International Journal of Environment, Agriculture and Biotechnology

Vol-8, Issue-5; Sep-Oct, 2023

Peer-Reviewed International Journal
Journal Home Page Available: https://ijeab.com/
Journal DOI: 10.22161/ijeab

Genetic Diversity 20 Bean Varieties using Microsatellite

Technique (SSR)
Phuoc Trong Nguyen , Khang Minh Le , Hieu Bui Chi , Loan Hong Thi Nguyen, Lang
thi Nguyen*

High Agricultural Technology Research Institute of Mekong Delta , CanTho (HATRI).

*Email: [email protected]

Received: 02 Sep 2023; Received in revised form: 03 Oct 2023; Accepted: 09 Oct 2023; Available online: 17 Oct 2023
©2023 The Author(s). Published by Infogain Publication. This is an open access article under the CC BY license
(https://creativecommons.org/licenses/by/4.0/).

Abstract— Agro-morphological characters and PCR based markers have provided valuable information
about genetic diversity of bean collection in HATRI . Analysis on SSR molecular markers: out of a total of
44 primers conducted genetic diversity studies, only 28 primers amplified the product on 20 bean varieties.
Through the SSR marker data with 28 primers used, 20 varieties are classified into 4 main groups. In the
subgroup of the SSR on 28 molecular markers are noted with 4 distinct groups. Molecular markers to be
able to indirectly assess the presence or absence of selected genes thanks to markers without
environmental influences. The diversity index analyzes according to the high SSR method (H = 0.384)
while the diversity index of stick beans. The results presented here are the first steps towards a better
understanding of varieties introduced from countries and may help guide future research into the crop.
Keywords— bean , gene source diversity, SSR.

I. INTRODUCTION that can be used to develop improved plant varieties that

The world is facing food insecurity due to climate change exhibit higher yields with better quality, bio-stress
and nearly 800 million people from developing countries resistance and abiotics (Nadeem et al., 2020, Nadeem et
go to bed hungry (Khush et la.,2012). The world's al.,2018,). A large number of studies have been conducted
population is growing rapidly and is estimated to reach 10 to explain morphological, phenomenological and
billion people by 2050. Therefore, it is necessary to agronomic variation among local bean populations in parts
increase world food production by 60%–110% to meet of the world (Boros et al.,2014; Madakba et al.,2011).
projected food demand by 2050 (Tilman et al.,2011). To Rana et al.,2015 explored agronomic and morphological
meet global food demand, it is necessary to harness plant variations in the bean variety and proposed several
genetic diversity. Characterization of the gene pool is a genotypes that work well for a breeding perspective and
strategy in this regard as it helps to discover genotypic and (Bozo et al.,2011) used the Turkish bean variety to explore
phenotypic variants that can be effectively selected by the phenotypic variations and report the existence of a variety
breeding community for use (Nadeem et al., 2020, Baloch of phenotypic diversity. Characterization and evaluation of
et al.,2017). Almost 41,500 gene sources from the genus diversity among traditional varieties will provide plant
Phaseolus are present at the International Center for breeders information necessary in the identification of
Tropical Agriculture (CIAT) (Islam, et al., 2006); In initial materials for hybridization to produce varieties with
addition, there are hundreds of local varieties present in the improved productivity and quality.The objectives of the
fields of farmers in bean-growing countries. Most of the study are: to evaluate genetic diversity of the bean
genes available at gene resource centers breed quite varieties in the genebank of High Agricultural Technology
race.Gene pool characterization has always been one of Research Institute of Mekong Delta, CanTho (HATRI),
scientists' favorite methods of investigating new variants Vietnam using morphological characters and microsatellite
markers. To study correlation among the characters for

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 123
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

