DISTRIBUTION AND DIVERSITY OF

MACROINVERTEBRATES AT TASEK BERA,

PAHANG, MALAYSIA

NURHIDAYATI BINTI ABD AZIZ

INTERNATIONAL ISLAMIC UNIVERSITY

MALAYSIA

MARCH 2008
! " #

$ $ % &
 DISTRIBUTION AND DIVERSITY OF
MACROINVERTEBRATES AT TASEK BERA,
PAHANG, MALAYSIA

NURHIDAYATI BINTI ABD AZIZ

A THESIS SUBMITTED IN PARTIAL FULFILMENT

OF THE REQUIREMENT
FOR THE BACHELOR OF BIOTECHNOLOGY

KULLIYYAH OF SCIENCE
INTERNATIONAL ISLAMIC UNIVERSITY
MALAYSIA

MARCH 2008
 Being an internationally recognized wetland as the first Ramsar site in Malaysia,
Tasek Bera is known for its rich and unique diversity of flora and fauna. However, up
till now scientific and socioeconomic study on the wetland is lacking despite the
presence of wealth research opportunities. Due to lack of information and consistent
monitoring, Tasek Bera is susceptible to ecosystem degradation. Therefore, a
comprehensive knowledge on the status of Tasek Bera ecosystem health is vital for
accurate assessment of its environmental condition, and consequently for its
sustainable and effective management. This study evaluate the water quality status of
Tasek Bera by assessing the distribution and diversity of macroinvertebrates as it
indicator. In addition, we also verify taxonomic identification of macroinvertebrates
based on morphological characteristics by using molecular marker COI mtDNA gene
through PCR (polymerase chain reaction) and phylogenetic analysis. Low diversity of
macroinvertebrates was found in Tasek Bera, with the presence of one of pollution9
sensitive taxon, Plecoptera. Respectively, the water quality status in the area under
assessment at Tasek Bera demonstrated slight organic pollution. Through the use of
molecular approaches, sludge worm which was identified to be a member of
Tubificidae family was verified and further correlated to genus $ ' by
phylogenetic analysis. The information obtained in this study serves as a baseline
reference for various agencies that are involved in management of Tasek Bera and the
use of molecular approaches could be utilized to serve as useful tools in the field of
conservation biology.

Keyword: Tasek Bera, macroinvertebrates, water quality, PCR, phylogenetic analysis.

ii
I certify that I have supervised and read this study and that in my opinion it conforms
to acceptable standards of scholarly presentation and is fully adequate, in scope and
quality, as a thesis for the degree of Bachelor of Biotechnology.

______________________________________
Assoc. Prof. Dr. Ahmed Jalal Khan Chowdhury
Principle Supervisor

I certify that I have read this thesis and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
thesis for the degree of Bachelor of Biotechnology.

________________________________ ___________________
Assoc. Prof. Dr. Kamaruzzaman Yunus Sr. Suhaila Mohd Omar
Examiner Examiner

This thesis was submitted to the Department of Biotechnology and is accepted as

partial fulfillment of the requirements for the degree of Bachelor of Biotechnology.

______________________________
Br. Kamarul Rahim Bin Kamaruddin
Head of Department
Department of Biotechnology

This thesis was submitted to the Kulliyyah of Science and is accepted as partial
fulfillment of the requirements for the degree of Bachelor of Biotechnology.

________________________
Prof. Dr. Ridzwan Bin Hashim
Dean
Kulliyah of Science

iii
I hereby declare that this thesis is the result of my own investigations except where
otherwise stated. I also declare that it has not been previously or concurrently
submitted as a whole for any degrees at IIUM or other institutions.

________________________
Nurhidayati Binti Abd Aziz
0326326
3 March 2008

iv
 INTERNATIONAL ISLAMIC UNIVERSITY MALAYSIA

Copyright © 2008 by Kulliyyah of Science, International Islamic University Malaysia

(IIUM) and Nurhidayati Binti Abd Aziz.

All rights reserved.

Distribution and Diversity of Macroinvertebrates at

Tasek Bera, Pahang, Malaysia

No part of this unpublished research may be reproduced, stored in a retrieval system,

or transmitted, in any forms or by any means, electronic, mechanical, photocopying,
recording or otherwise without prior written permission of the copyright holder except
as provided below.

1. Any material contained in or derived from this unpublished research may only
be used by others in their writing with due acknowledgements.

2. IIUM or its library will have the right to make and transmit copies (print or
electronic) for institutional and academic purposes.

3. The IIUM library will have the right to make, store in retrieval system and
supply copies of this unpublished research if requested by other universities
and research libraries.

_________________________ ______________________
Prof. Dr. Ridzwan Bin Hashim Nurhidayati Binti Abd Aziz
Dean, Kulliyyah of Science 0326326

v
 Thanks to my supportive supervisors Assoc. Prof. Dr. Ahmed Jalal Khan
Chowdhury and Br. Kamarul Rahim B. Kamaruddin; to ever9helpful mentor and lab
assistants – Br. Mohd Nahar Mohd, Br. Yahya, and Sr. Noor Izyan Hassan; to the
Department of Wildlife and National Parks (PERHILITAN) and the Department of
Environment (DOE) staffs in Tasek Bera, for their guidance and willingness in
sharing the information; to my family for their unconditional love and support
throughout my academic years; to my quirky friends who helped colour those black
and white days spent in the lab – Arshana Nor Noorul Amin, Azhane Ahmad, Hajar
Fauzan Ahmad, Mohd Razali Hilmi, Mohd Fardy Md Ibrahim, Munirah Ramli, Noor
Isma Yanti Masseren, Nurul Lyana Mohd Sidek and Siti Fatimah Mohd Sidek – and
especially Sofie Bt. Shaaruddin, who helped me with every angle of the study, and
finally thanks to my brother, who is also a magnificent friend, Ahmad Lutfi Lukman,
for listening to all the boring details, making me laugh every day, and for always
coming to the rescue.

vi
2.1 Wetland Conservation and Management Issues in Malaysia 4
2.2 Assessment of Wetland Ecosystem Health 7
2.2.1 Assesment Methods for Ecological Studies 7
2.2.2 Molecular Studies of Macroinvertebrates 9
2.3 Previous Studies Conducted in Tasek Bera 11

! " !

