CLB-09384; No.

of pages: 3; 4C:
Clinical Biochemistry xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Clinical Biochemistry

journal homepage: www.elsevier.com/locate/clinbiochem

Short Communication

Demethylation of the promoter region of GPX3 in a newborn with

classical phenylketonuria
Chike Bellarmine Item ⁎, Sharmane Escueta, Andrea Schanzer, Somayeh Farhadi, Thomas Metz,
Maximilian Zeyda, Dorothea Möslinger, Susanne Greber-Platzer, Vassiliki Konstantopoulou
Department of Pediatrics and Adolescent Medicine, Medical University of Vienna, Währinger Gürtel, 18-20 Vienna, Austria

a r t i c l e i n f o a b s t r a c t

Article history: Objectives: Phenylketonuria (PKU) is characterized by a high phenylalanine (phe) in plasma and oxidative
Received 13 July 2016 stress. However, the monitoring of oxidative stress in newborns with PKU using the activity levels of antioxidant
Received in revised form 16 September 2016 enzymes is not optimal. We investigated the possibility of monitoring an increased reactive oxygen species (ROS)
Accepted 4 October 2016 production using DNA methylation changes of an oxidative stress response element in the promoter region of an
Available online xxxx
enzymatic antioxidant gene.
Design and methods: Using DNA extracted from blood leukocytes, the cytosine phosphodiester bond gua-
Keywords:
Hyperphenylalaninemia
nine positions of an overlapping CCAAT box/metal response element (CGATTGGCTG) of the glutathione peroxi-
Glutathione peroxidase 3 dase 3 promoter activated by oxidative stimuli and expressed in plasma were analysed for methylation changes
Demethylation in 20 newborns with hyperphenylalaninemia and 20 healthy controls.
Newborn Results: A demethylated allele was detected in a PKU patient at a phe level of 465 μmol/L on day 2 after birth,
Oxidative stress but not in other patients (phe b 465 μmol/L, ≥day 2 after birth; phe N 465 μmol/L, ≥day 3 after birth) and healthy
controls (phe b 465 μmol/L, ≥day 2 after birth).
Conclusions: The detection of the demethylated allele could be time and phe concentration dependent. The
demethylated allele is suggested as an early epigenetic marker for an extracellular monitoring of an increased
ROS production in newborns with PKU.
© 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

1. Introduction that antioxidant enzymes have different activity patterns due to a vari-
able anti-oxidative system during growth and development [3,5,6,7,8].
The most prevalent inborn error of aminoacid metabolism in Thus very few studies have investigated probands under fifteen years,
European populations is phenylketonuria (PKU), with an incidence of whose oxidative stress status is usually affected by growth and develop-
1:10.000 [1]. Due to an increased phenylalanine (phe) level, there is ment [3,8]. PKU is characterized by the accumulation of phe in plasma
an enhanced endogenous production of free radicals which could lead [9] which readily expresses the antioxidant enzyme, glutathione perox-
to oxidative damage of DNA and oxidative stress in PKU [2]. Newborns idase 3 (GPX3) [10], suggesting that GPX3 could be an initial defence
with an early diagnosed PKU, whose oxidative stress status could be in- against reactive oxygen species (ROS), before ROS entry into cells.
fluenced by growth and immature antioxidant systems, are particularly GPX3 would therefore be a candidate gene for investigation. Since oxi-
susceptible to oxidative stress [3,4]. It has been suggested that oxidative dative stress has been suggested to result in epigenetic dysregulation
stress could be associated with the PKU pathology such as the late onset [11], cytosine phosphodiester bond guanine (CpG) positions of an over-
neurological deficits [5]. Therefore monitoring of the oxidative stress as lapping CCAAT-box/metal response element (CGATTGGCTG) of the
an adjuvant tool to the monitoring of phe blood levels in PKU patients is GPX3 promoter activated by oxidative stimuli will be analysed. The
essential. However, the monitoring of antioxidative systems, such as the overlapping CCAAT-box/metal response element is of particular inter-
measurements of the activity levels of the antioxidant enzymes, in chil- est, because it could be activated, not only by phe induced ROS, but
dren with PKU has been challenging. Some investigations have shown also by metal-ion homeostasis dysregulation induced ROS in PKU pa-
tients with a micronutrient imbalance [10,12]. The objective of this
manuscript is to report a case of a complete demethylation of the
Abbreviations: GPX3, glutathione peroxidase 3; CpG, cytosine phosphodiester bond CCAAT-box/metal response element in the promoter of the GPX3 gene.
guanine; PKU, phenylketonuria; phe, phenylalanine.
⁎ Corresponding author at: Medical University of Vienna, Department of Pediatrics and
This complete demethylation was not observed in healthy controls
Adolescent Medicine, A-1090 Vienna, Austria. and PKU and hyperphenylalaninemia (HPA) patients with a lower phe
E-mail address: [email protected] (C.B. Item). concentration (b465 μmol/L).