application in plant breeding, and and to relate results units of Taq HATRI, 4 nmol dNTP, 10pmol primer and
between morphological characters and molecular markers. 50ng genomic DNA. PCR cycles: double wire separation
at 94°C for 5 minutes, followed by 35 cycles of 94°C for
60 seconds, 36°C for 60 seconds and 72°C for 120
II. MATERIAL AND METHOD
seconds. The final cord extension is 72°C for 5 minutes.
The materials used include 20 bean seed samples collected Add 13(l buffer solution (98% formamide, 10mm EDTA,
at the gene bank of the HATRI. The experiment was 0.025% bromophenol blue, 0.025% xylene cyanol) after
conducted at the High Agricultural technology Research PCR. Polymorphism in the PCR product was detected by
Institute of Mekong Delta (HATRI). Morphological and ethidium bromide dye after electrophoresis above 5%
agronomic characterization of imported pea gene banks agarose gel. Data analysis: based on NTSYS-pc software
and selected plant varieties are carried out according to version 2.1.
plant variety evaluation criteria developed by the
PCR reaction products with SSR marker
International Institute of Plant Genetic Resources (IPGRI
1982) and European Community Plant Varieties (EU- To detect polymorphisms of 20 varieties of stick
CPVO), (2013). All characteristics are measured on 10 beans, 44 primers were used in a PCR reaction on DNA
representative individual plants, for 1 variety. A total of 10 genome obtained from leaf samples of 20 varieties of stick
seeds were randomly selected, fully developed and beans. The amplification product generated from these
undamaged. Ten plants of each genotype were sown, with primers was observed on 1.5% agarose gel. Observations
a distance of 30 cm X 30 cm, completely randomized showed that 28 primers amplified over 100% of the
block design (CRBD) with three iterations. All samples, while 20 primers did not amplify any band. The
characteristics are measured on 10 representative number of DNA fragments produced in a reaction is noted
individual plants, for 1 variety. The qualitative characters on the table (table 1). Based on the differences between
differ as measured according to the description IPGRI alleles shown in the bandages on the gel, it is possible to
(1986) for beans.A total of 10 randomly selected, fully determine the differences between the breeds genetically.
developed and seeds were used to measure seed length, After the PCR reaction is complete, 2.5 μl of 6X
width, and height using a digital Vernier caliper. Root loading dye solution (MB1 Ferment Inc., Maryland, USA)
length (cm) was measured by following the methodology is added to the PCR product and 1.5% agarose gel
of Aghamir et al 2016, (8) Width of fruit, (9) number of electrophoresis (m/v) with 1X TAE buffer solution, then
fruits per string, (10) number of seeds per tree (11) Yield the gel is stained with ethidium bromide and the results are
of fruit (kg) and (12) Yield of hectares (tons/ha). recorded using the system (Syngene, Cambridge, UK).
DNA extraction The DNA molecule for PCR Repeat the electrophoresis process 3 times to observe the
analysis is prepared according to the simplified miniscale ice locations accurately as well as the concentration of
process. A sample of fresh, young leaves (2 cm) was each plant with each primer.
collected and placed in a test tube, centrifuged 1.5ml with PCR reaction products with SSR marker To detect
markings, in ice. The leaves are ground in a mortar and polymorphisms of 20 varieties of stick beans, 44 primers
pestle (Spot Test Plate -Thomas Scientific) after 400 (l were used in a PCR reaction on DNA genome obtained
buffer solution is added (50 mM Tris-HCl pH 8.0, 25mM from leaf samples of 20 varieties of stick beans. The
EDTA, 300mM NaCl and 1% SDS). Grind the sample until amplification product generated from these primers was
the buffer solution is green. Add 400(l of buffer solution observed on 1.5% agarose gel. Observations showed that
and mix well. Transfer 400 (l lysate to a test tube with the 28 primers amplified over 100% of the samples, while 20
original leaf sample. Lysate triggers a protein splitting primers did not amplify any band. The number of DNA
reaction by adding 400(l chloroform. The floating object fragments produced in a reaction is noted on the table
(supernatant) is transferred into a new test tube (1.5 ml) and (table 1). Based on the differences between alleles shown
DNA is agglomerated using ethanol alcohol. The DNA in the bandages on the gel, it is possible to determine the
sample was dried by wind and agglutinated in 50(l of buffer differences between the breeds genetically. After the PCR
TE (10mM Tris-HCl pH 8.0, 1mM EDTA pH 8.0). Use reaction is complete, 2.5 μl of 6X loading dye solution
aliquot 1(l for PCR analysis. DNA samples are stored in a (MB1 Ferment Inc., Maryland, USA) is added to the PCR
refrigerator -20°C deep for use. 28 primer pairs were used product and 1.5% agarose gel electrophoresis (m/v) with
for evaluation according to table 1. 1X TAE buffer solution, then the gel is stained with
PCR Tests PCR amplification was performed in ethidium bromide and the results are recorded using the
10mM Tris-HCL (pH 8), 50mM KCl, 1.5mM MgCl2.1 system (Syngene, Cambridge, UK).

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 124
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

Table 1: Molecular markers from SSR used in bean experiment and polymorphic index and PIC diversity index
No No of polymorp
Primers sequencing replication Retio PIC reference
. band hisum

F-
TGTAAACGACGGCCAGTATGCGG (TCT) Rauscher et
1 BM 200 TTGGGAAGCCTCATACAG 3 4 68.59 0.32
10 al.,2013
R-ATCTTCGACCCACCTTGCT

F-
TGTAAACGACGGCCAGTATGCGG
TTGGGAAGC
67.68 Rauscher et
2 BMd45 R- (AG)5 3 9 0.36
7 al.,2013
CTCATACAG
ATCTTCGACCCACCTTGCT
F-
TGTAAACGACGGCCAGTATGCTC
ACGTACGAGT Rauscher et
3 PV-ag003 (AG)8 3 8 70.5 0.39
R- al.,2013
TGAATCTCAGGATGGTGTCGGAG
AGGTTAAGGTTG
F-TGTAAACGACGGCCAGTATGCG
Rauscher et
4 BMd10 R- (GA)8 3 9 75.93 0.41
al.,2013
CTCACGTACGAGTTGAATCTCAG
F-
TGTAAACGACGGCCAGTATGCCT
TGTTCCACCTCCCATCATAGC Rauscher et
5 BM156 (CT)32 3 7 70.88 0.39
al.,2013
R-
ATCTGAGAGCAGCGACATGGTAG
F-
TGTAAACGACGGCCAGTATGCGA Rauscher et
6 GATS91 GTGCGGAAGCGAGTAGAG (GA)17 2 12 76.40 0.42
al.,2013
R-TCCGTGTTCCTCTGTCTGTG
F-
TGTAAACGACGGCCAGTATGCAC Rauscher et
7 BMd47 CTGGTCCCTCAAACCAAT (AT)5 10 11 80.99 0.51
al.,2013
R- CAATGGAGCACCAAAGATCA
F-
TGTAAACGACGGCCAGTATGCGT (CGCCAC Rauscher et
8 BMd17 TAGATCCCGCCCAATAGTC 3 6 67.67 0.35
)6 al.,2013
R-AGATAGGAAGGGCGTGGTTT
F-
PVBR10 TGTAAACGACGGCCAGTATGCCC (CT)16 Rauscher et
9 CCTTTCTCACCACTTCAG 2 7 66.45 0.39
7 (GT)4 al.,2013
R-ACCAAAAACGGTGCTCAAAC
F-
TGTAAACGACGGCCAGTATGCCA (AT)5
BM175 ACAGTTAAAGGTC Rauscher et
10 (GA)19 2 8 85.00 0.44
al.,2013
R-
GTCAAATT

