Asian Biomedicine Vol. 10 No. 3 June 2016; 219 - 228 DOI: 10.5372/1905-7415.1003.

483

Original article

Antibiotic resistance profile and random amplification

typing of β -lactamase-producing Enterobacteriaceae
from the local area of Al-Taif and nearby cities in Saudi
Arabia
Ali K. Alzahrania, Mostafa M. Faraga, Said H. Abbadia,b, Mohamed M. Hassanc,d, Ahmed Gaberc,e,
Ahmed S. Abdel-Moneima,f
a
College of Medicine, Taif University, Al-Taif 5700, Saudi Arabia
b
Microbiology Department, Faculty of Medicine, Suez Canal University, Ismailia 42524, Egypt
c
Biotechnology and Genetic Engineering Unit, Taif University 5700, Saudi Arabia
d
Department of Genetics, Faculty of Agriculture, Minufiya University, Egypt
e
Department of Genetics, Faculty of Agriculture, Cairo University, Giza 12613, Egypt
f
Virology Department, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef 62511, Egypt

Background: The emergence of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli and

Klebsiella pneumoniae constitutes a serious problem because of the transfer of resistance genes from one
organism to another.
Objectives: To screen the antibiotic susceptibility of E. coli and K. pneumoniae from inpatients at King Abdul-
Aziz Hospital, Al-Taif, Saudi Arabia and to detect common ESBL genes, and random amplified polymorphic
DNA (RAPD) polymerase chain reaction (PCR) genotyping of the Enterobacteriaceae.
Methods: We analyzed 43 bacterial strains isolated from clinical samples of sporadic cases for their reactivity to
different antibiotics. Strains that showed resistance by monoplex PCR were screened for ESBL TEM- and CTX-
M-1-, -2-, and -9-encoding genes. Random amplifications were used for typing the resistant strains.
Results: The majority of the ESBL containing strains were sensitive to meropenem, amikacin, gentamicin, and
tigecycline. PCR detection using ESBL gene-specific primers showed that 17 of 43 strains harbored genes for
ESBL TEM, CTX-M-1, or CTX-M-2. RAPD typing revealed marked variation among the ESBL-producing E.coli
in relation to each other.
Conclusions: Considerably high incidence of ESBL-producing bacteria was present patients from the local area
of Al-Taif and nearby cities in Saudi Arabia with TEM and CTX-M subtypes being the most commonly detected
variants. There was evidence of a polymorphic genetic pattern among ESBL-producing bacteria.

Keywords: Antibiotic resistance, E.coli, Klebsiella pneumoniae, RAPD typing, Saudi Arabia

Gram-negative bacteria are potential causes of ESBLs are primarily produced by gram-negative
both nosocomial and community-acquired infections. organisms of the Enterobacteriaceae family, especially
Multiple antibiotic resistance to broad-spectrum Escherichia coli and Klebsiella pneumoniae [4, 5].
β-lactams are considered one of the most important The Ambler classification, clusters the enzymes
traits. Antibiotic resistance of Enterobacteriaceae is into 4 molecular classes (A–D) according to their
mainly accompanied by the production of extended amino acid sequences [6]. ESBLs are class A
spectrum β-lactamases (ESBLs) that hydrolyze third- β-lactamases that cleave oxyimino-cephalosporins and
generation cephalosporins and aztreonam, but can be monobactams, but not cephamycins or carbapenems.
inhibited by clavulanic acid [1−3]. Although there are many genotypes of ESBLs, SHV,
TEM, and CTX-M types are considered the most
Correspondence to: Ahmed S. Abdel-Moneim, College of common [7]. CTX-M-type ESBLs, which are non-
Medicine, Taif University, Al-Taif 5700, Saudi Arabia. TEM and non-SHV derivatives, represent a new and
E-mail: [email protected]; [email protected] rapidly growing family of molecular class-A ESBLs
220 Ali K. Alzahrani, et al.

