Biochemical and Biophysical Research Communications 663 (2023) 61e70

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Rps6ka2 enhances iMSC chondrogenic differentiation to attenuate

knee osteoarthritis through articular cartilage regeneration in mice
Juan Zhang a, b, Jin-Qi Liao c, Li-Ru Wen a, Arshad-Ahmed Padhiar a, Zhu Li a,
Zhong-Yuan He d, Hua-Chuan Wu d, Jian-Feng Li d, Shuai Zhang e, Yan Zhou a, c,
Xiao-Hua Pan f, Jian-Hua Yang g, **, Guang-Qian Zhou a, *
a
Department of Medical Cell Biology and Genetics, Guangdong Key Laboratory of Genomic Stability and Disease Prevention, Shenzhen Key Laboratory of
Anti-Aging and Regenerative Medicine, Shenzhen Engineering Laboratory of Regenerative Technologies for Orthopaedic Diseases, Health Science Center,
Shenzhen University, Shenzhen, 518107, China
b
The Affiliated Nanhua Hospital, Department of Endocrinology, Hengyang Medical School, University of South China, Hengyang, 421001, Hunan, China
c
Lungene Biotech Ltd., Longhua District, Shenzhen, 518107, China
d
Innovation Platform of Regeneration and Repair of Spinal Cord and Nerve Injury, Department of Orthopaedic Surgery, The Seventh Affiliated Hospital, Sun
Yat-sen University, Shenzhen, 518107, China
e
Brain Research Centre and Department of Biology, Southern University of Science and Technology, Shenzhen, 518107, China
f
Department of Orthopaedics, The Second Affiliated Hospital of Shenzhen University, The Second School of Clinical Medicine, Southern Medical University,
The Clinical Medical College of Guangdong Medical University, People's Hospital of Shenzhen Baoan District, Shenzhen, 518107, China
g
The Second Affiliated Hospital, The Chinese University of Hong Kong, Shenzhen & Longgang District People's Hospital of Shenzhen, Shenzhen, 518107,
China

a r t i c l e i n f o a b s t r a c t

Article history: Articular cartilage (AC) is most susceptible to degeneration in knee osteoarthritis (OA); however, the
Received 26 February 2023 existing treatments for OA do not target the core link of the pathogenesis-"decreased tissue cell function
Received in revised form activity and extracellular matrix (ECM) metabolic disorders” for effective intervention. iMSC hold lower
14 March 2023
heterogeneity and great promise in biological research and clinical applications. Rps6ka2 may play an
Accepted 17 April 2023
Available online 18 April 2023
important role in the iMSC to treat OA. In this study, the CRISPR/Cas9 gene editing Rps6ka2
/
iMSC were
obtained. Effect of Rps6ka2 on iMSC proliferation and chondrogenic differentiation was evaluated in vitro.
An OA model was constructed in mice by surgical destabilization of medial meniscus (DMM). The
Keywords:
Knee osteoarthritis
Rps6ka2
/
iMSC and iMSC were injected into the articular cavity twice-weekly for 8 weeks. In vitro
Articular cartilage regeneration experiments showed that Rps6ka2 could promote iMSC proliferation and chondrogenic differentiation.
Rps6ka2 In vivo results further confirmed that Rps6ka2 could improve iMSC viability to promote ECM production
iMSC to attenuate OA in mice.
Chondrogenic differentiation © 2023 Elsevier Inc. All rights reserved.

1. Introduction problem, among which knee osteoarthritis (OA) characteristic of

severe degeneration of articular cartilage (AC) is particularly
As the aging population grows, chronic bone and joint disease is prominent and is the main cause of chronic disability [1,2]. How-
an increasingly common and serious public health and social ever, the existing treatments for OA do not target the core link of
the pathogenesis- “decreased tissue cell function activity and
extracellular matrix (ECM) metabolic disorders” for effective
* Corresponding author. intervention [3,4]. With the development of cell regenerative
** Corresponding author. medicine, stem cell therapy for OA has entered a rapid develop-
E-mail addresses: [email protected] (J. Zhang), [email protected]. mental stage [5]. Clinically, mesenchymal stem cell (MSC) types
cn (J.-Q. Liao), [email protected] (L.-R. Wen), [email protected] mainly include adult tissue stem cells, embryonic stem cells (ESC),
(A.-A. Padhiar), [email protected] (Z. Li), [email protected]
induced pluripotent stem cells (iPSC) and fetal-related tissues such
(Z.-Y. He), [email protected] (H.-C. Wu), [email protected]
(J.-F. Li), [email protected] (S. Zhang), [email protected] as umbilical cord blood, Wharton's jelly of human umbilical cord,
(Y. Zhou), [email protected] (X.-H. Pan), [email protected] (J.-H. Yang), amniotic membrane and placenta [6e8]. In fact, the isolation of
[email protected] (G.-Q. Zhou).

https://doi.org/10.1016/j.bbrc.2023.04.049
0006-291X/© 2023 Elsevier Inc. All rights reserved.
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

Abbreviations DE differentially expressed;

DPBS dulbecco's phosphate-buffered saline;
AC articular cartilage CCK-8 cell counting kit-8
OA osteoarthritis FRKM fragments per kilobase of exon model per million
ECM extracellular matrix mapped reads
DMM destabilization of medial meniscus qRT-PCR quantitative reverse transcription-polymerase chain
MSC mesenchymal stem cells reaction
ESC embryonic stem cells RIPA radioimmunoprecipitation assay
iPSC induced pluripotent stem cell SDS-PAGE sodium dodocyle sulfate-polyacrylamide gel
ISCT International society for cellular therapy electrophoresis
iMSC iPSC-derived MSC PVDF polyvinylidene difluoride;
RSK ribosomal S6 kinase BSA bovine serum albumin
NTKD N-terminal kinase domain H&E hematoxylin and eosin
CTKD C-terminal kinase domain ANOVA one-way analysis of variance
ERK1/2 extracellular signal-regulated kinase-1/2 PCA principal component analysis
MAPK mitogen-activated protein kinase DMOAD disease-modifying OA drug

