Original Article

Access this article online

Quick Response Code:
Analysis of gut bacterial community
composition in obese and lean Indian
Downloaded from http://journals.lww.com/kleu by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

participants by denaturing gradient gel

electrophoresis
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/22/2023

Website:
www.ijournalhs.org Tej Bahadur, Rama Chaudhry, Vishwa Deepak Bamola, Alka Mohan Chutani1,
DOI:
Anil Kumar Verma2, Jaishree Paul3
10.4103/kleuhsj.
kleuhsj_273_20
Abstract:
BACKGROUND: Human gut microbiota consists of variety of microbes which play vital role in the
host development, physiology and homeostasis. Alteration in gut microbial composition or dysbiosis
may lead to various diseases and lifestyle disorders including obesity. Since gut microbiota varies
with differences in dietary habits and geographical locations therefore studies are required to look
into the gut microbial diversity in Indian obese and lean subjects whose dietary habits and geography
are different from the western world. Therefore, the present study was conducted to assess the
microbial diversity in obese and lean Indian subjects.
MATERIALS AND METHODS: Subjects with similar dietary habits were enrolled in the study. Fecal
samples were collected from each individuals and DNA was extracted. Polymerase chain reaction
(PCR) was performed to amplify the 16S ribosomal RNA gene (V1-V5 region) followed by GC clamp
PCR (V3 region) for the same. PCR products were run on Denaturing Gradient Gel Electrophoresis
(DGGE) system and DGGE sketches were analyzed in Gel Compar II version 6.6 software (Applied
Maths, Belgium) to assess the gut microbial diversity.
RESULTS AND CONCLUSION: The results showed variation in the gut microbial profiles among
obese and lean individuals and revealed more microbial diversity in the lean as compared to obese
individuals. These observations indicate that BMI is a contributing factor for the difference in gut
bacterial profile of obese and lean subjects and that support the role of gut microbiota in obesity.
Departments of Keywords:
Microbiology and
1
Dietetics, All India Body mass index, denaturing gradient gel electrophoresis, gut microbiota, Indian population, lean,
Institute of Medical obese
Sciences, 3School of Life
Science, Jawaharlal Nehru
University, New Delhi,
2
Division of Vector Borne Introduction maximum number of microbiota.[2] Different
Diseases, National physiological functions, energy balance,
Institute for Research in
Tribal Health, Jabalpur,
Madhya Pradesh, India
O besity is one of the serious public health
issues globally, and recent estimates
reported that more than 500 million people
and some metabolic activity are regulated
by human gut microbiota and alteration to
the composition of human gut microbiota
Address for are affected by obesity. The prevalence of may lead to different metabolic diseases
correspondence: obesity is increasing not only in a developed and lifestyle disorders including obesity.[3]
Prof. Rama Chaudhry, country but also in developing country Human gut microbiota also influences the
Department of including India.[1] The microorganism living metabolic potential and energy yield from
Microbiology, All India
Institute of Medical in the human body is termed microbiota. the diet.[4,5] Microbial population which
Sciences, New Delhi, The large intestine of humans contains the convert hemicelluloses, cellulose, resistant
India. starch (indigestible components of the host
E‑mail: drramach@gmail.
com This is an open access journal, and articles are
distributed under the terms of the Creative Commons How to cite this article: Bahadur T, Chaudhry R,
Received: 29 August Attribution‑NonCommercial‑ShareAlike 4.0 License, which Bamola VD, Chutani AM, Verma AK, Paul J. Analysis
2020 allows others to remix, tweak, and build upon the work of gut bacterial community composition in obese
Accepted in Revised non‑commercially, as long as appropriate credit is given and and lean Indian participants by denaturing gradient
Form: 26 November 2020 the new creations are licensed under the identical terms. gel electrophoresis. Indian J Health Sci Biomed Res
Published: 09 February 2021;14:42-7.
2021 For reprints contact: [email protected]

