Science - Abf8980 SM

Supplementary Materials for
Small-molecule activation of OGG1 increases oxidative DNA damage repair by

gaining a new function
Maurice Michel et al.
Corresponding authors: Maurice Michel, [email protected]; Thomas Helleday, [email protected]
Science 376, 1471 (2022)

DOI: 10.1126/science.abf8980
The PDF file includes:
Materials and Methods

Supplementary Text
Figs. S1 to S39
Tables S1 to S10
References
Other Supplementary Material for this manuscript includes the following:
MDAR Reproducibility Checklist

Movies S1 to S3
Materials and Methods
Chemical Synthesis
All reagents and solvents were purchased from Sigma-Aldrich, Combi-Blocks,
Thermo Fischer Scientific, or VWR and were used without purification. Unless otherwise
stated, reactions were performed without care to exclude air or moisture. Analytical thin-
layer chromatography was performed on silica gel 60 F-254 plates (E. Merck) and
visualized under an UV lamp. Flash column chromatography was performed in a
Biotage® SP4 MPLC system using Merck silica gel 60 Å (40–63 μm mesh). 1H and 13C
NMR spectra were recorded on Bruker DRX-400 MHz, Bruker 250, Bruker Fourier 300,
Bruker 600, Bruker 500, and Bruker Avance 400 spectrometer. Chemical shifts are
expressed in parts per million (ppm) and referenced to the residual solvent peak. For 1H
and 13C measurements, the chemical shift is referred to an internal standard; the
remaining protons or respectively the carbons of the corresponding deuterated solvent
were used. High-resolution mass spectra (HRMS) were measured with EI or ESI
ionization. A chromatographic purification was performed before each measurement. The
Thermo Q-Exactive plus device for ESI-mass spectra was coupled to a binary UHPLC
system. For EI-measurement, a GC-system was coupled to the Thermo Q-Exactive GC
device. Analytical LC–MS were performed on an Agilent MSD mass spectrometer
connected to an Agilent 1100 system with: Method ST1090A3: Column ACE 3 C8 (50 ×
3.0 mm); H2O (+ 0.1% TFA) and MeCN were used as mobile phases at a flow rate of 1
ml/min, with a gradient from 10% – 90% in 3 min; or Method B0597X3: Column Xterra
MSC18 (50 × 3.0 mm); H2O (containing 10 mM NH4HCO3; pH = 10) and MeCN were used
as mobile phases at a flow rate of 1 ml/min, with a gradient of 5% – 97% in 3 min. For
LC–MS, detection was made by UV (254 or 214 nm) and MS (ESI+). Preparative LC was
performed on a Gilson system using Waters C18 OBD 5 μm column (30 × 75 mm) with
water buffer (a) 50 mM NH4HCO3 at pH 10 or b) 0.1% TFA) and acetonitrile as mobile
phases using a flow rate of 45 ml/min. All final compounds were assessed to be >95%
pure by LC–MS analysis.
4-[4-(1H-imidazol-1-yl)phenoxy]-5-methyl-2-{octahydropyrrolo[1,2-a]pyrazin-2-
yl}pyrimidine (TH10715)
0.2 mmol (32.6 mg) of 2,4-dichloro-5-methyl-pyrimidine was dissolved in acetone
and 0.2 mmol (32.0 mg) 4-imidazol-1-ylphenol and 0.2 mmol (57.3 mg) potassium
carbonate were added. The reaction mixture was stirred at room temperature for 16
hours, quenched with concentrated NaHCO3 solution and extracted three times with
DCM. The combined organic phases were dried with Na 2SO4, filtered and concentrated
under reduced pressure. The residue was purified by RP-HPLC and the product was
isolated in 57.5% (57.3 mg) yield and directly used for the next step.
0.115 mmol (33.0 mg) of 2-chloro-4-(4-imidazol-1-ylphenoxy)-5-methyl-pyrimidine
was dissolved in isopropanol and 0.115 mmol (14.5 mg) 1,2,3,4,6,7,8,8a-
octahydropyrrolo[1,2-a]pyrazine and 0.115 mmol (14.5 mg) DIPEA were added. The
reaction mixture was refluxed for 5 hours and the solvent removed under reduced
pressure. The residue was purified by RP-HPLC (b) using a gradient of acetonitrile and
water as gradient. The product was isolated as the TFA salt in 21.0% (9.1 mg) yield.
1H–NMR (600 MHz, MeOD): δ = 8.25 (s, 1H), 8.13 (s, 1H), 7.75 (t, J = 1.3 Hz, 1H),
7.70 – 7.67 (m, 2H), 7.33 – 7.30 (m, 2H), 7.08 (bs, 1H), 3.13 (d, J = 5.1 Hz, 1H), 2.47 (dt,
2
J = 3.7 Hz, 1.8 Hz, 4H), 2.09 (s, 3H), 1.87 – 1.65 (m, 4H), 1.25 – 1.21 (m, 4H) ppm. 13C-
NMR (150 MHz, MeOD): δ = 176.6, 169.4, 169.0, 168.8, 160.5, 145.3, 145.1, 143.4,
139.6, 139.5, 132.7, 132.6, 130.7, 127.7, 127.7, 63.0, 58.2, 51.3, 30.1, 27.7, 26.4, 22.0,
21.2 ppm. HRMS [C21H24N6O]: Calc. [M+H]+ 377.2084, found 377.2083
(2S)-2-{[6-methyl-2-(phenylamino)pyrimidin-4-yl]amino}-N-phenylpropanamide
(TH10716)
0.2 mmol (32.6 mg) 2,4-dichloro-6-methyl-pyrimidine was dissolved in ethanol and
0.2 mmol (32.6 mg) (2S)-2-amino-N-phenyl-propanamide and 0.2 mmol (35 µL) DIPEA
was added. The reaction was stirred at 50 °C for 16 hours. The solvent was removed
under reduced pressure and the residue was purified using RP-HPLC (b). (2S)-2-[(2-
chloro-6-methyl-pyrimidin-4-yl)amino]-N-phenyl-propanamide was isolated in 20.6%
(12.0 mg) yield and used for the next step.
0.0413 mmol (12.0 mg) of (2S)-2-[(2-chloro-6-methyl-pyrimidin-4-yl)amino]-N-
phenyl-propanamide was dissolved in isopropanol and 0.0825 mmol (8 µL) Aniline and
0.0574 mmol (10 µL) DIPEA were added. The reaction mixture was refluxed for 16 hours,
evaporated under reduced pressure and purified by RP-HPLC (b). The product was
isolated as TFA salt in 50.9% (7.3 mg) yield.
1H–NMR (600 MHz, MeOD): δ = 9.95 (s, 1H), 8.83 (s, 1H), 7.55 (d, J = 7.3 Hz,
2H), 7.47 (d, J = 7.3 Hz, 2H), 7.15 (t, J = 7.9 Hz, 2H), 6.97 (t, J = 7.5 Hz, 2H), 6.89 (t, J =
7.5 Hz, 1H), 6.65 (t, J = 7.2 Hz, 1H), 5.81 (bs, 1H), 4.50 – 4.40 (m, 1H), 2.38 (d2.01 (s,
3H), 1.31 (d, J = 7 Hz, 3H) ppm. 13C-NMR (150 MHz, MeOD): δ = 181.8, 181.7, 172.4,
168.8, 150.8, 148.9, 138.4, 138.3, 138.1, 138.0, 132.9, 130.1, 128.8, 128.8, 128.1, 119.5,
105.7, 85.7, 75.4, 74.7, 60.1, 32.8, 30.8, 30.1, 28.00, 24.9 ppm. HRMS [C20H21N5O]: calc.
[M+H]+ 348.1819 found 348.1816
1-cyclohexyl-1-(2,4-dichlorophenyl)-2-(1H-imidazol-1-yl)ethan-1-ol (TH10840)
1 mmol (255 mg) 1-(2,4-Dichlorophenyl)-2-imidazol-1-ylethanone was dissolved in
1 mL anhydrous THF and 0.5 mL of a 1M solution of cyclohexyl magnesium bromide in
THF was added at 0 °C. The solution was allowed to warm up to room temperature, stirred
for 16 hours. The mixture was quenched with a saturated aqueous solution of NH4Cl,
extracted three times with DCM. The combined organic phases were dried with Na 2SO4,
filtered and evaporated under reduced pressure. The residue was repetitively purified
using RP-HPLC (a and b). The product was isolated as a mixture of enantiomers in 0.6%
(2.0 mg) yield. NMR contains traces of solvents acetone and dichloroethane.
1H–NMR (600 MHz, CDCl ): δ = 7.36 (s, 2H), 7.09 (d, J = 6.7 Hz, 1H), 5.11 (s, 1H),
3
4.31 (d, J = 11.7 Hz, 1H), 2.68-2.63 (m, 1H), 1.96-1.93 (m, 2H), 1.71-1.68 (m, 2H), 1.41-
0.72 (m, 11H) ppm. 13C-NMR (150 MHz, CDCl3): δ = 138.2, 134.1, 130.7, 130.6, 127.3,
42.0, 29.7, 27.3, 26.7, 26.4, 26.3, 26.1 ppm. HRMS [C17H20Cl2N2O]: calc. [M+H]+
339.1025 found 339.1018
N-cyclohexyl-2-cyclopropylquinazolin-4-amine (TH10785)
0.1 mmol (20.5 mg) 4-chloro-2-cyclopropyl-quinazoline and 50 µL cyclohexylamine
were dissolved in 1.5 mL isopropanol and stirred in a microwave reactor for 15 minutes
at 130 °C and then for 16 h at 120 °C on a heating plate. Solvents were removed and the
residue purified by RP-HPLC(b). The product was isolated as the TFA salt in 20.2% yield.
3
1H–NMR (600 MHz, CDCl3): δ = 7.81 - 7.80 (m, 1H), 7.70 (d, J = 8.4 Hz, 1H), 7.62
– 7.59 (m, 1H), 7.34 – 7.31 (m, 1H), 4.11 – 4.06 (m, 1H), 2.21 – 2.18 (m, 1H), 2.09 - 2.07
(m, 2H), 1.85 – 1.81 (m, 2H), 1.72 – 1.69 (m, 1H), 1.48 – 1.36 (m, 4H), 1.31 – 1.25 (m,
2H), 1.21 – 1.18 (m, 2H), 1.08 – 1.06 (m, 2H) ppm. 13C-NMR (150 MHz, CDCl3): δ =
167.2, 162.4, 162.1, 158.7, 133.0, 125.1, 121.6, 112.7, 50.5, 32.4, 25.6, 25.0, 17.1, 10.2
ppm. HRMS [C17H21N3]: calc. 267.1730 found 267.1727
N-cyclohexyl-2-cyclopropyl-N-methylquinazolin-4-amine (TH11735)
0.1 mmol (20.5 mg) of 4-chloro-2-cyclopropylquinazoline were dissolved in
isopropanol and 2.0 mmol (17 µL) cyclohexylamine and 2.0 mmol (20 µL) DIPEA were
added. The reaction mixture was stirred at 70 °C for 16 hours and evaporated under
reduced pressure. The residue was purified via silica gel chromatography using a gradient
of 0-15% MeOH in DCM. The product was isolated in 16.3% yield (4.6 mg).
1H–NMR (600 MHz, CDCl ): δ = 7.86 – 7.84 (m, 1H), 7.79 (d, J = 7.8 Hz, 1H), 7.64
3
– 7.61 (m, 1H), 7.30 – 7.28 (m, 1H), 4.34 – 4.29 (m, 1H), 3.16 (s, 3H), 2.21 -2.19 (m, 1H),
1.92- 1.87 (m, 4H), 1.73 – 1.71 (m, 1H), 1.66 – 1.59 (m, 2H), 1.44 – 1.36 (m, 2H), 1.17 –
1.14 (m, 2H), 0.99 – 0.97 (m, 2H) ppm. 13C-NMR (150 MHz, CDCl3): δ = 166.3, 163.7,
131.9, 127.0, 125.3 (2C), 123.1, 114.7, 59.5, 34.0, 29.9, 25.8, 25.7, 17.9, 9.4 ppm. HRMS
[C18H23N3]: calc. 281.1886 found 281.1886
4-(cyclohexyloxy)-2-cyclopropylquinazoline (TH11738)
1.0 mmol (205 mg) of 4-chloro-2-cyclopropylquinazoline was dissolved in DMF
and 2.0 mmol (19 µL) cyclohexanol and 3.0 mmol (115 mg; 60% dispersion in mineral oil)
NaH were added at 0 °C. The reaction mixture was allowed to warm up to room
temperature and was stirred for 16 hours. The reaction was quenched with saturated
aqueous solution of NH4Cl solution and extracted three times with DCM. The combined
organic phases were dried with Na2SO4, filtered and evaporated under reduced pressure.
The residue was purified via silica gel chromatography using a gradient of 0-15% MeOH
in DCM. The product was isolated in 5.9% yield (4.6 mg).
1H–NMR (600 MHz, CDCl ): δ = 8.09 (dd, J = 8.1 Hz, 0.7 Hz, 1H), 7.85 – 7.80 (m,
3
1H), 7.76 – 7.74 (m, 1H), 7.43 (t, J = 7.9 Hz, 1H), 5.34 – 5.29 (m, 1H), 2.04 – 2.02 (m,
2H), 1.87 – 1.82 (m, 2H), 1.72 – 1.67 (m, 2H), 1.63 - 1.59 (m, 2H), 1.52 – 1.46 (m, 2H),
1.20 – 1.18 (m, 2H), 1.06 – 1.04 (m, 2H) ppm. 13C-NMR (150 MHz, CDCl3): δ = 167.7,
166.3, 133.3, 126.4, 125.3, 123.6 (2C), 115.2, 74.4, 31.4 (2C), 25.6 (2C), 23.6, 18.3, 9.8
(2C) ppm. HRMS [C17H20N2O]: calc. 268.1570 found 268.1572
4-(cyclohexylmethyl)-2-cyclopropylquinazoline (TH11873)
0.1 mmol (205 mg) of 4-chloro-2-cyclopropylquinazoline were dissolved in dioxane
and 0.01 mmol (11.5 mg) tetrakis(triphenylphosphine)-palladium(0), 0.3 mmol (41.4 mg)
potassium carbonate and 0.15 mmol (14.2 mg) cyclohexylmethyl-boronic acid were
added. The reaction mixture was stirred for 16 hours at 90 °C and filtered over Celite. The
filtrate was concentrated under reduced pressure and the residue purified via silica gel
chromatography using a gradient of 0-15% MeOH in DCM. The product was isolated in
16.5% yield (4.4 mg).
1H–NMR (600 MHz, CDCl ): δ = 8.03 (d, J = 8.5 Hz, 1H), 7.90 – 7.88 (m, 1H), 7.80
3
– 7.76 (m, 1H), 7.50 – 7.46 (m, 1H), 3.06 (d, J = 7.0 Hz, 2H), 2.37 – 2.31 (m, 1H), 1.99 –
4
1.93 (m, 1H), 1.74 – 1.62 (m, 3H), 1.47 – 1.39 (m, 2H), 1.32 – 1.07 (m, 5H), 1.00 – 0.89
(m, 2H), 0.77 – 0.75 (m, 2H) ppm. 13C-NMR (150 MHz, CDCl3): δ = 133.1, 128.9, 128.2,
125.6, 124.9, 122.6, 115.5, 41.9, 38.2, 36.0, 34.6, 33.5, 26.5, 26.4, 26.2, 18.5, 10.3 ppm.
HRMS [C18H22N2]: calc. [M+H]+ 267.1856 found 267.1855
N-cyclohexyl-3-cyclopropylisoquinolin-1-amine (TH12119) was synthesized according to