MSC produces heterogeneous, non-clonal cultures of stromal cells the cytoplasm and will be translocated to the nucleus after stim-
containing stem cells with multipotential properties, committed ulation. RSK1 is mainly expressed in pancreas, lungs and kidneys,
progenitors and differentiated cells which leads to two unfavorable RSK2 and 3 are mainly expressed in myocardium and skeletal
results [9,10]. In terms of cell biology, the MSC obtained from tissue muscle [23]. In terms of cell physiology, RSKs can promote cell
isolation are already highly heterogeneous, cell populations are proliferation and study has found that the RSKs small molecule
unclear, multiple differentiation stages and states are mixed, and inhibitor BI-D1870 can promote cell apoptosis [24]. Our previous
MSC experiment results are often not completely reproducible. In study has found that RSK3 is the only member of the RSKs that
terms of clinical applications, transplantation for OA cannot be expresses in the AC and pRSK3 expression is correlated with AC
guaranteed to be the most suitable, homogeneous and functionally regenerative capacity, such that MRL/MpJ mice that are not sus-
clear MSC subgroups which makes the standardized evaluation of ceptible to OA show high expression levels of pRSK3, whereas STR/
the safety and effectiveness of MSC treatment more difficult. Ort and CBA mice that are highly and moderately susceptible to OA
Although the epigenetic memory or reprogramming process of exhibit low expression levels of pRSK3 [25].
initial tissue origin causes differences between cell clones, iPSC Herein, we aim to determine whether Rps6ka2 has the potential
show specific heterogeneity, the heterogeneity within a single iPSC to enhance iMSC chondrogenic differentiation to attenuate OA
clone found so far is relatively low [11,12]. A single iPSC cell or iPSC- through AC regeneration. At the molecular level, differentially
derived MSC (iMSC) obtained by clonal differentiation can reduce expressed (DE) signaling pathways in the Rps6ka2
/
iMSC- and
the heterogeneity of iMSC from the source [13]. With the iMSC-chondrogenic pellets are identified by the transcriptional
improvement and optimization of non-integrated iPSC induction profiling. In vitro, the effect of Rps6ka2 on the iMSC chondrogenic
technology, iPSC without viral vectors and tumorigenic gene c-myc differentiation is explained. In vivo, the effect of Rps6ka2 on the
are now available. We and other groups have successfully differ- iMSC chondrogenic differentiation to attenuate OA through AC
entiated iPSC from various tissues into iMSC with high efficiency regeneration is emphasized.
and the iMSC possess robust chondrogenic differentiation capac-
ities [11,12,14e16]. It has shown that iMSC possess more stable 2. Materials and methods
molecular phenotype, proliferation and differentiation perfor-
mance and stronger regeneration and repair ability in animal dis- 2.1. Animals
ease models compared with MSC derived from adult tissues
[15,17,18]. It is easier to carry out chemical stimulation or genetic Male C57BL/6J mice (age 9 weeks, weighing 25 ± 2 g) were
modification at the monoclonal stage of iPSC single cell and it is purchased from Liaoning Changsheng Biotechnology Co., Ltd
convenient to realize the gene labeling of iMSC or obtain specific (Liaoning, China). Mice were housed under a 12 h-light/12 h-dark
genetically modified iMSC by CRISPR/Cas9 gene editing, which can cycle and a constant temperature at 25  C and were provided the
be used to study the function of specific genes or develop a new standard diet and water ad libitum until adaptive one week later
generation of biotherapeutics of stem cell-gene modification to starting the experiment. This study was performed in strict accor-
treat OA [19,20]. Notably, the generation of iMSC from iPSC requires dance with the recommendations in the Guide for the Animal Care
a significant degree of molecular manipulation and that the clinical and Use Committee of Shenzhen University and conformed to the
use of iMSC requires further validation from preclinical and clinical National Institutes of Health Guide for the Care and Use of Labo-
studies [21]. ratory Animals. The protocol was approved by the Shenzhen Uni-
The p90 ribosomal S6 kinase (RSK) family is a highly conserved versity's Animal Care committee, Shenzhen, China. Permit Number:
serine/threonine kinase that contains four members with high AEWC-2021014. Every effort was made to minimize suffering.
sequence homology (75e80%) (RSK1, RSK2, RSK3 encoded by
Rps6ka2, RSK4); they have two functional kinase domains including 2.2. Cell culture and differentiation
N-terminal kinase domain (NTKD) and C-terminal kinase domain
(CTKD) required for the automatic activation of RSKs; extracellular A detailed procedure of CRISPR/Cas9 gene editing Rps6ka2
/

signal-regulated kinase-1/2 (ERK1/2)/mitogen-activated protein iPSC can be found in our previous publication with minor modifi-
kinase (MAPK) signal cascade can activate the D-domain of RSKs to cation [19]. We adopted the commercial scientific-grade hiPSC cell
obtain pRSKs [22]. Except for RSK4, other members are expressed in line provided by Nuwacell Co., Ltd (Anhui, China) (cell name:
62
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