42 © 2021 Indian Journal of Health Sciences and Biomedical Research KLEU | Published by Wolters Kluwer - Medknow
 Bahadur, et al.: Gut bacterial diversity in obesity

diet), and plant polysaccharides into short‑chain fatty stored at 4°C until further processing. All fecal samples were
acids (SCFAs) and sugars get anaerobic environment processed for DNA isolation. Total DNA was extracted
within the host for the utilization of host polysaccharides from the stool samples by using QIAamp DNA Stool Mini
as a substrate.[6,7] Difference in body weight may be due Kit (Qiagen) with slight improvisation in manufacturer
to physical activity, dietary patterns, and gut microbiota. instructions to increase the DNA yield. The quality and
Studies have reported that lifestyle factors such as quantity of DNA were checked by Nanodrop (TECAN
geographic site, age, and diet can influence the alteration Nano quant). The extracted DNA from the stool samples
Downloaded from http://journals.lww.com/kleu by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

in gut microbiota.[8,9] Gut microbiota transplantation of each subject was used for DGGE analysis.
from obese mice in the recipient mice resulting in the
better weight gain as compared to the gut microbiota Polymerase chain reaction amplification of the
transplantation from lean donors.[10] 16S rRNA gene
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/22/2023

The universal primer sequences (27F ‑ AGA GTT TGA

Human gut containing huge diversity of bacterial TCC TGG CTC AG; 907R – CCG TCA ATT CCT TTR
communities and hence its richness is complicated to AGT TT) targeting the V1‑V5 region of 16S rRNA gene,
the study. Mostly, cultivation‑based analysis has been with yielding a band size of 880 bp were used to amplify
used which though not provide exact impression of the
the stool DNA samples.[13] The PCR was performed
bacteria present in the human gut as the majority of the
in a 50 μl of reaction mixture containing 2.5 mM/µl
bacteria is very complicated to cultivate on the media,
PCR buffer, 0.5 mM/µl MgCl2, 1.6 mM/µl dNTPs,
and this procedure as a result gives only fast‑growing
0.2 units/µl of Taq polymerase, 0.2 μM/µl each of
agents. 16S rRNA sequence‑based molecular methods
forward – reverse primers, and 50 ng of template DNA.
such as denaturing gradient gel electrophoresis (DGGE),
Thermal Cycler – Applied Biosystems Veriti was used in
terminal restriction fragment length polymorphism,
this study. The program consisted of one cycle of initial
quantitative polymerase chain reaction, fluorescent
denaturation 95°C for 5 min, 29 cycles of denaturation
in situ hybridization, and high‑throughput sequencing
95°C for 1 min, annealing 55°C for 1 min, and extension
technologies are also used to illustrate human gut
72°C for 90 s and a final extension step of 72°C for 5 min.
microbiota.[11] DGGE generates the best profile of gut
PCR products were run on 1.5% agarose gel, stained with
microbiota in terms of resolution and species richness by
using V3 region of the 16S rRNA gene universal primer;[12] ethidium bromide and documented with Bio‑RAD Gel
therefore, in this study, DGGE has been used to assess gut DOC EZ System [Figure 1]. All nonspecific amplifications
bacterial composition in obese and lean Indian participants. were eliminated by separation and purification of 880 bp
bands from agarose gel followed by DNA extraction by
using QIA quick gel extraction kit.
Materials and Methods

