Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212

Contents lists available at ScienceDirect

Journal of Genetic Engineering and Biotechnology

journal homepage: www.elsevier.com/locate/jgeb

Original Article

Influence of PEG induced drought stress on molecular and biochemical

constituents and seedling growth of Egyptian barley cultivars
F.A. Hellal a, H.M. El-Shabrawi b,⇑, M. Abd El-Hady c, I.A. Khatab d, S.A.A. El-Sayed a, Chedly Abdelly e
a
Plant Nutrition Dept., National Research Centre, Dokki, Cairo, Egypt
b
Plant Biotechnology Dept., National Research Centre, Dokki, Cairo, Egypt
c
Water Relation and Field Irrigation Dept., National Research Centre, Dokki, Cairo, Egypt
d
Department of Genetics, Faculty of Agriculture, Kafr El-Sheikh University, 33516 Kafr El-Sheikh, Egypt
e
Centre of Biotechnology of Borj Cedria, Tunisia

a r t i c l e i n f o a b s t r a c t

Article history: In order to investigate the effects of drought stress on germination components of barley cultivars, a
Received 21 February 2017 laboratory experiment was conducted in a factorial randomized complete design with four replications.
Received in revised form 10 August 2017 The controlled experiment included ten of Egyptian barley cultivars namely; (Giza 123, 124, 125, 126,
Accepted 5 October 2017
127, 129, 130, 134, 135 and 2000) as first factor. The second factor included 4 levels of drought stress
Available online 20 October 2017
inducer by applying 0, 5, 10 and 20% of polyethylene glycol-6000 (PEG) which is equivalent to four osmo-
tic potential levels including 0.001, 0.27, 0.54 and 1.09 MPa, respectively. The results showed that,
Keywords:
the highest reduction was related to the drought level of 20% PEG among the barley cultivars. The best
Barley
Drought stress
cultivars in terms of germination traits were Giza 134, Giza 127, and Giza 126 this indicate their tolerance
Seed germination to drought stress and Giza 130, 135, 2000 cultivars was moderately tolerance and remaining is less tol-
SDS-PAGE erance. The protein band 27 kDa and 78 kDa showed high intensity after stress in almost all cultivars.
Detoxification enzyme Those two protein bands their exciting was very clear in treated barley leaf tissue. It could be related
ISSR to dehydrine and oxygen evolving enhancer protein 2 (OEE2) which involved in drought stress tolerance
response. Cultivars Giza 127, 130 and 134 showed highest tolerance response under drought stress. The
antioxidant enzymes PAGE pattern of Peroxidase (POX), Sodium dismutase (SOD) and Ascorbate perox-
idase (APX) for Barley cultivars under drought stress revealed a high activities for Giza 126, 127, 134,
136 and 2000 under 0.5 MPa osmotic stress by PEG in most of their isoforms. Based on similarity coef-
ficient values the highest values were 1.0 with 100% similarly between tolerant cultivars Giza 130 and
Giza 127. Similarly between the susceptible cultivars 125 and Giza 129 was 60%.These data confirmed
by the growth parameters which we ranked as tolerant to drought stress.
Ó 2017 Production and hosting by Elsevier B.V. on behalf of Academy of Scientific Research & Technology.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-
nd/4.0/).

1. Introduction of water deficit. Moreover, most agronomic traits are expressed

differently in normal and stress conditions and are known to be
Water is one of the major limiting factors for the agricultural affected by environmental factors. Therefore, selection based on
production in arid and semiarid areas. Drought is the main envi- the phenotype would be difficult for such traits Hittalmani et al.
ronmental constraint, which often having devastating effects on [24].
crop productivity. Hence, improved tolerance to drought has been Stress tolerance in plants is a complex trait and direct selection
an important goal in crop improvement programs [35]. Drought for grain yield under stress conditions has been hampered by low
tolerance is a complex trait affected with many genes and mostly heritability, polygenic control, epitasis, and high genotype by
conditioned by many component responses, which may interact environment interactions. Determination of the molecular basis
and may be different with respect to types, intensity and duration of drought tolerance would allow and facilitate the targeted breed-
ing of cultivars adapted to stress [7].
Barley (Hordeum vulgare L.) is a grain cereal in dry land farming
Peer review under responsibility of National Research Center, Egypt. systems of semi-arid areas. In these areas water deficit and
⇑ Corresponding author. unsuitable distribution of rainfall decrease the germination and
E-mail address: [email protected] (H.M. El-Shabrawi).

https://doi.org/10.1016/j.jgeb.2017.10.009
1687-157X/Ó 2017 Production and hosting by Elsevier B.V. on behalf of Academy of Scientific Research & Technology.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
204 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212