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 125
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

CACTCTTAGCATCAACTGGA
F-ATGCATGTTCCAACCACCTTCTC
(ATCC)3 Yu et
11 J01263 R- 3 2 72.8 0.42
(AG)2 al.,2000
GGAGTGGAACCCTTGCTCTCATC
F-
AGGGTGTTTCACTATTGTCACTGC Yu et
12 J04555 (CTT)3(T)3 2 10 75.2 0.38
R- al.,2000
TTCATGGATGGTGGAGGAACAG
F- TGCCACCACAGCTTTCTCCTC
Yu et
13 K03288 R- (ATGC)4 2 2 43.39 0.35
al.,2000
TATGAGAGAAGCGGTTGGCACG
F-
AGCTTTCACACTATGACACCACTG
G Yu et
14 K03289 (ATGC)4 2 5 65.46 0.39
al.,2000
R-
TGCGACATGAGAGAAAGACACGG
F-CCAGCTACCATCTCCTCCATCG Yu et
15 M18093 (CCA)6 2 3 59.00 0.38
R-TAGTGGTGGAGGTGGAGATTT al.,2000
F-
TAATTTCTCTCTTCCCATCCCAAA
C Yu et
16 M18094 (ATCT)3 7 15 55.74 0.35
R- al.,2000
GTAGTAATAAGGAGGAGGCGGTG
AG
F-
SS71564 ATCTGAGAGCAGCGACATGGTAG
17 (CT)8 12 17 79.25 0.48
7275 R-
TATACACACGAACTTTGCATTCCG
F-
SS71564 ACATGCAAGTTCACACGGTCCTC
18 (TCTTTC)6 12 17 82.4 0.55
9259 R-
ACCTAGAGCCTAATCCTTCTGCGT
F-
CAATCCTCTCTCTCTCATTTCCAA Yu et
19 M75856 TC (GA)11 4 19 54.46 0.32
al.,2000
R-GACCTTGAAGTCGGTGTCGTTT
F-
TGGAGCCATCTGTCTCTTACCCAC Yu et
20 U10419 (AAAT)3 2 6 55.4 0.38
R- al.,2000
GAGCACGAGTCACGTTTGCAAC
F- CTGAAGCCCGAATCTTGCGA Yu et
21 U18349 (GGC)5 2 9 66.24 0.35
R- CGCGAGAGGTGAACGAAAGC al.,2000
F- GGGAGGGTAGGGAAGCAGTG Yu et
22 U18791 (TA)22 8 7 57.68 0.33
R- GCGAACCACGTTCATGAATGA al.,2000
F-
GCAAGAGAACACTGAAGAGGATC
Yu et
23 U28645 G (CCA)5 3 15 74.51 0.41
al.,2000
R-
GACATTACTCATTTCATCATCTAC

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 126
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

TACACG
F-
GTTTCTTCCTTATGGTTAGGTTGT
TTG Yu et
24 U34754 (AT)8 4 17 68.45 0.36
R- al.,2000
TCACGTTATCACCAGCATCGTAGT
A
F- CGAGGAGGAAGGAGAAGACGG
R- Yu et
25 U54703 (TTA)4 4 12 61.23 0.35
GAGGGTTATCACAAGGAAGACAC al.,2000
G
F- CGTTAGATCCCGCCCAATAGT (GCCACC Yu et
26 U77935 2 6 66.57 0.36
R- CCGTCCAGGAAGAGCGAGC )5 al.,2000
F-
TCACGTACGAGTTGAATCTCAGG
AT Yu et
27 X04001 (AG)8 2 6 58.56 0.33
al.,2000
R-
GGTGTCGGAGAGGTTAAGGTTG
F- TTGATGACGTGGATGCATTGC
R- Yu et
28 X04660 (AG)8 6 8 74.25 0.49
AAAGGGCTAGGGAGAGTAAGTTG al.,2000
G