[8]. According to their amino acid sequence similarities, the current study, we intended to conduct antibiotic
they have been classified into five groups: 1, 2, 8, 9, susceptibility screening of E. coli and K. pneumoniae
and 25/26, and, to date, more than 40 CTX-M from inpatients and detect the common ESBL genes.
β-lactamases have been reported. Meanwhile, we intended to genotype the ESBL positive
ESBL-producing bacteria are among the common bacteria with random amplified polymorphic DNA
microorganisms that produce severe diarrhoea, (RAPD) polymerase chain reaction (PCR).
postoperative abdominal wound sepsis, urinary
tract infections, and respiratory tract infections [2]. Materials and methods
Cephalosporins commonly used in patients with
septic infections are ineffective in the case of Bacterial culture and identification
ESBL-producing bacteria. ESBL-producing bacteria Our study protocol was approved by Taif
can acquire resistance to antimicrobials such as the University Medical Ethics Review Board (project
aminoglycosides, cotrimoxazole, tetracyclines, No. 3364-435-1) in accordance with the guidelines for
trimethoprim, and quinolones with the potential of the the protection of human subjects. Samples were
development of multidrug resistant microbes [9−12]. collected for clinical purposes from inpatients from
There is a shortage of the new antibiotics the local area of Al-Taif and nearby cities at King
especially for gram-negative bacteria that produce Abdul-Aziz Hospital, Al-Taif, Saudi Arabia between
ESBLs [13]. Delays in laboratory diagnosis and the February 1st and August 30th 2015 after patient
use of inappropriate antibiotic therapy are among consent documented on standard hospital forms. The
factors that increase the severity of the disease clinical samples were from various origins: 38 were
with a subsequent increase in mortality [14, 15]. from urinary tract infections, and 5 were from
Accordingly, rapid detection of ESBL-producing suppurative wounds in the perineum, sepsis of various
bacteria may aid in selecting the appropriate antibiotic postoperative wounds, and the liver. We received 43
with a subsequent improvement in the antibacterial bacterial isolates anonymized by coding linked to
outcomes [16]. Rapid detection is also necessary to patient identities from the clinical laboratory, which
screen patients and subsequently improve hospital were derived from the samples originally collected
infection control policies, avoid misuse of antibiotics, for clinical purposes. The isolates were subcultured
thus prolonging the efficacy of the currently available on selective media including blood agar and
antibiotic armamentarium [17, 18]. MacConkey agar [22] and gram-negative rods were
Current techniques for detecting ESBL producers selected for further identification [23].
are based on the determination of susceptibility to
expanded-spectrum cephalosporins followed by the Bacterial isolates confirmation and antimicrobial
inhibition of the ESBL activity, mostly by the use of susceptibility tests
clavulanic acid or tazobactam [19]. The double-disk Cultured bacteria were resuspended in 0.45%
synergy test and the ESBL “E-test” were proposed saline and matched to the required McFarland
for that purpose. Sensitivities and specificities of units. Two milliliters of bacterial suspension were
the double-disk test and of the E-test are good, ranging automatically loaded into a VITEK 2 microbial
from 80% to 95% [20]. Automated bacterial identification system (bioMérieux, Durham, NC, USA)
identification and antibiotic susceptibility testing for identification with gram-negative bacilli and
are also used in the detection of ESBL-producing antimicrobial susceptibility testing-GN04 cards.
organisms. The performances of those systems differ Reference strains including E. coli American Type
depending on the species investigated, with much higher Culture Collection 25922 were used as controls.
sensitivity (80%−99%) than specificity (50%−80%) Criteria used to characterize ESBL are those of the
[19, 20]. Clinical and Laboratory Standards Institute (CLSI,
Those tests require overnight growth, meaning that formerly National Committee for Clinical Laboratory
up to 24 to 48 h can elapse, before ESBL production Standards) [24]. The gram-negative bacilli were
is detected once the isolate has grown [19, 20]. This tested for their susceptibility to ampicillin, amoxicillin/
may result in a delay in the initiation of appropriate clavulanic acid, piperacillin/tazobactam, cefalothin,
antibiotic therapy [17]. Molecular detection of ESBL cefoxitin, ceftazidime, ceftriaxone, cefepime,
genes by PCR is an attractive alternative [19−21]. In imipenem, meropenem, amikacin, gentamicin,
Vol. 10 No. 3 Resistance and typing of Enterobacteriaceae 221
June 2016

ciprofloxacin, tigecycline, nitrofurantoin, and completed by adding 100 μL of sterile double-distilled

