Scribd
Upload
51 views

CPP String Assignment

The document provides 28 problems involving string manipulation in C++. The problems include reversing, capitalizing, sorting, counting characters, checking palindromes, inserting characters, changing case, removing special characters, and more. The goal is to write C++ programs to solve each string manipulation problem using functions, conditionals, and other programming concepts.

Uploaded by

damodar.swami234
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
51 views

CPP String Assignment

The document provides 28 problems involving string manipulation in C++. The problems include reversing, capitalizing, sorting, counting characters, checking palindromes, inserting characters, changing case, removing special characters, and more. The goal is to write C++ programs to solve each string manipulation problem using functions, conditionals, and other programming concepts.

Uploaded by

damodar.swami234
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 6

C++ String assignment

1. Write a C++ program to reverse a given string.

2. Write a C++ program to change every letter in a given string


with the letter following it in the alphabet (ie. a becomes b, p
becomes q, z becomes a

3. Write a C++ program to capitalize the first letter of each word


of a given string. Words must be separated by only one space

4. Write a C++ program to find the largest word in a given


string.

5. Write a C++ program to sort characters (numbers and


punctuation symbols are not included) in a string

6. Write a C++ program to count all the vowels in a given string

7. Write a C++ program to count all the words in a given string

8. Write a C++ program to check whether two characters present


equally in a given string.
Example:
Sample Input: aabcdeef
Sample Output: True

9. Write a C++ program to check if a given string is a Palindrome


or not.

10. Write a C++ program to find a word in a given string which


has the highest number of repeated letters.

11. Write a C++ program to insert a dash character (-) between


two odd numbers in a given string of numbers
Example:
Sample Input: 1345789
Sample Output: Result-> 1-345-789

12. Write a C++ program to change the case (lower to upper and
upper to lower cases) of each character of a given string.

13. Write a C++ program to find the numbers in a given string and
calculate the sum of all numbers. Example:
Sample Input: w3resource from 2008
Sample Output: Sum of the numbers: 2011

14. Write a C++ program to convert a given non-negative integer


to English words.
Example:
Sample Input: 12
Sample Output: Twelve

15. Write a C++ program to find the longest common prefix from
a given array of strings.

16. Write a C++ program to find all combinations of well-formed


brackets from a given paris of parentheses.

Example:
n=2
[[]] [][]
n=3
[[]] [][] [[[]]] [[][]] [[]][] [][[]] [][][]

17. Write a C++ programming to find the length of the longest


valid (correct-formed) parentheses substring of a given string.

Example:
Original Parentheses string: [[]
Length of longest parentheses: 2
Original Parentheses string: [[]]]
Length of longest parentheses: 4
Original Parentheses string: ]]]][[[[
Length of longest parentheses: 0

18. A vowel is a syllabic speech sound pronounced without any


stricture in the vocal tract. Vowels are one of the two principal
classes of speech sounds, the other being the consonant.
Example:
Original string: w3resource
After reversing the vowels of the said string: w3resuorce
Original string: Python
After reversing the vowels of the said string: Python
Original string: Hello
After reversing the vowels of the said string: Holle
Original string: USA
After reversing the vowels of the said string: ASU

19. Write a C++ program to check whether a given string is a


subsequence of another given string. Return 1 for true and 0 for
false. Example:
word1: apple
subse1: apl
Is subse1 is the subsequence of word1? 1
word2: apple
subse2: ppe
Is subse2 is the subsequence of word2? 1
word3: ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
subse3: CGTTCGGCTATGCTTCTACTTATTCTA
Is subse3 is the subsequence of word3? 1
word4: CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
subse4: CGTTCGGCTATGCZTTCTACTTATTCTA
Is subse4 is the subsequence of word4? 0

20. Write a C++ program to remove all special characters from a


given string.

Example:
Original string: abcd $ js# @acde$
New string after removing the special characters from the said
string:
abcd js acde

21. Write a C++ program that count the number of unique


characters of two given strings.
Example:
Original Strings:
String1: Python
String2: Java
Total number of unique characters of the said two strings: 9

22. Write a C++ program to count number of duplicate characters


in a given string.

Example:
Original String:
Total number of unique characters of the said two strings.
Number of duplicate characters in the said string: 36

23. Write a C++ program to find the longest sequence of


consecutive ones in a given binary string.
Example:
Original Binary String:
1100110001
Longest sequence of consecutive ones of the said binary string:
11

24. Write a C++ program to check a given string is a title cased


string or not. Return "True" if the string is title cased string
otherwise "False".

Example:
Original String:
The Quick Brown Fox.
Check the said string is a title cased string or not!
True

25. Write a C++ program to insert a space when a lower


character follows an upper character in a given string.
Example:
Original String:
TheQuickBrownFox.
Insert white spaces between lower and uppercase Letters in the
said string:
The Quick Brown Fox.

26. Write a C++ program to identify the missing letter in a given


string (list of alphabets). The method returns, "There is no
missing letter!" if no letters are missing from the string.
Example:
Original string: abcdef
Identify the missing letter in the said string:

There is no missing letter!

27. Write a C++ program to check if a given string contains only


uppercase or only lowercase letters. Return "True" if the string is
uppercase or lowercase, otherwise "False".
Example:
Original string: ABCDEF
Check whether the said string is uppercase or lowercase: True

28. Write a C++ program that takes a string and reverses the
words of three or more lengths in a string. Return the new string.
As input characters, only spaces and letters are permitted
Example:
Original string: The quick brown fox jumps over the lazy dog
Reverse the words of three or more lengths of the said string:
ehT kciuq nworb xof spmuj revo eht yzal god

You might also like