the protocol reported here.(25)
N-cyclohexyl-2-cyclopropylquinolin-4-amine (TH12115)
1 mmol (198 mg) 2,4-Dichloro-quinoline was dissolved in 2 mL Cyclohexylamine
and stirred at 70 °C for 16 hours. The solvent was removed in vacuo and the residue was
dissolved in 1.5 mL 1.0 M Cyclopropylmagnesiumbromide solution in THF. The reaction
mixture was stirred under nitrogen atmosphere in a microwave and at 140 °C for 14 hours.
The solvents were removed and the residue was dissolved in DCM and extracted three
times from saturated sodium bicarbonate solution. The combined organic phased were
dried with Sodium sulfate, filtered and the solvent removed in vacuo. The residue was
purified by reverse phase HPLC (a and b). Pure fractions were combined to give the
product in 0.2% (0.5 mg) yield over two steps.
1H–NMR (400 MHz, CDCl ): δ = 8.12 (d, J = 8.1 Hz, 1H), 7.83 (d, J = 8.2 Hz, 1H),
3
7.69 – 7.65 (m, 1H), 7.43 – 7.39 (m, 1H), 6.48 (s, 1H), 3.70 – 3.67 (m, 2H), 3.50 – 3.43
(m, 1H), 2.40 – 2.34 (m, 1H), 2.03 – 2.00 (m, 2H), 1.91 – 1.87 (m, 2H), 1.71 – 1.26 (m,
7H), 0.93 – 0.89 (m, 2H) ppm. 13C-NMR (100 MHz, CDCl3): δ = 157.7, 152.5, 137.5,
132.6, 124.5, 124.4, 121.4, 118.6, 104.6, 52.3, 32.4, 24.9, 24.8, 13.4, 8.3 ppm. HRMS
[C18H22N2]: calc. [M+H]+ 267.1856 found 267.1856
N-cyclohexyl-3-cyclopropylnaphthalen-1-amine (TH12120)
2-bromoacetophenone (27 µL, 0.2 mmol), cyclopropylacetylene (10 µL, 0.12
mmol), N-cyclohexylformamide (26.3 mg, 0.21 mmol), sodium hydroxide (10.6 mg, 0.27
mmol) and copper iodide (2.5 mg, 0.014 mmol) were added to 1 mL of H2O. The reaction
tube was flushed with nitrogen, sealed, and the mixture was stirred at 120 °C for 2 days.
The solution was then diluted with distilled water and extracted with EtOAc (4 × 15 mL).
Combined organic layers were washed with brine, dried over sodium sulfate and
concentrated under reduced pressure. The crude residue was purified by silica gel
column chromatography using EtOAc/Hex as mobile phase to yield 1-cyclohexylamine-
3-cyclopropylenaphthalene (9.2 mg, 0.035 mmol, 29%).
1H–NMR (400 MHz, CDCl ): δ = 8.02 – 7.99 (m, 1H), 7.69 – 7.67 (m, 1H), 7.46 –
3
7.39 (m, 2H), 7.31 (bs, 1H), 7.09 (d, J = 1.8 Hz, 1H), 3.41 – 3.34 (m, 1H), 1.98 – 1.95 (m,
2H), 1.84 – 1.79 (m, 1H), 1.75 – 1.69 (m, 2H), 1.59 – 1.50 (m, 3H), 1.15 – 1.10 (m, 2H),
0.99 – 0.94 (m, 2H), 0.67 – 0.63 (m, 2H) ppm. 13C-NMR (100 MHz, CDCl3): δ = 141.3,
134.3, 130.6, 127.9, 126.8, 126.2, 124.5, 124.1, 120.9, 119.8, 61.5, 29.6, 24.8, 24.7, 15.3,
9.6 ppm. HRMS [C19H23N]: calc. [M+H]+ 266.1903 found 266.1904
N-cyclohexyl-2-cyclopropylpyrimidin-4-amine (TH12117)
0.1 mmol (14.9 mg) 2,4-dichloropyrimidime was dissolved in 2 mL isopropanol and
11.5 µL (0.1 mmol) cyclohexylamine were added. 20 µL DIPEA was added and the
reaction stirred at 80 °C for 16 hours. The solvent was evaporated and the residue dried
5
under high vacuum. The resulting solid was dissolved in 1.5 mL 1M Cyclopropyl-
magnesium-bromide in THF and stirred at 140 °C for 16 hours in a microwave. The
reaction was quenched with saturated aqueous NH4Cl solution, extracted three times with
DCM, the combined organic phases dried, filtered and evaporated. The residue was
purified several times using RP-HPLC (b). The product was isolated in 10.9% yield as its
TFA salt.
1H–NMR (500 MHz, CDCl ): δ = 6.10 (d, J = 11.6 Hz, 1H), 5.39 (dd, J = 11.6 Hz,
3
10.7 Hz, 1H), 3.95 – 3.88 (m, 1H), 2.05 – 2.02 (m, 2H), 1.76 – 1.72 (m, 2H), 1.70 – 1.63
(m, 2H), 1.46 – 1.37 (m, 2H), 1.27 – 1.19 (m, 2H), 1.01 – 0.97 (m, 2H), 0.64 – 0.61 (m,
2H) ppm. 13C-NMR (125 MHz, CDCl3): δ = 167.8, 167.7, 146.1, 119.3, 50.9, 32.4, 25.4,
24.6, 12.0, 8.7 ppm. HRMS [C13H19N3]: Calc. [M+H]+ 218.1652, found 218.1652
2-cyclopropyl-N-(4-iodophenyl)quinazolin-4-amine (TH12161)
4-chloro-2-cyclopropylquinazoline (21.2 mg, 0.103 mmol) and 4-iodoaniline (26.5
mg, 0.121 mmol) were dissolved in isopropanol (2 mL) and DIPEA (35 µL) was added
and obtained solution was stirred overnight at 80 °C. The solvent was then removed from
the mixture under reduced pressure and the crude solid was dissolved in minimum
amount of MeCN/H2O to purify the compound with RP-HPLC (b) to afford target
compound (11.5 mg, 0.030 mmol, 29% yield.)
1H–NMR (400 MHz, MeOD): δ = 8.52 (dd, J = 8.3, 0.6 Hz), 8.06 (ddd, J = 8.3, 7.0,
1.3 Hz), 7.85 – 7.78 (m, 4H), 7.48 (dd, J = 8.3, 0.9 Hz), 2.25 – 2.21 (m, 1 H), 1.36 – 1.32
(m, 2 H), 0.95 – 1.00 (m ,2H) ppm. 13C-NMR (100 MHz, CDCl3 & MeOD): δ = 167.9,
157.4, 150.0, 138.6, 137.5 (2C), 133.0, 127.0, 125.3, 122.9 (2C), 120.7, 113.5, 86.6, 18.1,
9.6 ppm. HRMS [C18H15IN2]: calc. [M+H]+ 388.0305 found 388.0307
MALDI-TOF-MS
MALDI-TOF-MS data were acquired using an ultrafleXtreme spectrometer from
Bruker Daltonics (MS scan range: 5000–20,000 m/z reflector positive mode or 20,000–
70.000 m/z, linear positive mode) equipped with an ultraviolet laser (smartbeam-II laser
of 1,000 Hz, laser power: 20–50%). Desorption and ionization was performed with the
assistance of a matrix. For the analysis of OGG1 and OGG1-DNA complex, Sinapinic
acid (Bruker, MALDI grade) was prepared as a saturated solution dissolved in 0.1
%TFA:acetonitrile (2:1 v/v); for the DNA alone, 3-hydroxy picolinic acid (Bruker, MALDI
grade) was dissolved to 50 mg/ml in water:acetonitrile (1:1 v/v). Calibration of the
acquisition method in reflector positive mode was performed using Peptide Calibration
Standard II (Bruker Daltonics) containing Bradykinin1–7, Angiotensin II, Angiotensin I,
Substance P, Bombesin, ACTH clip1–17, ACTH clip18–39, and Somatostatin 28.
Calibration of the acquisition method in linear positive mode was performed using a
mixture of Protein Calibration Standards I and II (Bruker Daltonics) containing Insulin,
Ubiquitin I, Cytochrome C, Myoglobin, Trypsinogen, Protein A and Albumin-Bovine.
Spectral data were processed using the flexAnalysis software from Bruker Daltonics and
visualized in OriginLab.
Target engagement assays

Differential scanning fluorimetry (DSF) was essentially performed as mentioned
here.(14) CETSA was performed as here.(19) In brief, U2OS cells were plated to reach
6
70-80% confluence. The following day, cells were treated with DMSO or TH10785 (20
µM) for 2 h at 37 °C. Cells were then washed, trypsinized and resuspended in growth
media. 8+ul cells were aliquoted into PCR tubes and subjected to heating conditions 37
°C-62 °C for 3 minutes. Samples were then lysed using RIPA buffer, centrifuged and the
lysate was collected and stored at −80 °C, until further analysis by western blot.
All equilibrium binding kinetics for affinity estimations were done on a JASCO J-1-1500
CD spectrophotometer with a Peltier temperature control system at 25 °C, in 10 mM
potassium phosphate pH 7.6, 5-15 % DMSO. Prior to performing binding experiments, all
compounds were dissolved in 5-15 % DMSO. Varied concentrations of compound (0 to
250 µM) plus a fixed amount (1 µM) of OGG1 were premixed and allowed to equilibrate
at room temperature for 30 minutes. The excitation wavelength was set to 290 nm
(excitation slit width 1 nm) and emission was measured between 300-400 nm (emission
slit width 5 nm). Curve fitting was done using KaleidaGraph 4.5.2. The standard equation
(see below) describing the equilibrium binding of two molecules was used for affinity
estimation.(18) FL = [ ([P]0 +KD + n)/2 – SQRT ([P]0 +KD + n)^2 /4 -([P]0n] x B + C; FL is
fluorescence change, [P]o and n are the total concentrations of the varied and non-varied
species respectively, KD is the equilibrium dissociation constant and B and C are
constants that take into consideration the total signal change and the signal at ([P]0 = 0),
respectively. The error for TH10785 was estimated from an average of three independent
measurements while the errors from the other compounds were estimated from the curve
fit.
Biochemical assay
The biochemical assay for NEIL1 was performed as mentioned here.(14) For
OGG1 and UNG2, the biochemical assay was based on the publication by Visnes et al.(3)
and “EUbOPEN” protocols and where mentioned adapted thereof using different pH, salt
content, EDTA additive or proteins.
In silico experiments
Protein preparation: PDB files were imported to Maestro Suite (Schrödinger 2019-
3) and prepared using the Protein Preparation Wizard. In brief, bond orders were
assigned, hydrogens were added, disulfide bonds were generated, missing side chains
and loops were filled using Prime and het states were generated using Epik for pH 7.0 ±
2.0. Afterwards, the structure was manually fixed upon problem identification. H-bond
assignments were performed, waters removed beyond a 3.0 Å radius of het groups and
a restrained minimization was performed using the OPLS3e force field, converging the
heavy atoms to an RMSD of 0.30 Å.
Ligand preparation: structures were exported as sdf from ChemDraw and imported into
the Maestro Suite. Using the OPLS3e force field, possible states at a pH 7.0 ±2.0 were
generated using Epik. Specific stereogenic centers were retained and a maximum of 32
species per ligand were kept.
Homology modelling: the structures were prepared as mentioned above and homology
modelling was performed using Prime by building a knowledge-based model based on
the FASTA sequence of the protein. Gaps were filled, rotamers retained, side chains
optimized and the protein preparation wizard rerun.
7
Induced-Fit docking: PDB 1HU0 was prepared as above and the Schiff base was
modelled into the structure and minimized again. The bound ligand was chosen as the
center of the docking grid, ring conformations were sampled at an energy window of 2.5
kcal/mol, Prime refinement was performed within 5.0 Å of ligand poses, side chains were
optimized and Glide redocking performed within 30 kcal/mol of the best pose and within
the top 20 structures using XP. No constraints were applied.
pKa predictions: pKa predictions were carried out within the Schrödinger Suite 2020-2
using the Epik module. States were predicted for aqueous conditions with a pH of 7 ± 2,
tautomers were generated where applicable and the number of output structures was
limited to 16. In the structures shown in Fig. S16 atom positions are highlighted and
correspond to the pKa values listed for the most common tautomers.
Molecular dynamics: molecular dynamics studies were performed with Desmond as
implemented in Schrödinger Suite 2019-3. The function system builder was performed
using SPC, a minimized orthorhombic box shape, structure neutralization adding Chloride
ions, addition of 0.15 M sodium chloride and the OPLS3 force field. Molecular dynamics
simulation was then performed using the generated system, with a simulation time of 500
ns, ensemble class NPT, a temperature of 310 K and a pressure of 1.01325 bar. The
system was relaxed before simulation.
Proteins and reagents for EMSA