trimethoprim/sulfamethoxazole. water onto the membrane bound DNA, and centrifuged
at 13,000 rpm for 2 min.
Molecular characterization of beta-lactamases in
Enterobacteriaceae Polymerase chain reaction for detection of the
DNA extraction ESBL-genes
DNA was extracted from ESBL-positive isolates PCR was conducted for individual TEM, CTX-M
using a DNA extraction kit (Koma Biotech, Seoul, group 1, group 2 and group 9 DNA was using 0.4
Korea). Briefly, 1 mL of bacterial suspension was pmol/μL of each primer (Table 1) [25]. The PCR
centrifuged for 5 min at 3000 rpm. The supernatant amplification was conducted using a PCR master mix
was discarded and the pellet was resuspended in (Solis BioDyne, Tartu, Estonia) as follows: initial
200 μL lysing solution and 20 μL proteinase K at 60°C denaturation at 95°C for 5 min; 40 cycles of 95°C
for 30 min and then further incubated at 95°C for for 40s, 60°C for 40s, and 72°C for 1 min; and a final
15 min. Then, 200 μL of ethanol was added to each elongation step at 72°C for 10 min. Amplicons were
sample, which was vortexed and loaded onto an visualized after separation of amplicons in 1.5% gel
XPTG mini column. After centrifugation at 13,000 rpm electrophoresis in Tris-acetate EDTA and staining with
for 1 min, the bound DNA was washed twice then ethidium bromide. A 100 bp DNA ladder (Solis
the excess ethanol was discarded by centrifugation BioDyne) was used to provide size markers.
for 3 min at 13,000 rpm. Elution of the DNA was

Table1. Oligonucleotide sequences used to identify genes encoding important β-lactamase (bla) genes and random
primers used for genotyping of the bacteria

Primer name Primer Sequence 5′′–3′′ Position Amplicon size

TEM-1 and TEM-2

MultiTSO-T_forward CATTTCCGTGTCGCCCTTATTC 13–34 800
MultiTSO-T_reverse CGTTCATCCATAGTTGCCTGAC 812–791
CTX-M group 1, group 2 and group 9
MultiCTXMGp1_forward TTAGGAARTGTGCCGCTGYA 61–80 688
MultiCTXMGp1-2_reverse CGATATCGTTGGTGGTRCCAT 748–728
MultiCTXMGp2_forward CGTTAACGGCACGATGAC 345–362 404
MultiCTXMGp1-2_reverse CGATATCGTTGGTGGTRCCAT 748–728
MultiCTXMGp9_forward TCAAGCCTGCCGATCTGGT 299–317 561
CTXMGp9_reverse TGATTCTCGCCGCTGAAG 859–842
Random primers
OP-A1 CAGGCCCTTC
OP-A3 AGTCAGCCAC
OP-A4 AATCGGGCTG
OP-A5 AGGGGTCTTG
OP-A6 GGTCCCTGAC
OP-A7 GAAACGGGTG
OP-A8 GTGACGTAGG
OP-A9 GGGTAACGCC
OP-A10 GTGATCGCAG
OP-B7 GGTGACGCAG
OP-D5 TGAGCGGACA
222 Ali K. Alzahrani, et al.