0.38
Total 111 257 65.65
4

Statistical analysis The SSR tape will be displayed based Statistics 20 software. The data from the SSR marker will
on molecular mass and in kilo base (kb) based on the scale be processed together
as a marker. The data is processed using MS Excel
software to calculate the polymorphic tapes of each
III. RESULTS AND DISCUSSION
individual primer, polymorphic average and polymorphic
scale. Analysis of potential information of molecular The variance analysis (ANOVA) showed a statistically
markers and genetic diversity in assessed genotypes significant phenotype (p < 0.05) for all characteristics of
including the number of alleles on the desired locus–Aep the variety, date of first flowering, plant height, flowers
according to (Weir BS et al 1996), Shannon diversity per plant, fruit weight (Table 2). Based on morphological
index- (Martynov SP et al. 2003) genetic parameters, the average value of characteristics related to
diversity/diversity index- Hep, marker index (MI) and flowering date, height of plant, number of fruits on plant
polymorphic content - PIC is calculated for each primer on with 20 varieties of beans is analyzed on table 2. The bean-
a plant based on the allele frequency on the locus of each like genotype has the very early appearance of 50% of
plant. flowering flowers (20 days after seeding) for Alubia beans,
while the bean variety imported from the United States
Cluster Analysis
recorded the longest flowering period (40 days after
SSR will be encrypted in binaries 0 and 1. On horizontal seeding) of 50% female flowering. The number of days of
electrophoresis gels, the sample with the tape is recorded flowering ranged to 24 days for Alubia (23.93) and the
as 1, the sample without the tape is recorded as 0. Based United States (40.66), respectively, while 13 days were
on the tape results, the matrix represents the genetic found to be the average number of days to appear. The
correlation for all pairs from Euclidean Distance and is number of flower varieties also varies HaLan (78.76
used to construct the family tree schema according to the flowers) varieties with the number of l cotton t ...The
Unweighted Pair Group Method with Arithmetic Mean variety with the lowest L number of flower is the Cong
(UPGMA). The data will be analyzed using IBM SPSS

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 127
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

Ty bean variety (36.39 flower per string).The color of seed flowers is also rich white, black and brown .
Table 2. Evaluation of physiological characteristics of 20 varieties of Bean sticks in the Winter-Spring crop 2021 planted in
Can Tho

Flowering ( Hight Second

no lines Color flower Color seed No flower
days) plants (cm) branch

1 Alubia 23,92d 193,19b white white 1,57ab 44,54b

2 Osu544C 35,91b 221,04ab white white 3,80c 69,43ab
3 Hà Lan 30,87c 300,40a white Large white 4,33efg 78,76ab
4 Pháp 32,24ab 188,47b white Small white 3,58def 56,76ab
5 Brasil 36,89ab 194,76ab Purple black 5,90de 77,51ab
White and spot
6 Áo 39,58a 184,75b red red 2,78ab 75,02ab
7 HoaKỳ 40,66a 198,68ab Gray gray 7,03fg 40,05ab
8 Anh 33,56ab 196,85ab Purple gray 5,90h 67,84ab
9 Ấn Độ 39,91a 198,81ab Whie gray 7,06fg 68,92ab
10 Bhatle 37,90a 203,41ab red black 4,20bc 55,32ab
11 Chiese Long 31,30c 190,71ab red Black 7,60def 66,12ab
12 WhiteOP 30,43c 172,15b White White 6,85g 68,31ab
There are black
13 DHundi 37,66a 194,35ab Purple spots 8,10d 75,95ab
14 LB39 36,51ab 192,25ab Whte White 4,11a 66,38ab
15 Chaumese 41,11a 189,681b red black 7,16fg 68,99ab
16 Thái Lan 37,50a 203,47ab white white 5,50bc 66,32a
17 Bolu (HQ) 31,20c 190,71ab white white 7,65def 56,12ab
18 Philippine 30,53c 222,25a white white 6,45g 48,13ab
19 Đài Loan 37,55a 197,36ab white white 8,18d 55,95a
20 CôngTy 36,69ab 194,23ab white white 4,47a 36,39ab
CV (%) 14,01 8,63 2,05 12,27

Note: Numbers that follow the same character have no 2.23cm. Productivity ranges from 0.70 to 1.8kg/wire. The
statistical significance difference at 5%. - Yield and yield tallest breed is still the Bhatle. Through the analysis of
composition recorded: the number of seeds/fruits ranges agronomic traits, yield and yield composition of 20
from 5 to 11 seeds. The Bhatle bean-like genotype exhibits varieties, we show that Bhatle variety followed by White
a maximum average weight (1.87 g), The highest fruit OP is somewhat superior to other varieties, Dai Loan bean
length is the Osu544C and Brasil bean variety long (17.9- variety is the lowest yielding variety (Table 3).
17.44 cm) repectity . The width ranges from 1.47 –
Table 3: Yield and yield composition of 20 varieties of bean melons in the Winter Spring crop 2021 in Can Tho
Length Number
Numbers Yield/plant Yield/ ton/
no Giống fruits wide (cm) pod /
seeds/ pod (kg) ha
(cm) plant

1 Alubia 8d 14.23d 2.23a 80 0.79h 8.47e

2 Osu544C 9c 17.90b 1.47b 58 1.51d 11.53a

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 128
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