# #
5.1 Area of Study 15
5.2 Sample Preparation 17
5.2.1 Sample Collection 17
5.2.2 Sample Identification and Preservation 17
5.3 Statistical Analysis 18
5.4 Molecular Analysis 19
5.4.1 DNA Extraction 19
5.4.2 Polymerase Chain Reaction (PCR) 20
5.4.3 PCR Product Purification 20
5.4.4 DNA Quantification 21
5.4.5 DNA Sequencing 21
5.4.6 Phylogenetic Analysis 21

$
6.1 The Study Site 22
6.2 Ecological Assessment of Macroinvertebrates in Tasek Bera 23
6.2.1 Distribution of Macroinvertebrates in Tasek Bera 23
6.2.2 Statistical Analysis of Macroinvertebrates Data 25
6.3 Molecular Analysis 27
6.3.1 DNA Extraction of Macroinvertebrate Samples 27
6.3.2 Amplification of COI mtDNA Gene 28
6.3.3 DNA Sequencing 29
6.3.4 Phylogenetic Analysis of Sludge Worm COI Gene 30

vii
 % !#
7.1 Ecological Assessment of Macroinvertebrates in Tasek Bera 35
7.1.1 Distribution of Macroinvertebrates in Tasek Bera 35
7.1.2 Application of Diversity Index 37
7.1.3 Assessment of Water Quality in Tasek Bera 38
7.2 Molecular Analysis as Tools to Identifying Macroinvertebrates 38
7.2.1 Isolation of Total Genomic DNA of Macroinvertebrates 39
7.2.2 Amplification of COI mtDNA Gene 40
7.2.3 Phylogenetic Analysis of Sludge Worm COI Gene 41

&
' !

viii
( )*+ ,-+
,.*+ # Detailed description of macroinvertebrates samples '
proceeded to DNA extraction
,.*+ # COI mtDNA sequences for forward and reverse primers
utilized in the amplification of COI mtDNA gene of
macroinvertebrates.
,.*+ $ Types of microhabitats found in three different points of the
sampling area at Tasek Bera, Pahang
,.*+ $ Composition and total abundance of aquatic insect !
communities found in sampling area of Tasek Bera, Pahang
,.*+ $ ! Biological indices based on composition and abundance of #
aquatic insect community found in sampling area of Tasek
Bera, Pahang.
,.*+ $ Biotic index scores for the Family Biotic Index (FBI), as #
adapted from Mandaville, 2002.
,.*+ $ # The Average Score per Taxon (ASPT) values, as adapted $
from Mandaville, 2002.
,.*+ $ $ Description of the DNA sequencing results for sample 5 !
and 7, as provided by the First Base Laboratories Sdn Bhd.
,.*+ $ % Corresponding sequences to Sample 5 and an outgroup !
obtained from NCBI Gene Bank collections.

ix
( )*+ ,-+
-/0+ # The sampling area for collection of macroinvertebrates in #
Tasek Bera covering three different microhabitats along the
25 m strecth of the lake bank side.
-/0+ # Location of the sampling area in Tasek Bera, Pahang, at the $
Persona Lake Resort as indicated by the red circle.
-/0+ $ Representative macroinvertebrates found in Tasek Bera,
Pahang.
-/0+ $ Purified isolated genomic DNA of macroinvertebrate %
samples.
-/0+ $ ! Amplified PCR results for amplification of COI gene. &
-/0+ $ Amplified DNA products of Sample 5 using gradient PCR '
at 12 temperature range.
-/0+ $ # Neighbour joining phylogenetic tree of Sample 5 (sludge !
worm) inferred from CO1 mitochondrial DNA gene using
PHYLIP.
-/0+ $ $ Maximum parsimony phylogenetic tree of Sample 5 (sludge !!
worm) inferred from CO1 mitochondrial DNA gene using
PHYLIP.
-/0+ $ % Consensus phylogenetic tree of Sample 5 (sludge worm) !
inferred from CO1 mitochondrial DNA gene using
PHYLIP.
-/0+ % Composition of taxonomic group of macroinvertebrates !$
found in Tasek Bera, Pahang
-/0+ % Different zones of biological communities linked to the !%
physical characteristic of lake ecosystem, (Water on the
Web, 2004).

x
Il Microlitre
ASPT Average Score per Taxon
AWB Asian Wetland Bureau
BMWP Biological Monitoring Work Party
BOD Biological oxygen demand
COI Cytochrome oxidase I
DNA Deoxyribonucleic acid
DOE Department of Environment
EPIC Extron9primed intron9crossing
FBI Family Biotic Index
FELDA Federal Land Development Authority
H’ Shannon – Wiener Diversity Index
IPT Institute of Advanced Studies, University of Malaya
mA Milliampere
MP Maximum parsimony
mtDNA Mitochondrial DNA
NJ Neighbour joining
o
C Degree Celcius
PCR Polymerase Chain Reaction
PERHILITAN Department of Wildlife and National Parks
pH Power of hydrogen
PHYLIP Phylogeny Inference Package
RFLP Restriction Fragment Length Polymorphism
rRNA Ribosomal ribonucleic acid
tRNA Transfer ribonucleic acid
V Volts

xi
 Wetland inventory, assessment, and monitoring are vital to the study of wetland
ecosystem health. Being one of the key ecosystems which provide a variety of social,
economic, and ecological functions, information on wetland ecological values is
essential for its wise management and conservation, especially in the face of present9
day economic development. One of the methods developed to assess wetland
ecosystem health is through the use of biotic factors as indicators, which ranges
widely from fish to macroinvertebrates. Information on the presence or absence of
certain species could elucidate the standard of ecosystem health and the level of
disturbance at the area of study.