Bacterial genotyping using RAPD analysis missing data as “9”. The genetic associations between
For RAPD analysis, 11 different 10-mer random isolates were evaluated by calculating the Jaccard
primers, which were preselected for their performance similarity coefficient for pairwise comparisons based
with DNA from isolates of Enterobacteriaceae on the proportion of shared bands produced by the
(Table 1) were used (Amersham Pharmacia Biotech, primers. The similarity matrix was subjected to cluster
Piscataway, NJ, USA). Following experiments to analysis by an unweighted pair group method for
optimize component concentrations, PCR amplification arithmetic mean and a dendrogram was generated.
of random primers was conducted according to The computations were performed using the program
published methods [26, 27]. Briefly, 1 μL (20 ng) of NTSYS-PC version 2.01 [28]. Jaccard’s similarity
genomic DNA, 12.5 μL of Go Taq Green Master Mix, matrix was subjected to principal component analysis.
Promega, USA, 1 μL of primer (20 pmol), and
deionized ultrapure distilled water up to a total volume Results and Discussion
of 25 L were used. For DNA amplification, an initial There is a current increase in ESBL-producing
denaturation at 94°C for 5 min was conducted, and bacteria worldwide mainly E. coli. Among the 43
followed by 94°C for 30 s, 35°C for 1.5 min, and 72°C tested samples, 27 isolates were E. coli and 16 were
for 2.5 min for 40 cycles and a final elongation step K. pneumoniae (Table 2).
at 72°C for 7 min. DNA amplicons were separated ESBL-producing bacteria were detected in 17/
by electrophoresis in 1.5% agarose gel in TBE. The 43 isolates (39.5%): 14 strains were E. coli and 3
gels were stained with ethidium bromide (5 μg ml–1). strains were K. pneumoniae. All E. coli isolates
A 100 bp DNA ladder (with 1500 bp and 500 bp and 2/3 of K. pneumoniae were positive for blaTEM
reference bands) was used to provide molecular (Table 3).
weight markers suitable to determine DNA fragment Only 2/14 E coli and 2/3 K. pneumoniae showed
sizes (AccuRuler 100 bp DNA RTU Ladder, Ready- resistance to nitrofurantoin. Ten of 14 E. coli and
To-Use Cat. No. 02001-500; Maestrogen, Las Vegas, 3/3 K. pneumoniae ESBL strains were resistant
NV, USA). DNA was visualized by illumination with to ciprofloxacin. ESBLs confer resistance to the
ultraviolet light and then photographed using a Gel oxyimino-cephalosporins (i.e., cefotaxime, ceftriaxone,
Doc 2000 device (Bio-Rad Laboratories, Hercules, ceftazidime) and monobactams (i.e., aztreonam)
CA, USA). [29]. ESBLs do not hydrolyze the cephamycins
(e.g., cefoxitin and cefotetan), or the carbapenems
Data analysis (imipenem and meropenem), and their hydrolytic
The amplification products of RAPD-PCR were activity can be inhibited by several β-lactamase
scored for the presence “1” or absence “0” and inhibitors such as clavulanic acid and tazobactam [29].

Table 2. Antibiotic sensitivity of the examined samples (Escherichia coli and Klebsiella pneumoniae).

Antimicrobial Resistant strains Nonresistant strains

E. coli K. pneumoniae E. coli K. pneumoniae
R S I R S I R S I R S I
Ampicillin 14 0 0 3 0 0 12 1 0 10 3 0
Amoxicillin/clavulanic acid 2 8 4 1 1 1 1 8 4 7 6 0
Piperacillin/tazobactam 5 8 1 2 0 1 2 11 0 7 6 0
Cefoxitin 2 9 3 1 1 1 0 11 2 7 6 0
Ceftazidime 14 0 0 3 0 0 0 13 0 7 6 0
Cefepime 14 0 0 3 0 0 0 13 0 7 6 0
Imipenem 0 13 1 0 3 0 0 13 0 7 6 0
Meropenem 0 13 0 0 3 0 0 13 0 7 6 0
Amikacin 0 14 0 1 2 0 0 13 0 7 6 0
Gentamicin 4 10 0 1 2 0 2 11 0 8 5 0
Ciprofloxacin 10 4 0 3 0 0 2 11 0 8 5 0
Tigecycline 0 14 0 0 2 1 0 13 0 7 5 1
Nitrofurantoin 2 11 1 2 0 1 0 13 0 10 0 3
Trimethoprim/Sulfamethoxazole 9 5 0 3 0 0 7 6 0 8 5 0
Vol. 10 No. 3 Resistance and typing of Enterobacteriaceae 223
June 2016