3 Hà Lan 8d 16.10bc 2.56a 37 1.35e 9,23d

4 Pháp 8d 15.82c 1.41b 42 0.70h 8.66e

5 Brasil 8d 17.44ab 1.09c 42 0.77h 7.97f

6 Áo 5g 14.17d 1.97ab 40 0 .83h 9.13d

7 Hoa Kỳ 7e 16.33bc 1.92ab 50 1.18g 9.90d

8 Anh 4h 14.46d 1,79ab 82 1.02g 9.39d

9 Ấn Độ 9c 16.96abc 1.88ab 32 1.56c 11.86b

10 Bhatle 11a 14.40d 1.07c 41 1.86a 12.94a

11 Chiese Long 8d 13.28de 1.49b 60 1,04g 7.04f

12 White OP 8d 12.24e 1.79b 59 1.78b 11.33b

13 DHundi 8d 13.50de 1.87ab 41 1.10g 10.52c

14 LB39 10b 13.07de 1.06c 40 1.64c 11.38b

15 Chaumese 6f 15.34c 1.12c 39 1.69c 8.55 e
16 Thai Lan 5g 11.6d 1.5b 41 0.85h 7.14f
17 HanQuoc 6f 15.20c 1.65b 37 1.17g 9.15d
18 Philippine 6f 13.67de 1.32b 72 0.8h 8.14e
19 DaiLoan 7e 16.12bc 1.41b 35 1.13g 5.85g
20 Công Ty 5g 16.11bc 1.6b 33 0.94h 7.36f
C% 4.33 5.45 4.11 2.16 1.12 11.28
Note: Numbers that follow the same character have no statistical significance difference at 5%.

PCR reaction products with SSR marker method Use 24 Cong Ty(180bp) (Figure 1A). For SS 715647275 DNA
SSR primers to amplify stick bean plants, in which all amplification for the product reaches 100% The product
eSSR products are recorded for polymorphism over 20 amplifies 12 alleles with molecular sizes ranging from
bean stick varieties (P = 100%). For SS715649259 DNA 250bp to 320bp. Alubia (210 bp), OSU 544C (220bp);
amplification for the product reaches 100% The product Netherlands (220;400bp), France (210bp), Brazil
amplifies 12 alleles with molecular sizes ranging from (210,350,400bp), Austria (2050bp) United States (205 bp)
180bp to 400bp. Alubia (210 bp), OSU 544C (220bp); Ha Anh (210,450 ...) Ấn Độ (250; 330,360bp);
Lan(210bp), Phap(250bp), Brazil (300bp), Austria Bhatle(260;300,380bp), Chiese Long (260;300,380bp);
(300bp), Hoa Ky(300bp), Anh (300bp), India White OP(250,300bp) Dhundi(250bp); LB39(270bp),
(300;320,350,400 bp); Bhatle (300;350,400), Chiese Long Chaurmes(270bp); Thai Lan (206bp), Han Quoc
(300;350,400); White OP (300bp); Dhundi (210bp); LB39 (240bp,380), Philippine (240bp,380), Đài Loan
(210bp), Chaurmes (220bp); Thailand (200bp), South (240,380bp), Công Ty (240bp) (figure 1B).
HanQuoc(210bp), Philippines (200bp), Đai Loan(200bp),

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 129
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

(A)

(B)
Fig.1: PCR products of SS715649259(A) and SS715647275(B) on 20 different bean varieties separated on polyacrylamide
gel with silver nitrate dyeing

Genetic diversity assessment of 20 stick bean grouping 20 bean varieties based on phenotypic data and
varieties using NTSYSpc.2.1 software The results of calculation results using NTSYSpc.2.1 software are

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 130
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

presented as subgroup trees combining phenotype and between breeds in group A are higher than in breeds in
genotype. Figure 2. Subgroup trees show the relationship group C, the coefficient of similarity.Genetic differences
of genetic distance between varieties based on the between breeds in group A are higher than in breeds in
correlation between varieties and their contribution to the group C, the similarity coefficient between group A and
diversity index of molecular markers. The results of group B compared to group C is 0.41 and breeds in group
genetic grouping based on genotype show that: at a genetic B can be considered intermediate breeds between group A
distance of about 0.74 breeds are divided into 4 very and group C. This means that if the breeds in groups A and
pronounced groups: Groups A, B, C, and D. Thus, with 28 C are crossbred with group C B can produce more
primers, 20 varieties are classified into 4 main groups, in individuals with many desirable traits because the longer
which the correlation between varieties ranges from 0.39 – the genetic distance, the higher the likelihood of hybrid
1.0, indicating that the breeds have high genetic diversity. superiority (Bui Chi Buu et al. 2003).
The degree of similarity between the varieties was as low Genetic subtypes are based on their ability to
as 0.39% and some varieties in group A had the highest combine with primers, at similarities 0 to 0.41 varieties are
degree of similarity of nearly 100%. Genetic differences divided into two main groups A, B, C, D:

0.74
0.00
Alubia
0.70
0.67 0.00
Osu544C
0.70 HàLan
0.80
0.00
Pháp
1.4
0.00
Brasil
1.6
1.0 0.70 Philippine
ChieseLong
0.43 1.1 0.50 0.00
0.13 ÐàiLoan
WhiteOP
TháiLan
0.57
0.54 0.50 Bolu(HQ)
1.2 DHundi
0.20 1.00 CôngTy
Anh
0.27
0.40 1.2 ?nÐ?
0.40 1.5 Chaumese
1.9 Bhatle
1.5
0.00
Áo
0.00
2.3 0.00
HoaK?
0.00
LB39