Subject enrollment Polymerase chain reaction amplification for

Healthy human volunteers were enrolled in this denaturing gradient gel electrophoresis
study. The study was conducted at All India Institute Nested PCR was performed with GC clamp targeting
of Medical Sciences, New Delhi, India, after ethical V3 region of 16S r RNA gene to amplify the 200 bp
clearance which was obtained from All India Institute of fragment for DGGE analysis. The primer sequences
Medical Sciences, Ansari Nagar New Delhi. Institutional were HDA‑1‑GC (5‑CGCCCGGGGCGCGCCCCGG
Ethical Committee with Ref no- IESC/T-143/01.03.2013. GCGGGGCGGGGGCACGGGGGGACTCCTA
Promising risks related with this study and procedures CGGGAGGCAGCAGT‑3) and HDA‑2
were explained to all volunteers, and informed consent (5‑GTATTACCGCGGCTGCTGGCAC‑3).[14] The PCR
was obtained before the assessment. The inclusion was performed in a 25 μl of reaction mixture containing
criteria for obese and lean individuals were according 2.5mM/µl PCR buffer, 0.5 mM/µl MgCl2, 1.6 mM/µl
to the WHO guideline for Asian Indians. The body mass dNTPs, 0.2 μM/µl each of forward and reverse primers,
index (BMI) cutoff for obese individuals was more than 0.2 units/µl of Taq polymerase, and 25 ng of 16S rDNA
25 (≥25 kg/m2) and for lean individuals <22.9 (18.5–22.9 purified PCR product as template DNA. The program
kg/m2). The exclusion criteria to enroll participants were consisted of one cycle of initial denaturation 95°C for
as follows: (i) history of intake of probiotic in the past 4 min, 29 cycles of denaturation 95°C for 30 s, annealing
8 weeks, (ii) history of intake of antibiotics in the past 56°C for 30 s, and extension 72°C for 45s. This was followed
8 weeks, (iii) history of intake of steroid, and (iv) history by a final extension step of 72°C for 5 min. Agarose gel
of any known gastrointestinal disorder. electrophoresis picture is mentioned in Figure 2.

Fecal samples collection and DNA isolation Denaturing gradient gel electrophoresis
Fecal samples from the 20 participants (10 obese and 10 The DGGE was carried out in 8% acrylamide:
lean participants) were collected in the sterile container and bisacrylamide (37.5:1) gel using 40% and 80% denaturing
Indian Journal of Health Sciences and Biomedical Research KLEU - Volume 14, Issue 1, January-April 2021 43
 Bahadur, et al.: Gut bacterial diversity in obesity

gradient in DGGE‑20001‑220 system (C.B.S. Scientific, samples was loaded, and the electrophoresis was run in
USA). Forty percent denaturing solution contained 40% 1X TAE buffer at the constant temperature of 60°C for 18 h
acrylamide/Bis (37.5:1) 15.0 ml, 2.0 ml of 50X TAE, 40% at 40V. The gel was stained for 15 min with EtBr on rocker
deionized formamide (Sigma Aldrich, USA) 16.0 ml, 7M and then destained with 1X TAE. The gel was visualized
urea 16.8 g, and double distilled water was used. Eighty under ultraviolet (UV) transilluminator, and image was
percent denaturing solution contained 40% acrylamide/ recorded on gel documentation system (Bio‑Rad, USA)
Bis (37.5:1) 15.0 ml, 2.0 ml of 50X TAE, 40% deionized [Figure 3]. The number of DGGE bands in each sample
Downloaded from http://journals.lww.com/kleu by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

formamide 32.0 ml, 7M urea 33.6 g and double‑distilled was defined as the number of operational taxonomic
water. The system was assembled according to the C.B.S. units (OTUs).
Scientific Manual. In each denaturation solution, 10% of
APS (Ammonium persulfate) (200 µl) and 13 µl TEMED Ten dominant bands were separated from each group
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/22/2023

were added. The gel was casted using these solutions, with a sterile scalpel from the polyacrylamide gel
and DGGE gradient was formed. The 500–600 ng of DNA under UV transilluminator, and each band was purified
in mili Q water at 4°C overnight by diffusion. This
purified gel DNA product was used as template for the

Figure 1: Agarose gel picture showing amplified 16S rRNA gene of the obese and Figure 2: Agarose gel picture with GC Clamp amplified product of V3 region from
lean stool DNA. Lane L is 1kb DNA ladder, Lane + C is C. difficile ATCC 9689, the obese and lean 16S rRNA gene amplified product. Lane L is 100bp + DNA
Lane –C is Negative control, Lane B1 –B10 are amplified product of Obese and ladder, Lane B1 –B10 are GC Clamp amplified product of obese and L1‑L10 GC
L1‑ L10 are amplified product of lean participants genomic DNA Clamp amplified product of lean

Figure 3: Denaturing gradient gel electrophoresis profiles of the V3 regions of

the 16S rRNA gene. Gel picture (B1‑B10) representing obese and (L1‑L10) is
representing lean participants. Band number (a‑j) and (a1‑e1) were excised and
sequenced. Dendrogram constructed with Unweighted Pair Group Method with
the Arithmetic average, viewing the similarity were performed using GelCompar II
version 6.6 (Applied Maths, Belgium) among obese (B1‑B10) and lean (L1‑L10) Figure 4: Bootstrap consensus phylogenetic tree were constructed by using
participants UPGMA method of MEGA4 software from 15 DGGE band nucleotide sequences