Tasek Bera is Malaysia’s largest Natural Freshwater lake system, in which it

encompasses 61% of the total area (10,000 ha) represented by only 2 sites. In 1994,
Tasek Bera was designated as Malaysia’s first Ramsar site in recognition of its social,
economic, and ecological importance. The high productivity of wetland provides
economical harvest to local people in fields of agriculture, fisheries, and water supply.
In addition, Tasek Bera offers ecological benefits which include flood control,
shoreline protection and stabilisation, climate change mitigations, water purification
and sediment and nutrient retention. Finally, its ability to support a diverse ecosystem
ranging from dry lowland dipterocarp forest to freshwater lake system gives Tasek
Bera an exceptional potential to support unique biological community which could be
highly endemic and/or endangered.

1
 Despite being one of Malaysia’s largest reservoirs of biodiversity, Tasek Bera has
not been extensively explored and consistently monitored. Following up the
comprehensive ecological study conducted in 1987 by Malaysian and Japanese
scientists under the support of International Biological Programme is a brief
assesment carried out in 1992 by the Asian Wetland Bureau (AWB). Since the 1993
publications, updates on Tasek Bera ecological values are scattered and difficult to be
accessed. For example, the only information available on macroinvertebrates of Tasek
Bera is regarding its diversity and dominant species. The absence of a complete listing
for macroinvertebrate species renders the application of assessment index to the
wetland ecosystem health and the comparison to the existing data difficult. Hence,
another assessment on the abundance of macroinvertebrates at Tasek Bera is vital not
only to update the existing and almost out9of9date data, but to illuminate how the
wetland ecosystem health might have been altered throughout the years as a result of
rapid economic and social development in the surrounding areas.

In addition, latest development of genetic studies provides assistance to the

assessment of ecological health. The analysis of genetic materials allows identification
of organisms to the molecular level by the use of DNA sequencing and in consequent,
the study of relationship amongst species can be achieved through systematics and
phylogenetic analysis. As a result, molecular ecology emerges as one of the attractive
field in conservation biology. However, the application of molecular tools to
macroinvertebrates is scarce, and there is no standard method to achieve the desired
results to date. Yet, given the lack of existing raw data on macroinvertebrates of Tasek
Bera, the use of genetic material as a source of species identification is undoubtedly
useful in assistance to morphological identification.

2
 In this study, a preliminary assessment on the diversity and distribution of
macroinvertebrates was carried out at Tasek Bera Pahang. The wetland ecosystem
health was subsequently assessed through the application of statistical index which
includes the Shannon9Wiener Biodiversity Index (H’), Family Biotic Index (FBI) and
Average Score per Taxon (ASPT). In addition, the taxonomic classification based on
morphological characteristic of the species was further validated and compared to the
genetic diversity of macroinvertebrates obtained by the use of molecular techniques
through DNA sequencing and phylogenetic analysis using mitochondrial DNA
(mtDNA) cytochrome oxidase I (COI) gene.

3
 +)*,12 (13+0 ,) (1 ,12 ,1,-+4+1) 33/+3 1 ,*,53 ,

One of the key assets of Malaysia’s biodiversity is its rich and diverse aquatic
ecosystems including rivers, lakes, reservoirs, swamps, mangroves, estuaries, and
seas. According to Yusoff et al (2006), although 90% of the Malaysia’s water is found
in sea, the inland water ecosystem supports most of the terrestrial population lives.
Wetland plays a significant role in agriculture and fisheries industries, apart from
providing a wide range of products used by local people such as food, medicine,
timber, fuel wood, and clean water (Gawler, 2002; Murugadas, 2002). In addition,
wetlands also fulfil the need for continuous water supply throughout the year through
replenishment of groundwater supplies, maintenance of water tables for agriculture,
flood control, climate change mitigation, sediment and nutrient retention, and water
purification. The high porosity of peat swamps for instance, enable a large volume of
water to be retained during heavy rainfalls and gradually released during dry season
(Yusoff et al, 2006; Murugadas, 2002). Most importantly, wetlands support diverse
species of flora and fauna, some of them endangered as well as endemic. Waterfowl,
monkeys, crocodiles are a commonly found wildlife in aquatic habitats, whereas
mudflats rich in benthic fauna provides a rich feeding ground for migratory and
resident birds. Highly endangered wildlife species such as Sumatran rhinoceros
(( ), proboscis monkey () ), and banded langur
(* ) usually inhabit peat swamp forests (Yusoff et al,
2006). Given these economic, social, and ecological values, wetlands offer additional
revenue to the country through tourisms activities.

4
 In response to the invaluable resources offered by wetlands as well as its
ecological importance, Malaysia ratified the Ramsar Convention of Wetlands of
International Importance in 1994. Tasek Bera was designated as the first Ramsar site,
and 96 wetland sites were highlighted by the Malaysian Wetland Directory in 1987. In
general, the Ramsar Convention stresses the importance of wetlands as a vital
component of national and global ecosystems and economies through global support
and political commitment for sustainable development and environmental
conservation. Sustainable management of wetlands are also supported by the
Convention on Biological Diversity, Agenda 21, and United Nations Framework
Convention on Climate Change, among others (Murugadas, 2002).

As a consequence of their ubiquitous resources and diverse functions to

surrounding populations, little concern has been paid to the wetlands’ conservation
and sustainable management. At the same time, continuous economic development
directly and indirectly causes constant degradation to wetland ecosystem. As a result,
a significant number of wetlands are now at imminent risk. According to Yusoff et al
(2006) and Murugadas (2002), the following are considered as major threats to
wetlands nationwide:

a. Urbanisation and land development

Often viewed as wastelands, wetlands are generally considered futile and hence, in
line with the strong pressure for development, wetlands are consequently converted or
reclaimed as sites for agriculture, human settlements, and infrastructure developments.
The resulting effects are not only loss of important ecosystem but threats of pollution
and economic decline. Land clearing activities and earthworks for instance, cause high
siltation and sedimentation, which contributes to massive degradation of water quality.
Activities of lodgings like hotels and resorts near lakes and beaches causes
eutrophication of waters through release of poorly managed sewage discharge. If this