Fig.2. The genealogy schema shows the genetic correlation between 20 bean varieties based on the Jaccard Homologity
Index using the SSR marker (UPGMA). Four groups when considering a similarity coefficient less than 0.74

- Group A: Group A has a yearly similarity in the there are 5 varieties: Bhatle, Chaumese, DaiLoan, An Do,
range of 0.00-0.40, including 3 varieties: LB39, stick cong ty . Group C: is divided into three groups C1, C2 and
beans imported from the Hoa Ky and Ao (with indicator C3 at a similarity coefficient of 0.50. Group C1 has 1
SS715649259) with a molecular size of 300bp. Group B: variety of Dhundi. Group C2 includes the following

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 131
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

varieties: 2 varieties: Bolu ( HQ) and Thai. Group C3: influence (11.32 to 11.95). The marker's parameter was
White OP, UK Group D: includes 2 varieties: Chiese Long calculated to detect the characteristics of each individual
and Philippne. Group E: includes 5 varieties: stick beans using a separate primer to identify polymorphic loci on
from Brazil, Phap, HaLan, OSU 544 C and Alubia. Group different melon varieties. Based on the number and
E1 includes 2 varieties: Brazilian, Phap. Group E2: frequency of scoring of DNA fragments, polymorphism
includes three varieties: Dutch, OSU 544 C and Alubia. rates, and other efficacy parameters after combining, it
appears that these SSR instructions suggest that
IV. DISCUSSION polymorphisms are best effective markers and can be used
to screen molecules in later high-yielding melon gene
Phenotypic analysis noted bean varieties with
pools. The electrophoresis tape analyzed by UPGMA
different meanings of different fruit forms. Among the 28
method (figure 1) shows the genotypic grouping process
primers (Fig. 1) show the lines of the trees in a uniform
into 4 main groups. There is a strong association between
way. SSR primers with a total of 257 band lines have 111
the genotypes that have been documented. Such genetic
alleles that exhibit polymorphism. Polymorphism is
correlation is very significant, it provides for breeds in the
expressed through markers of varieties valued from
crossing program.
28.57% (EC45). The average number of DNA fragments
amplified by the SSR marker in this study ranged from 2 All traits (except dates of appearance) reflect
to 12 alleles (size 180-400bp). With 28 markers, there is a significant genotyping, indicating the existence of
high variability of DNA fragments produced from the SSR genotypic variation useful for breeding purposes (Table 2).
marker, which can be attributed to differences in The genotypes observed in this experiment were found to
attachment sites across the entire set of alleles of different be consistent with previous reports (Okii etal.,2018). In
bean varieties. The effectiveness of the primers used in this study, all traits were found to be hereditary except for
SSR is to determine the quantity by estimating based on dates of occurrence, root length, and secondary branches
differences in genetic parameters (table 1). In the analysis on a scale of (Robinson et al.,1966) (Table 2). The degree
of genetic diversity divided into important components: of heredity is mainly governed by the degree of genetic
allele frequency and polymorphism in the group. To assess variation, while higher heredity leads to a lower
genetic diversity between different breeds/lineages of environment on a particular trait (Phuke et al.,2017).
geographical origin in the many traits are abundant and Variance analysis (ANOVA) for most of the traits studied
find genetic gaps to establish plausibility for later hybrid reflected that genotypic variance was significant within as
material. For SSR for polymorphic locus ratio: well as across the environment, indicating a higher degree
of their heredity. The findings of this study are consistent
At a significance level of 1%, the percentage of
with previous studies (Okii et al.,2018, Wondimu et al.,
polymorphic loci among seed groups ranged from 59% to
2017) stating that in the days leading up to maturity, fruit
100%. Polymorphism manifests itself most importantly in
per tree, number of seeds per tree, and weight of 100 seeds
different groups of breeds. Average number of alleles per
are less affected by environmental forces and are highly
locus: In general, in most loci there are two or three
heritable traits over many years/places.
alleles, except for the alele on molecules SS715649259
and SS, which 715647275 have 12 alleles. The genetic The wide range of phenotypic values obtained for
diversity index is (H) H = 0.384. However, the Shannon the 12 traits reflects the occurrence of important variation
Diversity Index, which evaluates only on primers in for different agromorphological traits in the study of bean
different melon varieties, indicates the similarity of narrow sprouts of many countries, which was found to be
genetics of the plants studied. When comparing PIC consistent with previous studies (Rana et al., 2015, De La
values, recorded a wide range of PIC values in this topic Fuente et al.,2013). Seed-related characteristics are
with 20 varieties ranging from 0.32 (BM 200) to 0.55 (SS considered important for stick beans and are considered a
715647275) with an average of 0.384. Genetic diversity major determinant of the commercial acceptability of
(Hep) is polymorphic, demonstrating the effectiveness of commercial varieties (Rana et al.,2015). Fruit / string
the eSSR loci information in this study also noted weight is an important characteristic, which has a positive
polymorphisms with high on primers such as M75856. and significant impact on stick bean yield. The average
weight of 100 grains (42.2 g) resulted in this study which
was significantly higher than previous studies (Bozo ̆glu et
In this study, Hep showed remarkable homogeneity across al.,2011, Yeken et al.,2019, Yeken, et al.,2018). The
each SSR primer and ranged from 0.85% (BM175) higher average seed weight noted in this study may be due
Furthermore, Hep showed a positive and significant to the inclusion of large numbers of joinings that have
association (r = 0.914, P < 0.001) with allele/locus larger seed sizes than in previous studies. Voysest et