ZSSY001, product number: RC 01001-A, batch number: 2.6. Quantitative reverse transcription-polymerase chain reaction
42bb407c6a3b). Briefly, the hiPSC were cultured in TeSR-E8 me- (qRT-PCR) in cell-chondrogenic pellets
dium (STEMCELL, 05990) in six-well plates coated with Vitronectin
(VTN) (STEMCELL, 07180). At 70e75% confluency on the day of Total RNA was isolated and reverse transcribed to cDNA. Trip-
transfection, iPSC was digested into single cells by Accutase licate samples containing the appropriate primers (1 mM, Table 1)
(STEMCELL, 07920) and electroporated by CRISPR Rps6ka2
/
were analyzed by qRT-PCR using PrimeScript™ RT-PCR Kit (Takara,
ribonucleoprotein (RNP) complexes (Integrated DNA Technologies, RR014A) according to the manufacturer's instructions. The GAPDH
IDT) and P3 Primary Cell 4D-Nucleofector® X Kit (Lonza, V4XP- gene was amplified separately as an internal control to normalize
3024) to obtain CRISPR/Cas9 gene editing Rps6ka2
/
iPSC. The for specific gene expression in the samples. Fold change was
iMSC and Rps6ka2
/
iMSC were differentiated from iPSC and calculated using the 2
DDCt method.
Rps6ka2
/
iPSC respectively using STEMdiff™ Mesenchymal Pro-
genitor Kit (STEMCELL, 05240) and incubated using MesenCult™- 2.7. Destabilization of medial meniscus (DMM)-induced OA mouse
ACF Plus Medium (STEMCELL, 05448) at 37  C, 5% CO2 according to model and clinical scoring of disease severity
the manufacturer's instructions. For studies reported here, iMSC
and Rps6ka2
/
iMSC were used at P5 and collected when An OA mouse model was created in mice by DMM using a
approximately 80% confluent. The ability of iMSC and Rps6ka2
/
previously reported protocol [28]. Briefly, male mice (body weight:
iMSC tri-lineage differentiation were assessed by specific cytos- 25 ± 2 g, n ¼ 6 per group) were anesthetized with 2% isoflurane
taining [adipogenesis: Oil Red O (Sigma, MAK194), chondrogenesis: (RWD, R510-22-16) air using an anesthesia machine (RWD Life
Alcian Blue (Beyotime, C0155), and osteogenesis: Alizarin Red Science Co., Ltd., Shenzhen, China). After opening the left knee joint
(Beyotime, C0148)]. capsule, the medial meniscotibial ligament, which anchored the
medial meniscus to the tibial plateau, was cut to destabilize the
joint. Cartilage injury beneath the medial meniscus was avoided.
2.3. Flow cytometry analysis Then, the knee joint capsule was closed with a 4-0 suture. Knee
joint capsule was only opened in the Sham group. For each study,
To confirm the surface phenotype of the iMSC and Rps6ka2
/
mice (n ¼ 6 per group) were randomly assigned to the following
iMSC, FITC/PE/APC-conjugated antibodies (BD Biosciences, USA) groups: (a) untreated control group; (b) DMM þ DPBS adminis-
including positive (CD73, CD90, CD105) and negative (CD34, CD45) tration; (c) DMM þ iMSC administration; and (d) DMM þ Rps6ka2
/


cell surface markers were detected by flow cytometry as previously iMSC administration. Mice were monitored daily for body weight,
described [14]. The cells (1  106) were harvested by Animal food intake, water consumption, clinical signs, stool consistency
Component-Free Cell Dissociation Kit (STEMCELL, 05426), washed and color daily. On weeks 2, 4, and 6 of the study (with DMM
with DPBS (Gibco, C14190500BT), blocked with 2% FBS (Gibco, administration initiated on day 0), iMSC and Rps6ka2
/
iMSC were
10091e148) at 4  C for 30 min and then incubated individually with administered by left intra-articular injection at a dose of
FITC/PE/APC-conjugated antibodies at 4  C for 1 h. Unlabeled cells 5  105 cells per mouse in 10 ml DPBS. The DMM þ DPBS group of
were used as control for all antibodies. The cells were re-suspended mice were administered 10 ml DPBS by left intra-articular injection.
in 0.4 mL DPBS and analyzed on a FACSCalibur (Becton Dickinson, Histology is the gold standard for evaluation of murine OA. Clinical
USA). Data were processed using FlowJo software (Java Software). scoring was done using the semi-quantitative OARSI scoring system
to apply to the proteoglycan staining of medial tibial plateau of the
joint, as described previously [29]. Briefly, A score of 0 represents
normal cartilage, 0.5 ¼ loss of proteoglycan with intact surface,
2.4. Cell viability assay
1 ¼ superficial fibrillation without loss of cartilage, 2 ¼ vertical
clefts and loss of surface lamina, 3 ¼ vertical clefts/erosion to the
Cell proliferation was analyzed using cell counting kit-8 (CCK-8)
calcified layer lesion for 1e24%, 4 ¼ vertical clefts/erosion to the
(MedChemExpress, HY-K0301) as previously described [26]. The
calcified layer lesion for 25e50%, 5 ¼ vertical clefts/erosion to the
optical density at 450 nm was determined using a microplate
calcified layer lesion for 50e75%, 6 ¼ vertical clefts/erosion to the
reader (Multiskan GO, Thermo Scientific, Germany).
calcified layer lesion for >75%. Safranin O coloration is approxi-
Cell-chondrogenic pellet differentiation. MesenCult™-ACF
mately proportional to the concentration of anions, which can
Chondrogenic Differentiation Kit (STEM CELL, 05455) for iMSC and
indirectly reflect the content and distribution of proteoglycan in the
Rps6ka2
/
iMSC-chondrogenic pellet differentiation in vitro ac-
cartilage matrix. If the cartilage is damaged, the proteoglycan in the
cording to the manufacturer's instructions.
cartilage are lost and appear as light or no staining with Safranin O.
The acid dye Fast Green combines with eosinophilic components in
the tissue appear green or blue color. Safranin O-Fast Green staining
2.5. RNA-sequencing & bioinformatics analysis

RNA extraction, sequencing and bioinformatic analyses were Table 1

A list of primer sequences used in current study.
performed by Genergy Bio-tech Inc. (Shanghai, China) according to
standard procedures and as previously described [27]. In this Gene Direction Sequence
project, 6 samples were sequenced on Illumina NovaSeq 6000 Aggrecan Forward TCCCCTGCTATTTCATCGAC
Platform with about 6 Gb data production per sample. RNA integ- Reverse CCAGCAGCACTACCTCCTTC
rity was assessed using the Qubit 4.0 Quantitation Kit of the Qubit Collagen II Forward AGGGCCAGGATGTCCGGCA
Reverse GGGTCCCAGGTTCTCCATCT
4.0 system (Invitrogen, USA). RNA quality control, read mapping
Sox9 Forward GGAATGTTTCAGCAGCCAAT
and bioinformatic analysis were performed by standard bio- Reverse TGGTGTTCTGAGAGGCACAG
informatic methods [27]. The levels of expression for each gene Rps6ka2 Forward ACGCTGTACCGGAAGGAGATC
were normalized to fragments per kilobase of exon model per Reverse CTCGTAGCCATCGGTGAAGTG
million mapped reads (FPKM). Data available at https://www.ncbi. GAPDH Forward CGGAGCCAAAAGGGTCATCA
Reverse GGGGGGCTAAGCAGTTGGTG
nlm.nih.gov/sra/PRJNA791455, accession number PRJNA791455.
63
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

is used to distinguish cartilage tissue from bone tissue. Alcian Blue LAS4000mini, Sweden). Densitometric analyses were performed
staining is also used to reflect the content and distribution of pro- using Gel-Pro Analyzer software (Media Cybernetics, Rockville,
teoglycan which could be regarded as a marker of chondrogenesis. USA).

