.... ,,: .

. ..
'~"'

L-3/T-2/BME Date: 25/03/2019

BANGLADESH UNIVERSITY OF ENGINEERING AND TECHNOLOGY, DHAKA
L-3/T-2 B. Sc. Engineering Examinations 2017-2018

Sub: CHE 471 (Biochemistry)

Full Marks: 210 Time: 3 Hours
USE SEPARATE SCRIPTS FOR EACH SECTION
The figures in the margin indicate full marks.

SECTION-A
There are FOUR questions in this section. Answer any THREE.

1. (a) Define Isopycnic Centrifugation. Differentiate between two major methods of

Isopycnic Centrifugation. (2+8=10)

(b) List the elements that are most essential to animal life and health. Why are they

important? (7)
(c) Formulate 2 (two) methods along with suitable diagranls for fractionation of cells. (8)

(d) Write definitions for the following items. (5x2=10)

(i) Dalton (ii) Conformation (iii) Active site (iv) Coenzyme (v) Holoenzyme

2. (a) 'The enzymatic catalysis of reactions is essential to living systems.' - Justify the

statement. (8)
(b) Choose a parameter to compare the catalytic efficiencies of different enzymes or
the turnover of different substrates by the same enzyme. Explain the reasons behind

choosing this parameter. (12)

(c) When IOllg of an enzyme of Mr 50,000 is added to a solution containing its ..•
substrate at a concentration one hundred times the Km, it catalyzes the conversion of

751lmol of substrate into product 3 min. What is the enzyme's turnover number? (5)
(d) Methanol (wood alcohol) is highly toxic because it is converted to formaldehyde in
a reaction catalyzed by the enzyme alcohol dehydrogenase. Part of the medical
treatment for methanol poisoning is to administer ethanol (ethyl alcohol) in amounts
large enough to cause intoxication under normal circumstances. Explain this

phenomenon along with suitable diagrams and equations. (10)

3. (a) Distinguish between Epimers and Anomers. (6)

(b) Describe a colorimeric method to determine glucose concentration levels in human

tear samples. (12)

(c) Graphically represent the formation of Pyranose and Furanose forms from D

Glucose and D Ribose. (10)

(d) Show the Catabolic pathway for Proteins, Carbohydrates and Flats in a single

diagram. (7)

Contd P/2
 =2=

CHE471

4. (a) Predict the lipids that are localized in the thylakoid membranes of chloroplasts.

Write short note on it. (6)

(b) Describe the transport processes for nonpolar and polar compounds through

membranes along with diagrams. (12+6=18)

Calculate the emgy cost for pumping Na+ from cytosol where its concentration is
about 10-6 M, to the extracellular fluid where its concentration is about I mM. Assume
a temperature of 37°C and a standard transmembrane potential of 100 mV (inside
positive) for the plasma membrane.
(c) List the major storage lipids and structural lipids. Point out the importance of

sterols in animal body. (6+5=11)

SECTION -B
There are FOUR questions in this section. Answer any THREE.

5. (a) Show mathematically why the pH of pure water is 7 at 25°C. (8)

(b) Explain with the help of a sketch of a titration curve, how you might use
phosphoric acid to buffer a biological reaction in the lab? (Phosphoric acid is tribasic,

with pK;s of2.14, 6.86, and 12.4) (14)

(c) Ammonium sulfate, (NH4)2S04 is a water-soluble salt. Explain the thermodynamic
feasibility of dissolving this molecule in water. Draw the relevant structures that form

when ammonium sulfate dissolves in water. (13)

6. (a) Describe in detail one characterization technique for Proteins and one for Nucleic

acids. Include appropriate diagrams if needed. (12)

(b) Give a few examples of commonly found secondary structures in RNA strands?

