Placenta 36 (2015) 790e795

Contents lists available at ScienceDirect

Placenta
journal homepage: www.elsevier.com/locate/placenta

Placental expression of imprinted genes varies with sampling site and

mode of delivery
A.B. Janssen a, S.J. Tunster a, N. Savory b, A. Holmes b, J. Beasley c, S.A.R. Parveen c,
R.J.A. Penketh b, R.M. John a, *
a
Cardiff School of Biosciences, Cardiff University, Cardiff, Wales, CF10 3AX, UK
b
Department of Obstetrics and Gynaecology, University Hospital Wales, Cardiff, Wales CF144XW, UK
c
Department of Obstetrics and Gynaecology, Royal Gwent Hospital, Newport, Wales NP202UB, UK

a r t i c l e i n f o a b s t r a c t

Article history: Imprinted genes, which are monoallelically expressed by virtue of an epigenetic process initiated in the
Received 2 May 2015 germline, are known to play key roles in regulating fetal growth and placental development. Numerous
Received in revised form studies are investigating the expression of these imprinted genes in the human placenta in relation to
25 June 2015
common complications of pregnancy such as fetal growth restriction and preeclampsia. This study aimed
Accepted 26 June 2015
to determine whether placental sampling protocols or other factors such as fetal sex, gestational age and
mode of delivery may influence the expression of imprinted genes predicted to regulate placental
Keywords:
signalling.
Placenta
Imprinted genes
Methods: Term placentas were collected from Caucasian women delivering at University Hospital of
Sampling Wales or Royal Gwent Hospital within two hours of delivery. Expression of the imprinted genes PHLDA2,
Delivery mode CDKN1C, PEG3 and PEG10 was assayed by quantitative real time PCR. Intraplacental gene expression was
analysed (N ¼ 5). Placental gene expression was compared between male (N ¼ 11) and female (N ¼ 11)
infants, early term (N ¼ 8) and late term (N ¼ 10) deliveries and between labouring (N ¼ 13) and non-
labouring (N ¼ 21) participants.
Results: The paternally expressed imprinted genes PEG3 and PEG10 were resilient to differences in
sampling site, fetal sex, term gestational age and mode of delivery. The maternally expressed imprinted
gene CDKN1C was elevated over 2-fold (p < 0.001) in placenta from labouring deliveries compared with
elective caesarean sections. In addition, the maternally expressed imprinted gene PHLDA2 was elevated
by 1.8 fold (p ¼ 0.01) in samples taken at the distal edge of the placenta compared to the cord insertion
site.
Conclusion: These findings support the reinterpretation of existing data sets on these genes in relation to
complications of pregnancy and further reinforce the importance of optimising and unifying placental
collection protocols for future studies.
© 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY license
(http://creativecommons.org/licenses/by/4.0/).

1. Introduction PLECKSTRIN HOMOLOGY-LIKE DOMAIN FAMILY A MEMBER 2

(PHLDA2), CYCLIN-DEPENDENT KINASE INHIBITOR 1C (CDKN1C),
Imprinted genes display parent of origin specific gene expres- PATERNALLY EXPRESSED GENE 3 (PEG3) and PATERNALLY EXPRESSED
sion [1] and play a key role in regulating placental development and GENE 10 (PEG10), is conserved in the human placenta [4]. While a
controlling fetal growth (reviewed in Ref. [2]). Recent studies have number of studies have examined human placental imprinted gene
identified several imprinted genes that regulate the endocrine expression focusing primarily on fetal growth restriction (FGR) as
lineages of the mouse placenta to modulate placental hormone an adverse outcome [4e9], the potential for aberrant placental
production (reviewed in Ref. [3]). Imprinting of four of these genes, signalling presents additional implications for human pregnancies.
Gene expression in the placenta can be influenced by many
factors including differences in sampling site, fetal sex, gestational
age and mode of delivery (reviewed in Ref. [10]). Variation in gene
* Corresponding author.
expression may occur in different regions of the placenta due to
E-mail address: [email protected] (R.M. John).