2.8. Western blotting 2.9. Histological evaluation

Total protein was obtained by lysing human cells in radio- Left knee joint samples were taken 8 weeks after OA modeling.
immunoprecipitation assay (RIPA) buffer containing a protease The mice were deeply anesthetized with isoflurane, the chest skin
inhibitor cocktail. The prepared samples were separated on 10% or was cut with scissors, the heart was exposed, and the left ventricle
15% sodium dodocyle sulfate-polyacrylamide gel electrophoresis apex was placed with an indwelling needle, perfused with DPBS
(SDS-PAGE) gels and transferred to polyvinylidene difluoride and then perfused with 4% paraformaldehyde (Biosharp, BL539A)
(PVDF) membranes (Millipore, Temecula, CA, USA). After blocking until the mice became stiff. The entire knee joint of the mouse was
with 3% bovine serum albumin (BSA) (Thermo Fisher Scientific, retained and fixed in 4% paraformaldehyde for 24 h at 4  C.
37525), the membranes were incubated overnight at 4  C with Following the decalcification by EDTA decalcification solution
primary antibodies including rabbit-anti pRSK3 (CST, 1:1000, (Leagene, DD0002, China), knee joint samples were placed in a 20%
12032), rabbit-anti RSK3 (Immunoway, 1:1000, YT 5839), rabbit- wt/vol sucrose solution (Sigma, V900116, USA) for 24 h at 4  C, prior
anti CDK2 (CST, 1:1000, 2456), rabbit-anti Type II collagen (Beyo- to embedding and freezing in OCT compound (Sakura, 4583, Japan).
time, 1:1000, AF6528) or mouse-anti b-actin (CST, 1:1000, 58169), OCT-embedded frozen knee tissues were cryosectioned at 20 mm
washed in TBS-Tween 20, and incubated with horseradish thickness in the vertical direction at the cartilage internal sagittal
peroxidase-coupled anti-rabbit or anti-mouse antibodies (CST, plane and mounted on adhesive slides (CITOGLAS,188105W, China).
1:1000, 7074/7076), which was detected by chemical luminescence The percentage of matrix staining for Hematoxylin and Eosin (H&E)
and visualized on a luminescent image analyzer (ImageQuant (Beyotime, C0105, China), Safranin O-Fast green (Servicebio, G1053,

Fig. 1. Schematic diagram for iMSC and Rps6ka2
/
iMSC preparation. (A) The identification of CRISPR/Cas9 gene editing Rps6ka2 by gene sequencing. (B) Cell morphology of iMSC
and Rps6ka2
/
iMSC. n ¼ 3. Scale bar, 100 mm or 200 mm.

64
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

China), or Alcian Blue staining (Beyotime, C0148, China) in AC was anti pRSK3 (CST, 1:200, 12032), mouse-anti CD44 (Beyotime,
calculated by Image-Pro Plus Software. 1:200, AF0105), rabbit-anti CD90 (Beyotime, 1:200, AF1636) diluted
with 3% BSA. Then, the sections were incubated with Alexa Flour
488/555-conjugated goat/donkey anti-rabbit/mouse secondary
2.10. Immunofluorescence analysis antibody (CST, 1:300, 4412/4409) for immunofluorescence. Subse-
quently, they were stained with Antifade Mounting Medium with
Cells were fixed with 4% paraformaldehyde for 20 min. The knee DAPI (Beyotime, P0131). The images were captured under a mi-
joint tissue sections were permeabilized with 0.3% triton X-100 croscope (Leica DM4B or Zeiss Primo Vert) or a confocal microscope
(Beyotime, ST795) for 30 min. The cells or sections were then (Zeiss LSM 880). Quantitative analysis was conducted in a blinded
incubated with 5% BSA and incubated overnight with rabbit-anti fashion with Image-Pro Plus Software.
Type II collagen (Beyotime, 1:200, AF6528), rabbit-anti Type X
collagen (Beyotime, 1:200, AF6538), rabbit-anti MMP-13 (Beyo-
time, 1:200, AF7479), mouse-anti Ki67 (CST, 1:200, 9449), rabbit-

Fig. 2. Transcriptome comparison of Rps6ka2
/
iMSC- and iMSC-chondrogenic pellets. (A) PCA of 3 Rps6ka2
/
iMSC and 3 iMSC samples showed clear distinction between
Rps6ka2
/
iMSC- and iMSC-chondrogenic pellets. Each dot represents one chondrogenic pellet sample. (B) Bioinformatic Venn diagram. (C) GO analysis. (D) Normalized gene
expression level (z-score) of DE transcripts between Rps6ka2
/
iMSC- and iMSC-chondrogenic pellets were used to generate heatmaps. Based on DE transcripts, Rps6ka2
/
iMSC-
and iMSC-chondrogenic pellets were distinctly separated. n ¼ 3.

65
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

2.11. Statistical analysis differentiated into chondrocytes (proteoglycan staining with Alcian
blue), adipocytes (intracellular lipid droplet) and osteoblasts
Results were presented as the mean ± standard deviation. Error (mineralized nodules) (Figs. S2Ae2D).
bars represent the mean ± standard deviation of three or six in-
dependent experiments performed in triplicate. Depending on the
design of the experiment, differences between groups were
assessed by independent-samples T test or by one-way analysis of 3.2. Transcriptome comparison of Rps6ka2
/
iMSC- and iMSC-
variance (ANOVA) followed by Tukey's Multiple Comparison Test, chondrogenic pellets
performed in SPSS 22.0 software. P < 0.05 was considered to
indicate a statistically significant difference. To elucidate the biological mechanisms of Rps6ka2 for iMSC
chondrogenic capacities, we performed RNA sequencing to
3. Results examine the transcriptome profiles of Rps6ka2
/
iMSC- and iMSC-
chondrogenic pellets. Quantitative transcriptomic differences be-
3.1. Phenotypic characterization of iMSC and Rps6ka2
/
iMSC tween Rps6ka2
/
iMSC- and iMSC-chondrogenic pellets were
in vitro clustered into two distinct clusters based on principal component
analysis (PCA): one cluster exclusively had samples from Rps6ka2
/
A schematic diagram of iMSC and Rps6ka2
/
iMSC preparation