Unlabeled nucleotides were purchased from GE Healthcare. [α 32P]-Cordycepin (3'-
dATP) and [γ32P]-ATP were obtained from Perkin Elmer Life Sciences. Substrates were
radiolabeled at the 3' end with [α32P]-Cordycepin and terminal deoxynucleotidyl
transferase (TdT) or at the 5' end with [γ32P]-ATP and T4 polynucleotide kinase (T4PNK).
TdT, T4PNK, human AP endonuclease I (hAPE1), E. coli Uracil DNA Glycosylase (UDG),
E. coli Endonuclease III (EndoIII) and T4 DNA ligase were from New England Biolabs.
Bacillus subtilis exonuclease deficient DNA polymerase X (PolX) was purified as
described in (17).
Oligonucleotides
The oligonucleotides were purchased from IdT. Oligonucleotide 5'-
CTGCAGCTGATGCGCUGTACGGATCCCCGGGTAC was 3'-labelled and further
hybridized to the complementary oligonucleotide 5'-
GTACCCGGGGATCCGTACGGCGCATCAGCTGCAG for both, the AP lyase activity
assays on AP sites, and the NaBH4 trapping assays. Oligonucleotide
5´GTACCCGGGGATCCGTAA8GCGCATCAGCTGCAG, where 8 stands for 8oxodG,
was 5'-labelled and further hybridized to the complementary oligonucleotide 5'-
CAGCAGCTGATGCGCCTTACGGATCCCCGGGTAC to perform the Electrophoretic
mobility shift assays (EMSA) and the AP lyase activity assays on 8oxoG/C containing
DNAs. The dsDNA molecules were obtained by hybridizing the indicated oligonucleotides
in the presence of 60 mM Tris-HCl (pH 7.5) and 0.2 M NaCl and heating to 80 ºC for 5
min before slowly cooling to room temperature overnight.
NaBH4 trapping assay

The reaction was carried out in a final volume of 12.5 µL. A concentration of 1 nM of
the indicated 3' labeled hybrid was treated with 0.2 U of E. coli UDG for 15 min at 37 °C
8
in the presence of 30 mM Hepes, pH 7.5, 4% glycerol to leave an intact AP site (presence
of AP site in Fig. S7). The DNA was further incubated with 100 nM of either the wild-type
or mutant K249Q hOGG1 in the presence of either 10% DMSO or 6.25 µM TH10785. The
Schiff base intermediates were trapped by the addition of 100 mM NaCl or freshly
prepared NaBH4. After incubation for 20 minutes on ice followed by an additional
incubation during 5 min at 37 ºC, samples were analyzed by 10% SDS-PAGE followed
by autoradiography of the dried gel. When indicated, the assay was performed with 1 nM
of intact 3' labeled hybrid (absence of AP site in Fig. S7).
In vitro repair of 8oxodG containing DNA by hOGG1

The incubation mixture contained in a final volume of 25 µL 30 mM Hepes, pH 7.4,
4% glycerol, 2 mM MgCl2,1 nM of the 5' labeled 8oxodG containing DNA, 50 nM hOGG1
and, when indicated 0.2 U hAPE1 that hydrolyzes the 5' phosphodiester bond of both, the
AP site and the 3'-PUA end generated by the glycosylase and AP-lyase activities of
OGG1, respectively, releasing a 5' product with a 3'-OH end. After incubation for 30 min
at 37 ºC, reactions were either stopped or further incubated 10 min at 37 ºC in the
presence of the indicated protein (PolX (50 nM) +100 µM dGTP, 0.2 U hAPE1, 0.2 U T4
PNK, 1 U T4 DNA ligase), as indicated. Reactions were stopped with 10 mM EDTA, and
reaction products were analyzed by 7M urea-20% PAGE and autoradiography.
Electrophoretic Mobility Shift Assays (EMSA)

The incubation mixture contained in a final volume of 20 µL, 30 mM Hepes, pH 7.4,
4% glycerol, 1 nM of the [32P]5’-labeled 8oxodG:C containing substrate with increasing
concentrations of hOGG1 (0.2, 0.3, 0.6, 1.2, 2.5, 5 and 10 nM), in the presence or either
10% DMSO or 6.25 µM TH10785, as indicated. Samples were analyzed by 6% PAGE.
After gel electrophoresis, the mobility of free dsDNA and the hOGG1-DNA complex was
detected by autoradiography.
AP lyase activity assay on AP site- and 8oxodG-containing substrates

Analysis of the AP lyase activity of hOGG1 on AP sites-containing dsDNA. 1 nM
of the 34mer [32P]3’-labeled uracil-containing substrate was incubated with 0.2 U of E.
coli UDG during 15 min at 37 ºC to obtain a natural AP site, in the presence of 30 mM
Hepes, pH 7.5, 4% glycerol and 20 mM EDTA. After incubation the mixture was
supplemented with either 25 nM hOGG1 or 3.5 nM of EndoIII, and either 10% DMSO or
6.25 µM TH10785, as indicated. Samples were incubated at 30 ºC for the indicated times
and the reaction products were stabilized by incubation with 30 mM of freshly prepared
NaBH4 for 20 min on ice. Stabilized (reduced) DNA products were analyzed by 7 M urea-
20% PAGE and autoradiography. The product (in fmol) yielded by the AP lyase activity
of hOGG1 was plotted against the incubation time and fitted to an exponential equation
by least-squares nonlinear regression.
To analyze the AP activity of hOGG1 on 8oxoG containing substrates, 1 nM of the
indicated 34mer [32P]5’-labeled 8oxoG-containing substrate was incubated with 25 nM
hOGG1 and either 10% DMSO or 6.25 µM TH10785, in the presence of 30 mM Hepes,
pH 7.5, 4% glycerol and 20 mM EDTA. Samples were incubated at 30 ºC for the indicated
times and the reaction products were stabilized by incubation with 30 mM of freshly
9
prepared NaBH4 for 20 min on ice. DNA products were analyzed by 7 M urea-20% PAGE
and autoradiography.
Recombinant Proteins
APE1, hOGG1, mOGG1 and NEIL1 were expressed as here.(3, 14) UNG2 was
expressed from the pET28a vector and purified as described here (3). OGG1 mutants
were generated using site directed mutagenesis on the pNIC OGG1-His6 wild type
plasmid used for expression of the protein as described before.(3) Fpg was obtained
commercially (New England Labs).
X-ray crystallography
Samples for co-crystallization of hOGG1 with the ligand were prepared by pre-
incubation of hOGG1 (18 mg/ml) with 2-4 mM of the ligand (from a stock solution of 100
mM in DMSO). Crystals of the hOGG1:TH10785 complex were obtained from a hanging-
drop vapor diffusion setup against 0.12 M Alcohols, 0.1 M Buffer System 2 pH 7.5 and 48
% v/v Precipitant Mix 4 (Morpheus screen, Molecular Dimensions, UK). A drop of 2 µl of
sample was mixed with equal amount of reservoir and incubated at 20 °C. Crystals grew
within 24 hours and were frozen in liquid nitrogen for data collection.
Crystals of the mOGG1:TH10785 complex were obtained from a sitting-drop vapor
diffusion setup against 0.06 M Divalents, 0.1 M Buffer System 3 pH 8.5 and 30 % v/v
Precipitant Mix 2 (Morpheus screen, Molecular Dimensions, UK). A drop of 100 nl of
within 3 days and were frozen in liquid nitrogen for data collection.
Crystals of the mOGG1:TH12161 complex were obtained from a sitting-drop vapor
diffusion setup against 0.12 M Alcohols, 0.1 M Buffer System 2 pH 7.5, 30% v/v
Precipitant Mix 2 (Morpheus screen, Molecular Dimensions, UK). A drop of 100 nl of
within 3 days and were frozen in liquid nitrogen for data collection.
Diffraction data were collected at stations I04-1 and I04 of the Diamond Light Source
(Oxon, UK). Complete datasets were collected from single crystals at 100 K for each
complex. Raw data images were processed and scaled with xia2, DIALS, and Aimless
using the CCP4 suite 7.0. Molecular replacement was performed with the coordinates of
human or mouse OGG1 (PDB code 6RLW and 6G3X, respectively), to determine initial
phases for structure solution in Phaser. The working models were refined using Refmac5
and manually adjusted with Coot Validation was performed with Molprobity.
Crystallographic data statistics are summarized in Table S4. Figures were drawn with
PyMOL (Schrödinger, LLC, New York). The atomic coordinates and structure factors
(codes 7AYY, 7AYZ, 7AZ0) have been deposited in the Protein Data Bank
(http://wwpdb.org).
Fluorescence recovery after photobleaching (FRAP), 8-oxoG Immunofluorescence and

microirradiation.
Fluorescence recovery after photobleaching (FRAP), 8-oxoG
Immunofluorescence and microirradiation were performed as previously described in
Hanna et al. (27).
10
Quantitative Microscopy
For quantitative microscopy in Fig. 2H, cells were seeded on a 24 well plate. Every
well contained a sterilized coverslip in the bottom. Attached cells were pre-treated with
TH10785, TH5487 or DMSO for 16 h (overnight), using a drug concentration of 10 µM in
all cases. Cells were exposed to 20 mM of KBrO3 (Sigma-Aldrich CAS 7758-01-2) for 1 h
in the presence or absence of compounds. Afterwards, fresh media containing
compounds or not was added. At this point ARP (N-(aminooxyacetyl)-N'-(D-Biotinoyl)
hydrazine (ref: A10550) was added in a concentration of 1 mM for a period of 3 h. Before
fixation, cells were pre-extracted with 0.2% Triton X-100 in PBS (Sigma) for 2 min (pre-
extraction). Cells were fixed with 4% paraformaldehyde (PFA; Agar scientific) for 10 min.
After washing with PBS (Sigma), cell permeabilization was performed with 0.5% Triton X-
100 (Sigma) in PBS for 15 min. Blocking with 3% Bovine Serum Albumine (BSA; Sigma)
in PBS for 1 h was followed by staining with primary and secondary antibodies and 0.5
µg/ml 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI; Sigma). After each staining,
a washing step three times (10 min in PBS each time). Primary antibodies for anti-γH2AX
(Millipore, 05-636, 1:1000). In the case of ARP-biotinylated probe was visualized by an
incubation with Streptavidin FITC Conjugate antibody (Ebioscience streptavidin FITC 11-
4317-87). Image acquisition was performed with a microscope Nikon Eclipse 90i 40x lens.
Image treatment was done with ImageJ software. Fluorescence signal intensity and the
nº of γH2AX foci per cell nuclei were determined using Cell Profiler software and plotted
using GraphPad Prism. (*No data quantification of ARP_FITC is shown in the body of the
manuscript, only γH2AX foci per nuclei.)
For quantitative microscopy in Fig. 3A and Fig. S26 cells were seeded on a 24 well
plate. Every well contained a sterilized coverslip in the bottom. Once cells were attached,
they were treated for 24 h with DMSO, TH10785 and TH5487, alone or in combination
with PNKP1i (A12B4C3) at the indicated concentration. Before fixation, cells were pre-
extracted with 0.2% Triton X-100 in PBS (Sigma) for 2 min (pre-extraction). Cells were
fixed with 4% paraformaldehyde (PFA; Agar scientific) for 10 min. After washing with PBS
(Sigma), cell permeabilization was performed with 0.5% Triton X-100 (Sigma) in PBS for
15 min. Blocking with 3% Bovine Serum Albumine (BSA; Sigma) in PBS for 1 h was
followed by staining with primary and secondary antibodies and 0.5 µg/ml 4′,6-Diamidino-
2-phenylindole dihydrochloride (DAPI; Sigma). After each staining, a washing step three
times (10 min in PBS each time). Primary antibodies for anti-γH2AX (Millipore, 05-636,
1:1000) and an anti-53BP1 antibody (Abcam, ab36823, 1:1000). Image acquisition was
performed with a microscope Nikon Eclipse 90i 40x lens. Image treatment was done with
ImageJ software. Nuclear signal intensity for γH2AX and 53BP1 as well as the nº of
γH2AX foci per cell nucleus were determined using Cell Profiler software and plotted
using GraphPad Prism.
For quantitative microscopy in Fig. 3B, U2OS cells were seeded on 96-well plates (4000
cells/well, Corning CLS3904) using 100 µl of Dulbecco’s Modified Eagle Medium (DMEM;
Gibco) that had been supplemented with 10% of fetal bovine serum (FBS; Gibco) and
100 U/mL penicillin–streptomycin (Gibco). Cells were treated for 24 h with DMSO,
TH10785 (1 µM or 10 µM), PNKP1i (10 µM)(23) or TH10785 + PNKP1i (1+10 µM or
10+10 µM). Subsequently, cells were fixed using 4% formaldehyde for 20 min,
permeabilized with 0.5% Triton X-100 for 5 min followed by 1 h blocking using a blocking
buffer of 4% bovine serum albumin (BSA, Sigma Aldrich). Cells were probed with an anti-
11
53BP1 antibody (Abcam, ab36823, 1:1000). DNA was stained with DAPI. Images were
taken with an Image Xpress Micro (Molecular Devices) microscope using a 20X lens.
Fluorescence signal intensity per cell nucleus were determined using Cell Profiler
software and plotted using GraphPad Prism.
Comet Analysis
Cells were suspended in 0.5% low melting point agarose in PBS and transferred
onto a frosted glass microscope slide pre-coated with a layer of 0.5% normal melting point
agarose. Slides were immersed in lysis solution (2.5 mol/L NaCl, 100 mmol/L EDTA,10
mmol/L Tris, 1% sodium lauryl sarcosinate, 10% DMSO, and 1% Triton X-100 (pH 10) at
4 °C overnight. Cells were washed with enzyme assay buffer (40 mM HEPES pH 8.0, 0.1
M KCl, 0.5 mM EDTA and 0.2 mg/ml BSA) three times and incubated in enzyme assay
buffer with/without purified human OGG1 enzyme for 30 min at 37 °C. Electrophoresis
buffer (0.3 mol/L NaOH and 1 mmol/L EDTA) was pre-cooled to 4 °C and slides were
incubated in electrophoresis buffer for 20 min. Electrophoresis was run at 300 mA, 25 V
for 30 min in a Comet Assay tank (Thistle Scientific). Slides were washed in neutralization
buffer (0.4 M Tris-HCl pH 7.5) and counterstained with 5 mM YOYO-1 dye (Invitrogen).
Images were acquired with a 20x objective in a Zeiss LSM 510 confocal microscope and
tail moment was quantified using Comet IV software. At least 200 comets per sample
were analyzed.
Genomic 8-oxoG analysis