establishment of barley. Barley is one of the most important cereal H2O2 + O2. Hydrogen peroxide is broken down to water by catalase
crops grown in many developing countries, where it is often sub- [2].
ject to extreme drought stress that significantly affects production Molecular markers reveal many polymorphisms at the DNA
[12]. Barley is grown over a broader environmental range than any level have been shown to be a very powerful tool for cultivar char-
other cereals where unfavorable climates prevail. In such condi- acterization and found gene(s) related to specific traits. Among
tions the barley encounters with drought stress during seed germi- these, simple sequence repeats (SSR) or microsatellite were
nation and early growth stages. These stages are the most showed to be high potential for identification and estimation and
vulnerable to drought stress and presenting a challenge in barley found gene(s) related to specific traits of barley genotypes . More
production [30]. than 775 microsatellites have been used by Varshney et al. [3].
Duman [16] reported that dryness stress decreases seed The genetic maps based on microsatellites for all seven barley
germination percentage and the length of radicle and plumule. chromosomes were conducted [4].
The creation and maintenance of a pure water potential in the This study was conducted elucidate the effects of various poly-
environment of soil is almost a difficult job. So in this regard, estab- ethylene glycol (PEG) osmotic solutions on molecular and bio-
lishing conditions of dryness stress using different osmotic materi- chemical parameters and early seedling growth of Egyptian
als to create the osmotic potential is considered as one of the best barley cultivars.
methods to study the effects of dryness stress on germination.
Among these substances, due to the simulation of natural environ-
mental conditions, polyethylene glycol has many applications and 2. Material and methods
is widely used in vitro [25]. Because this compound has a high
molecular weight, it cannot pass through the cell wall and there- The research was conducted in the growth champers of the
fore it is used to regulate water potential in germination tests. Plant biotechnology department, National Research Centre, Dokki,
Khazayi et al. [31] found that negative potentials between 0.4 EGYPT in 2016. Growth chambers conditions are: Light
and 0.8 MPa are the best condition for studying germination intensities at mid-canopy were maintained at approximately 400
features of different genotypes of plants under drought stress. lmols m 2 s 1. A photoperiod of 16 h light and 8 h dark was
El-Kholy et al. [18] emphasized that the highest N was recorded maintained using a combination of fluorescent lights and incandes-
for barley cultivars (Giza123, 124, 125, 126, 129 130 and 2000) cent lights. Temperatures were maintained at 23° C daytime and
grown under normal conditions. Plant nutrients such as, P, K, and 18° C nighttime and were monitored using chart recorders. Rela-
Na in all cultivars decreased under water stress condition. Taha tive humidity was maintained at approximately 50%.
et al. [46] evaluated three barley cultivars (Giza 123, Giza 124 The experiment was carried out as factorial in the form of ran-
and Giza 125) for its ability to release root exudates under iron domized complete design with four replications. The first factor
deficient condition. Barley cultivars Giza 123 proved better dry contained ten barley cultivars (Giza 123, 124, 125, 126, 127, 129,
matter, and exudates contents over Giza 124 and Giza 125. 130, 134, 135 and 2000). Barley (Hordeum vulgare L.) cultivars
Abdel-Moneam et al. [1] indicated that drought susceptibility seeds were kindly provided by Barley Department, Agricultural
index (DSI) over both conditions indicated that line-2, line-7, Giza Research Centre, Giza, Egypt. The second factor included four levels
130 and Giza 131 were tolerant for most traits, indicating the of drought stress created by adding polyethylene glycol-6000
importance of these parents in this regard. So, these genotypes (PEG) at four concentrations: 0, 5, 10 and 20%. The factors were
should be involved in breeding programs for developing new toler- priming with polyethylene glycol (PEG 6000) at four osmotic
ant varieties to water stress [19]. potential levels including 0.001, 0.27, 0.54 and 1.09 MPa.
El-Denary and El-Shawy [17] studied the water stress induced PEG was used because it has a high molecular weight, it cannot
by PEG application on three barley (Hordeum vulgare L.) genotypes. pass through the cell wall and therefore it is used to regulate water
Results showed that germination percentage, shoot length, root potential in germination tests. Polyethylene glycol 6000 was used
length and total dry mater were the most effective traits between to evaluate resistance to drought at germination stage and to cre-
sensitive and tolerant genotypes. Giza 126 and California Marriott ate different levels of water potential.
were tolerant and stable under different stress levels, while the To assess water stress tolerance during germination, the seeds
sensitive variety Giza 129 showed sharp decrease in germination were immersed in the solution of sodium hypochlorite 1% for 5
percentage, shoot length and total dry mater. min and were disinfected; then, washed by distilled water three
In addition to other biochemical and molecular changes that times. Petri dishes and the seeds bed (Whatman paper) were all
follow when plants are under stress, it is very well established that sterilized in autoclave. Ten seeds of each variety were transferred
the effects of various environmental stresses, including drought into each sterilized glass Petri dish with a diameter of 9 cm in
stress, are mediated, at least partly, by enhanced generation of which the filter papers were placed. Five ml of distilled water
reactive oxygen species (ROS) like superoxide radical (O2 ), singlet was added to each Petri dish. Then, after 24 h 10 ml of the solution
oxygen (O2 ), hydrogen peroxide (H2O2) and hydroxyl ions (OH) related to each treatment was added to the Petri dishes. The germi-
[34,37]. Chloroplasts, mitochondria and peroxisomes are impor- nated seeds were counted until full germination. The seeds whose
tant intracellular generators of activated oxygen species [42,13]. root length is 2 mm or more are considered as the germinated
The increased production of toxic oxygen derivative is a common ones. In the 8th day, the germinated seeds were taken out of the
feature of stress conditions. Plants have evolved a wide range of Petri dishes and the stem and root were separated to assess the
mechanisms to contend this problem. The capacity and activity morphological parameters. At this stage, germination component
of antioxidant defense system are important in limiting the oxida- was calculated according to ISTA [27].
tive damage and in destroying the active oxygen species that are Germination percentages (G%) were calculated as total number
produced in excess of those normally required for metabolism. of germinated seeds by total number of seed used into 100. Germi-
The plant cells have evolved antioxidant defense mechanism to nation rate (GR) was calculated as the summation of newly germi-
prevent the danger posed by these reactive oxygen species. This nated seeds on each day divided by number of days that elapsed
mechanism includes scavenging free radicals by natural antioxi- since onset of imbibitions with seed numbers adjusted to a base
dants such as glutathione, ascorbate [45]. For the destruction of of 100. The Seedling vigor index (SVI) was calculated as shoot
H2O2 several antioxidative enzymes act in synchrony. SOD, POX, and root length into germination percentage divided by 100.Root
GPX catalysis superoxide to hydrogen peroxide: 2O2 + 2H+ = and shoot length, root and shoot fresh weight, root and shoot dry
 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212 205