Explain why they are formed. (8)

(c) Given the following DNA template sequence write down the corresponding DNA
coding strand and the corresponding mRNA sequence. Finally write down the
sequence of amino acids that are coded by the sequence given using the chart given.
Choose the correct reading frame based on the start codon. (NOTE: the start codon is

present within the first 6 bases thus you should ignore all bases coming before that) (15)
DNA TEMP LATE sequence:
5' GGATGCCGAAACGCGAGAAGCATGCGAGTAATCAG 3'
Contd P/3
•

=3=

CHE 471

7. (a) Taking help of a neat schematic diagram, mention how the structure is stabilized.
Describe the salient features of the a-helix structure, mark (and state) the length of the

pitch of the helix in your diagram. (12)

(b) What are some of the factors that cause instability in the a-helix? (8)
(c) With the aid of appropriate diagrams explain the rules of DNA replication: (15)

8. (a) Draw the fully prolonaled structure and the titration curve for the pentapeptide
CHAIR. Mark on the titration curve the net charge on this pentapeptide at various pHs.
Show the corresponding schematic diagrams at these pHs. What is the pI and the

molecular weight of this pentapeptide? (20)

(b) (15)
(i) Calculate the pH of a buffer system that is 0.25 M benzoic acid and 0.75 M
ammonium benzoate if the pK. = 4.2
(ii) Calculate the number of grams of benzoate and benzoic acid required to make
a liter ofO.5M buffer solution at the pH calculated in (i)
(MW benzoic acid, C6HsCOOH = l22g mol-I);
(MW ammonium benzoate, C6HsCOONH4 = l39g mol-\
 1

•
•
-
-L-.J .-
(-
'cHEt.;r/
, ----,

Amino Acid Properties

-, --l--- ----,--
, r Amino acid
Molecular
. weight'

-l :.;~+K' _
. Molecu
_ pK I

pKR

T
2
1M
name
._--- art1i~o9~~i~ res~u;
Alanine 1.08 2.34 9.69
Arginine 174.20 I 156.18 I 2.17 9.04 12.48
, Asparagine 132.12 I II4.10 I 2.02 8.80
Aspartic Acid 133.11 115.09 1.88 9.60 3.65
Cysteine 121.16 103.14 1.96 10.28 . 8.18
Glutamic Acid 147.13 129.11 I
2.19 9.67 4.25
Glutamine 146.15 128.13 2.17 9.13
Glycine 75.07 5 7.05 I 2.34 9.60
Histidine 155.16 137.14 1.82 9.17 6.00
Hydroxyproline 131.13 II3 _II 1.82 9.65
Isoleucine 131.18 113.16 2.36 9.60
Leucine 131.18 II~j.t'6 2.36 9.60
Lysine 146.19 128.17 2.18 8.95 10.53
Methionine 149.21 13 1.19 2.28 9.21
Pheny lalanine 165.19 147.17 1.83 9.13
Proline 115.13 9 7.11 1.99 10.60
Serine 105.09 8 7.07 2.21 9.15
Threonine 119.12 10 1.10 2.09 9.10
Tryptophan 204.23 I 186.21 2.83 9.39
Tyrosine 181.19 I 163.17 2.20 9.11 10.07
Valine 117.15~9
"..-~=.-._.,_ .., ,.. _.--
.13 2.32
.... -
9.62 - - ._-

mRNA Codon
, Chart
u c A G
Phe Ser Tyr Cys U
~
Phe Ser I yr Cys C
U
Leu Set stop stop A
Leu Set 5toO Tro G
. leu Pro His Arg U
Leu Pro His Arg C
C
Leu Pro . Gin Arg A
Leu Pro Gin ArQ G
lie Tilt .. Asn Set U
A
lie Tllr Asn Set C
lie Tllr Lys Arg' A
Met Thr lV$ ArQ G
. Val Na Asp Gly. U
Val . Ala Asp Gly C
G
Val Ala Gill Gly A
Val Ala Glu Glv G
 L-3/T-2IBME Date: 13/0112021
BANGLADESH UNNERSITY OF ENGINEERING AND TECHNOLOGY, DHAKA
L-3/T -2 B. Sc. Engineering Examinations 2018-2019
Sub: CHE 471 (BIochemistry)
Full Marks: 180 Time: 2 Hours
The figures in the margin indicate full marks.
Symbols used have their usual meaning and interpretation.
USE SEPARATE SCRIPTS FOR EACH SECTION

SECTION A
There are THREE questions in this section. Answer any TWO.