5
problem continue unabated, important function of wetlands will be lost, and so it’s
important contribution to the economic development.

b. Changes of wetland hydrology

Activities like flood control, water supply, or energy development projects

generally modify surface water flows. Clearance of vegetation from catchment areas
disrupt seasonal surface water flow by increasing surface flows during wet season and
decreasing flows in the dry season since water9retaining property of the area is lost. In
addition, construction of dams and reservoirs manipulates natural drainage pattern
extensively, whereby changes in surface flow downstream the dam alter the stream
habitat and its flora and fauna. Besides, conversion of watercourses into concrete
drains in urban areas results in loss of riparian vegetation which also affects the
biodiversity of the area. Ultimately, drainage of peat swamps for agriculture or
infrastructure purposes reduces its ability to store water, which increases the incidence
of peat and forest fires. Severe degradation of peat swamps also results in its declining
capacity to act as carbon sink which without doubt affects the global climate change
through increasing carbon emission to the atmosphere.

c. Pollution

As a result of the above9mentioned situations, pollution becomes a serious threat

to wetlands in Malaysia. Solid wastes from domestic and industrial sources contribute
to high level of suspended solids and biochemical oxygen demand (BOD) in rivers,
which in turn increases the number of polluted rivers in Malaysia. Agriculture
activities cause pesticides and herbicides residues to be accumulated in wetlands,
disrupting their initial water quality like increase in toxicity or pH level. In marine
waters on the other hand, grease, oil spill, and coliform bacteria are major
contaminants.

6
 33+334+1) (6 +)*,12 7(353)+4 +,*)8

Since rapid degradations of wetlands are now evident through reports of water
shortage, seas and rivers pollution, and decline in fisheries resources, there is therefore
a crucial need for effective management of wetlands (Yusoff et al, 2006). Prior to
sustainable wetland management is a concerted effort of government agencies,
research institutions, and local communities for inventory and assessment of wetlands
ecosystem values and their constant monitoring because they provide the necessary
information that support management decisions (Murugadas, 2002). Furthermore,
rapid degradation of wetlands means information on its biodiversity and ecological
values is required urgently, and hence effective and efficient method is vital to assess
the wetlands (“Guidelines for the rapid ecological assessment of biodiversity in inland
water, coastal and marine areas”, 2006). Assessment of wetlands biodiversity can be
carried out for different purposes, for instance, it may focus on general and overall
biological diversity to obtain baseline information on the conservation values of the
area, or it may focus on specific taxa like fish, amphibian, or birds, to indicate for a
particular health quality of the ecosystem. To date, various methods are developed to
suit different purposes in which wetlands assessment is undertaken. The complex
nature and variability of wetlands may require a combination of several assessment
methods to obtain sufficient, relevant, and up9to9date information (Murugadas, 2002).

33+34+1) 4+)8(23 6(0 +7(*(- 7,* 3)/2 +3

One of commonly used assessment methods in wetland monitoring is the use of

biotic component as indicator for its quality as biological communities usually exhibit
the effects of stress and might respond in different ways to them (Ziglio et al, 2006).

Apart from fishery resources and periphyton, ecological assessment of aquatic

system using macroinvertebrates has been one of the frequently used protocols for

7
indication of water quality in standard water management (Barbour et al, 1999).
According to Ziglio et al (2006), macroinvertebrates includes those “organisms large
enough to be caught with a net or retained on a sieve with a mesh size of 250 to 1000
Om”. These organisms can be benthic, inhabiting the bottom substrates like
sediments, debris, or logs, or pelagic, swimming freely in the water column. Examples
of macroinvertebrates groups are arthropods such as families of insecta or crustacea,
and non9arthropods which includes families of mollusca, turbellaria, and oligochaeta.

Macroinvertebrates are generally useful as bioindicators due to following; first,

macroinvertebrates are ubiquitous and abundant in the whole aquatic system, hence
they play essential role in the aquatic habitat food web (Ziglio et al, 2006).
Furthermore, macroinvertebrates have limited migration pattern and they are generally
sessile, thus they are suitable as indicators for localized condition and site9specific
impacts, and in turn easy to collect and identify (Ziglio et al, 2006; Barbour et al,
1999). Macroinvertebrates also have long life span and they integrate environmental
conditions over long periods, and therefore, they are indicative of changing water
qualities. Finally, macroinvertebrates usually consists of heterogeneous collection of
evolutionary diverse taxa, for that reason, different species will react to different
changes in aquatic environment, natural as well as imposed, and physical as well as
chemical (Ziglio et al, 2006).

The methods at which macroinvertebrates are collected in aquatic system can be

diverse, depending on the physical characteristics of the aquatic habitat. In shallow
waters, samples can be collected by kick sampling technique with a handnet, whereas
deeper waters require more extensive instrument like grab sampler. Samples need to
be processed prior to identification through sorting and separation using siever and
salt floatation technique, and preservation with formalin or 70% ethanol. The
macroinvertebrates are taxonomically identified by using key identification guides,
and some samples may require examination under dissection microscope (Ziglio et al,
2006). Identification can be carried out at two possible levels, family or genus/species.
Genus/species level identification provides more accurate information on ecological

8
condition and population sensitivity, but identification at family level awards more
precision to the taxonomists, thus requires less expertise and time to complete
(Barbour et al, 1999).

The key component of macroinvertebrates protocols is its assessment method. For

macroinvertebrates information to be useful, the collected data is quantified according
to certain approaches to produce quantitatively meaningful information. According to
Ziglio et al (2006), most assessment methods for macroinvertebrates are taxonomical,
whereby analysis of a particular species groups or population is carried out. The
assessment of these groups can further be conducted in either of three approaches;
saprobic, diversity, or biotic approaches. Saprobic approach indicates specific
tolerance to pollution by a specific indicator species, whereas diversity approach
utilizes the community structure as evaluation for ecosystem health. On the other,
biotic approach combines both saprobic and diversity approach in the assessment of
water quality. Examples of indices used in macroinvertebrates study are Shannon9
Wiener diversity index (H’), Family Biotic Index (FBI), and Biological Monitoring
Work Party (BMWP).

