRNA that code for a specific amino acid.
Ribosomes read the codons in the mRNA and
using the genetic code (see Table 1) determine
the corresponding amino acids. Ribosomes will
use transfer RNA (tRNA) to bring these
corresponding amino acids together in order to
build the polypeptide. You can consult the

2
genetic code to see which codons code for which particular amino acid. By convention, these codons
are read from the 5’ end of the mRNA to
the 3’ end. Note that the tRNA also has 3 nucleotides and these are complementary and antiparallel to
the codon of the corresponding mRNA; these are called anti-codons. Remember, that when you want
to determine what amino acid comes next in a polypeptide, you should always look up the codon in
the mRNA, not the anti-codon of the tRNA. Translation always begins at the first AUG site of the
mRNA, thus making methionine the first amino acid of the polypeptide chain. AUG, often referred to
as the start codon, also establishes the start of the reading frame, which is the area of the mRNA that
the ribosome will use to translate and build the polypeptide. In addition, a polypeptide is also
assembled in one direction starting from the N-terminus (this is named because it has the free amino
end and thus, may be indicated by NH2) and ending with a final amino acid at the C-terminus (the
carboxyl end, often indicated by COOH). Stop codons (UAA, UAG, UGA) signal the ribosome to stop
translation and trigger the release of the completed polypeptide, thus ending the process of
translation.
A DNA mutation is any change in the base (nucleotide) sequence of DNA, brought about by a
random event, radiation or a mutagen (chemical that interacts with and alters the DNA sequence).
DNA mutations will lead to changes in the mRNA and possible changes in the amino acid sequence of
the polypeptide. Table 2 lists four major DNA mutations and the resulting effects, and Figure. 2
visually represents them.

Table 2: List of major DNA mutations

MUTATION EFFECT
Missense Changes one sense codon to a sense codon of a different amino acid
Nonsense Changes sense codon to a stop codon
Silent Changes sense codon to another codon for the same amino acid
Frameshift Changes reading frame through the insertion or deletion of a nucleotide

3
Here’s an example of how transcription and translation work.

This is the double stranded DNA molecule:

5’-GGGATGCCCAAATAATTT-3’
3’-CCCTACGGGTTTATTAAA-5’

You will notice that the top and bottom strands are complementary to one another. Either strand has
the potential to be the template strand. For the sake of this example, let’s say the bottom strand is
the template strand. We will use this template strand for transcription (synthesis of mRNA) and it is

4
read in the 3’ to 5’ direction (even if it is written backwards). Using this strand, we can create the
mRNA strand (synthesized in the 5’ to 3’ direction):

5’-GGGAUGCCCAAAUAAUUU-3’

Remember the mRNA is read in the 5’ to 3’ direction (even if it is written backwards). Thus, using this
mRNA strand we start at the 5’ end and look for the first AUG / start codon where the process of
translation (protein synthesis) will begin. We read each codon and match it to its corresponding
amino acid using the genetic code table above. The amino acid sequence is synthesized and read
from N-terminus to C-terminus (even if it is written backwards):

NH2-Met-Pro-Lys-COOH

Note: NH2 represents the amino group in the first amino acid (N-terminus) and the COOH represents
the carboxyl group of the last amino acid (C-terminus).
Test your knowledge - You will be discussing your answers with your classmates during your weekly
lab session.
• What is/are the start codon(s)? Is it only found once in the mRNA?
• Would a nonsense mutation in the DNA sequence affect the mRNA sequence? If so, how?
Would the polypeptide also be affected? If so, how?
• How does mRNA differ from the coding strand?
• What type of mutation is shown here?
o 5’-AUGACUUUUCCU-3’ => 5’-AUGUAGUUUCCU-3’
• What would happen to the process of translation if a mutation changed a stop codon into a
sense codon?

Exercise I and II: Activities

Go to https://www.youtube.com/watch?v=gG7uCskUOrA&ab_channel=yourgenome to review
transcription and translation. Then complete the problem-based questions in lab response sheet
below

Laboratory Response Sheet USE FOR ONLINE LAB ONLY

All your responses to the lab activities and questions below will need to be recorded
onto your Online Lab Response sheet. Please use this link to access your online lab
response sheet. https://uwindsor.ca1.qualtrics.com/jfe/form/SV_6tKBRfFntR4Ruke

5
You MUST complete the online lab response sheet and submit in one sitting. You will
NOT be able to save and come back later to complete.

All students must fill in their own responses independently. Keep a copy for your
records.

Exercise I

For this exercise, the questions will be based on this original strand of DNA:

5’-AAAAAAATGGGCCCGGATGCATGAAATGGATTAATTTTTAAAATA-3’

1. Write the sequence of the complementary strand of DNA which attaches to the segment above;
this strand will be the template strand of DNA.

3’ TTTTTTTACCCGGGCCTACTTTACCTAATTAAAAATTTTAT-5’

2. Using the template strand of DNA in question #1, write the strand of mRNA generated from this
DNA.
5’ UUUUUUUACCCGGGCCUACUUUACCUAAUUAAAAAUUUUAU-3’

3. Using the mRNA generated in question #2, what is the amino acid sequence (protein) for which this
RNA codes?
Phe- Phe- Tyr- Pro- Gly- Leu- Arg- Thr- Leu- Pro- Asn

4. Suppose a cosmic ray strikes the template strand of DNA and substitutes one nucleotide for
another. Suppose this substitution occurs in the first nucleotide of the fourth triplet of the DNA
template strand in question #1 so that the CCG becomes a GCG. What will the resulting amino acid
sequence be?
Phe- Phe- Tyr- Ala- Gly- Leu- Arg- Thr- Leu- Pro- Asn

6
5. If the cosmic ray strikes anywhere in the gene and alters one nucleotide, does that always mean
that there will be a change in amino acid sequence? Why or why not?