44 Indian Journal of Health Sciences and Biomedical Research KLEU - Volume 14, Issue 1, January-April 2021
 Bahadur, et al.: Gut bacterial diversity in obesity

re‑amplification by using the same GC clamp primer and Table 1: Statistical analysis of body mass index,
condition. These PCR products were sequenced. height, and number of denaturing gradient gel
electrophoresis bands
Denaturing gradient gel electrophoresis gel Variable Mean±SD P
Obese (n=10) Lean (n=10)
images and sequence analysis
BMI 33.8±3.6 21.4±1.5 0.001
Comparative analysis of DGGE bands pattern
Weight 96.2±12.9 60.9±4.9 0.001
was performed using Gel Compar II version 6.6
Downloaded from http://journals.lww.com/kleu by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Height (cm) 168.6±6.9 168.6±2.9 0.5

software (Applied Maths, Belgium). Group of bands was Number of bands 19.4±2.0 25.7±2.6 0.001
allocated automatically by the software. A Unweighted BMI: Body mass index, SD: Standard deviation
Pair Group Method with Arithmetic Mean (UPGMA)
dendrogram of the fingerprints was prepared using
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/22/2023

dominant human gut microbiota of the obese and lean

Pearson correlations in Gelcompar II, and the data were groups was analyzed [Figure 3]. The results revealed that
exported and analyzed.[15] Cluster analysis was done on the diversity in the lean groups was significantly more
the DGGE bands to compare the differences between as compared with obese groups (P < 0.05). Dendrogram
obese and lean gut microbial profiles. In DGGE profiles, was created based on the investigation of cluster from
it was assumed that each individual band refers to one DGGE sketches. Differences and similarity in bacterial
microbial taxon, also referred to as a phylotype or OTU. community configuration were analyzed with UPGMA
NCBI Genbank data base, Blast search program (http:// average clustering algorithm and dice coefficient by
www.ncbi.nlm.nih.gov/blast/) was used to analyze the using Gel Compar II version 6.6 (Applied Maths,
similarity between 16S rRNA gene sequences. Molecular Belgium). Each subject showed unique DGGE profile;
evolutionary genetics analysis (MEGA4) software however, bands similarity was also present between
(Developers- Pennsylvania State University USA) was participants. DGGE fingerprint of V3 region and band
used to construct the Bootstrap consensus phylogenetic sequencing results is shown in Figure 3 and Table 2. In
tree by using UPGMA as shown in Figure 4. this study, all ten DGGE band sequences of the obese
group were passed in the quality check, and only five
Statistical analysis DGGE band sequences of the lean group were passed
Statistical analysis of the data was performed in Stata the quality check. Blast match analysis of DGGE band
11.1 software, (College Station, Texas: StataCorp LP) sequences with NCBI database showed minimum of 81%
and independent test was performed to compare the and maximum 100% identity. Two bands were identified
difference in the number of DGGE bands between obese as Collinsella aerofaciens and Paraclostridium bifermentans
and lean group. P < 0.05 was considered statistically strain, and two bands were identified as uncultured
significant. bacterium, and other was identified as uncultured
bacterium at Phylum family and species level.
Results
Sequences with names and accession numbers were
Denaturing gradient gel electrophoresis gel bands matched from GenBank. Clostridium was clustered
analysis in one group, Uncultured Victivallis sp, Collinsella
DGGE gives a semi‑quantitative and rapid qualitative aerofaciens, and Uncultured Prevotella were clustered in
visual image of microbial DNA. DNA fragments having different group. Uncultured Ruminococcaceae bacterium,
similar length can be separated using this technique. uncultured Eubacterium sp., Dialister sp, uncultured
In this study, mean BMI of obese participants was Mitsuokella sp., and two uncultured bacteroidetes were
33.8 ± 3.6, and BMI of lean participants was 21.4 ± 1.5. clustered separately.
BMI and weight of obese participants was significantly
high as compared to lean subject (P < 0.05). However, Discussion
there was no significant difference in the height of the
participants of both groups. In this study, DGGE pattern In this study, DGGE was used to examine the human
of each sample revealed several bands with different gut microbial diversity in obese and lean participants.
intensities at different positions. DGGE analysis of the Clustering analysis (power of statistical tools) was used for
V3 region showed average no of bands 19.4 ± 2.0 in the the detection of small variations. Each lane of DGGE gel
obese group and 25.7 ± 2.6 in lean group, and DGGE was representing a bacterial fingerprint of fecal sample,
bands were significantly more in lean compared to obese and each band was corresponding to a single bacterial
with (P < 0.05) [Table 1]. species. Dominant bands were excised from DGGE gel,
purified and sequenced for the identification of bacterial
Same species of bacteria were represented by many species. One band was common in all the participants of
bands in the DGGE gel. On the basis of number of bands, both the groups and that was sequenced as uncultured
Indian Journal of Health Sciences and Biomedical Research KLEU - Volume 14, Issue 1, January-April 2021 45
 Bahadur, et al.: Gut bacterial diversity in obesity

