See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/7988481

Probiotic Bacteria May Become Dormant during Storage

Article  in  Applied and Environmental Microbiology · April 2005

DOI: 10.1128/AEM.71.3.1662-1663.2005 · Source: PubMed

CITATIONS READS

64 151

5 authors, including:

Miguel Gueimonde Arthur Ouwehand

Spanish National Research Council Dupont
257 PUBLICATIONS   8,102 CITATIONS    337 PUBLICATIONS   15,418 CITATIONS   

SEE PROFILE SEE PROFILE

Johanna P Reinikainen Seppo J Salminen

University of Turku University of Turku
4 PUBLICATIONS   259 CITATIONS    455 PUBLICATIONS   27,587 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Intestinal Microbiota View project

Gut microbiota and newborn View project

All content following this page was uploaded by Seppo J Salminen on 26 May 2014.

The user has requested enhancement of the downloaded file.

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 2005, p. 1662–1663 Vol. 71, No. 3
0099-2240/05/$08.00⫹0 doi:10.1128/AEM.71.3.1662-1663.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Probiotic Bacteria May Become Dormant during Storage

Sampo J. Lahtinen,* Miguel Gueimonde, Arthur C. Ouwehand,
Johanna P. Reinikainen, and Seppo J. Salminen
Functional Foods Forum, Department of Biochemistry and Food Chemistry,
University of Turku, Turku, Finland
Received 30 March 2004/Accepted 11 October 2004

The determination of bacterial viability in probiotic products is of economic, technological, and clinical
significance. We compared four methods to enumerate three Bifidobacterium strains in fermented oat products
during storage. A subpopulation of nonculturable cells retained a functional cell membrane typical of viable
cells, indicating that probiotic bacteria become dormant during storage.

Determination of bacterial viability is a complex issue, as in oat products. The oligonucleotides and PCR conditions pre-
illustrated by the numerous scientific papers published on the viously described (4) were used to quantify B. longum in the
topic (3, 5, 7). Traditionally, plate counting has been the products containing this microorganism. To quantify the bac-
method of choice for viability assays, but there are obvious teria in products containing Bb-12, a set of oligonucleotide
disadvantages (2). The use of this method is based on the primers and probes specific for B. animalis and B. lactis was
conceptions that culturability is synonymous with viability and designed (Table 1), and the specificities of the oligonucleotides
that the replication of a cell on a suitable agar medium is the were tested against an array of different intestinal and food
only direct proof of cell culturability (5). For readily culturable microorganisms (data not shown). To test the cell membrane
microorganisms, this outlook is justified (1). However, a simple integrity, a commercial LIVE/DEAD BacLight bacterial via-
two-value logic system of dividing bacteria into either a viable bility kit was used according to the manufacturer’s instructions.
or nonviable category does not adequately portray the bacte- The green fluorescence of the samples was analyzed with a
rial life cycle. Kell and colleagues (5) have suggested four Victor2 multilabel counter (Perkin-Elmer, Turku, Finland) and
terms to describe different stages of microorganisms: viable compared with a previously obtained standard curve (data not
(active and readily culturable), dormant (inactive but ulti- shown). Heat-treated and acetone-treated cells were used as
mately culturable), active but nonculturable, and dead (inac- controls. A strictly linear relationship between plate counts
tive and nonculturable). Most studies describing dormant bac- and L/D counts in a freshly fermented sample was established.
teria have been conducted using pathogenic microorganisms. After the linearity of the fluorescent response was established
The reliable determination of the viability of probiotic bacteria and the detection limit was determined, the following equation
is of technological, clinical, and economic significance. We was formulated to estimate the number of living cells deter-
determined the changes in viability occurring in fermented oat mined by using the L/D assay: cx ⫽ [(ax ⫺ b)/(a0 ⫺ b)] ⫻ c0,
products containing specific Bifidobacterium strains during where cx is the number of living cells (based on L/D staining)
storage. The four methods used in the experiment were plate in the suspension after x days, ax is the green fluorescence of
counting, fluorescent in situ hybridization (FISH), quantitative the suspension after x days, a0 is the green fluorescence of the
real-time PCR, and a commercial LIVE/DEAD BacLight bac- suspension after 0 days, b is the average background green
terial viability kit (L/D; Molecular Probes). The aim of this fluorescence, and c0 is the total number of living cells in fresh
study was to define the viabilities of subpopulations of probi- suspension, determined by plate counting.
otic bacteria in products during storage. Plate counts decreased approximately 2 log units per week
A sterile oat-in-water suspension (“oat milk”) was fer- for B. longum (Fig. 1) but remained stable for B. lactis. FISH
mented with Bifidobacterium longum 2C (DSM 14579), B. lon- and real-time PCR counts remained unchanged for all bacte-
gum 46 (DSM 14583), or Bifidobacterium lactis Bb-12 (Chr. ria, suggesting that bacterial DNA was intact and no cell lysis
Hansen, Hørsholm, Denmark). The numbers of bifidobacteria
in the fermented products (pHs below 4.5) were monitored
during storage at 4°C by using four methods. Plate counts were TABLE 1. Oligonucleotides used for the quantification of B. lactis
obtained by plating diluted products on reinforced clostridial by real-time PCRa
medium supplemented with 1.5% agar. FISH analysis was per- Oligonucleotide Sequence (5⬘-3⬘)b
formed by the method described by Langendijk and associates
(6). The quantitative real-time PCR methodology described by Animalis5 .............ACCAACCTGCCCTGTGCACCG
Animalis3 .............CCATCACCCCGCCAACAAGCT
Gueimonde and colleagues (4) for the quantification of intes- Aniprobe ..............EACCATGCGATGGAGCGGAGCATCCGGTTA
tinal bifidobacteria was used to analyze Bifidobacterium levels Aniquencher ........GCTCCATCGCATGGTD
a
The annealing temperature of the assay was 67°C.
b
Bold letters indicate bases that are not complementary to the target.
* Corresponding author. Mailing address: Functional Foods Forum/ E
, 2,2⬘,2⬘⬘,2⬘⬘⬘-{{6,6⬘-{4⬘⬘-[2-(4-isothiocyanatophenyl)ethyl]-1H-pyrazole-1⬘⬘,3⬘⬘-
University of Turku, Itäinen pitkäkatu 4, 20014 Turku, Finland. Phone: diyl}bis(pyridine)-2,2⬘-diyl}bis(methylenenitrilo)}tetrakis(acetato)europium
358 (2) 3336823. Fax: 358 (2) 3336862. E-mail: [email protected]. (III). D, dabcyl.