http://dx.doi.org/10.1016/j.placenta.2015.06.011
0143-4004/© 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
 A.B. Janssen et al. / Placenta 36 (2015) 790e795 791

differences in placental architecture or blood supply and therefore 2.2. Placental dissection
consistency in placental sampling is of key importance [10]. A
number of studies have demonstrated differences in intraplacental Placentas were weighed and dissected within 2 h of delivery.
gene expression depending on sampling site [11e17] but the pos- Villous trophoblast samples were obtained at five random sites on
sibility of intraplacental variation in expression of PHLDA2, CDKN1C, the maternal surface of the placenta, midway between the cord and
PEG3 or PEG10 has not been investigated. distal edge. Samples were thoroughly rinsed in ice cold phosphate
Sexual dimorphism in human placental gene expression (of both buffered saline to remove excess blood. Placental samples were
autosomal and sex chromosome linked genes) has also previously then stored in RNAlater (SigmaeAldrich, Dorset, UK) at 4  C prior to
been demonstrated [17,18] which has been proposed to underlie long term storage at 80  C.
sex differences in fetal growth [19]. As sexual dimorphism in To examine intraplacental variation in imprinted gene expres-
placental imprinted gene expression has been demonstrated in an sion, three placental samples (close to the cord insertion, middle
animal model [20] and for the imprinted H19 gene in human and distal edge) were taken from each of the fetal, middle and
placenta [9], controlling for fetal sex is important to studies of maternal layers of the placenta as described by Wyatt et al. (2005)
imprinted gene expression in the human placenta. (16). This was carried out for five term placentas (2 male, 3 female)
Infant morbidity and mortality [21e23] as well as placental from elective C-sections. Average placental gene expression (fetal,
pathology [24] have been observed to vary in response to gesta- middle and maternal layers of the placenta) was compared be-
tional age in term pregnancies. It has therefore been proposed that tween sampling sites close to the cord insertion and at distal sites.
infants should be distinguished as early term (37 0/7 to 38 6/7 Similarly, average placental gene expression (cord insertion, middle
weeks) and full term (39 0/7 to 41 6/7) [23]. While it has been and distal edge) was compared between basal and chorionic sur-
demonstrated that placental expression of PHLDA2 varies between face sampling sites.
preterm and term deliveries [7], it has not yet been established
whether expression of PHLDA2, CDKN1C, PEG3 or PEG10 varies be- 2.3. Gene expression analysis
tween early term and full term placentas. This is of particular
relevance to the study of pregnancy complications such as FGR, as Total RNA was extracted from the placental tissue samples using
these growth restricted infants may require earlier delivery [25]. GenElute Mammalian Total RNA Miniprep Kit (SigmaeAldrich,
Importantly, a number of studies have reported differences in Dorset, UK) with an on-column DNase digestion (SigmaeAldrich,
gene expression between labouring and non-labouring placentas Dorset, UK). 5 mg of RNA was reverse transcribed using M-MuLV
[26e29], which may arise from a decrease in placental oxygen reverse transcriptase (Promega, Southampton, UK) with random
supply during contractions [10] and/or differences in exposure to hexamers, according to manufacturer's instructions.
hormones associated with labour [30]. PHLDA2 is known to be Quantitative RT-PCR was performed using Chromo 4 Four
responsive to hypoxia [31e33] but it is not known whether Colour Real Time Detector (MJ Research) in a 20 ml reaction con-
placental expression of PHLDA2, CDKN1C, PEG3 or PEG10 is altered taining 5 ml of cDNA (diluted 1 in 50), 1X Buffer 2 mM MgCl2, 2 mM
in response to labour. dNTPs, 0.65 Units Taq (Fermentas (Thermo), Loughborough, UK),
To address this lack of information, this study examined placental 1 mM of each primer (SigmaeAldrich, Dorset, UK) and 0.12X Sybr
expression of the maternally expressed imprinted genes PHLDA2 and Green (Invitrogen, Paisley, UK). All samples were run in triplicate
CDKN1C and the paternally expressed imprinted genes PEG3 and and duplicate plates were performed. Conditions for amplification
PEG10 to determine whether their expression varied in relation to were: 1) 15 min at 94  C, 2) 30 s at 94  C, 3) 30 s at 60  C, 4) 30 s at
sampling site, fetal sex, gestational age or mode of delivery. 72  C and 5) 30 s 75  C, with steps 2e5 repeated for a total of 40
cycles. Melt Curve was performed from 70  C to 94  C, reading
2. Methods every 0.5  C and holding for 2 s.
Primer sequences were as follows: YWHAZ forward:
2.1. Study participants TTCTTGATCCCCAATGCTTC and reverse: AGTTAAGGGCCAGACCCAGT,
PHLDA2 forward: GAGCGCACGGGCAAGTA and reverse: CAGCG-
Study participants (N ¼ 40) were recruited prior to delivery at GAAGTCGATCTCCTT [6], CDKN1C forward: CCCATCTAGCTTG-
University Hospital Wales, Cardiff and Royal Gwent Hospital, CAGTCTCTT and reverse: CAGACGGCTCAGGAACCATT [4], PEG3
Newport. Written informed consent was obtained and the study
was approved by the South East Wales Research Ethics Committee Table 1
(REC number: 10/WSE02/10). Healthy Caucasian women with Characteristics of the study participants (N ¼ 40). Mean (SD)/range or number (%)
singleton pregnancies and no known medical disorders were is shown.
recruited and all infants were delivered normal birth weight at Study Participants (N ¼ 40)
term (37 weeks). Information on birth outcomes were obtained
Maternal Characteristic
from the maternal medical notes. Ethnicity:
In order to determine the effect of fetal sex on placental Caucasian 40 (100%)
imprinted gene expression, gene expression was compared be- Parity 1 (0.87)/0e3
tween male (N ¼ 11) and female (N ¼ 11) placentas delivered by Maternal age 30 (6.12)/19e40
Maternal BMI 27 (5.91)/17 - 38
elective C-section. Gene expression was also compared between Birth Outcome
early term (N ¼ 8) and full term (N ¼ 10) placentas delivered by Mode of Delivery:
elective C-section to determine whether expression varies with Vaginal 9 (22%)
gestational age at term. Finally, to determine whether labour effects Elective C section 27 (68%)
Emergency C section 4 (10%)
placental imprinted gene expression, gene expression was
Birth weight (g) 3417 (303)/2680 - 4030
compared between placentas delivered by elective C-section in the Gestational age (weeks) 39 (1.19)/37 - 42
absence of labour (N ¼ 21) and by vaginal (N ¼ 9) or emergency C- Placental weight (g) 676 (120)/434 - 891
section delivery following a period of labour (N ¼ 4). Allocation of Gender
participants to each group and participant characteristics is sum- Male 18 (45%)
Female 22 (55%)
marized in Supplementary Table 1.
792 A.B. Janssen et al. / Placenta 36 (2015) 790e795