2.5 × 106 U2OS cells were seeded in 15 cm dishes, incubated overnight and treated
with 20 mM KBrO3 for 1 h in serum-free medium. Cells were washed once with PBS and
added complete medium supplemented with 10 µM TH5487, 10 µM TH10785, 1 µM
TH10785, or 0.1% DMSO as vehicle control. After incubation at 37 °C with 5% CO2 for
the indicated times, cells were harvested by cell scraping. Genomic DNA was then
purified and the content of 8-oxo-dG and canonical deoxynucleosides were quantified
with LC-MS/MS as previously described (3).
DNA extraction and quantification of oxidized bases in specific genome regions by

qPCR
DNA was extracted from cultured cells using the Flexigene® DNA Kit (Qiagen)
following the manufacturer’s instructions and quantified by Nanodrop. We have adapted
the telomere oxidation protocol previously described (20) to quantify the relative
accumulation of oxidized bases at specific genomic regions by incubating the DNA with
hOGG1protein, which was purified as previously reported. In this case, evaluated
telomeres or G-4 quadruplex forming sequence at the MYC promoter(G4_MYC). As a
negative control, we included region within the MYC promoter that lies outside the G-4
quadruplex forming sequence (NO/G4_MYC).
This is a qPCR method which is based on differences in PCR kinetics between template
DNA digested by OGG1 and undigested DNA. This enzyme recognizes and cuts 8-oxoG,
producing abasic sites that are converted in SSBs by its AP lyase activity. These SSBs
inhibit the PCR, thus, the ΔCt after digesting DNA by OGG1 (Ct digested–Ct undigested)
is proportional to the oxidative damage in the amplified region. Conditions used for
incubation were 5 μM hOGG1 and during 3 h in DNA glycosylase buffer (25 mM Tris-HCl,
12
15 mM NaCl, 2 mM MgCl2, 0.0025% Tween at pH=8). The reaction was stopped by
incubating at 95 ºC for 5 min. qPCR analysis was performed on 40 ng of digested or
undigested genomic DNA. Each qPCR was performed in triplicate including no-template
controls in an Abi QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems)
Primers used are listed in Table S5. Three independent experiments were included for
each condition and analyzed in triplicate.
Relative AP-site quantification by FACS

A total of 100.000 cells were seeded in a p35 petri dish. Attached cells were pre-
treated with TH10785, TH5487 or DMSO for 16 h (overnight), using a drug concentration
of 10 µM in all cases. Cells were exposed to 20 mM of KBrO3 for 1 h in the presence of
compounds or vehicle (DMSO). Afterwards, fresh media containing compounds or DMSO
was added. At this point ARP (N-(aminooxyacetyl)-N'-(D-Biotinoyl) hydrazine (ref:
A10550) was added in a concentration of 1 mM, for a period of 3 h. Finally, cells were
fixed and permeabilized using eBioscience™️ Foxp3 / Transcription Factor Staining Buffer
Set according to the manufacturer instructions (00-5523-00). Next, cells were incubated
with Streptavidin FITC Conjugate antibody (1:200). Labelled cells were analyzed in a
FACS Celesta (BD) and each condition was run in biological triplicates. FloJo software
analysis was used to calculate the ARP-Streptavidin-FITC geometrical mean signal
intensity. Graphs were plotted using Graphpad Prism.
Cell culture and maintenance

U2OS cells were cultured in DMEM (Lonza or Gibco) growth medium
supplemented with 10% of fetal bovine serum (Biowest) and 100 U/ml penicillin-
streptomycin (Gibco) and grew at 37 °C in a 5% CO2 atmosphere. To induce oxidative
DNA damage, cells at about 80% of confluence were treated with KBrO 3 (Sigma) at the
concentration indicated in serum-free DMEM for the indicated periods. Cell line
authentication was performed by STR27 Profiling, and mycoplasma testing was
performed regularly.
RNA sequencing and analysis

U2OS cells were treated with 10 µM TH10785, 10 µM PNKP1i, 10 µM TH10785 +
10 µm PNKP1i or DMSO for 24 h (biological replicates n = 3). RNA was extracted using
RNA was extracted from cultured cells using TRIzol® Reagent (Thermo Fisher Scientific)
following the manufacturer’s instructions. Library preparation and library sequencing was
performed by Novogene Co., LTD (Beijing China). Briefly, library prep was performed
using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) following the
manufacturer’s instructions to construct 250~300 bp insert cDNA libraries. Libraries were
sequenced by the Novogene Bioinformatics Institute as 150-bp paired-end reads on an
Illumina Novaseq 6000 platform. The quality of raw reads was first assessed using
Novogene in-house script. Clean reads were obtained for further analysis after removing
reads with low quality, adapter sequence and poly-Ns. Clean Reads were aligned to the
human genome (Homo Sapiens, GRCh38/hg38) with HiSat2 (v2.0.5). The number of
mapped reads was determined with HTSeq (v0.6.1). Gene Counts were normalized using
DESeq2 (v1.30.1, default settings) and annotated using AnnotationHub (v2.22.1,
Shepherd MMaL. AnnotationHub: Client to access AnnotationHub resources. R package.
13
2021.). Gene sets were retrieved using msigdbr (v7.4.1, Dolgale I. msigdbr: MSigDB
Gene Sets for Multiple Organisms in a Tidy Data Format. R package. 2021.). Heatmaps
were plotted using ComplexHeatmap (v2.6.2).
Data and Code availability

Transcriptome data have been deposited at the Gene Expression Omnibus with the
accession number GSE188779. The code used for the RNA sequencing analysis is
available from the authors upon request.
Statistical Methods
Statistical method is described in the caption for each of the figures containing any
statistics. In brief, statistical differences between groups in the comparatives analyses
were addressed by using two-tailed unpaired t-test or Mann-Whitney analysis, for
parametric or non-parametric distributions, respectively. Kolmogorov-Smirnov test was
used to test Normality for each analysis. (p<0.05, do not pass Normality test). Rout
method from GraphPad Software for outlier identification/exclusion was applied for Fig.
2H (8 values excluded out of 146); Fig. 3A (4 values excluded out of 107); Fig. S26A (212
values excluded out of 9073) Fig. S26B (183 values excluded out of 7522). Fig. S25 (1019
values excluded out of 53356).
Supplementary Text
Structure Activity Relationship and biochemical benchmark
Structure-Activity-Relationship studies were performed by systematically removing
heteroatoms and interacting structural motifs. The resulting compounds were interrogated
for their activity enhancement in the fluorescent assay for their AC50 or AC20 and target
engagement in DSF. The AC50 or AC20 is the concentration at which the compounds
progress the assay to 50% or 20% of the endpoint of a full turnover coupled assay with
APE1 (2nM). APE1 concentration was used for practicable assay times of about 1h,
changing APE1 or OGG1 content would alter the measured AC50 (Fig. S14-S16). KD was
determined by fluorescence spectroscopy for negative control TH11738 and activating
molecules TH10785, TH12117, 8-BrG and TH12161. Products for β- and β,δ-elimination
were investigated for the same compounds (all Details see Table S6). TH12161 as an
inhibitor-activator chimera (TH5487 and TH10785) was also co-crystallized (Fig. S14,
S18). Assays performed as below and in method section.
14
Fig. S1.
50
TH10785
TH10840
48
TH10715
Tm in C
46 TH10716
44
DMSO
42
1×10 -6 1×10 -5 1×10 -4 1×10 -3
Concentration log[M]
Differential Scanning Fluorimetry of four reported molecular enhancers of OGG1

function: Compound A - TH10716, Compound B - not synthesized, Compound C -
TH10785, Compound D - TH10715, Compound E - TH10718 (rapid decomposition),
Compound F - TH10840;(4) 4 µM OGG1 in 25 mM Tris-acetate pH 7.5, 50 mM CaCl2,
10% glycerol, 1 mM DTT and 5X SYPRO Orange was incubated with a single dose of
compound at 100 µM and upon observed stabilization, a dose-response experiment was
performed. Of the four compounds, TH10785 is the strongest stabilizer in concentrations
as low as 31 µM. The plot summarizes two independent experiments with triplicates of
each compound, Mean ± SD.
15
Fig. S2.
TH10785 enhances OGG1 activity in biochemical assay performed in absence of

APE1: The OGG1 activity assay was performed in black 384-well plates (Optiplate,
PerkinElmer) using final concentrations of 25 mM Tris-HCl pH 8.0, 15 mM NaCl, 2 mM
MgCl2, 0.5 mM DTT, 0.0025% Tween-20, and 1:3000 dilution of dialyzed fish gelatin
(Sigma G7765), 800 pM OGG1 enzyme and 10 nM 8-oxoA:C substrate in a final volume
of 50 μl. The 8-oxodA:C substrate was a duplex oligonucleotide where 5′-FAM-TCTG
CCA 8CA CTG CGT CGA CCT G-3′ was annealed to a 25% surplus of 5′-CAG GTC GAC
GCA GTG CTG GCA GT-Dab-3′. “8” signifies 8-oxoA and “FAM” and “Dab” signify
fluorescein and dabcyl (TriLink Biotech). When applied, APE1 was used at 2 nM
concentration. For the reason of clarity, the initial slope, where the reaction curve is a
straight line was plotted in individual columns. This returns ΔFU/min which was corrected
16
for the DMSO control if not stated otherwise. Strong activation is reflected by high slope.
This leads to a bell-shaped curve for TH10785. (A) TH10785 reaction rate is presented;
(B) Reaction velocity in pM/min taken from a linear slope time point; for TH10785 and
DMSO control between minutes 24 to 30 and between 0 and 6 minutes for APE1; (C) The
assay was performed with additional 2 nM APE1 in all wells and shows competitive
behavior of TH10785 at higher concentrations. (D) Combining APE1 and TH10785 in
different concentrations shows that APE1 and TH10785 can compensate for one another
at lower concentrations. Both settings generate a strand break in the assay and cause an
increase in fluorescence signal. Data are representative of two independent experiments
with technical duplicates, depicted as column graphs with Mean ± SD. Created in
BioRender.com
17
Fig. S3.
18
TH10785 is selective for OGG1 function on 8-oxoA: For the reason of clarity, the initial
slope, where the reaction curve is a straight line was plotted in individual columns. This
returns ΔFU/min (ΔFluorescence Units per minute) which was corrected for the DMSO
control if not stated otherwise. Strong activation is reflected by high slope: (A) OGG1 at
the substrate Thymidine glycol as reported here,(14) nFU, normalized Fluorescence units
over empty well (DMSO control); Tg Oligo sequence: 5′-FAM-TCTG CCA YCA CTG CGT
CGA CCT G-3′ and complementary strand 5′-CAG GTC GAC GCA GTG CTG GCA GT-
Dab-3′. “Y” signifies Thymidine glycol, and “FAM-T” and “T-Dab” signify fluorescein and
dabcyl, respectively, both coupled to dT (TriLink BioTechnologies); (B) NEIL1 at the
substrate Thymidine glycol as reported in the same report, FU, Fluorescence units; (C)
OGG1 in absence of MgCl2 or additional 2.5 mM EDTA; (D) 51.2 U/mL Fpg (New England
BioLabs) in OGG1 assay buffer on 8-oxoA:C substrate; (E) APE1 on 8-oxoA:C. Plots are
representative of each two independent experiments in duplicates. Data depicted as
column graphs with Mean ± SD. Created with BioRender.com
19
Fig. S4.
TH10785 stimulates OGG1 AP-lyase activity: 10 nM UNG2 was incubated with 62.5
nM of a U:A containing Oligo in the OGG1 reaction buffer (10 µL enzyme and 40 µL
substrate). 800 pM OGG1 was added to a final volume of 60 µL and the reaction
monitored as above. The U:A substrate was a duplex oligonucleotide where 5′-FAM-
TCTG CCA UA CTG CGT CGA CCT G-3′ was annealed to a 25% surplus of 5′-CAG GTC
GAC GCA GTG ATG GCA GT-Dab-3′. “U” signifies uracil and “FAM” and “Dab” signify
fluorescein and dabcyl (TriLink Biotech). Plots are technical duplicates of two independent
experiments. For the reason of clarity, the initial slope, where the reaction curve is a
straight line was plotted in individual columns. This returns ΔFU/min which was corrected
for the DMSO control if not stated otherwise. Strong activation is reflected by high slope.
(A) TH10785 enables OGG1 to process abasic sites generated by UNG2; (B) TH10785
activates OGG1 to process abasic sites in a dose dependent manner. Higher doses
activate better when nucleobase is absent, indicating competitive behavior towards 8-
oxoA (see also Fig. S2A-C). Data depicted as column graphs with Mean ± SD. Created
with BioRender.com
20
Fig. S5.
Analysis of the effect of TH5487 and TH10785 on the glycosylase activity of hOGG1:
(Upper panel) scheme of the substrate and product during the reaction. (Lower panel)
The assay was performed by incubating 1 nM of the [32P]5’-labeled 8oxoG-containing
substrate with 100 pM hOGG1 for the indicated times. Reaction was stopped by adding
0.1 N NaOH and further incubation at 90 ºC for 5 min. Samples were analyzed by 7M
urea-20% PAGE and autoradiography. Position of products is indicated. C: control without
protein and 10% DMSO. The percentage of AP sites generated by the glycosylase activity
was plotted against the incubation time and fitted to an exponential equation by least
squares nonlinear regression. The graph corresponds to three independent assays.
21
Fig. S6.
Mechanism of TH10785 binding to OGG1: (A) Close-up view of TH10785 (purple)

binding to human OGG1 (grey). Solved at pH 7.5; (B) TH10785 (purple) binding to mouse
OGG1 (lilac). Solved at pH 8.5. Important residues in the binding sites are labelled (amino
acids in direct interactions in bold), hydrogen bond interactions are shown in black dashed
line, electron density for the ligand is shown as a 2Fo-Fc map at 2σ. (C) Comparison
between the binding of TH10785 (purple/lilac) to human OGG1 (grey) and to mouse
OGG1 (lilac). (D) Comparison between TH10785 (purple) and inhibitor TH5487 (green)
(28) bound to human OGG1 (grey and yellow, respectively). X-Ray refinement data at the
end of the manuscript in Table S4.
22
Fig. S7.
Effect of TH10785 on the formation of hOGG1-DNA complexes requires Lys249: (A)