Table 2: Denaturing gradient gel electrophoresis bands sequencing results of obese (a to j) and lean (a1to e1)
fecal DNA (V3 region of 16SrRNA gene)
Band number Very close relative after blast Phylum Very close accession number Identity %
a Uncultured Prevotella sp Bacteroidetes JQ083408 95
b Collinsella aerofaciens Actinobacteria LC258146 97
c Uncultured bacterium GU633800 98
d Uncultured Clostridium sp Firmicutes KY024773 98
Downloaded from http://journals.lww.com/kleu by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

e Dialister sp Firmicutes KY859801 87

f Uncultured Bacteroidetes bacterium Bacteroidetes GU956211 95
g Uncultured Ruminococcaceae bacterium Firmicutes KT963759 100
h Uncultured Eubacterium sp Firmicutes KP105807 94
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/22/2023

i Uncultured Victivallis sp Lentisphaerae KP107055 94

j Uncultured Mitsuokella sp Firmicutes KP103809 98
a1 Uncultured Bacteroidetes bacterium Bacteroidetes GU957098 94
b1 Uncultured Bacteroidetes bacterium Bacteroidetes JF928139 81
c1 Paraclostridium bifermentans Firmicutes KY523546 99
d1 Uncultured Clostridium sp Firmicutes JF427837 97
e1 Uncultured bacterium KF231465 92