1. (a) Explain with a suitable example how variations in amino acid sequence of (20)
haemoglobin may lead to a hereditary human disease.
(b) With a proper diagram, show how carbohydrate can be synthesized from (15)

different precursors. Differentiate among the processes for animals and plants.
(c) Mention a few electron transporter protcins ,that take part in Oxidative (4+6=10)

Phosphorylation. Write about the function of ATP sY.J1thaseenzymes.

2. (a) Draw formation of a-D-fructopyranose and a-D-fructofuranose from' D- (12)

fructose.
(b)' (i) At what substrate concentration would an enzyme with a keatof 30.0 S.1 and
a Km of 0.005 M operate at one-quarter of its maximum rate?
(ii) Determine the fraction of Vmax that would be obtained at the following
substrate concentrations: [S) = 10Km.
(iii) An enzyme that catalyzes the reaction X ~ Y is isolated from two bacterial
species. The enzymes have the same Vmax but different Km values for the
substrate X. Enzyme A has a Km of 2 IlM while enzyme B has a Km of 0.5
IlM. The plot below shows the kinetics of reactions carried out with the
same concentration of each enzyme and with [X] = I IlM. Which curve
corresponds to which enzyme and why?
 =2=
ChE471

(7+7+10
=24)

Time

(c) Differentiate between reversible and irreversible inhibition. (9)

3. (a) How do archaebacteria manage to survive in extreme conditions like low pH or (10)
high temperaturcs?
(b) Write short notes on different types of steroids found in human body or used as (15)
drugs.
(c) ."Individuallipid molecules can move late~ally in the plane of the membrane by (20)
changing places with neighboring lipid molecules"- describe a technique to prove
it.

SECTIONB
There are THREE questions in this section. Answer any TWO.

4. (a) With the help of a properly labelled titration curve 'for a weak acid, HA having (20)
pKa=5.86, caleulate the pH range within which this acid shows optimum buffering
capacity. (show your working). Explain in your own words why this is the optimum
pH range for buffering.
(b) Comparing two amino acids: aspartic acid and tryptophan - (18)
(i) which would be more soluble in water and why?
(ii) would either of them show absorbance in UV spectra, why or why not?
(iii) which would show positive hydropathic index and why?
(c) Draw the structure of a typical pyrimidine and purine. (7)
 =3=
ChE471

5. (a) The below DNA sequence is part of the DNA coding sequence, what is the (10)
corresponding mRNA sequence?
5' TTATGTGGCACAGAGAA3'
(b) Use the codon chart, find the start codon, ignore everything before the start (15)
codon. Use the correct reading frame to write down the correct peptide
sequence in one letter code.
(c) Explain ANY TWO rules of DNA replication with appropriate diagrams (20)

6. Explain with appropriate schematics/diagrams what do you understand by the (9x5

following statements (any five) : = 45)

(i) Planar nature of peptide bonds gives rise to dihedral angles (cp and 1jI)

(ii) a-helices are stabilized by hydrogen bonds.