Two of 14, E. coli and 1/3 K. pneumoniae showed (31.4%) were considered as monomorphic (Table 4).
resistance to cefoxitin and clavulanic acid inhibition, The number of amplified fragments scored for each
while all the tested strains were sensitive to imipenem isolate was recorded. The amplified products
and meropenem (Table 3). In a Russian study, 39.7% among the E. coli and K. pneumoniae isolates were
of E. coli isolates and 21.8% of K. pneumoniae polymorphic.
isolates, which were ESBL-producing strains were A phylogenetic tree was constructed for the 14
resistant to ciprofloxacin [30]. Unfortunately, ESBL- different bla E. coli strains compared with an ESBL-
producing organisms often also possess resistance negative E. coli control that showed a different pattern
determinants to other important antibiotic groups, such of DNA fragments with the different primers (data
as aminoglycosides and fluoroquinolones, leaving not shown). The total number of bands varied from
an extremely limited range of effective agents [31]. 22 with primer OPA-10, to 15 with primer OPA-09
Only four E. coli strains were found to be resistant (Table 4). The RAPD-PCR results using OPA-06-
to gentamicin, while all E.coli strains were sensitive primer showed the highest polymorphism, the 16
to amikacin. A single K. pneumoniae strain was found fragments showed 100% polymorphism (Table 4).
to be resistant to both gentamicin and amikacin. The molecular size of the amplicon products ranged
In the present study, the majority of the blaTEM- from 75 bp to 1450 bp. These findings denote that
type ESBLs were predominant (16/17) followed RAPD markers are effective in detecting similarity
by blaCTX-M group 1, 3/3 K. pneumoniae, and 2/14 between E. coli strains and provide a potential tool
E. coli isolates were positive for blaCTX-M genes for studying the interstrain genetic similarity and the
from CTX-M group 1. Only a single E. coli isolate establishment of genetic relationships.
was positive for the CTX-M-group 2, and none According to genetic similarity and intraspecies
were positive results for the CTX-M group 9 gene differentiation, the 14 E. coli strains and an ESBL-
(Table 3). K. pneumoniae isolate 5 (negative for negative E. coli control strain were grouped into
TEM positive for CTX-M-1) was more resistant different clusters with about 54% genetic similarity.
than the other two K. pneumoniae (positive to TEM E17 was clustered in a separate tree branch far distant
and CTX-M-1) because they showed resistance from other isolates. E6 and E9 formed another cluster
to amikacin and gentamicin. The negative PCR while the rest were clustered in two main subclusters:
results in this report do not negate the possibility the first one included (E1, E3, E4, and E7), while the
that modified blaCTX-M were present in these isolates. second included (E8 and E10−15). E17, and to lesser
Because of the increased complexity of β-lactam extent E6 and E9, were found distant from the other
resistance in gram-negative organisms, the key to tested ESBL-positive E. coli strains (Figure 2).
effective surveillance is the use of both phenotypic RAPDs proved to be useful as genetic markers
and genotypic analyses in concert [32]. in bacteria fingerprinting as previously described [33].
Molecular markers are efficient tools for Although major bands from RAPD reactions are highly
molecular identification and estimation of relatedness reproducible, minor bands can be difficult to reproduce
through DNA fingerprinting. RAPD markers were because of the random priming nature of this PCR
developed by Williams et al. [26]. RAPD technique reaction and potential confounding effects associated
using single-arbitrary-10-mer oligonucleotides was with comigration with other markers. The use of
used to amplify discrete fragments of DNA using multiple primers sets in RAPD analysis can be used
PCR. This technique has been used extensively in as a rapid method for preliminary biotyping of the
many different applications and in different bacterial E. coli.
species because of its simplicity [27]. Genomic Pairwise genetic distance and homogeneity tests
diversity of K. pneumoniae and E. coli isolates were performed to determine the relatedness between
(n = 17) was investigated by RAPD analysis. The the different bacterial strains. Smaller genetic distance
RAPD results showed polymorphic numbers of between E. coli reflected the geographical proximity
the amplicons in different E. coli (n = 14) and between them and the results supported the hypothesis
K. pneumoniae (n = 3) isolates described in Table 4 that the geographical distance is an important factor
(Figure 1). influencing the genetic relatedness of E. coli strains
The random primers yielded 207 distinct bands, [34, 35]. A previous study used fingerprinting for
142 (68.6%) were considered as polymorphic and 65 resistant different bacteria in Al-Taif in determining
 224
Table 3. Results of polymerase chain reaction of genes encoding important β-lactamases (bla) genes in selected bacteria and relevant antibiotic sensitivity

a c
Sample Isolated TEM CTX-M group Antibiotic sensitivity
Number bacteria CTX-1 CTX-2 CTX-9 bAmp Am/Cla Pip/Taz Cefo Cefta Cefe Imi Mer Amk Gen Cip Tig Nit Tri/Sulf