1662
VOL. 71, 2005 PROBIOTIC BACTERIA MAY BECOME DORMANT DURING STORAGE 1663

months after cells had lost their culturability. If the two meth-
ods measured the same subpopulation of cells, one would
expect the L/D counts to have remained more or less un-
changed after plate counts had reached the detection limit.
However, L/D count results and plate count results appeared
to be independent of each other. We suggest that this is be-
cause the two methods measure different subpopulations of
bacteria. The plate count method counts cells which are viable
and culturable on nutrient agar, whereas the L/D assay counts
the readily culturable cells and also cells which have an intact
and functional cell membrane typical of viable cells but do not
form colonies on conventional growth media. The data ob-
tained here do not allow us to determine whether cells are
ultimately culturable. However, the results indicate that al-
though the bacteria are not readily culturable, they are not
necessarily dead as defined by Kell and colleagues (5).
These findings highlight the need for further assessment of
FIG. 1. Plate count, real-time PCR, and FISH results of the prod- the methods applied to determine the viabilities of probiotic
ucts containing B. longum. products. The evaluation of cell viabilities in stored probiotic
foods is of vital importance economically and technologically,
and it is also important for efficacy. In addition, the reliable
had occurred (Fig. 1). However, viability counts of B. longum determination of viability is a prerequisite to the much-needed
determined by the LIVE/DEAD kit remained relatively stable, regulation of and legislation on the quality of probiotic prod-
decreasing 1.2 log units in 3 months (Fig. 2). The striking ucts. To our knowledge, this study is the first to report a
difference between plate count results and L/D count results subpopulation of potentially probiotic cells entering a state of
indicates that a subpopulation of the B. longum strains may reduced culturability while maintaining a functional cell mem-
have entered a dormant stage or possibly an active but non- brane during prolonged storage. Further work will be required
culturable stage. Such a conception is further supported by the to determine whether these bacteria are truly viable and ulti-
fact that the L/D counts continued to change for more than 2 mately culturable or the observed dormant-like state of the
bacteria is merely the gateway to imminent cell death.
We thank Riikka Parhiala for her skillful assistance.
S.J.L. was supported by the Applied Biosciences Graduate School.

REFERENCES

1. Barer, M. R., R. J. Smith, R. P. Cooney, and P. T. Kimmitt. 2000. Relation-

ships between culturability, activity and virulence in pathogenic bacteria.
J. Infect. Chemother. 6:108–111.
2. Breeuwer, P., and T. Abee. 2000. Assessment of viability of microorganisms
employing fluorescence techniques. Int. J. Food Microbiol. 55:193–200.
3. Colwell, R. R. 2000. Viable but nonculturable bacteria: a survival strategy.
J. Infect. Chemother. 6:121–125.
4. Gueimonde, M., S. Tölkkö, T. Korpimäki, and S. Salminen. 2004. New real-
time quantitative PCR procedure for quantification of bifidobacteria in hu-
man fecal samples. Appl. Environ. Microbiol. 70:4165–4169.
5. Kell, D. B., A. S. Kaprelyants, D. H. Weichart, C. R. Harwood, and M. R.
Barer. 1998. Viability and activity in readily culturable bacteria: a review and
discussion of the practical issues. Antonie Leeuwenhoek 73:169–187.
6. Langendijk, P. S., F. Schut, G. J. Jansen, G. C. Raangs, G. R. Kamphuis,
M. H. Wilkinson, and G. W. Welling. 1995. Quantitative fluorescence in situ
hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted
probes and its application in fecal samples. Appl. Environ. Microbiol. 61:
3069–3075.
FIG. 2. Plate count and L/D assay results of the products contain- 7. Nystrom, T. 2001. Not quite dead enough: on bacterial life, culturability,
ing B. longum. senescence, and death. Arch. Microbiol. 176:159–164.

View publication stats