http://dx.doi.org/10.1016/j.clinbiochem.2016.10.001
0009-9120/© 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Please cite this article as: C.B. Item, et al., Demethylation of the promoter region of GPX3 in a newborn with classical phenylketonuria, Clin
Biochem (2016), http://dx.doi.org/10.1016/j.clinbiochem.2016.10.001
2 C.B. Item et al. / Clinical Biochemistry xxx (2016) xxx–xxx

2. Materials and methods 465 μmol/L (N = day 2), phe N465 μmol/L (N = day 3), and in controls
(N = day 2).
2.1. Patients A complete/partial methylated CGATTGGC/TTGC, a partial methylat-
ed C/TGATTGGC/TTGC, and a complete methylated CGATTGGCTGC
Retrospective analysis was carried out with newborn blood spots were found in other samples (Table 1). The patients and controls
from the Austrian newborn screening program. The ethics number is showed a statistically significant difference of distribution of the four al-
EK 1085/2015. All patients with HPA were screened on days 2, 3, and leles (p = 0.03) using a chi-test.
4 respectively after birth. A diagnosis of PKU was made after the analysis
of a second blood spot on day N = 7 after birth. Two different groups of 4. Discussion
newborns were investigated. Group 1 contained early diagnosed HPA
term newborns with no diet restriction (37–41 gestation week, 1.9– The specificity of the demethylated allele for a severe laboratory dis-
4.0 kg birth weight, n = 20, phe N = 181 μmol/L). Group 2 contained ease parameter on day 2 after birth is suggested by the fact that it was
term control newborns (37–41 gestation week, 2.2–3.8 kg birth weight, found in a PKU patient with a high phe concentration (465 μmol/L),
n = 20, phe b 181 μmol/L). but not in healthy controls, PKU and HPA patients with a lower phe con-
centration (b 465 μmol/L). The demethylated allele was not found in
2.2. Analysis of sample other PKU patients (on days 3, 4 after birth, phe N 465 μmol/L), suggest-
ing that: 1). An early exposure (on day 2 after birth) to high phe
The analysis of samples was carried out as already described [13]. (465 μmol/L) induces the demethylated allele; and 2). a longer period
Primers used were: Fw 5′ [GC] CGTTCGTTTTTGAAATTTTAGTC 3′ and of exposure (on days 3, 4 after birth) to a higher phe (N 465 μmol/L)
Rev. 5′ CTACCTAATCCCTAACCACCGT 3′ does not induce the demethylated allele. These results suggest that
GC: 5′ CGCCCGCCGC GCCCCGCGCC CGTC 3′. the detection of the demethylated allele is dependent on the length of
The 5′ region of GPX3 (OMIM 138321) (164 bp) amplified corre- exposure to phe and the concentration of phe. This conclusion is sup-
sponds to the nucleotides −88 to −37 (ATG is +1) that includes CpG ported by the following literature: 1). The effect of the peroxide induced
positions of an overlapping CCAAT-box/metal response element oxidative stress on enzymatic antioxidants has been shown to be con-
(CGATTGGCTG). centration and time dependent [15]; and 2). Short term exposures of
Using tandem mass spectrometry (MS/MS) as described [14], the PKU patients to high phe before diet restriction induces antioxidant de-
phe concentration was determined from blood spots by measuring the fences that can overcome increased radical production to a certain ex-
butylester derivative of phe at a mass (m/z) of 222 N 120. Phe units tent, and long term exposures induce excessive radicals and little
were in μmol/L. antioxidant defences [16]. Since the demethylated allele was found in
one PKU patient on day 2 after birth, it could be a rare allele. However,
2.3. Statistical analysis it is not possible to say if other PKU patients analysed on days 3 and 4
after birth induced the demethylated allele on day 2 after birth, because
All statistical tests were carried out using a Statistical Package for So- no blood was collected. A shift of the demethylated state to a methylat-
cial Sciences (SPSS) software. A comparison of different parameters be- ed state with time is suggested by the detection of the demethylated
tween the patient and control groups was done by a Kruskal Wallis TGATTGGTTG allele on day 2 after birth (no diet restriction; phe
analysis and a chi-square test respectively. P values ≤0.05 were consid- 465 μmol/L), a partial/complete methylated CGATTGGC/TTG allele on
ered statistically significant. day 9 after birth (no diet restriction; phe 2355 μmol/L), and complete
methylated CGATTGGCTG allele on day 19 after birth (diet restriction/
3. Results antioxidant therapy; phe 191 μmol/L) respectively. The fact that an an-
tioxidant therapy (phe-restricted diet supplemented with dietary anti-
A Kruskal Wallis analysis of the patient and control groups showed a oxidants such as minerals and vitamins) which reduces the phe
comparable distribution of birth-weight (p = 0.482) and gestational concentration and the risk of oxidative stress in PKU patients [5,17]
age (p = 0.512). A demethylated TGATTGGTTG allele (PKU 10) was de- did not induce the demethylated TGATTGGTTG allele, but rather the
tected at phe of 465 μmol/L on day 2 after birth (Fig. 1), but not at phe b methylated CGATTGGCTG allele found in 60% of controls, suggests that