iMSC-chondrogenic pellets and the other cluster had samples
is shown in Fig. 1A. Both iMSC and Rps6ka2
/
iMSC at passage 5 from iMSC-chondrogenic pellets (Fig. 2A). By Venn analysis
which showed a spindle shape (Fig. 1B) were assessed by surface (Fig. 2B), we found that the intersection of the DE RNAs between
marker profiling and differentiation capacity according to MSC Rps6ka2
/
iMSC- and iMSC-chondrogenic pellets included ECM,
characteristics and identification criteria. Flow cytometric analysis regulation of cell proliferation and differentiation. Rps6ka2
/

revealed positive expression of MSC markers, including CD73, CD90 iMSC-chondrogenic pellets possessed down-regulated mRNAs
and CD105 which were expressed exclusively on MSC, and negative including cell proliferation, differentiation and collagen biosyn-
expression of CD34 and CD45 (Fig. S1). Tri-lineage differentiation thesis and up-regulated mRNAs involving collagen degradation
studies also revealed that both iMSC and Rps6ka2
/
iMSC could be compared to iMSC-chondrogenic pellets (Fig. 2C and D).

Fig. 3. Histologic analysis and quantitative evaluation of the AC lesion. (A) Intra-articular iMSC and Rps6ka2
/
iMSC administration schedule in DMM-induced OA in C57/BL6 mice.
(B)e(E) H&E, Safranin O and Fast green, Alcian blue staining and histopathological assessment. (n ¼ 6; *P < 0.05, **P < 0.01, ***P < 0.001). Mean ± SEM. Scale bar, 125 mm. (For
interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

66
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

3.3. Rps6ka2 promoted iMSC proliferation and chondrogenic iMSC þ DMM-treated mice, OA-like pathologic features were sur-
differentiation veyed by histological observations and OARSI scores which
revealed increased ECM production and improvements in DMM
To confirm a key role for Rps6ka2 in modulating iMSC viability, injury compared to DPBS þ DMM- and Rps6ka2
/
iMSC þ DMM-
we compared the proliferation and differentiation capacity of iMSC treated mice. Normal AC with intact cartilage integrity were
and Rps6ka2
/
iMSC in vitro. Here, we found that the proliferative observed in the Sham and iMSC þ DMM group mice. In contrast,
capacity of Rps6ka2
/
iMSC was markedly lower than iMSC OA-associated lesions were observed in the AC of DPBS þ DMM and
(Fig. S3A). Cell cycle assay indicated that Rps6ka2
/
iMSC had Rps6ka2
/
iMSC þ DMM group mice characterized by loss of
significantly reduced S þ M phase and increased G1 phase pop- cartilage cellularity and proteoglycan expression on the AC surface
ulations compared with iMSC (Fig. S3B and Fig. S3C). Western (Fig. 3BeE). Additionally, iMSC treatment was associated with
blotting assay indicated that Rps6ka2
/
iMSC possessed signifi- significantly increased number of CD44þ/CD90þ (Fig. 4 and Fig. 5E)
cantly lower CDK2 protein expression than iMSC (Fig. S3D). and Ki67þ (Fig. 4 and 5D) cells, increased hyaline cartilage labeled
Moreover, iMSC possessed stronger chondrogenic differentiation as with type II collagen (Fig. 4 and 5A) accompanied by decreased
demonstrated by increased type II collagen, Sox9 and aggrecan gene hypertrophic chondrocytes labeled with type X collagen (Fig. 4 and
and protein expression accompanied by increased Ki67 and pellet 5B) and MMP-13 (Fig. 4 and 5C) compared to Rps6ka2
/

diameter compared with Rps6ka2
/
iMSC (Figs. S4AeS4H). iMSC þ DMM mice. Collectively, these results suggested that
Collectively, these results suggested that Rps6ka2 could promote Rps6ka2 could improve iMSC viability to promote ECM production
iMSC proliferation and chondrogenic differentiation in vitro. to attenuate OA.

3.4. Rps6ka2 improved iMSC viability to promote ECM production 4. Discussion

to attenuate OA
In this study, we successfully got CRISPR gene editing Rps6ka2
/


We focused our analyses on whether Rps6ka2 could improve iMSC and further proved that both Rps6ka2
/
iMSC and iMSC
iMSC viability to attenuate OA. First, we induced DMM injury in possessed MSC phenotypic characterization. iMSC function is
C57BL/6J mice and then evaluated iMSC or Rps6ka2
/
iMSC effi- mainly mediated by damaged tissue structure and/or function
ciency after injection into the articular cavity (Fig. 3A). After intra- replacement, paracrine signal transduction, diseased tissue or or-
articular administration of iMSC twice-weekly for 8 weeks in gan self-recovery cell mechanisms, but its definition for OA is still

Fig. 4. Rps6ka2 improved iMSC viability to promote ECM production to attenuate OA. Immunofluorescence detection of Collagen II (green), Collagen X (red), MMP-13 (green), Ki67
(red)/pRSK3 (green), CD44 (red)/CD90 (green) CSPC in AC from mice with DMM-induced OA with or without iMSC or Rps6ka2
/
iMSC treatment. (n ¼ 6). Scale bar, 100 mm. (For
interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

67
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

Fig. 5. Rps6ka2 improved iMSC viability to promote ECM production to attenuate OA. (A)e(E) Quantitative analysis of Collagen II, Collagen X, MMP-13, Ki67/pRSK3, CD44/CD90
CSPC in AC from mice with DMM-induced OA with or without iMSC or Rps6ka2
/
iMSC treatment. (n ¼ 6; *P < 0.05, **P < 0.01, ***P < 0.001). Mean ± SEM.