forward: CTCACAACACAATCCAGGAC and reverse: TAGACCTC- samples taken at distal sampling sites compared with sampling
GACTGGTGCTTG, PEG10 forward: AAATTGCCTGACATGAAGAGGAGT- sites close to the cord insertion (Fig. 1A). There was no significant
CTA and reverse: AAGCCTAGTCACCACTTCAAAACACACTAAA [4]. difference in PHLDA2 expression between sampling sites on the
Gene expression data is presented as the DCT (target gene basal and chorionic placental surface (Fig. 1B).
expression relative to the housekeeping gene YWHAZ) and as the
fold change in expression, calculated using the 2DDCT [34] where 3.2. Fetal sex
the DDCT is the target gene expression relative to expression in the
control group. The housekeeping gene YWHAZ was chosen as this There was no significant difference in mean placental weight
gene has been demonstrated in a number of studies to be stably (663 g vs. 726 g; p ¼ 0.23), birth weight (3381 g vs. 3601 g; p ¼ 0.07)
expressed in the human placenta of normal pregnancies [35e37] or gestational age (273 days v 274 days; p ¼ 0.85) between male
and in pregnancies complicated by growth restriction [38]. In the and female infants. There was no significant difference in placental
current study there was no significant effect of fetal sex (p ¼ 0.56), PHLDA2, CDKN1C, PEG3 or PEG10 expression between male and
early term delivery (p ¼ 0.44) or labour (p ¼ 0.74) on placental female placentas (Fig. 2).
YWHAZ gene expression.
3.3. Gestational age
2.4. Statistical analysis
Early term infants were delivered between 37 and 38 weeks
All statistical analysis was carried out using IBM SPSS Statistics (mean gestational age 266 days) and full term infants between 39
for Windows (version 20.0, 2011). A ShapiroeWilk test was used to and 40 weeks (mean gestational age 277 days). There was no sig-
test for normal distribution of the data. All gene expression data nificant difference in mean placental weight (648 g vs. 717 g;
was normally distributed and therefore differences in gene p ¼ 0.23), birth weight (3445 g vs. 3392 g; p ¼ 0.07) between early
expression were analysed using an independent samples T-test. term and full term infants. The proportion of male and female in-
fants was also not significantly different between early (4 Male, 4
3. Results Female) and full term (4 Male and 6 Female) participants (p ¼ 0.67).
PHLDA2, CDKN1C, PEG3 and PEG10 expression was not significantly
A summary of participant demographics is shown in Table 1. altered in early term compared with full term placentas (Fig. 3).