weight was evaluated. Root: shoot ratio calculated as root length The data were statistically analyzed according to Gomez and Gomez
divided by shoot length into 100. Root and shoot dry weight was [22]. The least significant differences (LSD) were used to compare
obtained after drying at 70 °C for 48 h. Tissue water content calcu- differences among treatment means at 5% level.
lated as shoot fresh weight minus shoot dry weight divided by
shoot fresh weight percentage.
3. Results and discussion
2.1. SDS–PAGE proteins profile under drought stress
3.1. Number of germinated seeds
Barley cultivars under study were analyzed for protein profile,
total soluble protein was done as suggested by Larkindale and Number of germinated seeds of the studied barley cultivars as
Huang (2004). Protein present in the supernatant was measured affected by Polyethylene glycol (PEG) presented in Table 1 and
by a modification of the method using crystalline bovine albumin Fig. 1. Results showed that the highly germinated seed number
to establish a standard curve. was recorded after 5 days in cultivar Giza 127 (5.58) followed by
SDS PAGE was performed as described by Leammli et al. Giza 134 (5.14), while the lowest ones were detected for Giza
(1970). Changes in proteins having isoenzymic activity of the 123, 124, 125; 135. However, Giza 126, 130; 2000 were intermedi-
ROS scavenging enzymes were studied using PAGE under nonre- ate. Also, after 5 days, germination speed for cultivar Giza 127 and
duced, non-denatured conditions at 4 °C. Native PAGE analysis 134 was still the superior followed by Giza 125, 126; 134 and the
was performed for various enzymes involved in the ascorbate– rest of the studied cultivars were lower than the previous one. At
glutathione cycle on a gel (10%) with protein load of 50 lg in the end of the germination test, the most studied cultivars were
each well. Specific procedures for running and staining of gels improved such as Giza 125, 126, 127, 130, 135; 2000 and the high-
for different enzymes are given below. Staining of gels for SOD est germinated seed number was registered for Giza 134 (7.75), but
activity. Gels were soaked in NBT (2.45 mM) for 20 min followed the Giza 124 (3.67) was the lowest one.
by immersion in a solution containing TEMED (28 mM), riboflavin Drought is one of the important tensions in reducing the growth
(3 lM), and potassium phosphate (50 mM, pH 7.8) for 15 min. and production of plants. It can affect many aspects of plant meta-
Illumination was discontinued after maximum contrast between bolism and growth, because this tension reduces germination rate
the achromatic zones and general blue colour was achieved. Gel and percentage and finally delays establishment of plantlets Prisco
was pre-run for 30 min using electrode buffer containing 2 mM et al. [40]. According to the effect of the PEG % on the germinated
Ascorbate before the samples were loaded. Gel showed dark speed, resulted data revealed that increasing PEG % associated with
brown bands and was photographed immediately. Staining for decrease in germination rate with decreasing percentage 24%, 49%,
GR isoforms was performed. 81%; 25%, 46%, 77% and 19%, 42%, 45% at PEG % 5%, 10%; 20% after 3,
5; 7 days as compared with untreated ones, respectively. So it is
2.2. DNA extraction and PCR amplification for microsatellite markers clear that PEG% had a negative effect on the germinated seeds in
early stage while this negative effect was minimized at the end
Genomic DNA of the ten barley cultivars under investigation was of germination test.
extracted from leaves using CTAB method according Doyle and
Doyle [15]. DNA concentration was measured using Nane drop. Poly- 3.2. Root and shoot length
merase chain reaction (PCR) amplification was prepared in volume
of 25 ll using 40 ng of genomic DNA, 2 lmol dNTP, 25 mM of MgCl2, Root and shoot length measured at the end of the germination
10 pmol of each primer, and a 0.5 ll of 5U of Taqpolymerase. PCR test. Data in Table 1 noticed that the highest values were recorded
was carried out as the following program; one cycle at 95 °C for 5 at Giza 126, 127, 130; 134 followed by Giza 125, 2000 for root
min., then 35 cycles was performed as follow: 1 min at 95 °C for length. Similar trend was observed in case of the shoot length at
denaturation stage, 45 s. at 55 °C for annealing stage and 30 s. at the end of the germination test, except Giza 126, 134 cultivars
72 °C for extension stage. Reaction was incubated at 72 °C for 7 which were the best followed by Giza 125, 127, 130; 2000.
min. Amplification of SSR were compared with each other and Whereas, the lowest values in both characters were Giza 123,
DNA bands were scored as present (1) or absent (0), using Jacared 124, 129, 135 (root) and Giza 124 (shoot).
coefficient using PAST program (PAleontological Statistics Version Root/shoot ratio as affected by PEG % indicated that to similar
1.94b) adapted by Hammer et al. [23]. Cluster analysis was per- trend for the highest value (2.03, Giza 134) followed by Giza 123
formed to produce a dendrogram using unweighted pair-group (1.93), while the lowest values was recorded for Giza 123 (1.55).
method with arithmetical average (UPGMA). This finding could be explained on the base of the cultivars tolerant
List of SSR primers sequences used was; to osmotic pressure that gained from PEG %. Also, data noticed that
there were highly significant correlation between roots and shoot
Primer name Sequence length with germination studied periods. The obtained r values
of the correlations increased with increase the germination periods
Bmag 603 F- ATACCATGATACATCACATCG and
for both root and shoot length and the values were 0.820⁄⁄, 0.829⁄;
R- GGGGGTATGTACGACTAACTA
0.886⁄⁄ and 0.871⁄⁄, 0.919⁄⁄; 0.968⁄⁄ for the germination periods 3,
Ebmac 84 F- TTCCGTTGAGCTTTCATACAC and
5 and 7 days, respectively.
R- ATTGAATCCCAACAGACACAA
GBM1459 F- AACACATCCATACTTCCCCG and
R- AGCTGAATAAATGCCCATGC 3.3. Germination percentage and rate
GBM1405 F- TACACGCACTGAAAAGACGG and
R- CTCGCTGCTGAGTTTGTCTG Germination is one of the most critical periods in the life
GBM1221 F-ACCAGCAATCCAAGTTACGG and cycle of plants. Under water stress, low water potential is a
R-TGCCTTGGTCTTGGTGTGTA determining factor inhibiting seed germination [47]. Table 1
Bmag770 F- AAGCTCTTTCTTGTATTCGTG and and Figs. 2 and 3 illustrated the effect of the investigated barley
R-GTCCATACTCTTTAACATCCG cultivars on the germination percentage. Resulted data revealed
that there were three groups could be recognized. The first one
206 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212

Table 1
Effect of PEG on germination and plant length of barley.

Barley cultivars PEG levels (%) Number of germinated seeds at Plant length Root:Shoot ratio Germination
(cm/plant)
3 day 5 day 7 day Root Shoot Rate (%)
Giza 123 0 4.33 5.67 6.33 4.83 5.90 83.69 3.5 63.3
5 3.33 3.67 5.00 2.83 6.27 48.67 2.6 50.0
10 2.33 3.33 4.67 2.83 4.23 66.87 2.1 46.7
20 0.00 0.33 0.67 0.50 0.67 25.00 0.2 6.7
Giza 124 0 6.00 8.00 9.00 5.50 7.83 70.1 4.9 90.0
5 3.00 3.67 4.67 2.83 6.50 43.5 2.4 46.7
10 0.67 0.67 1.00 0.67 1.00 22.2 0.5 10.0
20 0.00 0.00 0.00 0.00 0.00 0.0 0.0 0.0
Giza 125 0 5.67 8.00 9.00 4.67 8.67 55.40 4.8 90.0
5 3.67 5.33 7.00 3.00 6.33 47.65 3.3 70.0
10 2.67 4.00 5.33 2.17 4.50 49.69 2.5 53.3
20 2.00 3.33 3.67 2.17 3.67 59.52 1.9 36.7
Giza 126 0 7.00 9.00 9.67 4.17 8.83 47.49 5.5 96.7
5 4.33 6.00 7.67 3.67 6.33 60.23 3.7 76.7
10 3.00 4.00 5.00 3.17 6.00 52.54 2.5 50.0
20 2.00 2.67 3.67 2.67 4.00 66.87 1.7 36.7
Giza 127 0 8.67 10.00 10.00 5.17 9.67 53.42 6.3 100.0
5 7.67 9.33 9.33 4.50 8.00 56.97 5.8 93.3
10 6.00 8.00 8.33 3.50 6.00 58.61 4.8 83.3
20 0.00 0.00 0.00 0.00 0.00 0.00 0.0 0.0
Giza 129 0 3.67 5.33 7.00 4.67 9.17 50.87 3.3 70.0
5 3.33 4.00 5.33 2.33 4.00 58.86 2.7 53.3
10 2.67 3.67 4.00 1.83 3.00 63.10 2.2 40.0
20 0.00 0.00 0.00 0.00 0.00 0.00 0.0 0.0
Giza 130 0 5.33 6.33 8.33 5.33 8.17 67.09 4.2 83.3
5 4.67 5.00 7.33 3.33 5.67 60.75 3.6 73.3
10 3.67 4.33 5.67 2.83 5.00 57.07 2.9 56.7
20 2.67 3.67 4.67 2.17 3.33 65.08 2.3 46.7
Giza 134 0 7.33 8.00 10.0 4.17 8.33 50.24 5.5 100.0
5 6.67 7.67 9.00 3.50 7.00 49.83 5.0 90.0
10 4.33 5.33 7.67 3.00 6.67 45.38 3.6 76.7
20 2.33 3.67 4.33 2.17 4.00 55.29 2.1 43.3
Giza 135 0 4.67 6.00 7.67 4.17 8.33 49.84 3.9 76.7
5 2.67 5.00 6.00 3.17 4.67 86.60 2.7 60.0
10 2.33 3.67 4.67 1.83 3.17 64.29 2.2 46.7
20 0.33 0.33 0.67 1.33 2.67 50.00 0.3 6.7
Giza 2000 0 6.33 7.67 8.67 4.50 9.67 47.1 4.9 86.7
5 5.33 6.00 7.67 3.17 6.17 51.5 4.1 76.7
10 2.33 3.33 3.33 2.33 3.50 45.37 1.9 33.3
20 2.00 2.67 3.33 2.17 3.33 67.14 1.7 33.3
LSD (0.05)
Barley varieties (V) 0.77 1.12 0.91 0.47 1.25 9.35 0.37 6.18
PEG levels (T) 0.39 0.45 0.41 0.33 0.56 11.79 0.88 4.93
(V*T) 1.19 1.34 1.36 0.90 2.52 41.19 1.15 12.71