unclear [13,18,30e33]. Therefore, we deeply analyze the cellular research of some new diagnosis and treatment methods [37].
mode of action at the genetic and molecular level to understand its There are currently four main models for traumatic OA in mice,
therapeutic mechanisms. which are classified according to the severity of the disease: Mild:
AC is most susceptible to degeneration in OA. MAPK/ERK is the transection of the anterior cross; Moderate: transection of the
major signaling pathway involved in homeostasis maintenance and anterior cross and medial meniscus; Medial: transection of the
suggested to contribute to the catabolic chondrocyte hypotrophy medial ligament and medial meniscus; Severe: all the ligaments of
and degeneration of cartilage [34e36]. RSKs are pleiotropic effec- the knee joint are transected þ internal and lateral meniscus are
tors for ERK signaling pathways [22]. Our previous study found that removed [38]. Considering the initiative of developing easy and
RSK3 encoded by Rps6ka2 is the only member of the RSKs that convenient prophylactic techniques for OA, we adopted a Mild-
expresses in the cartilage and pRSK3 expression level is correlated level mice model to compare the therapeutic efficiency of
with AC regenerative capacity [25]. In this study, We confirmed that Rps6ka2
/
iMSC and iMSC, explained the effects of genetic factor
Rps6ka2 promoted iMSC proliferation and chondrogenic differen- on the functional activity of transplanted iMSC in vivo, explored the
tiation in vitro. main mechanisms and key factors in AC regeneration and repair
Due to the wide range of mouse sources and stable biological after iMSC implantation and provided a basis for optimizing iMSC
factors coupled with the current stable transgene and gene treatment to OA. With no blood vessel, lymphatic drainage and
knockout effects, the animal models for the onset of OA are basi- nerve distribution in AC whose nutrition can only depend on sy-
cally mice which can be mostly used for the proof-of-concept novial fluid in the joint cavity, AC composed of cartilage cells and