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 132
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

al.,1983 claim that p...Given that the weight of 100 grains Institute for funding to facilitate the laboratory to
of regular beans can vary between < 15 to > 90 g per 100 implement this project.
grams
In addition to seed color, growth habits also REFERENCES
reflect variations in the height of the plant. Climatic
[1] Balkaya, A.; Ergün, A. Diversity and use of pinto bean
conditions and human preferences can play an important
(Phaseolus vulgaris) populations from Samsun, Turkey.N.
role in the distribution of bean in a particular area (Rana et Z. J. Crop Hortic. Sci. 2008, 36, 189–197.
al.,2015). In this study, climatic conditions noted French, [2] Baloch, F.S.; Alsaleh, A.; Shahid, M.Q.; Çiftçi, V.; De
Austrian varieties of determined growth with early Miera, L.E.; Aasim, M.; Nadeem, M.A.; Akta¸s, H.;Özkan,
maturity. The length and width of the left remain in the H.; Hatipo˘ glu, R. A whole genome DArTseq and SNP
shell. Similar findings were reported by Balkaya and analysis for genetic diversity assessment in durum wheat
Ergün (Balkaya et al.2008) on the use of genotypes of from central fertile crescent. PLoS ONE 2017, 12,
variable-length creeping pea varieties (Table 2) Selecting e0167821.
[3] Boros, L.;Wawer, A.; Borucka, K. Morphological,
the gene pool that performs best and is stable in multiple
phenological and agronomical characterisation of variability
environments per year is also one of the objectives of this
among common bean (Phaseolus vulgaris L.) local
study. populations from The National Centre for Plant
Genetic.Resources: Polish Genebank. J. Hortic. Res. 2014,
22, 123–130.
V. CONCLUSTION
[4] Bozo˘ glu, H.; Sozen, O.A. sample for biodiversity in
-Morphological parameters, average values of Turkey: Common bean (Phaseolus vulgaris L.) landraces
characteristics related to flowering date, string tall, number from Artvin. Afr. J. Biotechnol. 2011, 10, 13789–13796.
of leaves, number of cotton of genotypes on 20 varieties of [5] Bozo˘ glu, H.; Sozen, O.A. sample for biodiversity in
beans are analyzed. The Alubia genotype has a very early Turkey: Common bean (Phaseolus vulgaris L.) landraces
from Artvin. Afr. J. Biotechnol. 2011, 10, 13789–13796.
appearance of 50% of flowering female flowers (23.92
[6] Bui Chi Buu, Nguyen Thi Lang (2003). Application of
days after sowing), while the Chaumese variety recorded
molecular marker to rice breeding in mekong delta Vietnam.
the longest flowering period (41.11 days after sowing). Advances in rice genetic, IRRI
- Analysis on SSR markers: Through the SSR [7] De La Fuente, M.; González, A.M.; De Ron, A.M.; Santalla,
marker data with 28 primers used, 20 varieties are M. Patterns of genetic diversity in the Andean gene pool of
classified into 4 main groups. The SSR marker has proven common bean reveal a candidate domestication gene. Mol.
Breed. 2013, 31, 501–516.
to be a powerful tool for determining how to genetically
[8] Indian J. Genet. Scully, B.T.; Wallace, D.H.; Viands,
diversify across 20 varieties of beans to better manage the
D.R.1991. Heritability and correlation of biomass, growth
bean gene bank also to promote the use of imported rates, harvest index, sorghum (Sorghum bicolor L. Moench).
varieties in future breeding programs. In the subgroup of Front. Plant Sci. 2017, 8, 712.
the SSR on 28 molecular markers are noted with 4 distinct [9] Islam, F.M.A.; Basford, K.E.; Redden, R.J.; Beebe, Stephen
groups. A grouping map that coordinates two molecular E. 2006. Preliminary evaluation of the common bean core
marker methods is also established with four different collection at CIAT. Plant Genetic Resources Newsletter
groups. Relying on molecular markers to be able to (Italy). (145):29-37.
indirectly assess the presence or absence of selected genes [10] Khush, G.S.; Lee, S.; Cho, J.I.; Jeon, J.S. Biofortification of
crops for reducing malnutrition. Plant Biotechnol. Rep. Rep
thanks to markers without environmental influences.
(2012) 6:195–202.
- Diversity index analyzed by high SSR method [11] Madakba¸s, S.Y.; Ergin, M. Morphological and
(H = 0.384) while the diversity index of beans. The results phenological characterization of Turkish bean (Phaseolus
presented here are the first steps towards a better vulgaris L.) genotypes and their present variation states. Afr.
understanding of bean varieties introduced from countries J. Agric. Res. 2011, 6, 6155–6166.
and may help breeding program in future. [12] Martynov SP, Dobrotvorskaya TV, Dotlacil L, Stehno Z,
Faberova I, Bares I. (2003) Genealogical approach to the
formation of the winter wheat core collection. Russian J
ACKNOWLEDGMENTS Genet 2003; 39: 917 - 923.
[13] Nadeem, M.A.; Habyarimana, E.; Çiftçi, V.; Nawaz, M.A.;
The author sincerely thanks the project. Thank Karaköy, T.; Comertpay, G.; Shahid, M.Q.; Hatipo ˘glu, R.;
you to Can Tho City Department of Science and Yeken, M.Z.; Ali, F.; et al. Characterization of genetic
Technology for funding and data discussion. Thank you to diversity in Turkish common bean gene pool using
the Mekong Delta High-tech Agricultural Research phenotypic and whole-genome DArTseq-generated