1 E. coli + – – – R R I R R R S S S S R S S R
2 K. pneumoniae + + – – R R I R R R S S S S R S I R
3 E. coli + – – – R S R S R R S S S S R S S R
4 E. coli + – – – R I R S R R S S S S R S S S
5 K. pneumoniae – + – – R I R I R R S S R R R I R R
6 E. coli + – – – R S S S R R S S S S R S S R
7 E. coli + – – – R I S I R R S S S R R S I R
8 E. coli + – + – R S R S R R I S S R R S S S
9 E. coli + + – – R S S S R R S S S S S S S S
10 E. coli + – – – R I S S R R S S S S R S R R
11 E. coli + – – – R R R S R R S S S S R S S R
12 E. coli + – – – R S S S R R S S S S S S S R
13 E. coli + – – – R S S I R R S S S R S S S R
14 E. coli + + – – R S S R R R S S S S R S S S
15 E. coli + – – – R S S I R R S S S R S S S R
16 K. pneumoniae + + – – R S R S R R S S S S R S R R
17 E. coli + – – – R I R S R R S S S S R S R S
Ali K. Alzahrani, et al.

a
TEM variants including TEM-1 and TEM-2. bAmp (ampicillin), Am/Cla (amoxicillin/clavulanic acid), Pip/Taz (piperacillin/tazobactam), Cefo (cefoxitin), Cefta (ceftazidime), Cefe
(cefepime), Imi (imipenem), Mer (meropenem), Amk (amikacin), Gen (gentamicin), Cip (ciprofloxacin), Tig (tigecycline), Nit (nitrofurantoin), Tri/Sul (trimethoprim/sulfamethoxazole),
E. coli = Escherichia coli and K. pneumoniae = Klebsiella pneumoniae. cR (resistant), S (sensitive), I (intermediate).
Vol. 10 No. 3 Resistance and typing of Enterobacteriaceae 225
June 2016

pairwise genetic distance and homogeneity [27]. from Al-Taif and surrounds in Saudi Arabia. blaTEM
However, including strains from different genera of and blaCTX-M-1 were the most commonly detected
bacteria in the same tree did not provide clear picture. genes. There was evidence for the existence of
We concluded that a considerably high incidence polymorphic genetic patterns among ESBL-producing
of ESBL-producing bacteria was present in patients bacteria.

Figure 1. Agarose gel (1.5%) electrophoresis of random amplified polymorphic DNA profiles of extended-spectrum
β-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae. All isolates are E. coli except
Nos. 2, 5, and 16 as shown in Table 3 (in lanes 2, 5, 16 respectively) are K. pneumoniae. In the first left hand
lane of each gel a 100 bp DNA ladder was used to provide discrete DNA molecular weight markers (1500 bp
reference band, then 1000 to 100 bp in 100 bp steps with a 500 bp reference band) to determine DNA fragment
sizes (AccuRuler 100 bp DNA RTU Ladder; Maestrogen, Las Vegas, NV, USA). Primers (a) OPA-01, (b) OPA-03,
(c) OPA-04, (d) OPA-05, (e) OPA-06, (f) OPA-07, (g) OPA-08, (h) OPA-09, (i) OPA-10, (j) OPB-07, and (k) OPD-05.
An ESBL-negative E. coli control showed a different pattern of DNA fragments with the different primers (data
not shown).
226 Ali K. Alzahrani, et al.

Table 4. Polymorphic bands of each genetic primers and percentage of polymorphism in the extended spectrum
β-lactamase-producing bacterial isolates

Primers Total No. of No. Polymorphic % Monomorphic % Polymorphic

Bands Monomorphic Bands bands bands
Bands

OPA-01 19 4 15 26.3 73.7

OPA-03 20 6 14 30.0 70.0
OPA-04 20 5 15 25.0 75.0
OPA-05 21 5 16 23.8 76.2
OPA-06 16 0 16 0.00 100
OPA-07 18 10 8 55.5 44.5
OPA-08 19 6 13 31.5 68.5
OPA-09 15 1 14 6.67 93.3
OPA-10 22 4 18 18.2 81.8
OPB-07 17 9 12 52.9 47.1
OPD- 05 20 15 5 75.0 25.0
Total 207 65 142

Figure 2. Dendrogram of the 14 Escherichia coli isolates collected from inpatients at King Abdul-Aziz Hospital, Al-Taif,
Saudi Arabia based on the 11 random amplified polymorphic DNA primers compared with an extended spectrum
β-lactamase-negative strain (from our laboratory)