(*+7/*,0 3)/2 +3 (6 4,70( 1 +0)+.0,)+3

In addition to taxonomy identification, assessment of macroinvertebrates can

further be optimized by systematics study, whereby a diversity of organisms and all
relationship among them is studied (Hoy, 2003). Systematics generally concerns with
variation within a population, species, and taxa. According to Brockhouse and
McCreadie (2004), sole reliance on biodiversity measurement such as species richness
may lead to a simplistic conclusion of the ecological values of a habitat. Since
biodiversity is now a common measure for assessment of ecosystem health, it could be
logically extended that genetic diversity and gene flow is of equal importance. Genetic
variation for instance, can be used as a predictive tool for assessment of a habitat
disturbance, which could be indicated by a declining genetic diversity.

9
 Parallel to the increasing application of molecular methods, DNA analysis has
become one of suitable tools in systematics since it is the most direct genetic material
available for study (Hoy, 2003). Generally, DNA sequence data can be used in 1)
construction of molecular phylogenies to evaluate certain gene or gene families, 2)
evaluation of evolutionary changes within species, and 3) construction of phylogeny
among different species. Although the sequencing method is relatively expensive and
time9consuming, the application of polymerase chain reaction (PCR) significantly
reduces the time and cost required to complete it.

Amplification of DNA may involve genes from nuclear, mitochondrial DNA,

or ribosomal DNA. To date, the use of primers for amplification of genetic material is
diverse and random to the species of macroinvertebrates under study. Claxton and
Boulding (1998) cited how Baldwin et al (1996) demonstrated identification of
veligers to the species level by the use of Restriction Fragment Length Polymorphism
(RFLP) method, utilizing the universal Folmer primer for invertebrates. However, the
similar primer failed to amplify the genomic materials of zebra and quagga mussels
hence requiring design of different specific primers. Brockhouse and MacCreadie
(2004) on the other hand, used EPIC (exon9primed intron9crossing) primers for
amplification of insects of Hemiptera and Odonata. Of all those, mtDNA is most
commonly used and has been proven useful in studies of population genetic,
taxonomic status, and geographic variation. Generally, mtDNA are small (16 to 22 kb
in length), circular, lack introns, and contain 37 genes coding for small9 and large9
subunits rRNAs, 13 proteins, and 22 tRNAs arrayed in an order that is well conserved
within phyla. There are thousands mitochondria in cells, hence mtDNA is abundant
and easy to obtain, even from somewhat degraded samples. Furthermore, mtDNA is
usually maternally inherited, and they undergo mutation at more rapid rate than
nuclear DNA, thus allowing evolutionary changes to be examined more closely (Hoy,
2003). Amplification of mtDNA sequences by PCR usually employs primers from
both coding (cytochrome oxidase I and cytochrome b gene sequences) and non9coding
(16S and 12S gene sequences) regions to increase the possibility of nucleic acid
extension.

10
 In relations to the extraction of genetic materials, Brockhouse and McCreadie
(2004) studied several molecular protocols associated with the study of aquatic
insects. Different DNA extraction methods were used to assess the suitability of each
method with the target organisms, which includes + (Dragon
fly), (water scorpion), and * $ (hemiptera). Extraction of
DNA using Qiagen DNeasy DNA Purification kit by using mouse tail protocols
resulted in DNA worth amplified by PCR, apart from other methods. Harper et al
(2005) also used Qiagen DNeasy Tissue Kit for the extraction of beetles DNA.
However, in relation to fixed or preserved specimens, Brockhouse and MacCreadie
(2004) reported evidence of DNA degradation by ethanol or formalin.

! 33+33 1- )8+ +7(*(- 7,* ,*/+3 (6 ,3+9 +0,: ,8,1-

Despite being the first designated Ramsar site in Malaysia, hence harbouring rich
national biodiversity assets, Tasek Bera remained poorly known and undervalued.
Ecological studies on its ecosystem are scarce, and constant monitoring of its health is
almost non existent. According to Murugadas (2002), the latest extensive inventory
carried out on wetlands all over Malaysia was in 1987, whereas specific study
conducted on Tasek Bera was in 1982, which was followed by a brief assessment on
1992 (IPT9Asian Wetland Bureau, 1993). Since then, no updates can be found in
publications except for study on national reservoir fisheries in 2006 which includes
Tasek Bera as one of its study areas (Ambak & Jalal, 2006).

Tasek Bera Wildlife Reserve is located in Southwest Pahang; it has a catchment of

61,383 ha. Tasek Bera builds up 60% of the total natural freshwater lake system in
Malaysia, hence making it the Malaysia’s largest freshwater lake. However, as a result
of continuous logging and forest conversion, only approximately 10,000 ha remains
forested, putting its environmental condition and indigenous people at risk of
degradation and extinction. The central area surrounding Tasek Bera is currently
designated as a Wildlife Reserve, managed by the Bera District Office and the

11
Department of Wildlife and National Parks (PERHILITAN). The remainder of the
area is however, largely developed under the management of the Federal Land
Development Authority (FELDA) whereby the majority being the oil9palm plantation
(IPT9Asian Wetland Bureau, 1993).

Tasek Bera is a freshwater swamp where the area is permanently flooded and the
soils contain more than 35% mineral content (Murugadas, 2002), the swamp is 75%
occupied by understorey vegetation including rattan and palm species. Its water is
slightly acidic (pH average 5.33), perhaps due to permanent water logging and
prevalence of anaerobic condition in the soil (IPT9Asian Wetland Bureau, 1993). Peat
formation releases tannin and organic acid into the water, which accounts for the
water acidity and the coloration of water, which is almost black in appearance, but
clean when held up against light (Murugadas, 2002). The recorded diversity of
macroinvertebrates groups is low (except for Odonata, where 33 species was
recorded), which is attributed to the water acidic condition. However, there was
recorded presence of endemic species, , (Rotifera) (IPT9Asian
Wetland Bureau, 1993).