Prevotella species. All the recruited participants were Conventional molecular technique, i.e., PCR DGGE
similar dietary habits ovo‑lacto‑vegetarian diet. Wu fingerprinting, can be used for gut microbiome study
et al. in 2011 [1] also reported that family Prevotella and predominant microbiota can be identified by
is more abundant in the gut of humans on vegan, DGGE.[25] In visual comparison technique, DGGE is
ovo‑lacto‑vegetarian diets, and long‑term fiber intake. one of the best techniques for the identification of
Another study also showed that the Indian population microbial communities and that is effectively applied
has carbohydrate rich diet, so their gut bacterial profile to observe the diversity of microbiota.[26] In this study,
found enriched with the members of family Prevotellaceae DGGE band sequence represents gut microbial diversity
designated as carbohydrate‑metabolizing bacteria.[16] of Firmicutes, Bacteroidetes, Actinobacteria, and
Asian Microbiome project and another studies from Lentisphaerae in fecal DNA sample. The sequences
Indonesia and Thailand also suggested the predominance were confirmed at genus and species level with the
of Prevotella.[17] accession number. Multiple sequence alignments of
DGGE band sequence were prepared with Clustalw.
DNA‑based DGGE fingerprints and phylogenetic Phylogenetic tree was constructed by UPGMA from
tree analysis represent a remarkable separation of the nucleotide sequences using MEGA program version 4.[27]
bands. However, in phylogenetic analysis, the DNA In this study, participants of the both obese and lean
fingerprints did not exactly cluster on the basis of BMI, group showed difference in gut microbiota profile even
although bands B1, B4, B5, B6, B8, and B9 clustered all the participants were Indian vegetarian, residing in
together in the obese group and band L3, L7, L9, L10 New Delhi, India, for last 5–6 years thus sharing similar
in the lean group. Band B2, B3 and L2, L4 was clustered environment and geographical condition. The results
separately from the above clusters. However, band B7, revealed that individuals with less BMI having more
B10, L1, L5, L6, and L8 were clustered in between them. gut microbiota as compared to individuals with more
In this study, most of the identified microorganisms BMI. Therefore, these results are indicating that BMI of
were indexed as uncultured bacteria. Microbiota the enrolled participants was a contributing factor for
plays a crucial role with host health and nutrition.[18,19] the difference in gut microbiota and that is supporting
Microbiota may help in food supplementation and an associated of BMI with the composition of human
digestion in the intestine.[20] Several studies reported gut microbiota.
that intestinal microbiota can be influenced by several
factors such as diets, genetics, age, and existing Conclusion
environment. [21,22] Complex carbohydrate such as
dietary fiber is fermented by the gut microbiota in We investigate the gut bacterial profile of obese and
to (SCFAs: acetate, butyrate, and propionate), which lean individuals by DGGE. We observed a significant
contribute 10% of the total nutritional energy deliver in difference in the gut bacterial profile of obese and lean
humans.[23] Lucas López et al. in 2017[24] reported that the participants. The results of the study revealed that
function and composition of human gut microbiome are individuals with less BMI having more gut bacteria
associated with obesity. Butyrate and other SCFAs are as compared to individuals with more BMI. These
considered as direct anti‑inflammatory effect in the gut. observations indicate that BMI is a contributing factor for
46 Indian Journal of Health Sciences and Biomedical Research KLEU - Volume 14, Issue 1, January-April 2021
 Bahadur, et al.: Gut bacterial diversity in obesity

the difference in the gut bacterial profile of obese and lean Vernocchi P, et al. Effect of lactose on gut microbiota and
particiants, and that support the role of gut microbiota metabolome of infants with cow’s milk allergy. Pediatr Allergy
Immunol 2012;23:420‑7.
in obesity. However, large‑scale next‑generation
12. Yu Z, Morrison M. Comparisons of different hypervariable
sequencing‑based studies are required to explore the full regions of rrs genes for use in fingerprinting of microbial
spectrum of gut microbiota in obese and lean participants communities by PCR‑denaturing gradient gel electrophoresis.
in the Indian population. Appl Environ Microbiol 2004;70:4800‑6.
13. Lane D J. 16S/23S rRNA sequencing. In: Stackebrandt E,
Downloaded from http://journals.lww.com/kleu by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Goodfellow M, editors. Nucleic acid Techniques in Bacterial

Acknowledgments Systematics. Chichester, United Kingdom: John Wiley and Sons;
The authors acknowledged financial support in the form 1991. p. 115‑75.
of Senior Research Fellowship (SRF) to Dr. Tej Bahadur 14. Walter J, Tannock GW, Tilsala‑Timisjarvi A, Rodtong S,
by the Indian Council of Medical Research (ICMR) Loach DM, Munro K, et al. Detection and identification of
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 09/22/2023