Acknowledgment References
This study was supported by Taif University, 1. Coque TM, Baquero F, Canton R. Increasing
through a grant for project No. 3364-435-1. prevalence of ESBL-producing Enterobacteriaceae in
Europe. Euro Surveill. 2008; 13:pii: 19044. [online]
Conflict of interest statement Available from http://www.eurosurveillance.org/View
The authors declare that there is no conflict of Article.aspx?ArticleId=19044
interest in this research. 2. Pitout JD, Laupland KB. Extended-spectrum β-
Vol. 10 No. 3 Resistance and typing of Enterobacteriaceae 227
June 2016

lactamase-producing Enterobacteriaceae: an emerging antimicrobial treatment. Antimicrob Agents Chemother.

public-health concern. Lancet Infect Dis. 2008; 8: 2007; 51:1987-94.
159-66. 15. Schwaber MJ, Carmeli Y. Mortality and delay in
3. Poirel L, Bonnin RA, Nordmann P. Genetic support effective therapy associated with extended-spectrum
and diversity of acquired extended-spectrum β- β-lactamase production in Enterobacteriaceae
lactamases in Gram-negative rods. Infect Genet Evol. bacteriaemia: a systematic review and meta-analysis.
2012; 12:883-93. Antimicrob Agents Chemother. 2007; 60:913-20.
4. Paterson DL, Bonomo RA. Extended-spectrum β- 16. Paterson DL, Ko W-C, Von Gottberg A, Casellas JM,
lactamases: a clinical update. Clin Microbiol Rev. Mulazimoglu L, Klugman KP, et al. Outcome of
2005; 18:657-86. cephalosporin treatment for serious infections due to
5. Falagas M, Karageorgopoulos DE. Extended- apparently susceptible organisms producing extended-
spectrum β-lactamase-producing organisms. J Hosp spectrum β-lactamases: implications for the clinical
Infect. 2009; 73:345-54. microbiology laboratory. J Clin Microbiol. 2001; 39:
6. Ambler R. The structure of β-lactamases. Philos Trans 2206-12.
R Soc Lond B Biol Sci. 1980; 289:321-31. 17. Schwaber MJ, Navon-Venezia S, Kaye KS, Ben-Ami
7. Rupp ME, Fey PD. Extended spectrum β-lactamase R, Schwartz D, Carmeli Y. Clinical and economic impact
(ESBL)-producing Enterobacteriaceae. Drugs. 2003; of bacteremia with extended-spectrum-β-lactamase-
63:353-65. producing Enterobacteriaceae. Antimicrob Agents
8. Bonnet R. Growing group of extended-spectrum Chemother. 2006; 50:1257-62.
β-lactamases: the CTX-M enzymes. Antimicrob Agents 18. Zahar J-R, Lortholary O, Martin C, Potel G, Plesiat P,
Chemother. 2004;48:1-14. Nordmann P. Addressing the challenge of extended-
9. Pitout JD, Nordmann P, Laupland KB, Poirel L. spectrum beta-lactamases. Curr Opin Invest Drugs.
Emergence of Enterobacteriaceae producing extended- 2009; 10:172-80.
spectrum β-lactamases (ESBLs) in the community. J 19. Drieux L, Brossier F, Sougakoff W, Jarlier V. Phenotypic
Antimicrob Chemother. 2005; 56:52-9. detection of extended spectrum β lactamase production
10. Schwaber MJ, Navon-Venezia S, Schwartz D, Carmeli in Enterobacteriaceae: review and bench guide. Clin
Y. High levels of antimicrobial coresistance among Microbiol Infect. 2008; 14:90-103.
e x t e n d e d - s p e c t r u m -β- l a c t a m a s e - p r o d u c i n g 20. Gazin M, Paasch F, Goossens H, Malhotra-Kumar S.
Enterobacteriaceae. Antimicrob Agents Chemother. Current trends in culture-based and molecular detection
2005; 49:2137-9. of extended-spectrum-β-lactamase-harboring and
11. Morosini M-I, García-Castillo M, Coque TM, Valverde carbapenem-resistant Enterobacteriaceae. J Clin
A, Novais Â, Loza E, et al. Antibiotic coresistance Microbiol. 2012; 50:1140-6.
in extended-spectrum-β-lactamase-producing 21. Xu L, Ensor V, Gossain S, Nye K, Hawkey P. Rapid
Enterobacteriaceae and in vitro activity of tigecycline. and simple detection of blaCTX-M genes by multiplex
Antimicrob Agents Chemother. 2006; 50:2695-99. PCR assay. J Med Microbiol. 2005; 54:1183–1187.
12. Lautenbach E, Strom BL, Bilker WB, Patel JB, 22. Bruce SK, Schick DG, Tanaka L, Jimenez EM,
Edelstein PH, Fishman NO. Epidemiological Montgomerie JZ. Selective medium for isolation of
investigation of fluoroquinolone resistance in Klebsiella pneumoniae. J Clin Microbiol. 1981;13:
infections due to extended-spectrum β-lactamase— 1114-6.
producing Escherichia coli and Klebsiella 23. Collee J, Miles R, Watt B. Tests for identification of
pneumoniae. Clin Infect Dis. 2001; 33:1288-94. bacteria. In: Collee JG, Fraser AG, Marmion BP, Simmons
13. Boucher HW, Talbot GH, Bradley JS, Edwards JE, A, editors. Mackie and McCartney’s Practical Medical
Gilbert D, Rice LB, et al. Bad bugs, no drugs: no Microbiology. 14th edition. New York: Churchill
ESKAPE! An update from the Infectious Diseases Livingston; 1996, p 131-50.
Society of America. Clin Infect Dis. 2009; 48:1-12. 24. Spanu T, Sanguinetti M, Tumbarello M, D’Inzeo T,
14. Tumbarello M, Sanguinetti M, Montuori E, Trecarichi Fiori B, Posteraro B, et al. Evaluation of the new
EM, Posteraro B, Fiori B, et al. Predictors of mortality VITEK 2 extended-spectrum β-lactamase (ESBL)
in patients with bloodstream infections caused test for rapid detection of ESBL production in
by extended-spectrum-β-lactamase-producing Enterobacteriaceae isolates. J Clin Microbiol. 2006;
Enterobacteriaceae: importance of inadequate initial 44:3257-62.
228 Ali K. Alzahrani, et al.