Fig. 1. Germination speed of barly cultivars as affected by PEG levels.

include cultivars (Giza 134, 127) that scored germination per- were less than 47%. This finding represented the strength of
centage more than 69% and the second one include and Giza the cultivars and expresses their storage from carbohydrates.
125, 126; 130 that germination percentage ranged between 60% Also, it is clear to observe the narrow range between the first
and 69% and the third group (Giza 135; 2000) that ranged two groups, where the highest one was relative to the genetic
between 47% and 60%, while the rest of the studied cultivars features of the cultivars.
 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212 207

Fig. 2. Differences in germination % and rate of barley cultivars.

Fig. 3. Relation between germination % and rate and PEG levels.

Regarding to the effect of the osmotic pressure resulted from 3.4. Fresh and dry weight
PEG rates on the germination percentage, data on hand showed
that the increase in PEG dramatically decreased germination per- Regarding to the fresh and dry weight of shoot and root barley
centage, where the increase in PEG by 5% decreased germination cultivars as affected by PEG rates. Data presented in Table 2
percentage by 19% relative to the untreated one. But increasing showed that with each cultivars, increasing PEG led to progres-
PEG from 5% to 10% decreased germination percentage by 9%. sively decreased in both fresh weight and dry weight of root, but
Whereas, increased PEG from 10% to 20% decreased germination it is clearly mentioned that highly fresh weight of root were
percentage by 30%. The results affected directly on the total ger- recorded at Giza 124, Giza 125 were superior due to their values
mination percentage. Salehi [43] reported the reduction of ger- that exceeds 125 mg/plant, while Giza 123, Giza 134, Giza 2000
mination percentage and the increase of osmotic potential were more than 50 mg/plant. Another trend was attained in case
produced by polyethylene glycol. Kafi et al. [29] stated that as of the fresh weight of shoot where Giza 125 was the best one
the water potential decreased, germination percentage, germina- and scored 146.2 mg/plant. Also, there were two cultivars (Giza
tion rate, root length, stem length, root dry weight, and stem dry 124 > Giza 2000) have got the second highest values (more than
weight decreased. The interaction effect of the PEG rates on the 100 mg/plant) as well as Giza 127, 123, 134 recorded fresh weight
examined barley cultivars mentioned that PEG at 20% had a values 86.6, 72.3; 70.0 mg/plant, respectively. Similarly, Baalbaki
harmful effect on the germination percentage especially for bar- et al. [9] reported that root and shoot weights of all wheat cultivars
ley cultivars Giza 124, 127 and Giza 123, 135 recorded the low- declined when osmotic potential was decreased, but the extent of
est germination percentage. Also, Fig. 2 showed highly reduction in root growth was less than that for shoots. Regardless
correlation between germination percentage and rate except for of barley cultivars, Table 2 revealed the effect of PEG rates on the
the cultivar Giza 127. fresh weight of root and shoot. Data on hand pointed out that
It is worthy to mention that cultivars Giza 127, 134 were increasing PEG% associated with reduction in fresh weight of both
superior since the gained the highest germination percentage, root and shoot and the reduction values were 69.3, 80.9, 90.6 and
followed by Giza 126 (96%), 124(90%); Giza 125 (90%) under 57.6, 75.2 and 85.2 at PEG % 5, 10; 205 for root and shoot fresh
control treatments. The most tolerant cultivars were 134 (77%) weight relative to the control, respectively. Also, data indicated
and Giza 127 (83%) and the following cultivars comes intermedi- that increase PEG level led to reduction by 7; 11% and 58, 18%
ate (Giza 125/53%, Giza 126/50%; Giza 123/47%) relative to the for PEG at 5% and 10% relative to the untreated treatment, respec-
PEG 10%. Also, it could rank the reduction in germination per- tively. Jamshidi [28] investigated safflower genotypes under water
centage as a result of the PEG addition as follows 20% (57.7) stress and reported that at lower potential levels the seedlings had
>10% (25.0) >5% (9.5%) relative to the untreated control treat- thinner and longer roots than the control treatment and as the
ment. Germination is one of sensitive step to drought stress; stress increased up to about 1.2 MPa, the root length reduced more.
trait modification related to germination is important purposes Oskooei [38] reported that as the drought stress increased, the
in regions which plant establishment is failed due to drought stem growth decreased (Table 3).
Bayoumi et al. [10]. Germination process is controlled by envi- According to the fresh weight of root and shoot as affected by
ronmental and hormonal factors. Light, oxygen, temperature different studied barley cultivars, data in Table 2 showed that bar-
degree and water availability plays important role among other ley cultivars Giza 124, 125 were superior ones for fresh weight of
factors [20]. root and gained the highest values as 40.6, 45.2 mg/plant,
208 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212

Table 2
Effect of PEG on root and shoot weight and seedling vigor index.