3.1. Sampling site variation 3.4. Labour

Placental CDKN1C, PEG3 and PEG10 expression did not differ There was no significant difference in mean placental weight
significantly between cord insertion and distal sampling sites (708 g vs. 661 g; p ¼ 0.31), birth weight (3470 g vs. 3451 g; p ¼ 0.85)
(Fig. 1A) or between the basal and chorionic surface (Fig. 1B). or gestational age (273 days v 276 days; p ¼ 0.49) between
Placental PHLDA2 expression was significantly increased, by 77%, in labouring and non-labouring participants. There was also no

A) 2.2 *
2
1.8
Fold gene expression
(relative to YWHAZ)

1.6
1.4
1.2
Cord insertion
Series1
1
Series2
Distal edge
0.8
0.6
0.4
0.2
0
PHLDA2
1 CDKN1C
2 PEG3
3 PEG10
4

B)
1.4

1.2
Fold gene expression
(relative to YWHAZ)

0.8
Basal surface
Series1
0.6 Chorionic surface
Series2

0.4

0.2

0
PHLDA2
1 CDKN1C
2 PEG3
3 PEG10
4

Fig. 1. Effect of sampling site on placental imprinted gene expression. Gene expression is shown relative to sampling site near the cord insertion (A) and on the basal surface (B)
of the placenta. Mean fold gene expression is shown (±SEM). Three samples were taken at each site for a total of five placentas (N ¼ 15 samples per site). Differences in gene
expression were analysed using an independent samples t-test. *p < 0.05.
 A.B. Janssen et al. / Placenta 36 (2015) 790e795 793

Fig. 2. Sex differences in placental imprinted gene expression. Mean fold gene expression is shown (±SEM) relative to expression in male placentas. Differences in gene
expression were not statistically significant using an independent samples t-test.

Fig. 3. Early term delivery and placental imprinted gene expression. Mean fold gene expression is shown (±SEM) relative to expression in full term placentas. Differences in gene
expression were not statistically significant using an independent samples T-test.

Fig. 4. Effect of labour on placental imprinted gene expression. Mean fold gene expression is shown (±SEM) relative to expression in placentas from elective C section deliveries.
Differences in gene expression were analysed using an independent samples T-test. ***p < 0.001.

significant difference in the proportion of male and female infants 4. Discussion

between labouring (6 Male, 7 Female) and non-labouring (11 Male,
10 Female) participants (p ¼ 0.72). This study demonstrates that both the site of sampling and the
There was no significant effect of labour on placental PHLDA2, mode of delivery can influence the quantitative assessment of
PEG3 or PEG10 expression (Fig. 4). Placental CDKN1C was increased, imprinted gene expression in the human placenta.
by 140%, in labouring compared with non-labouring participants Our first key finding was that the expression of PHLDA2 varied
(Fig. 4). This increase in placental CDKN1C expression remained with site of sampling. PHLDA2 is a maternally expressed imprinted
significant when labouring participants were divided into those gene whose elevated placental expression has been reported in
delivering vaginally (115% increase, p ¼ 0.001, n ¼ 9) and those relation to fetal growth restriction in several human studies [39]. In
delivering by emergency C-section (197% increase, p ¼ 0.001, n ¼ 4). mice we have shown that transgenically elevated Phlda2 drives a
794 A.B. Janssen et al. / Placenta 36 (2015) 790e795