Dependence of hOGG1-DNA cross-link on NaBH4. The assay was performed by
incubating 1 nM of the [32P]3’-labeled uracil-containing substrate previously treated with
E. coli UDG to leave an intact AP site, with 100 nM of either the wild-type or mutant K249Q
OGG1, and 100 mM of either NaBH4 or NaCl, in the presence/absence of 6.25 µM
TH10785. (B) Adduct formation is dependent on the presence of an abasic site. The
assay was performed by incubating 1 nM of [32P]3’-labeled uracil-containing substrate
either untreated (absence of AP site) or after treatment with E. coli UDG (presence of AP
site) with 100 nM of either the wild-type or mutant K249Q hOGG1, 100 mM of NaBH4 and
in the presence/absence of 6.25 µM TH10785. Autoradiography of corresponding protein-
DNA adducts after the SDS–PAGE separation is shown. (C) Addition of NaBH4 abrogates
OGG1 assay process: Fluorescence assay was performed as above and after 15 min
10 µL of a 10 mM solution of NaBH4 was added. Reaction progress was monitored up to
60 min. Plot shows representative duplicates of three independent experiments. (D)
Detection of covalent bond formation of OGG1 and DNA substrate after incubation with
NaBH4 by MALDI-TOF indicates reduction of Schiff-Base: Both protein and separate DNA
strand molecule masses are observed. After incubation with NaBH4 the two DNA strands
are observed bound to OGG1. (C) Data depicted as column graphs with Mean ± SD.
Created with BioRender.com
23
Fig. S8.
Fluorescent Biochemical assay with mouse and mutant human OGG1 indicate
binding of TH10785 to the active site. For the reason of clarity, the initial slope, where
the reaction curve is a straight line was plotted in individual columns. This returns
ΔFU/min which was corrected for the DMSO control if not stated otherwise. Strong
activation is reflected by high slope. (A) TH10785 activates mouse OGG1 biochemical
function; (B) TH10785 is addressing the active site based on the interrogation of OGG1
mutants. Ser326Cys – lies outside the active site and is believed to have DNA interacting
properties together with the possibility to be oxidized; Lys249Trp – is the catalytically dead
mutant; Phe319Ala – Phe319 enables π-stacking to interrogated DNA nucleobases, 8-
oxoG and TH10785; Cys253Tyr – lies deeper in the catalytic pocket and is believed to
play the role of a redox switch with Lys249; Concentrations of enzymes, substrates and
additives within the biochemical assay as above. A representative concentration of 5 µM
TH10785 was used. Representative plots of duplicates of two independent experiments.
Data depicted as column graphs with Mean ± SD. Created with BioRender.com
24
Fig. S9.
A
Dynamic Protein-Ligand RMSD (Root-mean-square deviation of positions) of

TH10785 reflects a low affinity binder to OGG1: (A) hOGG1 and (B) mOGG1 indicates
fast desorption of the small molecule activator TH10785 from protein surface: both
distances between starting conditions and polypeptide backbone Cα (blue) and between
Ligand and the corresponding Protein positions (red) are significantly increased after 50
ns or 120 ns respectively. Over the course of the simulation only few interactions are
maintained for longer times (right panels; percentage of maintained contact during 500
ns simulation). (C) A stronger binder, like OGG1 inhibitor TH5487, restricts movements
of the respective bound protein residues.(28) Here, distances are generally shorter than
25
with a weak binder. Consequently, contact times with amino acid residues are much
longer (right panel). The results indicate a low affinity of TH10785 to the active site.
26
Fig. S10.
Saturation kinetics of TH10785 against the two substrates 8-oxoA:C and UNG2
treated U:A substrate: (A) OGG1 was incubated with a 2:1 dilution curve of TH10785
for 15 minutes. Slope was calculated as above. Reaction Buffer and Materials as above.
The double amount of OGG1 was used. All reagents, buffer and plates used at room
temperature. Experiment performed twice in duplicates. (B) UNG2 was added to a range
of TH10785 and U:A substrate concentrations and incubated for 30 minutes. OGG1 and
the indicated concentrations of substrate were added with a multichannel pipette robot.
Kinetic mode was used to read increasing fluorescence in Hidex Sense. Linear range was
used to plot slope. Two biochemical replicates with two technical duplicates were used to
calculate curve. Created with BioRender.com
27
Fig. S11.
Effect of the compounds on the DNA binding ability of hOGG1: The assay was
performed incubating 1 nM of the [32P]5’-labeled 8oxodG:C containing substrate with the
indicated concentrations of OGG1, in the presence of either 10% DMSO, 50 µM
TH11738, 6.25 µM TH10785, 50 µM TH5487, 20 µM TH12112, 50 µM TH12161, 50 µM
TH12117 (all upper panel) or 50 µM TH12120 (second lower panel). After gel
electrophoresis, the mobility of free dsDNA and the hOGG1-DNA complex was detected
by autoradiography. Created with BioRender.com
28
Fig. S12.
Three induced-fit docked poses of TH10785 in a ternary complex of DNA, Protein

and compound overlap with TH10785-OGG1 crystal structures: (A) The 1N position
of the highest-ranking pose of TH10785 overlaps with 9N of excised 8-oxoG. Of the six
best poses, three, orange (B), green (C) and red (D), are following the orientation
experimentally observed for TH10785 in mOGG1 and hOGG1 (Fig. S8). The other three
poses, black (E), yellow (F) and pink (G), are flipped regarding the parts cyclohexyl and
quinazoline. The former poses (B-D) bring the 1-N position in reach of the C’2-H of the
open chain desoxyribose with distances between 4.3 and 4.6 Å. The flipped orientation
reaches similar docking scores (Table S3) but distances vary between 4.6 and 6.4 Å, (E-
G). Protein positions (Gly42, Phe319 and Lys249) and Protein-Ligand interactions are
highlighted. Blue – π-stacking, pink – distance basic nitrogen C’2-H, brown – weak intra
29
ligand or ligand protein clashes, red – strong intra ligand or ligand protein clashes, yellow
– H-bond. Complex build from PDB 1HU0. Created with BioRender.com
30
Fig. S13.
A
Orientation of 1-N position of TH10785 and 9-N position in 8-oxoG indicate possible
similar mode of action: To perform β-elimination, 8-oxoG brings its 9-N position close
to the C’2 position of the open-chain deoxyribose. (A) Overlay of the induced-fit poses of
TH10785 (orange as above from Fig. S12) and excised 8-oxoG show 1N and 9N as close
as 0.3 Å; (B) Overlay of crystal structures of TH10785 in OGG1 and DNA-bound OGG1
reflect structural analogy with respect to their 1-N position, posing the possibility of a local
basic environment to induce β-elimination. The difference between the in-silico study and
the crystal structures showcases possible movements of the bound compounds and
conformational changes from OGG1 with TH10785 to OGG1 with DNA bound (see also
Movie S3).
31
Fig. S14.
Activator-Inhibitor Chimera TH12161 is an OGG1 activator: To compare reaction

rates, the linear slope was measured in ΔFU/min as above. Combining active site affinity
from TH5487 and biochemical activity of TH10785 afforded TH12161. TH5487 is an
OGG1 inhibitor and halts assay progress. TH10785 is an OGG1 activator and increases
assay progress. TH12161 is an OGG1 activator and increases assay progress.
Furthermore, generating chimera compound TH12161 indicates poses B-D in Fig. S12 to
be the active orientation in a ternary complex of OGG1, DNA and activator. Data are
representative of two independent measurements with two technical replicates each,
depicted as column graphs with Mean ± SD. Created with BioRender.com
32
Fig. S15.
33
hOGG1 activation by analogues of TH10785 and 8-BrG: The SAR (Details see Table
S6) suggests the nitrogen in the quinolone position of TH10785 to be a necessity. In
addition, the aromatic system has to be extended and fairly electron rich to π-stack with
Phe319 and establish a suitable pKa of the aforementioned nitrogen. The remainder of
the molecule governs active site affinity with the H-bond to Gly42 being the most crucial
part. In addition, earlier reports mentioned 8-oxoG binding to OGG1 with considerable
low KD.(18) Further, an enhancement of an EMSA based assay was observed in presence
of increased amounts of 8-oxoG. Due to the low solubility of the nucleobase under neutral
pH and the influence that pH has towards progression of an OGG1 mediated assay, 8-
BrG was used in the biochemical assay performed as above and activates OGG1
mediated strand cleavage. For the reason of clarity, the initial slope, where the reaction
curve is a straight line was plotted in individual columns. This returns ΔFU/min which was
corrected for the DMSO control if not stated otherwise. Strong activation is reflected by
high slope. Data are representative of two independent measurements with two technical
replicates each, depicted as column graphs with Mean ± SD. Created with
BioRender.com
34
Fig. S16.
pKa prediction by Epik suggests control of β-elimination by preferable acid-base

equilibrium under physiological pH: The 1N position of TH10785 has a pka of 6.55 ±
1.13 which allows for rapid exchange of protons at a pH around 7. Quinoline derivative
TH12115 has an increased pKa of 9.78 ±2.22, indicating a nearly complete protonation
at physiological pH, likely abrogating possible β-elimination events. Under physiological
pH 8-oxoG will be almost completely protonated and not able to act as a base (pka =
10.14 ±2.00). In contrast, 8-BrG with a pKa of 8.22 ± 2.22 allows for proton abstraction
events. (A) TH10785, (B) 8-oxoG, (C) 8-BrG; (D) TH12117; (E) TH11735; (F) TH12161;
(G) TH11738; (H) TH11873; (I) TH12119; (J) TH12120; (K) TH12115.
35
Fig. S17.
OGG1 biochemical assay progress and activation is pH dependent: (A) hOGG1

reaction optimum for residual β-lyase activity is at a pH between 7.5 and 8.0 with the
reaction being abrogated at low acidic pH; (B) hOGG1 reaction optimum in the presence
of TH10785 is shifted towards lower pH, confirming a more vivid acid-base equilibrium of
the TH10785 1-N position; For the reason of clarity, the initial slope, where the reaction
curve is a straight line was plotted in individual columns. This returns ΔFU/min which was
corrected for the DMSO control if not stated otherwise. Strong activation is reflected by
high slope. The assay was performed as above and pH was controlled by adding few µL
1M HCl to the stem buffer. Representative plot of two independent experiments. Data
depicted as column graphs with Mean ± SD. Created with BioRender.com
36
Fig. S18.
Mechanism of TH12161 binding to mouse OGG1: TH101261 (cyan) binding to mouse

OGG1 (green). Important residues in the binding sites are labelled (amino acids in direct
interactions in bold), hydrogen bond interactions are shown in black dashed line. X-Ray
refinement data at the end of the manuscript in Table S4.
37
Fig. S19.
Effect of the compounds on the AP-lyase activity of hOGG1 on 8oxoG:C-containing

DNA. The assay was performed using 1 nM of the indicated [ 32P]5’-labeled 8oxoG-
containing substrate, in the presence of 25 nM hOGG1, 20 mM EDTA and either 10%
DMSO, 50 µM TH11738, 6.25 µM TH10785, 50 µM TH5487, 20 µM TH12112, 50 µM
38
TH12161, 50 µM TH12117 (all top panel) or 50 µM TH12120 (second lower panel)
reflecting the best concentrations from the corresponding fluorescence based
biochemical assay. After incubation for the indicated times at 37 ºC, reactions were either
stopped (-) or further incubated 10 min in the presence of T4 PNK (+). After incubation
samples were analyzed by 7 M urea-20% PAGE and autoradiography. Position of
products is indicated. Created with BioRender.com
39
Fig. S20.
Effect of the compounds on the AP-lyase activity of hOGG1 on AP:C-containing