Barley cultivars PEG levels (%) Fresh weight Dry weight Tissue water content Seedling vigor index
(mg/plant) (mg/plant) (%)
Root Shoot Root Shoot Root Shoot
Giza 123 0 84.4 72.3 3.67 6.58 95.7 90.9 6.80
5 20.4 28.7 1.07 2.21 94.7 92.3 4.55
10 12.0 4.6 0.71 0.51 94.1 88.9 3.30
20 0.6 1.1 0.04 0.09 31.1 30.6 0.08
Giza 124 0 126.1 116.1 6.01 8.93 95.2 92.3 12.00
5 23.6 28.7 0.98 2.61 95.8 90.9 4.36
10 12.7 8.1 0.70 0.81 31.5 30.0 0.17
20 0.0 0.0 0.00 0.00 0.0 0.0 0.00
Giza 125 0 125.2 146.2 7.83 16.25 93.8 88.9 12.00
5 22.2 34.8 1.23 2.48 94.4 92.9 6.53
10 17.8 28.1 0.94 3.51 94.7 87.5 3.56
20 16.9 24.3 1.05 2.21 93.8 90.9 2.14
Giza 126 0 24.4 47.8 1.06 4.34 95.7 90.9 12.57
5 15.6 38.9 0.78 2.99 95.0 92.3 7.67
10 8.9 24.6 0.49 2.73 94.4 88.9 4.58
20 8.0 22.2 0.47 1.85 94.1 91.7 2.44
Giza 127 0 45.6 86.7 2.40 6.67 94.7 92.3 14.83
5 21.8 57.3 1.36 5.21 93.8 90.9 11.67
10 17.8 31.7 1.19 3.17 93.3 90.0 7.92
20 12.2 14.4 0.58 1.81 31.7 29.2 0.00
Giza 129 0 30.4 65.9 1.32 7.32 95.7 88.9 9.68
5 13.3 15.0 0.70 1.07 94.7 92.9 3.38
10 12.2 12.2 0.72 1.53 94.1 87.5 1.93
20 0.0 0.0 0.00 0.00 0.0 0.0 0.00
Giza 130 0 45.6 53.3 2.17 4.85 95.2 90.9 11.25
5 18.9 40.0 0.79 3.08 95.8 92.3 6.60
10 6.9 21.1 0.38 2.35 94.4 88.9 4.44
20 4.3 8.9 0.31 0.74 61.9 61.1 2.57
Giza 134 0 24.0 70.0 1.50 5.38 93.8 92.3 12.50
5 18.2 33.4 1.01 3.04 94.4 90.9 9.45
10 14.0 31.1 0.74 3.11 94.7 90.0 7.41
20 6.0 11.9 0.38 1.49 93.8 87.5 2.67
Giza 135 0 55.6 50.2 2.42 5.58 95.7 88.9 9.58
5 5.7 12.2 0.28 0.87 95.0 92.9 4.70
10 4.1 10.8 0.23 1.35 94.4 87.5 2.33
20 0.7 0.9 0.04 0.08 31.4 30.3 0.27
Giza 2000 0 56.7 101.1 2.98 7.78 94.7 92.3 12.28
5 30.0 54.4 1.88 3.89 93.8 92.9 7.16
10 11.7 28.7 0.78 2.87 62.2 60.0 1.94
20 9.4 12.2 0.45 1.22 95.2 90.0 1.83
LSD (0.05)
Barley cultivars (V) 16.06 16.86 1.47 0.85 17.15 17.83 1.99
PEG Levels (T) 10.77 12.14 0.97 0.60 10.43 10.84 2.06
(V*T) 35.17 42.46 3.29 1.94 35.15 37.41 3.11

Table 3
Similarity coefficient values among ten barley cultivars.

Giza 134 Giza 130 Giza 127 Giza 2000 Giza 126 Giza 124 Giza 123 Giza 135 Giza 125
Giza129 0.25 0.25 0.25 0.29 0.29 0.33 0.20 0.40 0.60
Giza 125 0.25 0.43 0.43 0.29 0.29 0.60 0.50 0.17
Giza 135 0.13 0.13 0.13 0.14 0.14 0.17 0.00
Giza 123 0.00 0.33 0.33 0.00 0.00 0.50
Giza 124 0.25 0.43 0.43 0.13 0.29
Giza 126 0.57 0.22 0.22 0.67
Giza 2000 0.57 0.38 0.38
Giza 127 0.33 1.00
Giza 130 0.33

respectively. While the lowest values recorded with barley culti- The maximum and minimum dry weight values were attained
vars Giza 129–14.0). In case of fresh weight of shoot still Giza at control treatment (distilled water) and at PEG at 20%, respec-
125 the best variety (58.3 mg/plant) followed by Giza 2000 (49.1 tively. Barley cultivar Giza 124 was superior in both root and shoot
mg/plant) and Giza 127 (47.5 mg/plant). Whereas, the variety Giza dry weight. Regarding to the root and shoot dry weight, data in
124, 126, 130, 134 were intermediate values and the rest examined Table 2 illustrated that within barley cultivars, PEG rate had a neg-
cultivars were the lowest, especially Giza 135 (18.5 mg/plant). ative effect on the dry weight of both root and shoot. This negative
 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212 209

