This document discusses string matching algorithms. It introduces the brute force algorithm and its O(MN) complexity. It then describes the Knuth-Morris-Pratt (KMP) algorithm which improves efficiency by preprocessing the pattern string to determine how to match more efficiently. The KMP algorithm runs in O(N+M) time where N and M are the lengths of the text and pattern strings, respectively. It provides examples of building the KMP table and tracing the algorithm.
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0 ratings0% found this document useful (0 votes)
7 views23 pages
12 StringMatching
This document discusses string matching algorithms. It introduces the brute force algorithm and its O(MN) complexity. It then describes the Knuth-Morris-Pratt (KMP) algorithm which improves efficiency by preprocessing the pattern string to determine how to match more efficiently. The KMP algorithm runs in O(N+M) time where N and M are the lengths of the text and pattern strings, respectively. It provides examples of building the KMP table and tracing the algorithm.
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 23
So sánh xâu nhanh
String matching String Matching
Tham khảo bài giảng 15-211
Fundamental Data Structures and Algorithms, CMU In this lecture • String Matching Problem – Concept – brute force algorithm – complexity • Knuth-Morris-Pratt (KMP) Algorithm – Pre-processing – complexity
Tham khảo bài giảng 15-211 Fundamental Data
Structures and Algorithms, CMU Pattern Matching Algorithms String Matching • Text string T[0..N-1] T = “abacaabaccabacabaabb” • Pattern string P[0..M-1] P = “abacab” • Where is the first instance of P in T? T[10..15] = P[0..5] • Typically N >> M Why String Matching? • Applications in Computational Biology – DNA sequence is a long word (or text) over a 4-letter alphabet – GTTTGAGTGGTCAGTCTTTTCGTTTCGACGGAGCCCCCAATTA ATAAACTCATAAGCAGACCTCAGTTCGCTTAGAGCAGCCGAA A….. – Find a Specific pattern W • Finding patterns in documents formed using a large alphabet – Word processing – Web searching – Desktop search (Google, MSN) • Matching strings of bytes containing – Graphical data – Machine code • grep in Unix/Linux – grep searches for lines matching a pattern. Naïve Algorithm (or Brute Force) • Assume |T| = n and |P| = m Text T Pattern P Pattern P Pattern P
Compare until a match is found. If so return the index where match
occurs else return -1 String Matching abacaabaccabacabaabb • The brute force abacab algorithm abacab • 22+6=28 comparisons. abacab abacab abacab abacab abacab abacab abacab abacab abacab A bad case 00000000000000001 • 60+5 = 65 0000- comparisons are 0000- needed 0000- • How many of them 0000- could be avoided? 0000- 0000- 0000- 0000- 0000- 0000- 0000- 0000- 00001 String Matching • Brute force worst case – O(MN) – Expensive for long patterns in repetitive text • How to improve on this? • Intuition: – Remember what is learned from previous matches Knuth Morris Pratt (KMP) Algorithm KMP – The Big Idea • Retain information from prior attempts. • Compute in advance how far to jump in P when a match fails. – Suppose the match fails at P[j] T[i+j]. – Then we know P[0 .. j-1] = T[i .. i+j-1]. • We must next try P[0] ? T[i+1]. – But we know T[i+1]=P[1] – What if we compare: P[1] ? P[0] • If so, increment j by 1. No need to look at T. – What if P[1] = P[0] and P[2] = P[1] ? • Then increment j by 2. Again, no need to look at T. • In general, we can determine how far to jump without any knowledge of T! Implementing KMP • Never decrement i, ever. – Comparing T[i] with P[j]. • Compute a table f of how far to jump j forward when a match fails. – The next match will compare T[i] with P[ f[j-1] ] • Do this by matching P against itself in all positions. Building the Table for f • P = 1010011 • Find self-overlaps Prefix Overlap j f 1 . 1 0 10 . 2 0 101 1 3 1 1010 10 4 2 10100 . 5 0 101001 1 6 1 1010011 1 7 1 What f means Prefix Overlap j f • f non-zero implies there is 1 . 1 0 a self-match. 10 . 2 0 E.g., f=2 means P[0..1] = P[j- 101 1 3 1 2..j-1] 1010 10 4 2 • Hence must start new 10100 . 5 0 comparison at j-2, since we 101001 1 6 1 know T[i-2..i-1] = P[0..1] 1010011 1 7 1 • If f is zero, there is no In general: self-match. – Set j=f[j-1] – Do not change i. – Set j=0 • The next match is – Do not change i. T[i] ? P[f[j-1]] • The next match is T[i] ? P[0] Favorable conditions • P = 1234567 • Find self-overlaps Prefix Overlap j f 1 . 1 0 12 . 2 0 123 . 3 0 1234 . 4 0 12345 . 5 0 123456 . 6 0 1234567 . 7 0 Mixed conditions • P = 1231234 • Find self-overlaps Prefix Overlap j f 1 . 1 0 12 . 2 0 123 . 3 0 1231 1 4 1 12312 12 5 2 123123 123 6 3 1231234 . 7 0 Poor conditions • P = 1111110 • Find self-overlaps Prefix Overlap j f 1 . 1 0 11 1 2 1 111 11 3 2 1111 111 4 3 11111 1111 5 4 111111 11111 6 5 1111110 . 7 0 KMP pre-process Algorithm m = |P|; Define a table F of size m F[0] = 0; i = 1; j = 0; while(i<m) { compare P[i] and P[j]; if(P[j]==P[i]) Use { F[i] = j+1; previous i++; j++; } values of f else if (j>0) j=F[j-1]; else {F[i] = 0; i++;} } KMP Algorithm input: Text T and Pattern P |T| = n |P| = m Compute Table F for Pattern P i=j=0 while(i<n) { if(P[j]==T[i]) { if (j==m-1) return i-m+1; i++; j++; } else if (j>0) j=F[j-1]; else i++; Use F to determine } next value for j.
output: first occurrence of P in T
Brute Force KMP 000000000000000000000000001 0000000000000000000000000001 0000000000000- 0000000000000- 0000000000000- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 0000000000000- 0- 01 • A worse case example: 28+14 = 42 comparisons 196 + 14 = 210 comparisons KMP Performance • Pre-processing needs O(M) operations. • At each iteration, one of three cases: – T[i] = P[j] • i increases – T[i] <> P[j] and j>0 • i-j increases – T[I] <> P[j] and j=0 • i increases and i-j increases • Hence, maximum of 2N iterations. • Thus worst case performance is O(N+M). Exercises • E1 – Construct the KMP table for P = 10010001 – Trace the KMP algorithm with T = 000100100100010111 • E2 – Construct the KMP table for pattern P = ababaca – Trace the KMP algorithm with T = bacbababaabcbab