late and asymmetric fetal growth restriction [40] suggesting a mouse placentas in response to maternal diet alteration [53]. Thus,
causal role for PHLDA2 in human fetal growth restriction. In this a sex-specific response in human placental imprinted gene
current study, we found that placental PHLDA2 expression differed expression to an adverse intrauterine environment merits further
significantly with sampling site, with increased expression at distal investigation.
sampling sites compared with sites close to the umbilical cord. In conclusion, we have found that the expression of PHLDA2
Although no previous study has examined placental PHLDA2 varied with sampling site and that expression of CDKN1C varied
expression in relation to sampling site, a number of studies have with mode of delivery. These types of study further highlight the
similarly reported significant intraplacental variation in gene importance of developing uniform collection protocols with details
expression [12e14,16,17]. Given that placental PHLDA2 expression on mode of delivery as well as birth outcomes [10].
is altered in response to hypoxia [31e33], it is possible that differ-
ences in perfusion between distal sites and sites close to the um- Acknowledgements
bilical cord [14,16] could underlie the differences in expression
observed. The finding of intraplacental variation in PHLDA2 With thanks to the participants at University Hospital Wales and
expression is novel and has implications for interpretation of pre- Newport Gwent Hospital who kindly donated their placenta
vious studies and for future studies with consistency in placental anonymously for this study. ABJ was funded by BBSRC doctoral
sampling of key importance. training grant BB/F016557/1. SJT was funded by BBSRC grant BB/
A second key finding in this study was the variation in CDKN1C J015156.
in relation to mode of delivery. In humans, loss of expression of
CDKN1C has been linked to the childhood overgrowth disorder Appendix A. Supplementary data
Beckwith Weidemann Syndrome while microduplications span-
ning the gene and alterations in the PCNA domain of CDKN1C have Supplementary data related to this article can be found at http://
been linked to the growth restriction disorders Silver-Russell syn- dx.doi.org/10.1016/j.placenta.2015.06.011.
drome (SRS) and IMAGe syndrome, respectively [41]. Mouse
studies demonstrate that Cdkn1c functions early in life to limit fetal
References
growth and to regulate placental development [42e45] consistent
with a role for this gene in these disorders. [1] M.A. Surani, Imprinting and the initiation of gene silencing in the germ line,
Loss of function of CDKN1C may also play a role in preeclampsia/ Cell 93 (3) (1998) 309e312.
[2] A.L. Lim, A.C. Ferguson-Smith, Genomic imprinting effects in a compromised
HELLP syndrome [46] which has also been partially supported by
in utero environment: implications for a healthy pregnancy, Semin. Cell Dev.
animal studies [47]. However, while one study reported signifi- Biol. 21 (2) (2010) 201e208.
cantly reduced CDKN1C expression in preeclamptic placentas [48] [3] R.M. John, Epigenetic regulation of placental endocrine lineages and compli-
two other studies reported significantly elevated expression cations of pregnancy, Biochem. Soc. Trans. 41 (3) (2013) 701e709.
[4] A.I. Diplas, L. Lambertini, M.-J. Lee, R. Sperling, Y.L. Lee, J.G. Wetmur, et al.,
[49,50]. In the study by Kawasaki et al. [48], placental villous Differential expression of imprinted genes in normal and IUGR human pla-
samples were obtained immediately after caesarean section in the centas, Epigenetics 4 (4) (2009) 235e240.
absence of labour for both controls and preeclampsia pregnancies [5] J. McMinn, M. Wei, N. Schupf, J. Cusmai, E.B. Johnson, A.C. Smith, et al., Un-
balanced placental expression of imprinted genes in human intrauterine
that would exclude mode of delivery as a confounder. In the study growth restriction, Placenta 27 (6e7) (2006) 540e549.
by Enquobahrie et al. [50] preeclamptic pregnancies had a higher [6] S. Apostolidou, S. Abu-Amero, K. O'Donoghue, J. Frost, O. Olafsdottir,
caesarean delivery rate but a similar rate of labour with controls K. Chavele, et al., Elevated placental expression of the imprinted PHLDA2 gene
is associated with low birth weight, J. Mol. Med. 85 (4) (2007) 379e387.