effect was observed in descending order, the following barley cul- cultivars Giza 2000 (12.26), Giza 134 (12.50), Giza 127 (14.83),
tivars Giza 124 > Giza 129 > Giza 135 > Giza 125 relative to their Giza 126 (12.57), Giza 124, 123 (12.0), while the lowest values of
values at PEG at 10% and 20%. Total dry mater of root and shoot, seedling vigor index were recorded in Giza 124, 129 (0.0) and Giza
germination percentage, shoot length, root length were the most 123, 135 gained the lowest values. Dryness stress decreases seed
effective traits between sensitive and tolerant barley cultivars [17]. germination percentage and the length of radicle and plumule
Regarding to the effect of investigated barley cultivars on dry [16]. Regarding to the effect of barley cultivars on the seedling
weight of root and shoot, data in Table 2 represented that Giza vigor index, resulted data pointed out that cultivars Giza 127,
125 gained the highest value, which is doubled of the following 134 scored the highest values (8.60, 8.01, respectively. While culti-
cultivars Giza 127, Giza 2000, Giza 134 and Giza 124. Whereas, vars Giza 123, 129 recorded the lowest values (3.68, 3.75). In addi-
under shoot dry weight same trend observed. With respect to the tion Giza 125, 126, 130 were in between (about 6) or (6.06, 6.82).
effect of PEG rates on the dry weight of root and shoot, data found The rate of change in seedling vigor index relative to the
that PEG had a negative effect where a progressively decrease was increase PEG% was highly. Meanwhile, the increase in PEG com-
noticed. The highest and the lowest values of dry weight of root bined with decrease in seedling vigor index. The rate of decrease
and shoot were recorded at distilled water (control) and PEG was 41.8%, 43.1% and 68.1% at PEG 5%, 10%; 20% as compared with
20%, respectively. The rate of reduction in dry weight of root and control. Also, it is clear to mention that the rate of the decrease rel-
shoot were highly after 5% than other rates of PEG and the values ative to PEG unit (5%) were 41.8% and 2.3% for 5% and 10% PEG
were 67.8, 78.1, 89.4; 62.7, 70.2, 87.1 at PEG 5%, 10%, 20% for root comparing with untreated. While increased PEG by doubled (from
and shoot dry weight, respectively. Akhondi [6] reported that as 10% to 20% PEG) led to decrease seedling vigor index by 25%. PEG
the stress increased, morphological traits such as root length solutions caused a growth reduction in shoots of triticale seedling;
decreased. Shahriari and Hassan [44] reported that as the levels however, the root dry matter increased with rising osmotic stress
of stress increased the length of root decreased. The decrease of ( 0.45 MPa) [8]. The presence of increased concentrations of PEG
elongation of stem and root (stem and root) due to drought stress during the growth of seedling inhibits the developmental traits
could be associated with the fact that meristem cells of the root and survival of barley seedling. Shoot length, root length, germina-
and stem are affected and the cell division and elongation process tion percentage and dry weight were always decreased by expo-
is disrupted. Water deficit conditions affect the water absorption sure to all the stress levels tested. It was clear that as the stress
by the cells and thus the necessary turgescence pressure for the level increases, the seedling vigor index decrease. A similar obser-
cells enlargement decreases which accelerates the growth stop- vation was reported by Radhouane [41]. Nemat et al. [36] showed
ping or slowing. that Giza 126 was better than the other genotypes under the stress
levels tested. The tested genotypes varied significantly in their
3.5. Tissue water content reaction to PEG. However, the reduction in shoot and root length
may be due to an impediment of cell division and elongation lead-
From Table 2 results showed that same trend was obtained ing to kind of tuberization. This tuberization and lignification of the
regarding to the effect of interaction between barley cultivars root system allows the plant to enter a slowed-down state, while
and PEG rates on the tissue water content (root and shoot). The waiting for the conditions to become favorable again [21].
barley cultivars (Giza 124; Giza 129) had affected by high rate of
PEG at 20%. Also, the highest values of tissue water content were
3.7. SDS- PAGE profile of germinated barley cultivars under PEG
recorded at distilled water followed by 5% PEG. In addition, results
treatment
noticed that variety Giza 125 and Giza 2000 were the superior
ones. In case of the cultivars effect on the tissue water content
The SDS–PAGE profile revealed that the soluble protein accu-
(root and shoot), Table 2 indicated that Giza 124, 126, 134 scored
mulation increased after 20% PEG treatment for all nine barley
the highest values followed by Giza 130, 200, Giza 123 and Giza
genotypes (Giza 123, 125, 126, 127, 130, 134 and 2000), except
127, in sequences. Regarding to the germination rates effect on
Giza 124 and 135 which showed decreasing of total soluble protein
the tissue water content (root and shoot), Table 2 recorded that
under PEG treatment (photo 1). It is very obvious that the upper
the highest and lowest values were attained in distilled water
band with molecular weight 78 KDa existed in all PEG treated sam-
(untreated) and PEG at 20% in both root and shoot. The rate of
ples and it was very hard to detect it in normal samples. Also there
change resulted from PEG rates relative to the control were 0.3%,
is another drought induced band with molecular weight 14 kDa at
10.7%, 43.9% and 1.4%, 12.0%, 43.7% for root and shoot, respec-
the end of the SDS–PAGE gel. The overall profile of the nine barley
tively. Water stress therefore appears to reduce the absorption
and utilization of water to such an extent that the tolerance mech-
anisms employed by these plants in a drought are insufficient to
maintain normal growth. Depending on decrease in shoot growth,
tissue water content (TWC) gradually declined with the increasing
of concentration of PEG. Relative water content (RWC) was used as
a measure of drought. This index may be useful for determining the
plant leaf water status. Drought induced with PEG decreased shoot
water status in the present study. But seedlings of large seeds had
higher relative water content than that of medium and small seeds.
This result indicated that large seeds having longer root lengths
had more water uptake abilities resulting in higher TWC of shoot
[14].

3.6. Seedling vigor index

With respect to the seedling vigor index (SVI) as affected by

both barley cultivars and PEG %, results in Table 2 and Figs. 4
and 5 showed that the highest SVI were recorded for barley Fig. 4. Cultivar differences in seedling vigor index.
210 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212

However, based on the band thickness showed by all cultivars,

it was observed that dehydrin protein produced by plants under
stress condition thicker than the one in the normal condition.
Dehydrins are a group of plant proteins which respond to any type
of stress that causes dehydration at the cellular level, such as cold
and drought stress. Previously, three dehydrins of 65, 60, and 14
kDa were identified as the predominant proteins present in cold
acclimated blue berry and in response to drought. Biochemical
markers also are key tools in the evaluation of genetic variability
in both natural populations and germplasm accessions. As exam-
ple, storage protein (Hordein and glutenin) has a great inter-
genotypic variation, and has been used as marker in cultivar iden-
tification, genetic diversity studies, determination of phylogenic
origins [11] and in covered and hulless barley [32].

Fig. 5. Relation between seedling vigor and PEG. 3.8. ROS scavenging system of barley germinated cultivars under PEG

In gel antioxidants enzymes pattern activities of barley seedlings

cultivars under drought condition. Screening of electrophoretic pro-
genotypes is highly accumulation of soluble protein in leaf tissue file of detoxification enzymes (POX, SOD and APX) ware already
after 10 days of 20% PEG. studded in 10 barley cultivars shoots under two levels of osmotic
The study the effects of drought stress on barley may change stress using PEG (0 and 10%) on seedlings stage (Fig. 3). The POX
their gene expression and protein accumulation during a biotic activity in barley cultivars was so high under 0.5 MPa of 10% PEG
stress. In an attempt to understand the molecular basis of barley specially in the lower group of peroxidase isozyme II and III compar-
drought tolerance, a SDS–PAGE method was used to screen pro- ing to the basal level of activity profile in normal conditions. G135
teins involved in drought stress response. It is widely known that and G136 was showing highest activity rather than G126 and
there are numerous transient responses to environmental shock G127 for the isozyme no II. All barley seedlings of the Pox gel pattern
and that many of these genes are common to several types of stres- showed low regulation of almost all POX isoforms in normal condi-
ses, such as cold, salinity, heat and drought stress. Some proteins tion and up regulation under osmotic pressure specially isoform no
were found to express at a lower level in drought stress plants. This III in all cultivars. The specific SOD isozyme activities were also
could be due to the inhibitory effects of drought stress on tran- tested in barley shoot seedlings (Fig. 3). The base activity level of
scriptional process. Another protein may induce after stress like Mn SOD and Cu, Zn SOD isoforms were very low in all barley culti-
dehydrin proteins. It seems that the initial increase in total soluble vars. Under 0.5 MPa the Cu, Zn SOD isoform were up regulated
proteins during drought stress was due to the expression of new and their bands shows high activities comparing to Mn SOD was dra-
stress proteins, but the decrease was due to a severe decrease in matically decreased G125, G126 and G127 revealed a heights activ-
photosynthesis. Photosynthesis is decreased in drought stress ity under 10% PEG germination treatment. The Fe SOD isoform could
and materials for protein synthesis weren’t provided; therefore, not be detected in barley shoot during all course of PEG experiment.
protein synthesis dramatically reduced or even stopped. Those Only G 2000 and 136 showed another third band of Cu SOD in osmo-
two bands were present in the stress and control (normal) condi- tic stress conditions. The APX activity of Barley shoot under osmotic
tion which indicates that some inducible protein like dehydrin pro- stress showed interesting activity response. All the three isoforms
teins was produced either in stressed or normal condition. This were upregulated under drought stress for all barley cultivars
finding is in accordance to the research reported previously that (G 126, 127, 136 and 20,000) specially isoform I and III. The activity
a similar size of dehydrin protein (approximately 78 kDa) was of isoform No. II did not change after increase the osmotic pressure
expressed in both irrigated leaf tissues and drought-stressed tis- (Fig. 3). All the isozyme assay of three detoxification enzymes
sues in P. bulbosa. (POX, SOD and APX) by PAGE technique confirmed the previous data