To date, the increasing development progress in areas surrounding Tasek Bera

Wildlife Reserve imperils its ecosystem integrity. Destruction and conversion of the
catchment areas cause erosion and drop in water levels especially during dry season.
New logging roads and highways increase access to the reserve, and consequently
damage the drainage pattern of Tasek Bera. Furthermore, increasing agriculture
activities and human settlements contributes to pollution in the form of sewage and
residues of agriculture fertilizers and pesticides. Whereas, shifting cultivation practice
and removal of aquatic vegetation for tourism appeal alter the floral communities of
Tasek Bera, while at the same time threatens the wildlife inhabiting the area (IPT9
Asian Wetland Bureau, 1993). All of these factors if allowed to persist may not only
degrade the ecosystem health of Tasek Bera itself, but also its overall ecosystem
functioning contributions to Malaysia’s social and economic development and the
regulation of global climate (Murugadas, 2002).

12
 !

"

In response to the severe need for better management of Tasek Bera as a Ramsar
site, it is important to explore and consequently update the ecological status of the
wetland. Based on this perspective this study aims to assess the distribution and
diversity of macroinvertebrates in Tasek Bera, Pahang, Malaysia. The current
distribution of macroinvertebrates is hoped to be bioindicators for the existing
ecosystem health status of Tasek Bera, which in turn could be a useful reference for
the respective agencies.

At the same time, due to lack of published reference data on macroinverbrates of

Tasek Bera, this study conducted molecular analyses in order to verify taxonomic
classification based on morphological characteristic, and consequently, to explore the
possibility of using molecular tools as alternative to morphological identification for
taxonomic classification of the macroinvertebrates.

13
 Based on previous studies carried out in 1992, it is stipulated that the diversity of
macroinvertebrates in Tasek Bera could be low due to the wetland’s nature as peat
swamp. Whereas, given the extensive sequences available in the GenBank, and the
advance provided in phylogenetic studies discipline, it is promising that molecular
analysis could be a possible alternative for taxonomic classification of
macroinvertebrates towards the approach of morphological identification.

14
 #

# 0+, (6 )/25

Sample collection was conducted at Tasek Bera Ramsar Site, Pahang, Peninsular
Malaysia. The sampling area was chosen to cover three different points of
microhabitats (Figure 5.1). Macroinvertebrates species was obtained on 30th of July
2007 along 25 metre (m) stretch of the lake bankside at the vicinity of the Persona
Lake Resort (Figure 5.2).

1 2 3

25 m

-/0+ # The sampling area for collection of macroinvertebrates in Tasek Bera

covering three different microhabitats along the 25 m strecth of the lake bank side.

15
 -/0+ # Location of the sampling area in Tasek Bera, Pahang, at the Persona Lake
Resort as indicated by the red circle.

16
# ,4;*+ 0+;,0,) (1

Sample collection and preservation methods were adapted from Wahizatul Afzan
et al (2006), and Barbour et al (1999).

# ,4;*+ (**+7) (1

The macroinvertebrates were collected by using frame nets of 500 Im, by forcing
the net through vegetation or surface layers of substrate at the lake bank side. The
organisms were either put into a white tray for better observation or transferred
directly to a labelled plastic bag. The labelled plastic bags were filled with the lake
water prior to the transfer of macroinvertebrates. All samples were brought back to the
laboratory fresh and alive.

# ,4;*+ 2+1) 6 7,) (1 ,12 0+3+0 ,) (1

At the laboratory, all samples were mixed together in a white tray for classification
into different taxa. Different individuals of different families were put in separate
white containers, and the macroinvertebrate were consequently preserved with 75%
ethanol.

Whichever possible, prominent organisms were identified to the family level by

using key identification guide (Jessup et al, 2003), and representatives of each taxon
were photographed by using digital camera.

17
#! ),) 3) 7,* 1,*53 3

Macroinvertebrates species diversity and distribution of individual species in the

community assemblage were determined by the Shannon9Wiener Diversity Index (H’)
using the following formula:

H’ = − ∑ * (log * )
=1

where * is the proportion of individuals found in the species , * is estimated through

the ration ) -), where ) is the number of individuals of the species and ) is the
total number of individuals (Jorgensen et al, 2005).

Two biological indices were used to evaluate the ecological status of the sampling
area, namely Family Biotic Index (FBI) and Average Score per Taxon (ASPT)
(Mandaville, 2002; Zimmermann 1993). These indices have bee used to monitor the
impact of disturbances and pollution in freshwater ecosystem by researchers.

18
# (*+7/*,0 ,1,*53 3

The molecular analysis method for macroinvertebrates was carried out as tailored
by Kamarul et al (2006) and Brockhouse et al (2004).

# )0,7) (1

All samples were extracted by using Qiagen Dneasy Blood & Tissue Kit
(manufacturer’s protocols). Detailed descriptions of all samples are given in Table 5.1.

,.*+ # Detailed description of macroinvertebrates samples proceeded to DNA

extraction
,4;*+ 02+0< ,4 *5 (44(1 ,4+ ( (6 12 2/,*3
1 Viviparidae Pouched snail 3
2 Gerridae Water strider 2
3 Corixidae Lesser water boatmen 37
4 Plecoptera Stoneflies 13
5 Tubificidae Sludge worm 4
6 Gomphidae Dragonfly 1
a
7 . " $ " Fish fingerling 1
8 Limnocharidae Water mites 16
9 Coleoptera Beetles 9
Note: a This sample was initially obtained as the outgroup for subsequent phylogenetic
analysis, but it was later replaced by , .

19
# (*54+0,3+ 8, 1 +,7) (1 = >

Amplification of Cytochrome Oxidase subunit 1 (CO1) gene of Sample 7 was

carried out using Eppendorf Master Cycler PCR whereas for sample 1 and 5 the
reaction was carried out using Eppendorf Gradient Master Cycler PCR to determine
the most optimal temperature for each sample.