T
T

Fig. 1. Demethylated TGATTGGTTG allele of GPX3 Promoter.

Please cite this article as: C.B. Item, et al., Demethylation of the promoter region of GPX3 in a newborn with classical phenylketonuria, Clin
Biochem (2016), http://dx.doi.org/10.1016/j.clinbiochem.2016.10.001
 C.B. Item et al. / Clinical Biochemistry xxx (2016) xxx–xxx 3

Table 1
The GPX3 promoter methylation status and phe concentrations of 15 PKU samples (PKU1–15), 5 HPA samples (HPA 2–4, 7, 10) on days 2, 3, 4 after birth, without a diet restriction. Samples
PKU10b (no diet restriction) and PKU10c (diet restriction/antioxidant therapy) are second and third blood spots respectively from sample PKU 10. +: allele present ; −: allele absent.

Samples Gender Day of Blood PHE (μmol/L) CGATTGGCTG CGATTGGC/TTG C/TGATTGGC/TTG TGATTGGTTG
collection (completemethylated allele) (complete/partial methylated allele) (partial methylated allele) (demethylated allele)

2 3 4–19

PKU 1 Male 3 566 – – + –

PKU 2 Female 3 471 + – – –
PKU 3 Male 3 779 + – – –
PKU 4 Female 2 223 – – + –
PKU 5 Female 2 322 – – + –
PKU 6 Male 2 285 – – + –
PKU 7 Male 3 837 – – + –
PKU 8 Female 4 1124 – – + –
PKU 9 Female 3 493 – – + –
PKU 10 Female 2 465 – – – +
PKU 10b 9 2355 – + – –
PKU 10c 19 191 + – – –
PKU 11 Male 4 706 – + – –
PKU 12 Female 3 559 – + – –
PKU 13 Male 3 399 – – + –
PKU 14 Male 2 384 + – – –
PKU 15 Female 2 371 + – – –
HPA 2 Female 3 265 – – + –
HPA 3 Male 2 190 – – + –
HPA 4 Male 2 187 + – – –
HPA 7 Male 3 256 + – – –
HPA 10 Male 3 344 + – – –