(iii)~-sheets are stabilized by hydrogen bonds.
pK+ K
(iv) The pI of all amino acids is not 1 P 2.
2

(v) pK. values for the ionizable groups in glycine are lower than those for simple,
methyl-substituted amino and carboxyl groups.
(vi) The enzyme DNA polymerase catalyzes the addition of dNTP to a DNA chain.
(vii) The formation of the micelle is governed by the change of entropy in the system.
•

=4=
ChE471

mRNA Codon Chart

u C A G
:
'. 'Phe'
--'--- ' •...
_.
"$~r~~. .''ryr'
..•..•.. ,: -- . .-
'(3'
...
'~y"s:_.' ",
...
:JJ~
U
Phe Ser T)'r. Cys c
~.sef: ": t.~~ ~ '-fI>"'-'"

L:eu
'I,. _.. '-' . - - l.-
istQp: . .
:s~p:._ .. A
-.~. '-- .'
Leu SeT stoo Tro G
I '~eO , F'i't5' 'His' . 4,"l-g'.. . -,---.....-.
u
"---_ .....:
"

"'- -~'" -' ~. .~ •• ~.!>,.... • - • .~-+ ••. "/j.•• ~ -. _';".fi.;..-:',~

C --.
C r- ... Leu -- ,, 'Pro'.. .-. -
~~y:' ,"
Pro
__ n

'
~"'._
His
'TGlrt~- -
.'
Arg
-"••••
.,.;~

.:Am.
~Ji
•.••..
--.--. _-. .•....•
. __P..,,---
. .
"
.•. ~ L .•••• ; ••••. 0
__ , ~",,~i
. ~._...<-_-, .,.,-~
Leu Pro Gin Arc G
!
~~ .
- .11~.. .•...
.. _
- .
'tW'"r~
.~ _'.r."
- _. ~Asl'f'
..:._. ;',;...,-
-- _..~~J~;:J:!,:j
A ..

'jie>'
lie
.-
Thr
-~~~.,.-i"''''--''-- T___
.- ,--~
Asn
_.
Ser .. _
.- .'.......-o:"~
fJi\
--_._---~ .,'Th{ ...•... " .~ ___ ;.;.:..-.,/9 .. ,:'. ___ '~~ . LJfL:-e-
~ . ~-t:~~sr.~'.~
- ~r
C
I
- . .~-
Met Thr
~'--.----'.

Lvs
-'

Arc
.
- -er-
I•.. __ , _~, ,I ___ : __'__
.
Gl'''
Val' ->- L_.J~~; -~--- ~~f=I.' __~ ::...~_.C;.
.-11

U" .•.•.
~_y~ i' -,,--t"'
Val .A1a .. - Asp Gly C
G
L Val
-
__~.~_r- .•.;.o...-----_
....•... -~ . ~ATti . {Stir
~ ...--
- - __ r_,,-,,-",,," ._" ...••• • _--+

..
-'- -~G1y~
, .. _ ....... )...
~ ..._,--",
---,;
"~ __ ,._,_>--J •• --~~
:'-'- . .- -"- -'..-" -
Val Ala Glu Glv G
•

=5=
ChE 471

Amino Acid Properties

Molecular
Amino acid weight Molecular weight pK] pK2 pKR
name amino acid residue
Alanine 89.10 71.08 2.34 9.69
Arginine 174.20 156.18 2.17 9.04 12.48
Asparagine 132.12 114.10 2.02 8.80
Aspartic Acid 133.11 115.09 1.88 9.60 3.65
Cysteine 121.16 103.14 1.96 10.28 8.18
Glutamic Acid 147.13 129.11 2.19 9.67 4.25
Glutamine 146J5 128.13 2.17 9.13
Glycine 75.07 57.05 2.34 9.60
Histidine 155.16 137.14 1.82 9.17 6.00
Hydroxyproline 131.13 113.11 1.82 9.65
Isoleucine 131.18 113.16 2.36 . 9.60
Leucine 131.18 113.16 2.36 9.60
Lysine 146J9 128.17 2.18 8.95 10.53
Methionine 149.21 131.19 2.28 9.21
Phenylalanine 165.19 147.17 1.83 9.13
Proline 115.13 97.11 1.99 10.60
Serine 105.09 87:07 2.21 9.15
Threonine 119J2 101.10 2.09 9.10
Tryptophan 204.23 186.21 2.83 9.39
Tyrosine 181.19 163.17 2.20 9Jl 10.07
Valine 117.15 99J3 2.32 9.62