DNA: The assay was performed using 1 nM of the UDG treated [ 32P]5’-labeled uracil-
containing substrate, in the presence of 25 nM hOGG1, 20 mM EDTA and either 10%
DMSO, 50 µM TH11738, 6.25 µM TH10785, 50 µM TH5487, 20 µM TH12112, 50 µM
TH12161 or 50 µM TH12117 reflecting the best concentrations from the corresponding
biochemical assay. After incubation for the indicated times at 37 ºC, samples were
analyzed by 7M urea-20% PAGE and autoradiography. Position of products is indicated.
Created with BioRender.com
40
Fig. S21.
TH10785 stabilizes OGG1 in cells: (A-B) Comparative graphs showing a shift in the
Thermal stabilization profile for U2OS cells treated with DMSO, TH10785 or TH5487.
U2OS cells were treated with DMSO, TH10785 (20µM) or TH5487 (20 µM) for 2 h at 37
°C and 5%CO2. (A) Data is represented as column graphs with Mean ± SD. (B)
connecting lines represent thermal stabilization profiles for different compounds. Cells
were then washed, trypsinized and subjected to a temperature range 37 °C – 62 °C.
Further, cell lysis was done and thermal stability of OGG1 ± TH10785 or TH5487 was
analyzed using immunoblotting. Actin was used as a loading control. Created with
BioRender.com
41
Fig. S22.
TH10785 increases recruitment of OGG1-GFP: (A) Representative live cell confocal

images of U2OS OGG1-GFP cells treated with OGG1 inhibitor (TH5487), OGG1 activator
(TH10785) or vehicle (DMSO) at the indicated time points after laser microirradiation sites
pointed by white arrows (*Part of this set of images is duplicated and included in Fig. 2A).
(B) Connecting lines of mean values ± SEM representingOGG1-GFP recruitment kinetics
(*This analysis is duplicated in Fig. 2A). (C) Scatterplot with mean values ± SEM of the
maximum OGG1-GFP intensity at laser-irradiated sites for the indicated conditions. Scale
bar, 5 µm. NFU, normalized fluorescence units. Statistical significance was assessed
using unpaired two-sided t-test (*, P< 0.05, **, P< 0.01).
42
Fig. S23.
Effect of TH10785 on the DNA binding ability of hOGG1. A: The assay was performed
as described in Materials and Methods, incubating 1 nM of the [ 32P]5’-labeled 8oxodG:C
containing substrate with increasing concentrations of hOGG1, in the presence or
absence of 6.25 μM TH10785. After gel electrophoresis, the mobility of free dsDNA and
the hOGG1-DNA complex was detected by autoradiography. B: Quantification of the
relative fraction of retarded DNA (%) against hOGG1 concentration. C: Connecting lines
showing that OGG1 regains its mobility in oxidatively stressed cells treated with TH10785.
Quantification of fluorescence recovery after photobleaching (FRAP). U2OS cells
expressing OGG1-GFP were treated with 40 mM potassium bromate for 1 hour. 0.1%
DMSO, 10 μM TH5487, 1 μM TH10785 or 10 μM TH10785 were added to the same
medium containing potassium bromate for another hour. A nuclear region was bleached,
and recovery of fluorescence after photobleaching was recorded. RFU, relative
fluorescence units. D: Quantification of OGG1’s mobile fraction from the FRAP
experiment described in (C). Data represent mean (C) or mean ± SD (D) of three
independent experiments. Statistical significance was assessed using unpaired two-sided
t-test (**, P< 0.01, ****, P< 0.0001). Created with BioRender.com
43
Fig. S24.
Number of oxidized bases is decreased by TH10785 in U2OS cells challenged with

KBrO3: Comparative analysis of comet tail moment. Cells were treated as indicated in
method section and the tail moment of the cells were analyzed using blinded automatic
analysis (n = 200 cells per condition from two independent experiments). Scatterplot with
mean values ± SEM. U2OS cells were treated with the indicated concentration of
TH10785 for 1 h in the presence or absence of KBrO3 (1 mM/30 min). Strand-breaks and
OGG1 substrate lesions were analyzed with the OGG1-modified Comet assay. Created
with BioRender.com
44
Fig. S25.
8-oxodG accumulation in U2OS cells: Cells were treated with 20 mM KBrO3 for 1 hour.
Afterwards, cells were allowed to recover for 3 or 7 hours in medium containing TH10785,
TH5487 or DMSO at the indicated concentration. 8-oxodG level was assessed by
immunofluorescence. Data of at least 3527 cells per condition. Bars represents mean ±
SEM. Data are presented as mean of 2 independent experiments (non-treated) or 3
independent experiments (all other conditions) with 2 technical repeats each. Statistical
significance was determined using Mann-Whitney tests (****, P< 0.0001). Created with
BioRender.com
45
Fig. S26.
Quantification of γH2AX (A) and 53BP1 (B) nuclear intensity in U2OS cells
treated for 24 h with the indicated conditions: PNKP1i, PNKP1 inhibitor; C_TH10785
(Combination of TH10785 and PNKPi); C_TH5487 (Combination of TH5487 and
PNKP1i). Bars showing mean values ± SEM. Data is the average of 3 independent
experiments. For each experiment a minimum of 200 cells was analyzed. Statistical
analysis was performed using Mann-Whitney test for non-parametric distributions. (****,
p<0.0001, ns, non-significant).
46
Fig. S27.
47
Mode of action of TH10785 mediated AP-lyase activation of OGG1 and its
implications on different levels of Base Excision Repair: On the Protein-Level
TH10785 leads to quicker release of OGG1 from its product. The consequence is an
apparent larger fraction of OGG1 that is undergoing recruitment to damaged sites at a
speed faster than under basal conditions. Due to the new function of an AP-Lyase activity,
the substrate scope within genomic DNA and secondary structures such as G4
Quadruplexes and Telomeres is additionally expanded towards preferred abasic sites. At
the same time, the new function results in a new product and alters repair intermediate
progression within BER. This process is independent of APE1 and leads to a dependency
on PNKP1 and inter-pathway connections to DDR. On a Molecular Level TH10785
enables a OGG1 β,δ-lyase activity by a prefered binding to the intermediate schiff-base
complex between OGG1 and the abasic site. Interactions of the electron-rich quinazoline
structure via π-staking to Phe319 and H-bond formation to Gly42 achieve active site
affinity similar to 8-oxoG. However, a favourable pKa around 7 at a suitable position
allows for a rapid exchange of protons with the substrate backbone, inducing enhanced
β-elimination. Varying amounts of β- and δ-elimination products in EMSA point towards
δ- succeeding an β-elimination event leading to 3’- and 5’- phosphates. The reaction
cascade indicates a de novo δ-elimination by enhanced β-elimination and reduces affinity
to the product. This leads to a de facto enhancement of the whole functional cycle due to
apparent higher levels of free OGG1. A comparison of TH10785 and TH5487 governing
OGG1 function is shown in Fig. S28. Created with BioRender.com
48
Fig. S28.
Molecular model for TH10785 and TH5487 mode of action in OGG1 chromatin
recruitment, BER repair initiation and progression as well as the cellular outcome:
All numbered statements are supported by corresponding key experiment, referenced in
Table S7. Briefly, under oxidative stress conditions like KBrO3 treatment, oxidative DNA
damage will be generated. In normal conditions, OGG1 will recognize and excise 8-oxoG
from the oxidized DNA. Afterwards, APE1 will take care of the resulting AP-site to
progress BER. In the case of TH10785, activated-OGG1 can recognize both 8-oxoG and
AP-sites, with a higher efficiency for abasic sites. Through its novel β,δ-lyase activity, the
system will be loaded with BER-intermediates that now require the action of PNKP1 to
successfully complete BER. Here, a dependency on PNKP1 has been generated.
Simultaneously, since most of the activated OGG1 processes AP-sites, a delay in the
repair of 8-oxoG can be observed. In the case of TH5487, recruitment of OGG1 to
chromatin is impaired by its direct competition with 8-oxoG for binding to OGG1 active
site. Thus, BER initiation is blocked, resulting in accumulation of 8-oxoG.
49
Fig. S29.
(Upper) 1H-NMR and (Lower) 13C-NMR spectra of TH10715: Chemical shifts (δ) are
shown in parts per million.
50
Fig. S30.
51
Fig. S31.
52
Fig. S32.
53
Fig. S33.
54
Fig. S34.
55
Fig. S35.
56
Fig. S36.
57
Fig. S37.
58
Fig. S38.
59
Fig. S39.
60
Table S1.
Fluorescence auto-fluorescence
DNA intercalation
200 µM 69301 609
50 µM 66284 99
10 µM 67633 63
no ThO 30
positive ThO 3839
negative PI 59598
empty 52
DNA intercalation and auto-fluorescence test on TH10785: DNA intercalation was

measured by incubating 10 nM unlabeled, undamaged oligonucleotides in OGG1 reaction
buffer in the presence of 62.5 nM Thiazole Orange (Sigma Aldrich 390062) as described
previously.(29) Auto-Fluorescence was measured by incubating the indicated amounts of
compound in the OGG1 reaction buffer and measuring the signal in the OGG1 assay
setup in a Hidex-Sense.(3)
61
Table S2.
Compounds DMSO (%) KD (μM) errors Wavelength
(nm)
TH10785 5 4 (7.1) ± 1.1 (2.2) 325 (330)
5 6.1 (6.3) ± 1.6 (2.3) 325 (330)
5 6.4 (8.6) ± 2.4 (3) 325 (330)
TH10785 15 3.2 (3.2) ± 0.6 (0.7) 325 (330)
TH10785 (2 μM 5 1.3 (1.9) ± 0.3 (0.6) 325 (330)

THF)
TH10785 (2 μM 5 1.8 (3.0) ± 0.6 (1.0) 325 (330)
G-site)
TH012117 15 320 ± 100 330
TH012161T 15 10 ±3 340
TH011738 15 20 ±6 337
8-BrG 5 600 ± 330 322
8-oxoG 15 1.4 (3) ± 0.9 (1.8) 325 (330)
Binding affinity KD of selected compounds and DNA to OGG1 as determined by
fluorescence spectroscopy. Values in brackets were measured at another
wavelength, shown in the last column.
62
Table S3.
TH10785
8-oxoG [kcal/mol] [kcal/mol]
-10.131 -11.90
-11.26
-11.72
-11.43
-11.05
-10.06
Induced-fit docking scores of 8-oxoG and TH10785 in crystal structure of OGG1

and DNA (PDB:1HU0) indicate no discrimination for binding: Crystal structure of 8-
oxoG in hOGG1 (1HU0) was prepared and TH10785 and 8-oxoG induce-fit docked on
the position of the original 8-oxoG. The best docking score for 8-oxoG is surpassed by
six different poses of TH10785, indicating that TH10785 could replace 8-oxoG to perform
“product assisted catalysis”.(13)
63
Table S4.
hOGG1:TH10785 mOGG1:TH10785 mOGG1:TH12161
Data collection
PDB code 7AYY 7AYZ 7AZ0
Station DLS-I04-1 DLS-I04 DLS-I04
Space group P41212 P212121 P212121
Cell dimensions
a, b, c (Å) 86.0, 86.0, 427.6 80.8, 81.8, 170.6 81.1, 81.6, 169.6
α, β, γ (°) 90.0, 90.0, 90.0 90.0, 90.0, 90.0 90.0, 90.0, 90.0
Resolution (Å) 2.00-86.0 (2.00- 2.60-85.3 (2.60- 2.40-81.64 (2.40-
2.03)a 2.72)a 4.49) a
No. total / 2,651,770 / 456,706 / 1,181,101 / 44,894
unique reflections 110,134 35,633
Rmerge 0.299 (2.65)a 0.082 (0.986)a 0.184 (2.534) a
Rpim 0.087 (0.89)a 0.034 (0.412)a 0.051 (0.731) a
CC1/2 0.998 (0.529)a 1.00 (0.870)a 0.999 (0.640) a
I / σI 8.1 (1.2)a 18.3 (2.2)a 11.1 (1.4) a
Completeness (%) 100.0 (100.0)a 100.0 (100.0)a 100.0 (100.0) a
Redundancy 24.1 (19.0)a 12.8 (12.8)a 26.3 (25.0) a
Wilson B factor 22.5 55.7 53.6
Refinement
No. reflections 104,291 33,700 44,827
used
Rwork / Rfree (%) 20.7 / 25.0 23.7 / 28.6 23.0/25.7
B-factors
Protein (all 35.7/30.9/28.5/25.8/ 71.1/76.6/94.3 75.2/61.4/78.6
atoms)b 29.3
Ligandb 28.0/22.4/20.9/22.1/ 48.8/67.1/95.4 71.3/66.0c
20.7
Water 31.8 56.8 52.3
R.m.s. deviations
Bond lengths 0.006 0.003 0.004
(Å)
Bond angles (°) 1.41 1.23 1.25
Ramachandran statistics
Favored (%) 96.5 94.4 94.9
Outliers (%) 0.00 0.22 0.11
X-ray crystallography -data collection and refinement statistics.
64
Table S5.
Target/Substrate Oligo sequence
NO/G4_MYC-F CCCCCAACAAATGCAATGGG
NO/G4_MYC-R CGCATCCTTGTCCTGTGAGT
G4_MYC-F TGATTTCTCCCAAACCCGGC
G4_MYC-R CTGCCAAAGCAGCAGATACC
Telomeres-F 5’ CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT 3’
Telomeres-R 5’ GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT 3’
5′-FAM-TCTG CCA UA CTG CGT CGA CCT G-3′ was annealed to a 25%
surplus of 5′-CAG GTC GAC GCA GTG ATG GCA GT-Dab-3′
U:A (fluorescence)
8-oxoA:C (fluorescence)5′-FAM-TCTG CCA 8CA CTG CGT CGA CCT G-3′ was annealed to a 25%
surplus of 5′-CAG GTC GAC GCA GTG CTG GCA GT-Dab-3′.
Tg:A (fluorescence) 5′-(dT-FAM)CTG CCA TgCA CTG CGT CGA CCT G-3′ was annealed to 25%
surplus of 5′-CAG GTC GAC GCA GTG CTG GCA GT-Dab-3′
U:C (EMSA) 5’-32P-CTGCAGCTGATGCGCUGTACGGATCCCCGGGTAC-3’ and

3’-GACGTCGACTACGCGCCATGCCTAGGGGCCCATG-5’
8-oxoG:C (EMSA) 5’-32P-GTACCCGGGGATCCGTAA8GCGCATCAGCTGCAG-3’ and

3’-CATGGGCCCCTAGGCATTCCGCGTAGTCGACGTC-5’
U:G (EMSA) 5’-CTGCAGCTGATGCGCUGTACGGATCCCCGGGTAC-3’-dAMP
List of primers and DNAand 3’-GACGTCGACTACGCGGCATGCCTAGGGGCCCATG-5’

Oligo structures used in this paper
65
Table S6.
TH# R1 R2 X R3 π-stack DSF AC50 AC20 KD in µM Product
ΔT in K* [% DMSO] in EMSA
TH10785 N N NH Cy quinaz 5.6 783 nM 226 nM 5.5 ± 1.7 (5) β,δ
TH11735 N N NMe Cy quinaz -0.7 36.3 µM 3.0 µM n.d. n.d.
TH11738 N N O Cy quinaz -0.3 inactive inactive 20 ± 6 (15) n.o.
TH11873 N N CH2 Cy quinaz -0.9 inactive inactive n.d. n.d.
TH12115 N CH NH Cy quino 0.2 inactive inactive n.d. n.d.
TH12119 CH N NH Cy isoquino 0.3 inactive inactive n.d. n.d.
TH12120 CH CH NH Cy naphtha -0.1 inactive inactive n.d. n.o.
TH12117 N N NH Cy pyrimi 1.2 12.4 µM 4.5 µM 320 ± 100 (15) β
TH12161 N N NH 4-I-ph quinaz 0.2 78.3 µM 11.8 µM 10 ± 3 (15) β,δ
8-BrG 0.2 9.4 µM 600 ± 330 (5) β
Summary of tests for synthetic analogues generated during the