demethylated TGATTGGTTG allele could be a first response to an in- Miida, M. Fukui, Y. Okano, Experimental evidence that phenylalanine is strongly as-
sociated to oxidative stress in adolescents and adults with phenylketonuria, Mol.
creased generation of radicals. A demethylation to methylation shift Genet. Metab. 103 (2011) 220–225.
could offer the possibility of monitoring the diet restriction therapy. [4] G. Mario, M. Rizzo, G. Scaturroa, A. Pitruzzell, A.M. Gammazza, F. Cappello, G.
Corselloa, G.L. Volti, Oxidative stress markers at birth: analyses of a neonatal popu-
lation, Acta Histochem. 117 (2015) 486–491.
5. Conclusions [5] J.C. Rocha, M.J. Martins, Oxidative stress in phenylketonuria: future directions, re-
view, J. Inherit. Metab. Dis. 35 (2012) 381–398.
[6] A. Sitta, C.S. Vanzin, G.B. Biancini, V. Manfredini, A.B. de Oliveira, C.A. Wayhs, G.O.
Exposure time to phe and the phe concentration could be important Ribas, L. Giugliani, I.V. Schwartz, D. Bohrer, S.C. Garcia, M. Wajner, C.R. Vargas, Evi-
in the detection of the demethylated allele. Since this allele affected an dence that L carnitine and selenium supplementation reduces oxidative stress in
phenylketonuric patients, Cell. Mol. Neurobiol. 31 (2011) 429–436.
oxidative stress response site, was detected early after birth at a high
[7] A. Sitta, A.G. Barschak, M. Deon, T. Terroso, R. Pires, R. Giugliani, C.S. Dutra-Filho, M.
phe in PKU, but not in controls, it could be an early marker for an extra- Wajner, C.R. Vargas, Investigation of oxidative stress parameters in treated phenyl-
cellular monitoring of an increased radical production. More patients ketonuric patients, Metab. Brain Dis. 21 (2006) 287–296.
[8] H. Tsukahara, Biomarkers for oxidative stress: clinical application in pediatric med-
have to be studied in order to confirm these initial results. Other enzy- icine, Curr. Med. Chem. 14 (2007) 339–351.
matic antioxidants will be investigated in PKU patients with a higher [9] P.F. Schuck, F. Malgarin, J.H. Cararo, F. Cardoso, E.L. Streck, G.C. Ferreira, Phenylke-
phe that lack a demethylated allele. tonuria pathophysiology: on the role of metabolic alterations, Aging Dis. 6 (2015)
390–399.
[10] C. Bierl, B. Voetsch, R.C. Jin, D.E. Handy, J. Loscalzo, Determinants of human plasma
Conflict of interest glutathione peroxidase (GPx-3) expression, J. Biol. Chem. 279 (2004) 26839–26845.
[11] Y. Chervona, M. Costa, The control of histone methylation and gene expression by
oxidative stress, hypoxia and metals, Free Radic. Biol. Med. 53 (2012) 1041–1047.
The authors do not have any conflict of interests. [12] M. Robert, J.C. Rocha, M. van Rijn, K. Ahring, A. Bélanger-Quintana, A. MacDonald, K.
Dokoupil, H. Gokmen Ozel, A.M. Lammardo, P. Goyens, F. Feillet, Micronutrient sta-
tus in phenylketonuria, Mol. Genet. Metab. 110 (2013) S6–S17.
Acknowledgment [13] K.A. Tendl, S.M.F. Schulz, T.P. Mechtler, A. Bohn, T. Metz, S. Greber-Platzer, D.C.
Kasper, K.R. Herkner, C.B. Item, DNA methylation pattern of CALCA in preterm neo-
This project was supported by the Department of Pediatrics, Univer- nates with bacterial sepsis as a putative epigenetic biomarker, Epigenetics 8 (2013)
1261–1267.
sity of Vienna Medical School, Vienna, Austria. [14] D.H. Chace, T.A. Kalas, E.W. Naylor, Use of tandem mass spectrometry for
(Apothekengeld/Kostenstelle: 370110). multianalyte screening of dried blood specimens from newborns, Clin. Chem. 49
(2003) 1797–1817.
[15] F. Miguel, A.C. Augusto, S.A. Gurgueira, Effect of acute vs chronic H2O2-induced ox-
References idative stress on antioxidant enzyme activities, Free Radic. Res. 43 (2009) 340–347.
[16] A. Sitta, A.G. Barschak, M. Deon, A.T. Barden, G.B. Biancini, P.R. Vargas, C.F. de Souza,
[1] C.R. Scriver, S. Kaufmann, Hyperphenylalaninemia: phenylalanine hydroxylase defi- C. Netto, M. Wajner, C.R. Vargas, Effect of short- and long-term exposition to high
ciency, in: C.R. Scriver, A.L. Beaudet, W.S. Sly, D. Valle (Eds.), The Metabolic and Mo- phenylalanine blood levels on oxidative damage in phenylketonuric patients, Int. J.
lecular Basis of Inherited Disease, McGraw-Hill, New York 2001, pp. 1667–1724. Dev. Neurosci. 27 (2009) 243–247.
[2] C.R. Vargas, M. Wajner, A. Sitta, Oxidative stress in phenylketonuric patients, Mol. [17] P.N. Mazzola, G.A. Karikas, K.H. Schulpis, C.S. Dutra-Filho, Antioxidant treatment
Genet. Metab. 104 (2011) 97–99. strategies for hyperphenylalaninemia, Metab. Brain Dis. 28 (2013) 541–550.
[3] Y. Sanayama, H. Nagasaka, M. Takayanagi, T. Ohura, O. Sakamoto, T. Ito, M. Ishige-
Wada, H. Usui, M. Yoshino, A. Ohtake, T. Yorifuji, H. Tsukahara, S. Hirayama, T.

Please cite this article as: C.B. Item, et al., Demethylation of the promoter region of GPX3 in a newborn with classical phenylketonuria, Clin
Biochem (2016), http://dx.doi.org/10.1016/j.clinbiochem.2016.10.001