Forward and reverse primers of COI (Palumbi et al, 1991) were used to obtain
amplified DNA products. The sequences for each primer are illustrated in Table 5.4.2.
Each 50 Il PCR reaction contained 10 Il PCR reaction buffer (Promega), 3 Il MgCl2
(Promega), 1 Il dNTPs (Promega), 2.5 Il of each primer, 10 Il DNA template, 0.5 Il
Taq polymerase, and 20.5 Il sterilized distilled water (dH2O). The normal PCR profile
comprised an initial denaturation step (2 min at 95oC), denaturation (30 s at 95oC),
annealing (30 s at 50oC), extension (30 s at 72oC), and a final extension step (5 min at
72oC). The gradient PCR profile utilized for amplification of sample 1 and 7 includes
a temperature range of 45 to 55oC at 5oC temperature gradient.

,.*+ # COI mtDNA sequences for forward and reverse primers utilized in the
amplification of COI mtDNA gene of macroinvertebrates.
0 4+0 +?/+17+
COI Forward 5’9CCAACAGGAATTAAAATTTTTAGATGATTAGC93’
COI Reverse 5’9TCCAATGCACTAATCTGCCATATTA93’

# ! 0(2/7) /0 6 7,) (1

All PCR products were purified with the Promega Wizard SV Gel and PCR Clean9
Up System (manufacturer’s protocols).

20
# @/,1) 6 7,) (1

The total genomic DNA extract and amplificed PCR products were verified and
quantified through gel electrophoresis using 1% agarose gel. 10 Il of prepared DNA
extracts were mixed with 2 Il 6X loading dye for dilution, and 1 kb DNA marker
(Vivantis) was used as reference. The DNA samples were run at 90 V, 118 mA for 1
hour. Ethidium bromide was used as fluorescent dye.

# # +?/+17 1-

The purified PCR products were subsequently submitted to the First Base
Laboratories for sequencing. DNA sequencing was done for both forward and reverse
reactions. The purified products were directly sequenced using BigDye® Terminator
v3.1 Sequencing Kit analyzed on ABI PRISM® 377 Genetic Analyzer. Cycle
sequencing reaction was done in a programmable cycler and. Cycle sequencing
reaction was done for 25 cycles of 96˚C for 10 seconds, 50˚C for 5 seconds and 60˚C
for 4 minutes at rapid.

# $ 85*(-+1+) 7 1,*53 3

Chromas version 1.45 was used to display fluorescence9based DNA sequence

analysis results. Multiple alignment of the sequences was carried out by using
ClustalX program version 1.81 (Thompson et al, 1997), and accordingly aligned by
visual inspection and modification. PHYLIP (Felsenstein, 2004) was used to carry out
the phylogenetic analysis of the sequences. The phylogenetic relationship of
macroinvertebrates DNA sequences was analysed by using neighbour9joining (NJ)
and maximum parsimony (MP) method. All phylogenetic analyses were carried out by
using PHYLIP.

21
 $

$ 8+ )/25 )+

The sampling area was selected to cover three different points of microhabitats.
These points represent different degree of human interference, types of biotopes and
hydrological characteristics. Table 6.1 shows the description of microhabitats at each
three point.

,.*+ $ Types of microhabitats found in three different points of the sampling area
at Tasek Bera, Pahang
),) (1 ( 1) 70(8,. ),)3
1 Habitat covered with overhead wooden
jetty, unused boat at the bankside, heavily
covered with bushes and disturbed with
floating rubbish, plenty of soft, dead logs.

2 Habitat well covered with large trees and

riparian vegetations. Water is clear and
flows freely.

3 Habitat exposed to direct sunlight, plenty

of reeds and * " species. Presence
of point9source pollution from the resort’s
chalets.

22
$ 7(*(- 7,* 33+334+1) (6 ,70( 1 +0)+.0,)+3 1 ,3+9 +0,

$ 3)0 ./) (1 ,12 +03 )5 (6 ,70( 1 +0)+.0,)+3 ,) ,3+9

+0,: ,8,1-

A total of 85 individuals of 8 Orders have been collected from the bank side of
Tasek Bera along the 25 m stretch around the vicinity of Persona Lake Resort.
Composition and total abundance of aquatic insect communities obtained during the
sampling are outlined in Table 6.2.

,.*+ $ Composition and total abundance of aquatic insect communities found in

sampling area of Tasek Bera, Pahang
, ,< 02+0 ,4 *5 12 2/,*3
Oligochaeta Tubificidae 4
Arachnida Limnocharidae 16
Gastropoda Viviparidae 3
Hemiptera Corixidae 37
Gerridae 2
Odonata Gomphidae 1
Plecoptera . " $ " 13
Tricoptera . " $ " 9
&#

23
 -/0+ $ Representative macroinvertebrates found in Tasek Bera, Pahang. A: Water
mites (Arachnida), B: Lesser water boatmen (Hemiptera), C: Sludge worm
(Oligochaeta), and D: Stoneflies (Plecoptera)

24
$ ),) 3) 7,* 1,*53 3 (6 ,70( 1) +0)+.0,)+3 ,),

Based on the Shannon9Wiener Diversity Index, the diversity of macroinvertebrates

found in Tasek Bera was categorized as low, given the score of 1.242. On the other
hand, from the biological indicator perspective, there is a possible slight organic
pollution at the area under study as indicated by the Family Biotic Index (FBI) and
Average Score per Taxon (ASPT) score indicated in Table 6.3. below. The reference
range values for FBI and ASPT are given in Table 6.4 and 6.5.