New Delhi, Government of India (ICMR file number gastrointestinal Lactobacillus species by using denaturing
gradient gel electrophoresis and species specific PCR primers.
80/686/2011‑ECD‑1) and Institute fellowship from All
Appl Environ Microbiol 2000;66:297‑303.
India Institute of Medical Sciences (AIIMS), New Delhi. 15. McCune B, Grace J, Urban D. Analysis of Ecological Communities.
USA: MjM Software Design; 2002.
Financial support and sponsorship 16. Rho JH, Wright DP, Christie DL, Clinch K, Richard HF,
Nil. Roberton AM. A novel mechanism for desulfation of
mucin: Identification and cloning of a mucin‑desulfating
glycosidase (sulfoglycosidase) from Prevotella strain RS2.
Conflicts of interest J Bacteriol 2005;187:1543‑51.
There are no conflicts of interest. 17. Nakayama J, Koichi W, Jiang J, Matsuda K, Chao SH, Haryono P,
et al. Diversity in gut bacterial community of school‑age children
References in Asia. Sci Rep 2015;5:8397.
18. Burr G, Galtin D, Ricke S. Microbial ecology of the GI tract of fis
1. Wu GD, Chen J, Hoffmann C, Bittinger K, Chen YY, Keilbaugh SA, hand the potential application of prebiotiocs and probiotics in
et al. Linking long‑term dietary patterns with gut microbial finfish aquaculture. J World Aquacult Soc 2005;36:425‑36.
enterotypes. Science 2011;334:105‑8. 19. Verschuere L, Rombaut G, Sorgeloos P, Verstraete W. Probiotics
2. Turnbaugh PJ, Ley RE, Hamady M, Fraser‑Liggett CM, bacteria as biological control agents in aquaculture. Microbiol
Knight R, Gordon JI. The human microbiome projects. Nature Mol Biol Rev 2000;64:655‑71.
2007;449:804‑10. 20. Sakata T. Microflora in the digestive tract of fish and shell fish.
3. Blaut M. Ecology and physiology of the intestinal tract. Curr Top In: Lessel R, editor. Microbiology in Poikiloterms. Amsterdam:
Microbiol Immunol 2013;358:247-72. [doi: 10.1007/82_2011_192]. Elsevier; 1990. p. 171‑6.
4. Tremaroli V, Bäckhed F. Functional interactions between the gut 21. Mueller S, Saunier K, Hanisch C, Norin E, Alm L, Midtvedt T,
microbiota and host metabolism. Nature 2012;489:242‑9. et al. Differences in fecal microbiota in different European
5. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, study populations in relation to age, gender, and country:
Gordon JI, et al. An obesity‑associated gut microbiome with A cross‑sectional study. Appl Environ Microbiol 2006;72:1027‑33.
increased capacity for energy harvest. Nature 2006;444:1027‑31. 22. Xu X, Xu P, Ma C, Tang J, Zhang X. Gut microbiota, host health,
6. Bäckhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, et al. and polysaccharides. Biotechnol Adv 2013;31:318‑37.
The gut microbiota as an environmental factor that regulates fat 23. Clarke SF, Murphy EF, Nilaweera K, Ross PR, Shanahan F,
storage. Proc Natl Acad Sci USA 2004;101:15718‑23. O’Toole PW, et al. The gut microbiota and its relationship to diet
7. Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. and obesity: New insights. Gut Microbes 2012;3:186‑202.
Host‑bacterial mutualism in the human intestine. Science 24. Lucas López R, Grande Burgos MJ, Gálvez A, Pérez Pulido R. The
2005;307:1915‑20. human gastrointestinal tract and oral microbiota in infammatory
8. Wu GD, Lewis JD. Analysis of the human gut microbiome bowel disease: a state of the science review. APMIS 2017;125:3‑10.
and association with disease. Clin Gastroenterol Hepatol 25. Keijser BJ, Zaura E, Huse SM, van der Vossen JM, Schuren FH,
2013;11:774‑7. Montijn RC, et al. Pyrosequencing analysis of the oral microflora
9. David LA, Maurice CF, Carmody RN, Gootenberg DB, Button JE, of healthy adults. J Dent Res 2008;87:1016‑20.
Wolfe BE, et al. Diet rapidly and reproducibly alters the human 26. Ledder RG, Gilbert P, Huws SA, Aarons L, Ashley MP, Hull PS,
gut microbiome. Nature 2014;505:559‑63. et al. Molecular analysis of the subgingival microbiota in health
10. Bäckhed F, Manchester JK, Semenkovich CF, Gordon JI. and disease. Appl Environ Microbiol 2007;73:516‑23.
Mechanisms underlying the resistance to diet‑induced obesity 27. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular
in germ‑free mice. Proc Natl Acad Sci U S A 2007;104:979‑84. evolutionary genetics analysis (MEGA) software version 4.0. Mol
11. Francavilla R, Calasso M, Calace L, Siragusa S, Ndagijimana M, Biol Evol 2007;24:1596‑9.

Indian Journal of Health Sciences and Biomedical Research KLEU - Volume 14, Issue 1, January-April 2021 47