while in the study by Unek et al. [49] placenta were sampled after [7] N. Kumar, J. Leverence, D. Bick, V. Sampath, Ontogeny of growth-regulating
caesarean delivery without stating whether labour was initiated. genes in the placenta, Placenta 33 (2) (2012) 94e99.
Similarly, studies examining placental CDKN1C expression in rela- [8] C. Demetriou, S. Abu-Amero, A.C. Thomas, M. Ishida, R. Aggarwal, L. Al-Olabi,
et al., Paternally expressed, imprinted insulin-like growth factor-2 in chori-
tion to fetal growth restriction have reported conflicting results
onic villi correlates significantly with birth weight, PLoS One 9 (1) (2014)
with both unaltered [4], increased [5] and decreased [51] expres- e85454.
sion reported in FGR placentas which may result from a failure to [9] G.E. Moore, M. Ishida, C. Demetriou, L. Al-Olabi, L.J. Leon, A.C. Thomas, et al.,
The role and interaction of imprinted genes in human fetal growth, Philos.
control for mode of delivery in these analyses.
Trans. R. Soc. Lond B Biol. Sci. 370 (1663) (2015) 20140074.
In this study, the expression of CDKN1C varied in response to [10] G.J. Burton, N.J. Sebire, L. Myatt, D. Tannetta, Y.L. Wang, Y. Sadovsky, et al.,
mode of delivery with both vaginally delivered and emergency Optimising sample collection for placental research, Placenta 35 (1) (2014)
caesarean placenta expressing CDKN1C at significantly higher levels 9e22.
[11] J.M. Brameld, R. Hold, F.B. Pipkin, Regional variation in angiotensin converting
than placenta obtained by elective caesarean in which labour was enzyme activity in the human placenta, Placenta 32 (11) (2011) 906e908.
not initiated. This is consistent with previous reports of signifi- [12] A.A. Tzschoppe, E. Struwe, H.G. Dorr, T.W. Goecke, M.W. Beckmann,
cantly increased CDKN1C expression in the mouse uterus and hu- R.L. Schild, et al., Differences in gene expression dependent on sampling site in
placental tissue of fetuses with intrauterine growth restriction, Placenta 31
man myometrium in association with labour [52]. In light of these (2010) 178e185. England: 2009 Elsevier Ltd.
new findings, it will be important to re-examine the data both from [13] G. Pidoux, P. Gerbaud, I. Laurendeau, J. Guibourdenche, G. Bertin, M. Vidaud, et
studies reporting a link between placental CDKN1C and pre- al., Large variability of trophoblast gene expression within and between hu-
man normal term placentae, Placenta 25 (2004) 469e473. England.
eclampsia or fetal growth restriction and those studies finding no [14] J. Hempstock, Y.P. Bao, M. Bar-Issac, N. Segaren, A.L. Watson, D.S. Charnock-
association. Jones, et al., Intralobular differences in antioxidant enzyme expression and
No significant difference was observed in placental PHLDA2, activity reflect the pattern of maternal arterial bloodflow within the human
placenta, Placenta 24 (2003) 517e523. England.
PEG3 or PEG10 expression in response to labour, and no intra- [15] L. Avila, R.K. Yuen, D. Diego-Alvarez, M.S. Penaherrera, R. Jiang, W.P. Robinson,
placental variation was observed in placental CDKN1C, PEG3 or Evaluating DNA methylation and gene expression variability in the human
PEG10 expression at different sampling sites. None of the four genes term placenta, Placenta 31 (2010) 1070e1077. England: 2010 Elsevier Ltd.
[16] S.M. Wyatt, F.T. Kraus, C.R. Roh, U. Elchalal, D.M. Nelson, Y. Sadovsky, The
showed a significant difference in expression between early and
correlation between sampling site and gene expression in the term human
late term deliveries and there was no significant difference in placenta, Placenta 26 (2005) 372e379. England.
relation to fetal sex confirming the findings of Moore et al. [9]. [17] R. Sood, J.L. Zehnder, M.L. Druzin, P.O. Brown, Gene expression patterns in
However, sexual dimorphism exists in the human fetal response to human placenta, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 5478e5483. United
States.
an adverse environment (reviewed in Ref. [19]) and differential [18] S. Buckberry, T. Bianco-Miotto, S.J. Bent, G.A. Dekker, C.T. Roberts, Integrative
imprinted gene expression has been reported in male and female transcriptome meta-analysis reveals widespread sex-biased gene expression
 A.B. Janssen et al. / Placenta 36 (2015) 790e795 795