68
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

ECM which mainly includes proteoglycan, type II collagen and a Appendix A. Supplementary data
small amount of type IX and XI collagen, cannot be in good repair
[25,39,40]. Among them, the proliferated chondrocytes express Supplementary data to this article can be found online at
type II collagen participating in maintaining the stability of joints https://doi.org/10.1016/j.bbrc.2023.04.049.
and proteoglycan is a kind of large-protein molecule composed of
core protein and aminoglycan which accounts for half of the dry References
weight of AC. The near-central area of the growth soft plate con-
tains hypertrophic chondrocytes expressing type X collagen related [1] A.E.M. Jørgensen, M. Kjær, K.M. Heinemeier, The effect of aging and me-
chanical loading on the metabolism of articular cartilage, J. Rheumatol. 44
to the calcification of cartilage in a specific area which tend to (2017) 410e417.
undergo apoptosis. Intervening in all aspects in time to promote [2] R.F. Loeser, J.A. Collins, B.O. Diekman, Ageing and the pathogenesis of osteo-
ECM anabolism and inhibit ECM catabolism to enhance AC regen- arthritis, Nat. Rev. Rheumatol. 12 (2016) 412e420.
[3] C.Y. Ng, J.Y. Chai, J.B. Foo, N.H. Mohamad Yahaya, Y. Yang, M.H. Ng, J.X. Law,
eration may be the most promising way to attenuate OA. We found
Potential of exosomes as cell-free therapy in articular cartilage regeneration: a
that Rps6ka2 could improve iMSC viability to promote ECM pro- review, Int. J. Nanomed. 16 (2021) 6749e6781.
duction to attenuate OA in mice. [4] U. Anil, D.H. Markus, E.T. Hurley, A.K. Manjunath, M.J. Alaia, K.A. Campbell,
The present study needs further systematic research. Chon- L.M. Jazrawi, E.J. Strauss, The efficacy of intra-articular injections in the
treatment of knee osteoarthritis: a network meta-analysis of randomized
drocytes cannot regenerate and iMSC can be differentiated into controlled trials, Knee 32 (2021) 173e182.
iMSC-chondrocytes. We need to further compare the morphology [5] M.A.B. Siddiq, D. Clegg, T.L. Jansen, J.J. Rasker, Emerging and new treatment
and related biological functions of iMSC-chondrocytes with AC options for knee osteoarthritis, Curr. Rheumatol. Rev. (2021).
[6] T. Wang, J. Zhang, J. Liao, F. Zhang, G. Zhou, Donor genetic backgrounds
native chondrocytes. We also need to trace iMSC after intra- contribute to the functional heterogeneity of stem cells and clinical outcomes,
articular injection to clarify their residence and differentiation. Stem Cells Translat. Med. 9 (2020) 1495e1499.
Based on the understanding of Ras/Raf/MEK/ERK, PI3K/Akt and [7] W. Zakrzewski, M. Dobrzyn
ski, M. Szymonowicz, Z. Rybak, Stem cells: past,
present, and future, Stem Cell Res. Ther. 10 (2019) 68.
other signaling pathways and the results we have got on the role of [8] M. Dominici, K. Le Blanc, I. Mueller, I. Slaper-Cortenbach, F. Marini, D. Krause,
Rps6ka2 on iMSC in vivo and in vitro, we will use Rps6ka2 knockout R. Deans, A. Keating, D. Prockop, E. Horwitz, Minimal criteria for defining
and AC-specific Rps6ka2 deletion mouse DMM models and iMSC- multipotent mesenchymal stromal cells, Int. Soci. Cellular Ther. Posit. State-
ment, Cytother. 8 (2006) 315e317.
chondrocyte differentiation models with ERK and Rps6ka2 de- [9] U. Galderisi, G. Peluso, G. Di Bernardo, Clinical trials based on mesenchymal
letions to prove that Rps6ka2 has the functions of modification, stromal cells are exponentially increasing: where are we in recent years?
conversion and fine-tuning on important signaling pathways such Stem Cell Rev. Rep. 18 (2022) 23e36.
[10] T. Squillaro, G. Peluso, U. Galderisi, Clinical trials with mesenchymal stem
as ERK1/2, as well as the “interactive dialogue” and connection with
cells: an update, Cell Transplant. 25 (2016) 829e848.
other types of MAPK signaling pathways, so as to play their role in [11] A.J.C. Bloor, A. Patel, J.E. Griffin, M.H. Gilleece, R. Radia, D.T. Yeung, D. Drier,
maintaining iMSC homeostasis to attenuate OA and so that new L.S. Larson, G.I. Uenishi, D. Hei, K. Kelly, I. Slukvin, J.E.J. Rasko, Production,
ideas, new strategies or new technologies for the diagnosis and safety and efficacy of iPSC-derived mesenchymal stromal cells in acute
steroid-resistant graft versus host disease: a phase I, multicenter, open-label,
treatment of OA based on molecular mechanism research to dose-escalation study, Nat. Med. 26 (2020) 1720e1725.
remove “harmful” signals or promote “beneficial” signals are ex- [12] M.L. Saetersmoen, Q. Hammer, B. Valamehr, D.S. Kaufman, K.J. Malmberg, Off-
pected. Our data herein provided that Rps6ka2 has the potential to the-shelf cell therapy with induced pluripotent stem cell-derived natural
killer cells, Semin. Immunopathol. 41 (2019) 59e68.
enhance iMSC chondrogenic differentiation to attenuate OA [13] J. Zhang, M. Chen, J. Liao, C. Chang, Y. Liu, A.A. Padhiar, Y. Zhou, G. Zhou,
through AC regeneration. Induced pluripotent stem cell-derived mesenchymal stem cells hold lower
heterogeneity and great promise in biological research and clinical applica-
tions, Front. Cell Dev. Biol. 9 (2021), 716907.
[14] L. Luo, Y. Zhou, C. Zhang, J. Huang, J. Du, J. Liao, N.L. Bergholt, C. Bünger, F. Xu,
CRediT author statement
L. Lin, G. Tong, G. Zhou, Y. Luo, Feeder-free generation and transcriptome
characterization of functional mesenchymal stromal cells from human
Zhang Juan: Conceptualization, Methodology, Software. Zhang pluripotent stem cells, Stem Cell Res. 48 (2020), 101990.
Juan, Zhou Guangqian, Yang Jianhua: Data curation, Writing- Orig- [15] E.I. Ozay, J. Vijayaraghavan, G. Gonzalez-Perez, S. Shanthalingam,
H.L. Sherman, D.T. Garrigan Jr., K. Chandiran, J.A. Torres, B.A. Osborne,
inal draft preparation. Zhang Juan, Wen Liru, Li Zhu, He Zhongyuan, G.N. Tew, Slukvin II, R.A. Macdonald, K. Kelly, L.M. Minter, Cymerus™ iPSC-
Wu Huachuan, Li Jianfeng: Visualization, Investigation. Zhou MSCs significantly prolong survival in a pre-clinical, humanized mouse
Guangqian, Yang Jianhua, Pan Xiaohua: Supervision. Zhang Shuai, model of Graft-vs-host disease, Stem Cell Res. 35 (2019), 101401.
[16] M. McGrath, E. Tam, M. Sladkova, A. AlManaie, M. Zimmer, G.M. de Peppo,
Zhou Yan, Padhiar Arshardahmed, Liao Jinqi: Software, Validation. GMP-compatible and xeno-free cultivation of mesenchymal progenitors
Zhang Juan, Zhou Guangqian: Writing- Reviewing and Editing. derived from human-induced pluripotent stem cells, Stem Cell Res. Ther. 10
(2019) 11.
[17] E. Fernandez-Rebollo, J. Franzen, R. Goetzke, J. Hollmann, A. Ostrowska,
M. Oliverio, T. Sieben, B. Rath, J.W. Kornfeld, W. Wagner, Senescence-associ-
Declaration of competing interest
ated metabolomic phenotype in primary and iPSC-derived mesenchymal
stromal cells, Stem Cell Rep. 14 (2020) 201e209.
The authors declare they have no competing interests. [18] Y.H. Chang, K.C. Wu, D.C. Ding, Induced pluripotent stem cell-differentiated
chondrocytes repair cartilage defect in a rabbit osteoarthritis model, Stem
Cell. Int. 2020 (2020), 8867349.
[19] J.Q. Liao, G. Zhou, Y. Zhou, Generation of Monoclonal iPSC Lines with Stable
Acknowledgements Cas9 Expression and High Cas9 Activity, Methods in Molecular Biology (Clif-
ton, N.J.), 2020.
The authors would like to thank Xiu-Rong Rao, Zhi-Mei Huang [20] G. Wang, L. Yang, D. Grishin, X. Rios, L.Y. Ye, Y. Hu, K. Li, D. Zhang, G.M. Church,
W.T. Pu, Efficient, footprint-free human iPSC genome editing by consolidation
(Shenzhen TOP Biotechnology Co., Ltd, China) for providing tech- of Cas9/CRISPR and piggyBac technologies, Nat. Protoc. 12 (2017) 88e103.
nical support for animal experiments.The present study was [21] J. Liu, Y. Ding, Z. Liu, X. Liang, Senescence in mesenchymal stem cells: func-
partially supported by the National Natural Science Foundation of tional alterations, molecular mechanisms, and rejuvenation strategies, Front.
Cell Dev. Biol. 8 (2020) 258.
China (82072480, 89201312), Shenzhen Commission of Science and
[22] A. Carriere, H. Ray, J. Blenis, P.P. Roux, The RSK factors of activating the Ras/
Innovation (JCYJ20220530162206012), the Sanming Project of MAPK signaling cascade, Front. Biosci. : J. Vis. Literacy 13 (2008) 4258e4275.
Medicine in Shenzhen (SZSM202106019), and the Shenzhen Com- [23] R. Anjum, J. Blenis, The RSK family of kinases: emerging roles in cellular sig-
mission for Development and Reform via the Shenzhen Engineer- nalling, Nat. Rev. Mol. Cell Biol. 9 (2008) 747e758.
[24] D. Neise, D. Sohn, A. Stefanski, H. Goto, M. Inagaki, S. Wesselborg, W. Budach,
ing Laboratory of Regenerative Technologies for Orthopedic K. Stühler, R.U. J€
anicke, The p90 ribosomal S6 kinase (RSK) inhibitor BI-D1870
Diseases. prevents gamma irradiation-induced apoptosis and mediates senescence via