SAR studies: Substitution in relation to R groups in the molecule left
to this text; 4-I-Ph, 4-iodo-phenyl; π-stack, π-stacking moiety; *DSF: all
compounds measured at 0.5 mM, except 8-BrG (0.2 mM); n.d., not
determined; n.o., not observed. Cy – cyclohexyl; ph – pheny; quinaz –
quinazoline; quino – quinolone; isoquino – isoquinoline; naptha –
naphthalene; pyrimi – pyrimidine
66
Table S7.
Statements Key experiments
1. 8-oxoG and AP-sites are generated after KBrO3 Fig. 2D and 2G
2. Chromatin recruitment Fig. 2A and Fig. S22A-C
3. OGG1 preclusion Fig. S11 and Fig. S23
4. Activated OGG1 repairs 8-oxoG less efficient than Fig. 2D, Fig. 1G and H
AP-sites
5. OGG1 inhibition blocks 8-oxoG excision Fig. 2D, Fig. S25
6. Activated OGG1 processes AP-sites faster and Fig. 1D, Fig. 2E-H, Fig. S4
increases nº of γH2AX nuclear foci.
7. Glycosylase activity is saturated by high TH10785 Fig. 1G and Fig. S2A-C
doses
8. 8-oxoG repair delay Fig. 2D, Fig. S25
9. β,δ-lyase activation Fig. 1E, Fig. 3A-C, Fig. S26
10. PNKP1 dependence Fig. 3D, Fig. 3E, Fig. S26
All numbered statements in Fig. S28 are supported by corresponding key

experiment, referenced in table above.
67
Table S8:
time(s) DMSO 10 µM TH5487 1 µM TH10785
Mean SEM Mean SEM Mean SEM
0 1 0 1 0 1 0
2 1,0748 0,00714423 1,0265 0,00625237 1,09125 0,00705343
4 1,1532 0,00771838 1,1135 0,00805491 1,18291667 0,01000868
6 1,192 0,00976388 1,14 0,00839799 1,22583333 0,01202227
8 1,2204 0,01020588 1,16 0,01048809 1,25708333 0,01284635
10 1,2428 0,01118809 1,1735 0,01054502 1,29125 0,01482155
12 1,264 0,01240967 1,1885 0,01138501 1,31041667 0,01587404
14 1,2736 0,01271325 1,1995 0,01096586 1,32875 0,01714508
16 1,2868 0,01289341 1,2045 0,01230051 1,34 0,01829707
18 1,2896 0,01355827 1,2075 0,01337466 1,34458333 0,01821748
20 1,2968 0,01382896 1,2215 0,01384643 1,35583333 0,01794634
22 1,3016 0,01336263 1,222 0,01459272 1,35875 0,01867255
24 1,306 0,01450287 1,224 0,01469694 1,36041667 0,01762614
26 1,306 0,01470827 1,232 0,01444773 1,36083333 0,01751724
28 1,306 0,0139523 1,233 0,01504554 1,36208333 0,01825721
30 1,306 0,01464013 1,236 0,01560027 1,3625 0,0172077
32 1,3088 0,01518025 1,2315 0,01536015 1,36125 0,01735512
34 1,3104 0,01559359 1,2385 0,01579932 1,36041667 0,01775925
36 1,306 0,01536229 1,236 0,01667649 1,36333333 0,01691482
38 1,302 0,01557776 1,237 0,0171541 1,3575 0,01764433
40 1,306 0,01571623 1,2415 0,01706451 1,35583333 0,01719366
42 1,3036 0,01609223 1,235 0,01626265 1,35875 0,01846768
44 1,3032 0,01578734 1,24 0,01799123 1,35541667 0,01761072
46 1,3012 0,01570902 1,238 0,01645728 1,35208333 0,01812776
48 1,3016 0,01609016 1,2375 0,01764974 1,35083333 0,01767169
50 1,2928 0,01638617 1,244 0,01752292 1,34583333 0,01747583
52 1,2968 0,01665053 1,234 0,01662908 1,34208333 0,01710982
54 1,2948 0,01664452 1,2345 0,01865864 1,33958333 0,01694491
56 1,2924 0,01651545 1,2365 0,01715678 1,33833333 0,0170641
58 1,288 0,0168523 1,237 0,01791941 1,33416667 0,01687461
60 1,2884 0,01761325 1,2335 0,01738534 1,33458333 0,01783559
62 1,2828 0,01723872 1,2345 0,0170058 1,33166667 0,01608026
64 1,2824 0,01678571 1,233 0,01712339 1,32875 0,01701781
66 1,2836 0,01810967 1,227 0,0182252 1,32916667 0,01698163
68 1,2828 0,01789339 1,2275 0,0178867 1,32041667 0,0166755
70 1,2772 0,0172 1,2325 0,01865017 1,3225 0,0167597
72 1,2804 0,01781834 1,226 0,01899307 1,31833333 0,01692553
74 1,2752 0,01847629 1,2245 0,01798355 1,31708333 0,01705149
68
76 1,2744 0,0188156 1,2215 0,0187543 1,31125 0,01683587
78 1,2748 0,01939175 1,221 0,01901385 1,31375 0,01753684
80 1,2752 0,01872716 1,2245 0,0189108 1,31 0,01798752
82 1,2716 0,01924994 1,218 0,01902353 1,31541667 0,01882393
84 1,2728 0,01848892 1,222 0,01951518 1,30875 0,01773714
86 1,2676 0,0192118 1,213 0,018326 1,3075 0,01735447
88 1,2684 0,01891807 1,216 0,0180846 1,30583333 0,01735099
90 1,262 0,01798147 1,2125 0,0189858 1,30166667 0,01746287
92 1,2612 0,01916003 1,2145 0,01971474 1,2975 0,01715498
94 1,2608 0,01900807 1,217 0,01933227 1,29416667 0,01790592
96 1,2596 0,01890749 1,2125 0,01872059 1,29041667 0,01810276
98 1,258 0,01832121 1,2125 0,01928832 1,29 0,0175491
100 1,252 0,01725302 1,2135 0,0186417 1,29458333 0,01782543
102 1,2552 0,01813027 1,203 0,01852594 1,29 0,01830696
104 1,2484 0,01862507 1,2085 0,01911565 1,28541667 0,01799737
106 1,2508 0,01806396 1,2045 0,01840302 1,28708333 0,01862559
108 1,2452 0,01835865 1,2005 0,01963449 1,28916667 0,01871716
110 1,2432 0,01899754 1,2035 0,01917063 1,28416667 0,01859091
112 1,2488 0,01857705 1,201 0,01906913 1,28625 0,01908991
114 1,2504 0,01883684 1,202 0,01856142 1,2825 0,01823011
116 1,2428 0,01873962 1,199 0,02003812 1,28375 0,01944718
118 1,2488 0,01915133 1,1945 0,01874307 1,28041667 0,01878057
120 1,2424 0,02020132 1,196 0,01997894 1,28083333 0,01989935
Mean ± SEM corresponding to Fig. 2A (right)
69
Table S9:
Conditions Mean SEM
Fig. 2B DMSO 3,7 0,2
KBrO3+DMSO 5,28 0,6
KBrO3+TH10785 4,43 0,5
KBrO3+TH5487 6 0,28
Fig. DMSO 6,04 0,6
2C_Left KBrO3+DMSO 7,68 0,64
KBrO3+TH10785 5,93 0,91
KBrO3+TH5487 8,42 0,99
Fig. DMSO 4,24 0,22
2C_Right KBrO3+DMSO 4,1 0,2
KBrO3+TH10785 3,72 0,41
KBrO3+TH5487 4,27 0,23
Fig. 2H DMSO 0,37 0,05
KBrO3+DMSO 6,67 0,73
KBrO3+TH10785 14,7 1,7
KBrO3+TH5487 5,81 0,85
Fig. 3A DMSO 1,12 0,17
PNKP1i 0,55 0,19
TH10785 3,7 0,75
C_TH10785 4,12 0,72
TH5487 0,74 0,48
C_TH5487 0,6 0,09
Fig. 3B DMSO 1 0,001
HU 1,05 0,002
PNKP1i 0,96 0,001
TH10785 1,01 0,001
C_TH10785 1,05 0,001
TH5487 0,98 0,001
C_TH5487 0,97 0,001
TH12161 0,96 0,001
C_TH12161 1,01 0,001
TH11738 0,96 0,001
C_TH11738 0,97 0,001
8-Br-G 0,96 0,001
C_8-Br-G 0,97 0,001
Mean ± SEM corresponding to Fig. 2B, 2C, 2H, 3A and 3B
70
Table S10:
PNKPi 0 µM PNKPi 1.25 PNKPi 2.5 PNKPi 5 PNKPi 10 PNKPi 20