at the human fetal-maternal interface, Mol. Hum. Reprod. 20 (2014) 810e819. levels of housekeeping genes in human placenta, Placenta 31 (2010)
England: The Author 2014. Published by Oxford University Press on behalf of 556e557. England.
the European Society of Human Reproduction and Embryology. [38] P. Murthi, E. Fitzpatrick, A.J. Borg, S. Donath, S.P. Brennecke, B. Kalionis,
[19] V.L. Clifton, Review: Sex and the human placenta: mediating differential GAPDH, 18S rRNA and YWHAZ are suitable endogenous reference genes for
strategies of fetal growth and survival, Placenta 31 (2010) S33eS39. England: relative gene expression studies in placental tissues from human idiopathic
Crown 2010. Published by Elsevier Ltd. fetal growth restriction, Placenta 29 (2008) 798e801. England.
[20] M. Faisal, H. Kim, J. Kim, Sexual differences of imprinted genes' expression [39] A.B. Jensen, S.J. Tunster, R.M. John, The significance of elevated placental
levels, Gene 533 (1) (2014) 434e438. PHLDA2 in human growth restricted pregnancies, Placenta 35 (8) (2014)
[21] C. Crump, K. Sundquist, M.A. Winkleby, J. Sundquist, Early-term birth (37e38 528e532.
weeks) and mortality in young adulthood, Epidemiology 24 (2) (2013) [40] S.J. Tunster, M. Van De Pette, R.M. John, Isolating the role of elevated PHLDA2
270e276. in asymmetric late fetal growth restriction in mice, Dis. Model Mech. 7 (2014)
[22] W.A. Engle, M.A. Kominiarek, Late preterm infants, early term infants, and 1185e1191. England: 2014. Published by The Company of Biologists Ltd.
timing of elective deliveries, Clin. Perinatol. 35 (2) (2008) 325e341 vi. [41] T. Eggermann, G. Binder, F. Brioude, E.R. Maher, P. Lapunzina, M.V. Cubellis, et
[23] A.R. Fleischman, M. Oinuma, S.L. Clark, Rethinking the definition of term al., CDKN1C mutations: two sides of the same coin, Trends Mol. Med. 20 (11)
pregnancy, Obstet. Gynecol. 116 (1) (2010) 136e139. (2014) 614e622.
[24] J. Stanek, Comparison of placental pathology in preterm, late-preterm, near- [42] K. Takahashi, T. Kobayashi, N. Kanayama, p57(Kip2) regulates the proper
term, and term births, Am. J. Obstet. Gynecol. 210(3) (234) (2014) e1e6. development of labyrinthine and spongiotrophoblasts, Mol. Hum. Reprod. 6
[25] H.L. Galan, Timing delivery of the growth-restricted fetus, Semin. Perinatol. 35 (11) (2000) 1019e1025.
(5) (2011) 262e269. [43] S.C. Andrews, M.D. Wood, S.J. Tunster, S.C. Barton, M.A. Surani, R.M. John,
[26] T. Cindrova-Davies, H.W. Yung, J. Johns, O. Spasic-Boskovic, S. Korolchuk, Cdkn1c (p57Kip2) is the major regulator of embryonic growth within its
E. Jauniaux, et al., Oxidative stress, gene expression, and protein changes imprinted domain on mouse distal chromosome 7, BMC Dev. Biol. 7 (2007) 53.
induced in the human placenta during labor, Am. J. Pathol. 171 (2007) England.
1168e1179. United States. [44] P. Zhang, N.J. Liegeois, C. Wong, M. Finegold, H. Hou, J.C. Thompson, et al.,
[27] V. Sitras, R.H. Paulssen, H. Gronaas, A. Vartun, G. Acharya, Gene expression Altered cell differentiation and proliferation in mice lacking p57KIP2 indicates
profile in labouring and non-labouring human placenta near term, Mol. Hum. a role in BeckwitheWiedemann syndrome, Nature 387 (6629) (1997)
Reprod. 14 (2008) 61e65. England. 151e158.
[28] K.J. Lee, S.H. Shim, K.M. Kang, J.H. Kang, D.Y. Park, S.H. Kim, et al., Global gene [45] Y. Yan, J. Frisen, M.H. Lee, J. Massague, M. Barbacid, Ablation of the CDK in-
expression changes induced in the human placenta during labor, Placenta 31 hibitor p57Kip2 results in increased apoptosis and delayed differentiation