25. Dallenne C, Da Costa A, Decre D, Favier C, Arlet G. Chemother. 2003; 47:3724-32.

Development of a set of multiplex PCR assays 31. Livermore DM, Woodford N. Guidance to diagnostic
for the detection of genes encoding important laboratories: laboratory detection and reporting
β-lactamases in Enterobacteriaceae. Antimicrob Agents of bacteria with extended spectrum β-lactamases.
Chemother. 2010; 65:490-5. London: Health Protection Agency Colindale; 2004,
26. Williams JG, Kubelik AR, Livak KJ, Rafalski JA, p 1-14.
Tingey SV. DNA polymorphisms amplified by 32. Eisner A, Fagan EJ, Feierl G, Kessler HH, Marth E,
arbitrary primers are useful as genetic markers. Nucleic Livermore DM, et al. Emergence of Enterobacteriaceae
Acids Res. 1990; 18:6531-35. isolates producing CTX-M extended-spectrum β-
27. Hassan MM, Gaber A, Attia AO, Baiuomy AR. lactamase in Austria. Antimicrob Agents Chemother.
Molecular characterization of antibiotic resistance 2006; 50:785-7.
genes in pathogenic bacteria isolated from patients 33. Soares-Ramos JR, Ramos HJ, Cruz LM, Chubatsu LS,
in Taif hospitals, KSA. Am J Phytomed Clin Therapeut. Pedrosa FO, Rigo LU, et al. Comparative molecular
2014; 2:939-51. analysis of Herbaspirillum strains by RAPD, RFLP,
28. Rohlf FJ. NTSYS-pc: numerical taxonomy and and 16S rDNA sequencing. Genet Mol Biol (São
multivariate analysis system. New York: Applied Paulo). 2003; 26:537-43.
Biostatistics; 2000. 34. Li H, Medina F, Vinson SB, Coates CJ. Isolation,
29. Bush K, Jacoby GA. Updated functional classification characterization, and molecular identification of
of b-lactamases. Antimicrob Agents Chemother. bacteria from the red imported fire ant (Solenopsis
2010; 54:969-76. invicta) midgut. J Invertebr Pathol. 2005; 89:203-9.
30. Edelstein M, Pimkin M, Palagin I, Edelstein I, 35. Moraes PM, Perin LM, Junior AS, Nero LA.
Stratchounski L. Prevalence and molecular Comparison of phenotypic and molecular tests to
epidemiology of CTX-M extended-spectrum β- identify lactic acid bacteria. Braz J Microbiol. 2013;
lactamase-producing Escherichia coli and Klebsiella 44:109-12.
pneumoniae in Russian hospitals. Antimicrob Agents