Giza 123 Giza 124 Giza 125 Giza 126 Giza 127 Giza 130 Giza 134 Giza 135 Giza2000

Fig. 6. Total soluble proteins profile under drought stress using 1D - SDS-PAGE.
 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212 211

G123 G124 G125 G126 G127 G130 G134 G135 G136 G2000 G123 G124 G125 G126 G127 G130 G134 G135 G136 G2000

Fig. 7. Similarity dendrogram of ten cultivars based on band polymorphisms by SSR.

and the classification of the tolerant barley and sensitive barley affected by drought stress more than germination percentage.
cultivars. Most cultivars had acceptable germination in drought stress of
0.54 MPa (10% PEG) which indicates the characteristics of barley
3.9. DNA extraction and PCR amplification for microsatellite markers in tolerating drought stress and its suitability for being cultivated
in arid and semiarid areas. Treatment with 0.54 MPa can be the
Out of six used primer pairs, three primers showed monomor- germination sensitivity threshold for the studied barley cultivars.
phic fragment profiles (GBM 1459, GBM1405 and GBM 1221) In summary, due to its better growth responses to drought stress,
which were discarded from analysis. The outstanding three primer Giza 134, 127 and 126 cultivars was the superior one and Giza 129
pairs (Bmac603, Ebmac 84, and Bmag 770) generated clear frag- and 124 was the lowest.
ment patterns with high polymorphism (100%) (photo 4).
Based on used SSR Primers (Bmag 603, Ebmac 84, GBM1459,
GBM1405, GBM1221 and Bmag770) results gave bands ranged Acknowledgments
between (110 to 220 bp) in Ebmac 84 and Bmag770, respectively
with two alleles using Bmag 770 to three alleles using Bmag 84. The authors warmly thank the Agricultural Research in the
Some of these bands found only in same tolerant cultivars using Mediterranean Area 2 (ARIMNet 2) and Academy of Scientific
specific primers like 770. Band with size 220 found only on Giza Research and Technology (ASRT), who have funded this research
124, 126 and Giza 134. Similarly some of these SSR markers were work.
used by Mariey et al. [33] and Khatab and Mariey [5] for salt stress
for Egyptian barley genotypes. Among different types of molecular References
markers available for barley, microsatellite or simple sequence
repeats (SSRs) have proven to be the markers of choice for [1] Abdel-Moneam MA, Sultan MS, Eid AA, El-Wakeel Sally E. Response of Hull-
marker-assisted selection (MAS) in breeding and genetic diversity less Barley genotypes for high yield potential and stability as affected by
different water stress conditions. Asian J Crop Sci 2014;6:202–13.
studies. The value of microsatellite markers for both genetic diver- [2] Anderson JW, Beardall J. Molecular activities of plant cells. An introduction of
sity studies and for barley breeding was demonstrated [26]. plant biochemistry. Oxford: Blackwell Scientific Publications; 1991.
Using Polygenetic tree in Fig. 6 there were found main clusters, [3] Varshney R, Marcel T, Ramsay L, Russell J, Rӧder M, Stein N, Waugh R,
Langridge P, Niks R, Graner A. A high density barley microsatellite consensus
cluster one include only cultivar Giza 135. However, cluster 2 and 3 map with 775 SSR loci. Theor Appl Genet 2007;6(114):1091–103.
include most of tolerant cultivars (Giza 126, 134, 2000, 130, 127) [4] Ramsay L, Macaulay M, Degli S, MacLean K, Cardle L, Fuller J, Edwards K,
which classified as tolerant cultivars and last cluster consist sus- Tuvesson S, Morgante M, Massari A, Maestri E, Marmiroli N, Sjakste T, Ganal M,
Powell W, Waugh R. A simple sequence repeat-based linkage map of barley.
ceptible cultivar (Fig. 7). Genetics 2000;156:1997–2005.
Based on similarity coefficient values the highest values were [5] Khatab IA, Mariey A Samah. Development of agronomic al and molecular
1.0 with 100% similarly between tolerant cultivars Giza 130 and genetic markers associated with salt stress tolerance in some barley
genotypes. Curr Res J Biol Sci 2013;5(5):198–204.
Giza 127. Similarly between the susceptible cultivars 125 and Giza
[6] Akhondi M. The effect of polyethylene glycol on alfalfa genotypes in
129 was 60%. Contrary, between tolerant and susceptible cultivars hydroponic medium. In: The 11th congress on Iranian agronomy and plant
should low similarity between Giza 123 and all tolerant cultivars breeding. Shahid Beheshti University; 2010.
Giza 134, 2000 and 126 showed 0%.In the other hand, molecular [7] Amini R. Drought stress tolerance of barley (Hordeum vulgare L.) affected by
priming with PEG. Int J Farm All Sci 2013;2:803–8.
markers have been used as a valuable tool in the characterization [8] Atak M, Kaya MD, Kaya G, Cıkılı Y, Ciftci CY. Effects of NaCl on the germination,
and evaluation of genetic diversity within and between species seedling growth and water uptake of triticale. Turk J Agric Fore
and population. The advent of the polymerase chain reaction 2006;30:39–47.
[9] Baalbaki RZ, Zurayk RA, Bleik MM, Talhouk SN. Germination and seedling
(PCR) favored the development of different molecular techniques development of drought tolerant and susceptible wheat under moisture stress.
such as RAPD, simple sequence repeats (SSR), sequence tagged Seed Sci Technol 1999;27:291–302.
sites (STS), random amplified microsatellite polymorphism (RAMP) [10] Bayoumi TY, Eid MH, Metwali EM. Application of physiological and
biochemical indices as a screening technique for drought tolerance in wheat
and inter-simple sequence repeat polymorphic DNA (ISSR), and so genotypes. Afric J Biotech 2008;7:2341–52.
on. These molecular markers had been used in genotype identifica- [11] Bettaïeb-BenKaab L, El Felah M, Lauriere M, Czeh. J Plant Breed 2005;41:11–6.
tion, genetic mapping and in genes differentially expressed [39]. [12] Ceccarelli S, Grando S, Baum M. Participatory plant breeding in water-limited
environments. Exp Agric 2007;43:1–25.
[13] del Rio LA, Sandalio LM, Palma JM, Bueno P, Corpas FJ. Metabolism of oxygen
4. Conclusion radicals in peroxisomes and cellular implications. Free Radicle Biol Med
1992;13:557–80.
[14] Digdem K, Mehmet Y. Germination, seedling growth and relative water
Drought stress had a significant effect on all the measured traits content of shoot in different seed sizes of triticale under osmotic stress of
at all PEG levels used. In this experiment, germination speed was water and NaCl. Afr J Biotech 2008;7(16):2862–8.
212 F.A. Hellal et al. / Journal of Genetic Engineering and Biotechnology 16 (2018) 203–212