(2010) 698e704. England. during mouse development, Genes. Dev. 11 (8) (1997) 973e983.
[29] H.H. Peng, C.C. Kao, S.D. Chang, A.S. Chao, Y.L. Chang, C.N. Wang, et al., The [46] V. Romanelli, A. Belinchon, A. Campos-Barros, K.E. Heath, S. Garcia-Minaur,
effects of labor on differential gene expression in parturient women, pla- V. Martinez-Glez, et al., CDKN1C mutations in HELLP/preeclamptic mothers of
centas, and fetuses at term pregnancy, Kaohsiung J. Med. Sci. 27 (2011) Beckwith-Wiedemann Syndrome (BWS) patients, Placenta 30 (2009)
494e502. China Republic : 1949-: 2011. Published by Elsevier B.V. 551e554. England.
[30] G. Weiss, Endocrinology of parturition, J. Clin. Endocrinol. Metab. 85 (12) [47] N. Kanayama, K. Takahashi, T. Matsuura, M. Sugimura, T. Kobayashi,
(2000) 4421e4425. N. Moniwa, et al., Deficiency in p57Kip2 expression induces preeclampsia-like
[31] H.S. Kim, C.R. Roh, B. Chen, B. Tycko, D.M. Nelson, Y. Sadovsky, Hypoxia reg- symptoms in mice, Mol. Hum. Reprod. 8 (12) (2002) 1129e1135.
ulates the expression of PHLDA2 in primary term human trophoblasts, [48] K. Kawasaki, E. Kondoh, Y. Chigusa, M. Ujita, R. Murakami, H. Mogami, et al.,
Placenta 28 (2e3) (2007) 77e84. Reliable pre-eclampsia pathways based on multiple independent microarray
[32] C.R. Roh, V. Budhraja, H.S. Kim, D.M. Nelson, Y. Sadovsky, Microarray-based data sets, Mol. Hum. Reprod. 21 (2) (2015) 217e224.
identification of differentially expressed genes in hypoxic term human tro- [49] G. Unek, A. Ozmen, I. Mendilcioglu, M. Simsek, E.T. Korgun, The expression of
phoblasts and in placental villi of pregnancies with growth restricted fetuses, cell cycle related proteins PCNA, Ki67, p27 and p57 in normal and pre-
Placenta 26 (4) (2005) 319e328. eclamptic human placentas, Tissue Cell. 46 (3) (2014) 198e205.
[33] T.M. Tomlinson, J.R. Garbow, J.R. Anderson, J.A. Engelbach, D.M. Nelson, [50] D.A. Enquobahrie, M. Meller, K. Rice, B.M. Psaty, D.S. Siscovick, M.A. Williams,
Y. Sadovsky, Magnetic resonance imaging of hypoxic injury to the murine Differential placental gene expression in preeclampsia, Am. J. Obstet. Gynecol.
placenta, Am. J. Physiol e Regul. Integr. Comp. Physiol 298 (2) (2010). 199 (2008). United States 566 e1e11.
R312eR9. [51] G. Rajaraman, P. Murthi, N. Pathirage, S.P. Brennecke, B. Kalionis, Downstream
[34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using targets of homeobox gene HLX show altered expression in human idiopathic
real-time quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 fetal growth restriction, Am. J. Pathol. 176 (2010) 278e287. United States.
(4) (2001) 402e408. [52] K.E. Bethin, Y. Nagai, R. Sladek, M. Asada, Y. Sadovsky, T.J. Hudson, et al.,
[35] M. Meller, S. Vadachkoria, D.A. Luthy, M.A. Williams, Evaluation of house- Microarray analysis of uterine gene expression in mouse and human preg-
keeping genes in placental comparative expression studies, Placenta 26 nancy, Mol. Endocrinol. 17 (8) (2003) 1454e1469.
(2005) 601e607. England. [53] E.J. Radford, E. Isganaitis, J. Jimenez-Chillaron, J. Schroeder, M. Molla,
[36] J.K. Cleal, P. Day, M.A. Hanson, R.M. Lewis, Measurement of housekeeping S. Andrews, et al., An unbiased assessment of the role of imprinted genes in an
genes in human placenta, Placenta 30 (2009) 1002e1003. England. intergenerational model of developmental programming, PLoS Genet. 8 (4)
[37] J.K. Cleal, P.L. Day, M.A. Hanson, R.M. Lewis, Sex differences in the mRNA (2012) e1002605.