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 133
 Nguyen et al. International Journal of Environment, Agriculture and Biotechnology, 8(5)-2023

silicoDArT marker information. PLoS ONE 2018, 13, linkage map of common bean (Phaseolus vulgaris L.). J.
e0205363. Hered. 91(6): 429–434.
[14] Nadeem, M.A.; Gündo ˘gdu, M.; Erci¸sli, S.; Karaköy, T.; [25] Weir BS. (1996). Genetic data analysis II: Methods for
Saraco ˘glu, O.; Habyarimana, E.; Lin, X.; Hatipo ˘glu, R.; discrete population genetic data. Sinauer Publishers,
Nawaz, M.A.; Sameeullah, M.; et al. Uncovering Sunderland, MA, USA.
Phenotypic Diversity and DArTseq Marker Loci Associated
with Antioxidant Activity in Common Bean. Genes 2020,
11, 36.
[15] Okii, D.; Mukankusi, C.; Sebuliba, S.; Tukamuhabwa, P.;
Tusiime, G.; Talwana, H.; Odong, T.; Namayanja,
A.;Oswaldo, V. Variedades de Fríjol en América Latina y su
Origen; Centro Internacional de Agricultura Tropical
Paparu, P.; Nkalubo, S.; et al.2018. Genetic variation,
Heritability estimates and GXE ects on yield traits of Phuke.
[16] Phuke, R.M.; Anuradha, K.; Radhika, K.; Jabeen, F.;
Anuradha, G.; Ramesh, T.; Hariprasanna, K.; Mehtre, S.P.;
Deshpande, S.P.; Anil, G.; et al. Genetic variability,
genotype 9 environment interaction, correlation, and GGE
biplot analysis for grain iron and zinc concentration and
other agronomic traits in RIL population of sorghum
(Sorghum bicolor L. Moench). Front. Plant Sci. 2017, 8,
712.
[17] Robinson.M.; Anuradha, K.; Radhika, K.; Jabeen, F.;
Anuradha, G.; Ramesh, T.; Hariprasanna, K.; Mehtre, S.P.;
pool using phenotypic and whole-genome DArTseq-
generated silicoDArT marker information. PLoS ONE Rana,
J.C.; Sharma, T.R.; Tyagi, R.K.; Chahota, R.K.; Gautam,
N.K.; Singh, M.; Sharma, P.N.; Ojha, S.N. Robinson, H.F.
1966. Quantitative genetics in relation to breeding of the
centennial of mendalism.
[18] Rana, N. P., Dwivedi, Y. K., Williams, M. D., & Lal, B.
(2015). Examining the Success of the Online Public
Grievance Redressal Systems: An Extension of the IS
Success Model. Information Systems Management, 32, 1-
21, DOI: 10.1080/10580530.2015. 983019.
[19] Rauscher, Janneke, Leonard Swiezinski, Martin Riedl, and
Chris Biemann. 2013. Exploring Cities in Crime: Significant
Concordance and Co-occurence in Quantitative Literary
Analysis. Proceedings of the Second Workshop on
Computational Linguistics for Literature, Atlanta, Georgia,
June 14, 2013, 61-71 (accessed September 3, 2013).
[20] Tilman, D.; Balzer, C.; Hill, J.; Befort, B.L. Global food
demand and the sustainable intensification of agriculture.
Proc. Natl. Acad. Sci. USA 2011, 108, 20260–20264.
[21] Voysest, O. 1983. Variedades de fríjol en América Latina y
su origen. Centro Internacional de Agricultura Tropical,
Cali, Colombia, 87p.
[22] Yeken, M.Z.; Kantar, F.; Çancı, H.; Özer, G.; Çiftçi, V.
Breeding of Dry Bean Cultivars Using Phaseolus vulgaris
Landraces in Turkey. Int. J. Agric. Wild. Sci. 2018, 4, 45–
54,
[23] Yeken, M.Z.; Nadeem, M.A.; Karaköy, T.; Baloch, F.S.;
Çiftçi, V. Determination of Turkish Common Bean
Germplasm for Morpho-agronomic and Mineral Variations
for Breeding Perspectives in Turkey. KSU J. Agric. Nat.
2019, 22, 38–50.
[24] Yu, K., Park, S.J., Poysa, V., and Gepts, P. 2000. Integration
of simple sequence repeat (SSR) markers into a molecular

ISSN: 2456-1878 (Int. J. Environ. Agric. Biotech.)

https://dx.doi.org/10.22161/ijeab.85.17 134