No, because many sequences code for the same amino acid, so it could cause a silent mutation
instead of a missense or nonsense.

6. Perhaps more frightening is a frame shift mutation, brought on by either the insertion or deletion
of a base or bases. Suppose, in the DNA template sequence from question # 1, a mutagen removes
the first A base from the left (just that base). Will the mRNA sequence still be the same?
No, it would not be the same because the sequence would change

7. Write the new mRNA sequence from the mutated DNA template strand in question #6. What is the
start codon and where is it in the mRNA?

3’ TTTTTTTCCCGGGCCTACTTTACCTAATTAAAAATTTTAT-5’
5’ UUUUUUUCCCGGGCCUACUUUACCUAAUUAAAAAUUUUAU-3’
The start codon is AUG and it is not in the mRNA.

8. What is the amino acid sequence for which this mRNA in question #7 codes?

Phe- phe- ser- arg- ala- tyr- val- leu- tyr- leu- ile- lys- asn- phe-

9. Is this sequence in question #8 different from the sequence in question #3? That is, how many
different amino acids are there now?
Yes, there are is an extra amino acid in the sequence in question 8. The order in all the amino
acids is different with the exception of the first 2.

Exercise II

In this exercise, you will continue to apply your knowledge of transcription and translation by
answering a variety of problem-based questions

7
 1. What is the sequence of the mRNA strand from the following DNA template strand?

3’-AAATTTTTATACAGCTTCATA-5’

5’ AAAUUUUUAUACAGCUUCAUA 3’

2. What is the polypeptide sequence from the following mRNA strand? Don’t forget to label the type
of terminus at each end.

5’-GGGCUAAUGUACGGCCCUGUAUAAUUUGACCCG-3’

NH2- met- tyr- gly-pro- val -COOH

Use the following DNA coding strand to answer questions 3-6.

5’-GGGGCCATGTATTTAAGCCGGTTAAGCTATTAACGC-3’

3. What is the DNA template strand?

3’ CCCCGGTACATAAATTCGGCCAATTCGATAATTGCG-5’

4. What is the sequence of the mRNA? Identify the positions of the 3 nucleotides that will establish
the start of reading frame for the ribosome. (e.g., Nucleotides 5-7)
5’-GGGGCCAUGUAUUUAAGCCGGUUAAGCUAUUAACGC-3’

8
 5. What is the amino acid sequence for the polypeptide? Assume that the left side is the N-terminus
and the right side is the C-terminus.
NH2- met- tyr- leu-ser-arg- leu- ser- tyr- COOH

6. Assume there was a single base-pair substitution of the third nucleotide in the fourth triplet
(starting from the 3’ end) of the DNA template strand from an ‘A’ to a ‘G’. What would now be
the amino acid sequence of the polypeptide? Assume that the left side is the N-terminus and the
right side is the C-terminus.

It would remain the same

Below is a polypeptide /amino acid sequence. Use this information to answer questions 7-10.

NH2-Met-Lys-Gly-Thr-COOH.

7. Which sequence on the mRNA strand would correspond to the amino acid sequence? Label
which side is your 3’ and 5’ end.
5’ AUGAAAGGCACCUAA 3’

8. Which DNA sequence on the template strand would produce this polypeptide? Label which side
is your 3’ and 5’ end.
3’ TACTTTCCGAGGATT 5’

9. What would happen if the fifth nucleotide in the mRNA coding strand was removed? What type
of mutation occured?
This would cause a frameshift mutation.

10. What would happen to the amino acid sequence of the polypeptide if the sixth nucleotide in the
mRNA coding strand was changed to a G?
It would be a silent mutation because the amino acid sequence wouldn’t change

9
11. Which mRNA codes for the following polypeptide?

NH2-Met-Pro-Ser-Asp-Glu-COOH

AUG-CCC-AGC-GAC-GAG

12. During translation, the tRNA is the RNA molecule that attaches to the mRNA molecule and
provides the new amino acids to a growing polypeptide chain. Each tRNA has an anti-codon
region that is complementary and antiparallel to the codon in the mRNA sequence.

Based on this information, what is the anti-codon of the tRNA molecule that binds to the start
codon of the mRNA strand?

UAC

13. Based on the strand below, what is the percentage of guanine and adenosine nucleotides present
in this strand?

3’-CAGTATCAAACGCGTTATACAGCAACATAC-5’
Percentage of gauanine= 4/30= 13%
Percentage of adenine = 12/30= 40%

14. Suppose you transcribe an mRNA from a template DNA strand. The template DNA strand
contains the following percentages for nucleotide bases: 16% A, 29% G, 33% C, and 22% T. What
would be the percentages for the nucleotide bases in the complementary RNA strand?

16 u
29 c
33 g
22 a

10
© Dora Cavallo-Medved and Joseph Fotso, Department of Biological Sciences

11