[15] Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh [33] Mariey SA, Mohamed MN, Khatab IA, EL-Banna AN, Abdel Khalek AF, Al-Dinary
leaf tissue. Focus 1990;12:13–5. ME. Genetic diversity analysis of some barley genotypes for salt tolerance
[16] Duman I. Effects of seed priming with PEG or K3PO4 on germination and using SSR markers. J Agric Sci 2013;5(7):12–28.
seedling growth in lettuce. Pak J Biol Sci 2006;11:923–8. [34] Mittler R, Zilinskas BA. Regulation of pea cytosolic ascorbate peroxidase and
[17] El-Denary ME, El-Shawy EE. Molecular and field analysis of some barley other antioxidants enzymes during the progression of drought stress and
genotypes for water stress tolerance. Egypt J Genet Cytol 2014;43:187–98. following recovery from drought. Plant J 1994;5:397–405.
[18] El-Kholy MA, Gaballah MS, El-Ashry S, Bawab AM. Combating drought using [35] Nazari, Pakniyat H. Assessment of drought tolerance in barley genotypes. J
yield stabilizing agents in barley. Int Agric Bot 2005;1(4):369–75. Appl Sci 2010;2:151–6.
[19] Fawzy FS, Ashraf AA, Mohamed AA, Ismaeil H. A (2014): effective selection [36] Nemat AN, Eman AM, Abdel-Tawab Yasser M. Laboratory evaluation of some
criteria for evaluating some barley crosses for water stress tolerance. Adv Agric barley genotypes under drought and salinity stresses. Plant Stress 2010;4
Biol 2014;1(3):112–23. (1):72–8.
[20] Finch Savage WF, Phelps JRA, Whalley WR, Rowse HR. Seed reserve-dependent [37] Noctor G, Arisi A, Jouanin L, Kunert K, Rennenberg H, Foyer C. Glutathione:
growth responses to temperature and water potential in carrot (Daucus carota biosynthesis, metabolism and relationship to stress tolerance explored in
L.). J Exp Bot 2001;252:218–9. transformed plants. J Exp Bot 1998;49:623–47.
[21] Fraser T, Silk W, Rosr T. Effect of low water potential on cortical cell length in [38] Oskooei B. The effect of drought stress on some lines and cultivars of wheat at
growing region on maize roots. Plant Physiol 1990;93:648–51. vegetative growth stage. In: The 11th congress on Iranian agronomy and plant
[22] Gomez KA, Gomez AA. Statistical procedures for agriculture research. 2nd breeding. Shahid Beheshti University; 2010.
ed. New York: John Wiley and Sons; 1984. p. 180. [39] Pan Z, Deng G, Zhai X, Long H, Tang Y, Qiang X, Yu M. Front Agric China
[23] Hammer Ø, Harper DAT, Ryan PD. Paleontological statistics software package 2008;2:372–9.
for education and data analysis. Palaeontol Electron 2001;4:1–9. [40] Prisco JT, Baptista CR, Pinheiro EJL. Effect of seed pre-treatment on seed
[24] Hittalmani S, Huang N, Courtois B, Venuprasad R, Shashidhar HE. Identification germination under water stress condition. Revta Brasil Bot 1992;15:31–5.
of QTL for growth and grain yield-related traits in rice across nine locations of [41] Radhouane L. Response of Tunisian autochthonous pearl millet (Pennisetum
Asia. Theor Appl Genet 2003;107:679–90. glaucum L.) to drought stress induced by polyethylene glycol (PEG) 6000. Afr J
[25] Ibrahim M, Zeid N, El-Semary A. Response of two differentially drought Biotech 2007;6:1102–5.
tolerant cultivars of maize to drought stress. Pakistan J Biol Sci 2001;4:779–84. [42] Salin M. Toxic oxygen species and protective systems of the chloroplast.
[26] Ibrahim OM, Mohamed MH, Tawfik M, Badr EA. Int J Acad Res 2011;3(2):81–5. Physiol Plant 1988;72:681–9.
[27] ISTA – International Seed Testing Association. International rules for seed [43] Salehi FM. The effect of drought stress on seedling germination and growth in
testing. Zurich: ISTA; 2008. 8 genotypes of bean. In: The 11th congress on Iranian agronomy and plant
[28] Jamshidi M. The effect of environmental stress on safflower genotypes. In: The breeding. Shahid Beheshti University; 2010.
9th congress on Iranian agronomy and plant breeding. Shahid Beheshti [44] Shahriari R, Hassan Panah D. Measuring the length of coleoptiles in native and
University; 2006. promising genotypes of wheat in vitro using Mannitol as the osmotic stress
[29] Kafi M, Nezami A, Hosaini H, Masomi A. Physiological effects of drought stress factor. The fourth congress on Iran biotechnology. Acta Bot Boreal Occident Sin
by polyethylene glycol on germination of lentil (Lens culinaris Medik.) 2005;22(3):561–65.
genotypes. Agron Res Iran 2005;3:69–80. [45] Smirnoff N, Pallanca JE. Ascorbate metabolism in relation to oxidative stress.
[30] Karimi H. Barley (Hordeum vulgare L.): physiology and yield. In: Forage crops Biochem Soc Transact 1996;24:472–8.
production in Iran. Tehran: Tehran University Press; 2005. p. 258–75. [46] Taha SA, El-Naggar MI, Shata SM, Hellal FA. Effect of applying some forms and
[31] Khazayi H, Kafi M, Masumi A. Physiological effects of stress induced by rates of iron on the phytosiderophores release and iron distribution in barley
polyethylene glycol on germination of chickpea genotypes. J Agron Res Iran plants. Zagazig J Agric Res 1998;26(2):469–78.
2008;2(6):453. [47] Wang JG, Chen GC, Zhang CL. The effect s of water stress on soluble protein
[32] Michelmore DS, Fuller N, Wikinson JW, Plucknett Y, Andre H, Scharf MJ. J Plant content, the activity of SOD, POD and CAT of two eco types of seeds (Phragmites
Genet 2007;36:201–9. communis L). Acta Bot Boreal Occident Sin 2002;22(3):561–5.