69
J. Zhang, J.-Q. Liao, L.-R. Wen et al. Biochemical and Biophysical Research Communications 663 (2023) 61e70

RSK- and p53-independent accumulation of p21WAF1/CIP1, Cell Death Dis. 4 retinal ganglion cells against mitochondrial complex I defect-induced
(2013) e859. degeneration, Theranostics 9 (2019) 2395e2410.
[25] S. Zhang, P. Hu, T. Liu, Z. Li, Y. Huang, J. Liao, M.R. Hamid, L. Wen, T. Wang, [33] K.H. Chen, K.C. Lin, C.G. Wallace, Y.C. Li, P.L. Shao, J.Y. Chiang, P.H. Sung,
C. Mo, M. Alini, S. Grad, T. Wang, D. Chen, G. Zhou, Kartogenin hydrolysis H.K. Yip, Human induced pluripotent stem cell-derived mesenchymal stem
product 4-aminobiphenyl distributes to cartilage and mediates cartilage cell therapy effectively reduced brain infarct volume and preserved neuro-
regeneration, Theranostics 9 (2019) 7108e7121. logical function in rat after acute intracranial hemorrhage, Am. J. Tourism Res.
[26] S. Zhang, M.R. Hamid, T. Wang, J. Liao, L. Wen, Y. Zhou, P. Wei, X. Zou, G. Chen, 11 (2019) 6232e6248.
J. Chen, G. Zhou, RSK-3 promotes cartilage regeneration via interacting with [34] S.K. Hong, P.K. Wu, J.I. Park, A cellular threshold for active ERK1/2 levels de-
rpS6 in cartilage stem/progenitor cells, Theranostics 10 (2020) 6915e6927. termines Raf/MEK/ERK-mediated growth arrest versus death responses, Cell.
[27] M.G. Grabherr, B.J. Haas, M. Yassour, J.Z. Levin, D.A. Thompson, I. Amit, Signal. 42 (2018) 11e20.
X. Adiconis, L. Fan, R. Raychowdhury, Q. Zeng, Z. Chen, E. Mauceli, N. Hacohen, [35] J.A. McCubrey, L.S. Steelman, W.H. Chappell, S.L. Abrams, R.A. Franklin,
A. Gnirke, N. Rhind, F. di Palma, B.W. Birren, C. Nusbaum, K. Lindblad-Toh, G. Montalto, M. Cervello, M. Libra, S. Candido, G. Malaponte, M.C. Mazzarino,
N. Friedman, A. Regev, Full-length transcriptome assembly from RNA-Seq data P. Fagone, F. Nicoletti, J. B€ asecke, S. Mijatovic, D. Maksimovic-Ivanic,
without a reference genome, Nat. Biotechnol. 29 (2011) 644e652. M. Milella, A. Tafuri, F. Chiarini, C. Evangelisti, L. Cocco, A.M. Martelli, Ras/Raf/
[28] Y. Zhao, B. Liu, C.J. Liu, Establishment of a surgically-induced model in mice to MEK/ERK and PI3K/PTEN/Akt/mTOR cascade inhibitors: how mutations can
investigate the protective role of progranulin in osteoarthritis, J. Vis. Exp. result in therapy resistance and how to overcome resistance, Oncotarget 3
(2014), e50924. (2012) 1068e1111.
[29] S.S. Glasson, M.G. Chambers, W.B. Van Den Berg, C.B. Little, The OARSI his- [36] E.K. Kim, E.J. Choi, Pathological roles of MAPK signaling pathways in human
topathology initiative - recommendations for histological assessments of diseases, Biochim. Biophys. Acta 1802 (2010) 396e405.
osteoarthritis in the mouse, Osteoarthritis Cartilage 18 (Suppl 3) (2010) [37] M.H. Gregory, N. Capito, K. Kuroki, A.M. Stoker, J.L. Cook, S.L. Sherman,
S17eS23. A review of translational animal models for knee osteoarthritis, Arthritis
[30] M. Yoshimatsu, H. Ohnishi, C. Zhao, Y. Hayashi, F. Kuwata, S. Kaba, (2012), 764621, 2012.
H. Okuyama, Y. Kawai, N. Hiwatashi, Y. Kishimoto, T. Sakamoto, M. Ikeya, [38] S. Kamekura, K. Hoshi, T. Shimoaka, U. Chung, H. Chikuda, T. Yamada,
K. Omori, In vivo regeneration of rat laryngeal cartilage with mesenchymal M. Uchida, N. Ogata, A. Seichi, K. Nakamura, H. Kawaguchi, Osteoarthritis
stem cells derived from human induced pluripotent stem cells via neural crest development in novel experimental mouse models induced by knee joint
cells, Stem Cell Res. 52 (2021), 102233. instability, Osteoarthritis Cartilage 13 (2005) 632e641.
[31] J.J. Sheu, P.H. Sung, C.G. Wallace, C.C. Yang, K.H. Chen, P.L. Shao, Y.C. Chu, [39] R. Wang, W. Jiang, L. Zhang, S. Xie, S. Zhang, S. Yuan, Y. Jin, G. Zhou, Intra-
C.R. Huang, Y.L. Chen, S.F. Ko, M.S. Lee, H.K. Yip, Intravenous administration of articular delivery of extracellular vesicles secreted by chondrogenic progen-
iPS-MSC(SPIONs) mobilized into CKD parenchyma and effectively preserved itor cells from MRL/MpJ superhealer mice enhances articular cartilage repair
residual renal function in CKD rat, J. Cell Mol. Med. 24 (2020) 3593e3610. in a mouse injury model, Stem Cell Res. Ther. 11 (2020) 93.
[32] D. Jiang, G. Xiong, H. Feng, Z. Zhang, P. Chen, B. Yan, L. Chen, K. Gandhervin, [40] R. Wang, S. Zhang, R. Previn, D. Chen, Y. Jin, G. Zhou, Role of forkhead box O
C. Ma, C. Li, S. Han, Y. Zhang, C. Liao, T.L. Lee, H.F. Tse, Q.L. Fu, K. Chiu, Q. Lian, transcription factors in oxidative stress-induced chondrocyte dysfunction:
Donation of mitochondria by iPSC-derived mesenchymal stem cells protects possible therapeutic target for osteoarthritis? Int. J. Mol. Sci. 19 (2018).

70