μM μM μM μM μM
TH10785 mean SEM mean SEM mean SEM mean SEM mean SEM mean SEM
Fig. 0 µM 100,00 0,00 107,78 7,37 91,95 0,96 111,36 2,53 98,07 1,08 103,37 5,26
3D 0,08 µM 96,46 2,90 98,26 3,40 105,53 2,32 101,18 2,42 105,81 2,70 105,12 3,15
0,16 µM 105,45 3,96 100,44 3,63 99,01 6,34 96,59 3,07 99,61 1,86 101,39 4,44
0,31 µM 102,32 4,93 97,06 3,66 95,00 4,12 93,74 1,88 96,99 1,54 94,77 5,01
0,63 μM 101,78 4,32 98,81 3,82 99,88 5,01 95,13 1,53 97,07 1,35 92,91 2,73
1,25 μM 102,97 3,91 100,97 3,16 97,01 2,94 95,68 2,52 95,74 0,47 97,64 6,33
2,5 μM 103,19 4,51 102,82 3,34 100,42 4,51 96,14 3,39 97,97 2,01 81,44 11,09
5 μM 104,81 3,40 94,95 1,50 100,80 6,54 100,26 5,70 97,42 4,41 35,63 21,55
10 μM 102,17 4,69 97,20 2,35 97,60 4,48 97,88 4,32 52,41 20,62 8,65 8,17
20 μM 53,79 9,13 51,87 10,85 44,01 12,83 8,04 3,60 0,49 0,79 -2,37 0,31
TH5487 PNKPi 0 μM PNKPi 1.25 PNKPi 2.5 μM PNKPi 5 μM PNKPi 10 μM PNKPi 20 μM
μM
Fig. 0 µM 100,00 0,00 97,28 1,96 94,35 0,53 95,57 2,90 97,19 0,67 90,96 7,11
3E 0,08 µM 96,63 6,35 91,29 3,65 94,77 5,90 88,98 6,18 90,55 3,43 93,60 4,48
0,16 μM 92,84 7,03 93,85 10,17 94,18 6,81 96,93 5,32 96,10 3,92 85,69 12,78
0,31 μM 88,85 5,54 99,71 3,91 97,28 5,05 95,15 3,49 91,78 3,74 83,42 4,89
0,63 μM 96,31 4,24 89,11 6,72 96,12 5,15 92,53 8,40 93,79 3,02 90,17 2,30
1,25 μM 92,08 4,42 98,77 4,11 94,01 6,29 94,89 5,64 92,38 5,65 89,82 7,63
2,5 μM 90,64 3,95 94,00 3,59 93,37 4,29 93,40 5,94 91,23 5,39 88,49 3,99
5 μM 86,40 2,85 90,08 2,90 88,13 6,65 89,03 6,90 85,66 4,38 80,91 3,38
10 μM 76,93 3,35 81,27 4,16 76,39 3,80 74,40 3,88 72,92 2,06 64,33 6,51
20 μM 43,29 3,68 47,17 2,58 42,66 1,08 40,98 4,44 39,27 7,01 18,46 12,27
Mean ± SEM corresponding to Fig. 3D, Fig. 3E
71
References and Notes
1. N. Donley, P. Jaruga, E. Coskun, M. Dizdaroglu, A. K. McCullough, R. S. Lloyd, Small
molecule inhibitors of 8-oxoguanine DNA glycosylase-1 (OGG1). ACS Chem. Biol. 10,
2334–2343 (2015). doi:10.1021/acschembio.5b00452 Medline
2. Y. K. Tahara, D. Auld, D. Ji, A. A. Beharry, A. M. Kietrys, D. L. Wilson, M. Jimenez, D.
King, Z. Nguyen, E. T. Kool, Potent and selective inhibitors of 8-oxoguanine DNA
glycosylase. J. Am. Chem. Soc. 140, 2105–2114 (2018). doi:10.1021/jacs.7b09316
Medline
3. T. Visnes, A. Cázares-Körner, W. Hao, O. Wallner, G. Masuyer, O. Loseva, O. Mortusewicz,
E. Wiita, A. Sarno, A. Manoilov, J. Astorga-Wells, A.-S. Jemth, L. Pan, K. Sanjiv, S.
Karsten, C. Gokturk, M. Grube, E. J. Homan, B. M. F. Hanna, C. B. J. Paulin, T. Pham,
A. Rasti, U. W. Berglund, C. von Nicolai, C. Benitez-Buelga, T. Koolmeister, D. Ivanic,
P. Iliev, M. Scobie, H. E. Krokan, P. Baranczewski, P. Artursson, M. Altun, A. J. Jensen,
C. Kalderén, X. Ba, R. A. Zubarev, P. Stenmark, I. Boldogh, T. Helleday, Small-
molecule inhibitor of OGG1 suppresses proinflammatory gene expression and
inflammation. Science 362, 834–839 (2018). doi:10.1126/science.aar8048 Medline
4. B. A. Baptiste, S. R. Katchur, E. M. Fivenson, D. L. Croteau, W. L. Rumsey, V. A. Bohr,
Enhanced mitochondrial DNA repair of the common disease-associated variant,
Ser326Cys, of hOGG1 through small molecule intervention. Free Radic. Biol. Med. 124,
149–162 (2018). doi:10.1016/j.freeradbiomed.2018.05.094 Medline
5. D. Schniertshauer, D. Gebhard, H. van Beek, V. Nöth, J. Schon, J. Bergemann, The activity of
the DNA repair enzyme hOGG1 can be directly modulated by ubiquinol. DNA Repair 87,
102784 (2020). doi:10.1016/j.dnarep.2019.102784 Medline
6. S. Oka, J. Leon, K. Sakumi, N. Abolhassani, Z. Sheng, D. Tsuchimoto, F. M. LaFerla, Y.
Nakabeppu, MTH1 and OGG1 maintain a low level of 8-oxoguanine in Alzheimer’s
brain, and prevent the progression of Alzheimer’s pathogenesis. Sci. Rep. 11, 5819
(2021). doi:10.1038/s41598-021-84640-9 Medline
7. S. S. B. Komakula, J. Tumova, D. Kumaraswamy, N. Burchat, V. Vartanian, H. Ye, A.
Dobrzyn, R. S. Lloyd, H. Sampath, The DNA repair protein OGG1 protects against
obesity by altering mitochondrial energetics in white adipose tissue. Sci. Rep. 8, 14886
(2018). doi:10.1038/s41598-018-33151-1 Medline
8. S. S. B. Komakula, B. Blaze, H. Ye, A. Dobrzyn, H. Sampath, A novel role for the DNA
repair enzyme 8-oxoguanine DNA glycosylase in adipogenesis. Int. J. Mol. Sci. 22, 1152
(2021). doi:10.3390/ijms22031152 Medline
9. W. You, D. Rotili, T.-M. Li, C. Kambach, M. Meleshin, M. Schutkowski, K. F. Chua, A. Mai,
C. Steegborn, Structural basis of Sirtuin 6 activation by synthetic small molecules.
Angew. Chem. Int. Ed. 56, 1007–1011 (2017). doi:10.1002/anie.201610082 Medline
10. B. P. Hubbard, A. P. Gomes, H. Dai, J. Li, A. W. Case, T. Considine, T. V. Riera, J. E. Lee,
S. Y. e, D. W. Lamming, B. L. Pentelute, E. R. Schuman, L. A. Stevens, A. J. Y. Ling, S.
M. Armour, S. Michan, H. Zhao, Y. Jiang, S. M. Sweitzer, C. A. Blum, J. S. Disch, P. Y.
Ng, K. T. Howitz, A. P. Rolo, Y. Hamuro, J. Moss, R. B. Perni, J. L. Ellis, G. P. Vlasuk,
D. A. Sinclair, Evidence for a common mechanism of SIRT1 regulation by allosteric
activators. Science 339, 1216–1219 (2013). doi:10.1126/science.1231097 Medline
11. S. J. Gardell, M. Hopf, A. Khan, M. Dispagna, E. Hampton Sessions, R. Falter, N. Kapoor, J.
Brooks, J. Culver, C. Petucci, C.-T. Ma, S. E. Cohen, J. Tanaka, E. S. Burgos, J. S.
Hirschi, S. R. Smith, E. Sergienko, A. B. Pinkerton, Boosting NAD+ with a small
molecule that activates NAMPT. Nat. Commun. 10, 3241 (2019). doi:10.1038/s41467-
019-11078-z Medline
12. Z. Huang, J. Zhao, W. Deng, Y. Chen, J. Shang, K. Song, L. Zhang, C. Wang, S. Lu, X.
Yang, B. He, J. Min, H. Hu, M. Tan, J. Xu, Q. Zhang, J. Zhong, X. Sun, Z. Mao, H. Lin,
M. Xiao, Y. E. Chin, H. Jiang, Y. Xu, G. Chen, J. Zhang, Identification of a cellularly
active SIRT6 allosteric activator. Nat. Chem. Biol. 14, 1118–1126 (2018).
doi:10.1038/s41589-018-0150-0 Medline
13. J. C. Fromme, S. D. Bruner, W. Yang, M. Karplus, G. L. Verdine, Product-assisted catalysis
in base-excision DNA repair. Nat. Struct. Biol. 10, 204–211 (2003). doi:10.1038/nsb902
Medline
14. M. Michel, T. Visnes, E. J. Homan, B. Seashore-Ludlow, M. Hedenström, E. Wiita, K.
Vallin, C. B. J. Paulin, J. Zhang, O. Wallner, M. Scobie, A. Schmidt, A. Jenmalm-Jensen,
U. Warpman Berglund, T. Helleday, Computational and experimental druggability
assessment of human DNA glycosylases. ACS Omega 4, 11642–11656 (2019).
doi:10.1021/acsomega.9b00162 Medline
15. T. Visnes, M. Grube, B. M. F. Hanna, C. Benitez-Buelga, A. Cázares-Körner, T. Helleday,
Targeting BER enzymes in cancer therapy. DNA Repair 71, 118–126 (2018).
doi:10.1016/j.dnarep.2018.08.015 Medline
16. T. A. Rosenquist, D. O. Zharkov, A. P. Grollman, Cloning and characterization of a
mammalian 8-oxoguanine DNA glycosylase. Proc. Natl. Acad. Sci. U.S.A. 94, 7429–
7434 (1997). doi:10.1073/pnas.94.14.7429 Medline
17. B. Baños, J. M. Lázaro, L. Villar, M. Salas, M. de Vega, Editing of misaligned 3′-termini by
an intrinsic 3′-5′ exonuclease activity residing in the PHP domain of a family X DNA
polymerase. Nucleic Acids Res. 36, 5736–5749 (2008). doi:10.1093/nar/gkn526 Medline
18. I. Boldogh, G. Hajas, L. Aguilera-Aguirre, M. L. Hegde, Z. Radak, A. Bacsi, S. Sur, T. K.
Hazra, S. Mitra, Activation of ras signaling pathway by 8-oxoguanine DNA glycosylase
bound to its excision product, 8-oxoguanine. J. Biol. Chem. 287, 20769–20773 (2012).
doi:10.1074/jbc.C112.364620 Medline
19. R. Jafari, H. Almqvist, H. Axelsson, M. Ignatushchenko, T. Lundbäck, P. Nordlund, D.
Martinez Molina, The cellular thermal shift assay for evaluating drug target interactions
in cells. Nat. Protoc. 9, 2100–2122 (2014). doi:10.1038/nprot.2014.138 Medline
20. J. M. Baquero, C. Benítez-Buelga, V. Rajagopal, Z. Zhenjun, R. Torres-Ruiz, S. Müller, B.
M. F. Hanna, O. Loseva, O. Wallner, M. Michel, S. Rodríguez-Perales, H. Gad, T.
Visnes, T. Helleday, J. Benítez, A. Osorio, Small molecule inhibitor of OGG1 blocks
oxidative DNA damage repair at telomeres and potentiates methotrexate anticancer
effects. Sci. Rep. 11, 3490 (2021). doi:10.1038/s41598-021-82917-7 Medline
21. S. Roychoudhury, S. Pramanik, H. L. Harris, M. Tarpley, A. Sarkar, G. Spagnol, P. L.
Sorgen, D. Chowdhury, V. Band, D. Klinkebiel, K. K. Bhakat, Endogenous oxidized
DNA bases and APE1 regulate the formation of G-quadruplex structures in the genome.
Proc. Natl. Acad. Sci. U.S.A. 117, 11409–11420 (2020). doi:10.1073/pnas.1912355117
Medline
22. K. Kubo, H. Ide, S. S. Wallace, Y. W. Kow, A novel, sensitive, and specific assay for abasic
sites, the most commonly produced DNA lesion. Biochemistry 31, 3703–3708 (1992).
doi:10.1021/bi00129a020 Medline
23. P. Srivastava, A. Sarma, C. M. Chaturvedi, Targeting DNA repair with PNKP inhibition
sensitizes radioresistant prostate cancer cells to high LET radiation. PLOS ONE 13,
e0190516 (2018). doi:10.1371/journal.pone.0190516 Medline
24. N. Owen, I. G. Minko, S. A. Moellmer, S. K. Cammann, R. S. Lloyd, A. K. McCullough,
Enhanced cytarabine-induced killing in OGG1-deficient acute myeloid leukemia cells.
Proc. Natl. Acad. Sci. U.S.A. 118, e2016833118 (2021). doi:10.1073/pnas.2016833118
Medline
25. D. Zheng, Z. Chen, J. Liu, J. Wu, An efficient route to 1-aminoisoquinolines via AgOTf-
catalyzed reaction of 2-alkynylbenzaldoxime with amine. Org. Biomol. Chem. 9, 4763–
4765 (2011). doi:10.1039/c1ob05582h Medline
26. S. Gianni, A. Engström, M. Larsson, N. Calosci, F. Malatesta, L. Eklund, C. C. Ngang, C.
Travaglini-Allocatelli, P. Jemth, The kinetics of PDZ domain-ligand interactions and
implications for the binding mechanism. J. Biol. Chem. 280, 34805–34812 (2005).
doi:10.1074/jbc.M506017200 Medline
27. B. M. F. Hanna, T. Helleday, O. Mortusewicz, OGG1 inhibitor TH5487 alters OGG1
chromatin dynamics and prevents incisions. Biomolecules 10, 1483 (2020).
doi:10.3390/biom10111483 Medline
28. T. Visnes, C. Benítez-Buelga, A. Cázares-Körner, K. Sanjiv, B. M. F. Hanna, O.
Mortusewicz, V. Rajagopal, J. J. Albers, D. W. Hagey, T. Bekkhus, S. Eshtad, J. M.
Baquero, G. Masuyer, O. Wallner, S. Müller, T. Pham, C. Göktürk, A. Rasti, S. Suman,
R. Torres-Ruiz, A. Sarno, E. Wiita, E. J. Homan, S. Karsten, K. Marimuthu, M. Michel,
T. Koolmeister, M. Scobie, O. Loseva, I. Almlöf, J. E. Unterlass, A. Pettke, J. Boström,
M. Pandey, H. Gad, P. Herr, A.-S. Jemth, S. El Andaloussi, C. Kalderén, S. Rodriguez-
Perales, J. Benítez, H. E. Krokan, M. Altun, P. Stenmark, U. W. Berglund, T. Helleday,
Targeting OGG1 arrests cancer cell proliferation by inducing replication stress. Nucleic
Acids Res. 48, 12234–12251 (2020). doi:10.1093/nar/gkaa1048 Medline
29. W. C. Tse, D. L. Boger, A fluorescent intercalator displacement assay for establishing DNA
binding selectivity and affinity. Acc. Chem. Res. 37, 61–69 (2004).
doi:10.1021/ar030113y Medline

Science - Abf8980 SM

Uploaded by

Copyright:

Available Formats

Science - Abf8980 SM

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Science - Abf8980 SM

Uploaded by

Copyright:

Available Formats

Supplementary Materials for

Small-molecule activation of OGG1 increases oxidative DNA damage repair by

Maurice Michel et al.

Corresponding authors: Maurice Michel, [email protected]; Thomas Helleday, [email protected]

Science 376, 1471 (2022)

The PDF file includes:

Materials and Methods

Other Supplementary Material for this manuscript includes the following:

MDAR Reproducibility Checklist

N-cyclohexyl-3-cyclopropylisoquinolin-1-amine (TH12119) was synthesized according to

Target engagement assays

Proteins and reagents for EMSA

NaBH4 trapping assay

In vitro repair of 8oxodG containing DNA by hOGG1

Electrophoretic Mobility Shift Assays (EMSA)

AP lyase activity assay on AP site- and 8oxodG-containing substrates

Fluorescence recovery after photobleaching (FRAP), 8-oxoG Immunofluorescence and

Genomic 8-oxoG analysis

DNA extraction and quantification of oxidized bases in specific genome regions by

Relative AP-site quantification by FACS

Cell culture and maintenance

RNA sequencing and analysis

Data and Code availability

Differential Scanning Fluorimetry of four reported molecular enhancers of OGG1

TH10785 enhances OGG1 activity in biochemical assay performed in absence of

Mechanism of TH10785 binding to OGG1: (A) Close-up view of TH10785 (purple)

Effect of TH10785 on the formation of hOGG1-DNA complexes requires Lys249: (A)

Dynamic Protein-Ligand RMSD (Root-mean-square deviation of positions) of

Three induced-fit docked poses of TH10785 in a ternary complex of DNA, Protein

Activator-Inhibitor Chimera TH12161 is an OGG1 activator: To compare reaction

pKa prediction by Epik suggests control of β-elimination by preferable acid-base

OGG1 biochemical assay progress and activation is pH dependent: (A) hOGG1

Mechanism of TH12161 binding to mouse OGG1: TH101261 (cyan) binding to mouse

Effect of the compounds on the AP-lyase activity of hOGG1 on 8oxoG:C-containing

Effect of the compounds on the AP-lyase activity of hOGG1 on AP:C-containing

TH10785 increases recruitment of OGG1-GFP: (A) Representative live cell confocal

Number of oxidized bases is decreased by TH10785 in U2OS cells challenged with

DNA intercalation and auto-fluorescence test on TH10785: DNA intercalation was

TH10785 15 3.2 (3.2) ± 0.6 (0.7) 325 (330)

TH10785 (2 μM 5 1.3 (1.9) ± 0.3 (0.6) 325 (330)

Induced-fit docking scores of 8-oxoG and TH10785 in crystal structure of OGG1

U:C (EMSA) 5’-32P-CTGCAGCTGATGCGCUGTACGGATCCCCGGGTAC-3’ and

8-oxoG:C (EMSA) 5’-32P-GTACCCGGGGATCCGTAA8GCGCATCAGCTGCAG-3’ and

U:G (EMSA) 5’-CTGCAGCTGATGCGCUGTACGGATCCCCGGGTAC-3’-dAMP

List of primers and DNAand 3’-GACGTCGACTACGCGGCATGCCTAGGGGCCCATG-5’

Summary of tests for synthetic analogues generated during the

All numbered statements in Fig. S28 are supported by corresponding key

Mean ± SEM corresponding to Fig. 2A (right)

Mean ± SEM corresponding to Fig. 2B, 2C, 2H, 3A and 3B

PNKPi 0 µM PNKPi 1.25 PNKPi 2.5 PNKPi 5 PNKPi 10 PNKPi 20

Mean ± SEM corresponding to Fig. 3D, Fig. 3E

You might also like