,.*+ $ ! Biological indices based on composition and abundance of aquatic insect

community found in sampling area of Tasek Bera, Pahang.
12 7+3 ,*/+3 *,33
Family Biotic Index 3.9647 Very good
Possible slight organic
pollution
Average Score Per Taxon 5 Doubtful quality

,.*+ $ Biotic index scores for the Family Biotic Index (FBI), as adapted from
Mandaville, 2002.
() 7 12+ ,)+0 @/,* )5 +-0++ (6 0-,1 7 (**/) (1
0.0093.50 Excellent No apparent organic pollution
3.5194.50 Very good Possible slight organic pollution
4.5195.50 Good Some organic pollution
5.5196.50 Fair Fairly significant organic pollution
6.5197.50 Fairly poor Significant organic pollution
7.5198.50 Poor Very significant organic pollution
8.51910.00 Very poor Severe organic polluion

25
 ,.*+ $ # The Average Score per Taxon (ASPT) values, as adapted from Mandaville,
2002.
7(0+ ,)+0 @/,* )5 33+334+1)
>6 Clean water
596 Doubtful quality
495 Probable moderate pollution
<4 Probable severe pollution

26
 $! (*+7/*,0 1,*53 3

$! )0,7) (1 (6 ,70( 1 +0)+.0,)+3 ,4;*+3

Isolation of total genomic DNA for samples 1, 2,3,4,5, and 7 produced desired
results but for Sample 6, 8, and 9, the results showed no expected bands. Relatively,
sample 5 showed highest amount of DNA followed by Sample 1 and 7 (Figure 6.2.).
These observed DNA bands were above 10,000 bp. All of these samples were
subsequently selected for amplification of CO1 gene using PCR.

~10 kbp

-/0+ $ Purified isolated genomic DNA of macroinvertebrate samples. Lane L: 1

kb DNA marker, 1: Sample 1, 2: Sample 2, 3: Sample 3, 4: Sample 4, 5: Sample 5, 6:
Sample 6, 7: Sample 7, 8: Sample 8, 9: Sample 9. The description of each sample is
shown in Table 5.3.1.

27
 $! 4;* 6 7,) (1 (6 5)(780(4+ 2,3+ = > +1+

Amplification of CO1 gene using normal PCR method was successful only for
Sample 7 at annealing temperature 50oC (Figure 6.3.). The positive product with
single and bright band was observed between 500 bp and 750 bp. Due to the high total
genomic DNA intensity, Sample 1 and 5 were further selected to undergo gradient
PCR method. However, only COI amplification of Sample 5 showed positive results
at annealing temperatures 45.0oC, 45.1oC, 45.7oC, and 46.6oC as indicated in Figure
6.4. Sample 5 and 7 were furthered to DNA sequencing.

750 bp
500 bp

-/0+ $ ! Amplified PCR results for amplification of COI gene. Lane L: 1 kb DNA
marker, 1: Sample 1, 2: Sample 2, 3: Sample 3, 4: Sample 4, 5: Sample 5, 6: Sample
6, 7: Sample 7, 8: Sample 8, 9: Sample 9. The description of each sample is shown in
Table 5.3.1.

28
750 bp
500 bp

-/0+ $ Amplified DNA products of Sample 5 using gradient PCR at 12

temperature range. Lane L: 1 kb DNA marker, 1:45.0oC, 2: 45.1 oC, 3: 45.7 oC, 4: 46.6
o
C, 5: 47.7 oC, 6: 49.0 oC, 7: 50.4 oC, 8: 51.8 oC, 9: 53.0 oC, 10: 54.1 oC, 11: 55.0 oC,
12: 55.4 oC. The description of each sample is shown in Table 5.3.1.

$!! +?/+17 1-

Subsequent to purification of PCR products, sample 5 and 7 were furthered to the

First Base Laboratories Sdn. Bhd. for sequencing. The results are shown in Table 6.6.

29
 ,.*+ $ $ Description of the DNA sequencing results for sample 5 and 7, as provided
by the First Base Laboratories Sdn Bhd.
,4;*+ 0 4+0 )+ (44+1)3< .3+0 ,) (13 /--+3) (13
Sample 7 Forward Noisy data with good signal strength. Check multiple
priming sites.

Reverse Noisy data with good signal strength Check multiple

priming sites.

Sample 5 Forward Noisy data with good signal strength Check primer
purity
Reverse Good sequence obtained

$! 85*(-+1+) 7 1,*53 3 (6 ,4;*+ # +1+

Good sequences of sample 5 and 7 were blasted in the NCBI GenBank to acquire
corresponding sequences for phylogenetic analysis. 13 ingroup sequences including
sample 5, and an outgroup sequence were chosen as listed in Table 6.7. Sample 7
however, was excluded from phylogenetic analysis later and was replaced by a
sequence of ,! !

These sequences were subsequently analyzed using PHYLIP software through

neighbour9joining (NJ) and maximum parsimony (MP) method to generate
phylogenetic trees. It was deduced that Sample 5 is closely related to $ ' $ '
and very possibly is a member of family Tubificidae as illustrated in Figure 6.5., 6.6.,
and 6.7., where consensus tree supports clustering of Sample 5 with ! $ ' with
100% bootstrap values, while NJ and MP trees demonstrate confidence level of 50%
and 28%, respectively.

All trees exhibit the same topology or clustering pattern, where 5 families of order
Oligochaeta can be found namely Trichobranchidae, Oenonidae, Megascolecidae,
Tubificidae, and Naididae.

30
 ,.*+ $ % Corresponding sequences to Sample 5 and an outgroup obtained from NCBI Gene Bank collections.
( +1+ ;+7 +3 +1/3 ,4 *5 02+0 85*/4
a
1 AY252981.1 , , Miridae Hemiptera Insecta
2 AY838866.1 Oenonidae Polychaeta Annelida
3 AF534864.1 / / Tubificidae Oligochaeta Annelida
4 AF534832.1 0 " 0 Naididae Oligochaeta Annelida
5 AF534831.1 0 " 0 Naididae Oligochaeta Annelida
6 EU100091.1 " " Hirudinea Annelida
7 AY960801.1 , ! , Megascolecidae Oligochaeta Annelida
8 AY960799.1 , , Megascolecidae Oligochaeta Annelida
9 AF534843.1 ) ) Naididae Oligochaeta Annelida
10 AF534856.1 Naididae Oligochaeta Annelida
11 AF534859.1 $ Naididae Oligochaeta Annelida
12 AF342674.1 ! Trichobranchidae Polychaeta Annelida
13 AF534866.1 $ ' $ ' $ ' Tubificidae Oligochaeta Annelida
a
Note: This sequence is the outgroup for the rest of the corresponding sequences to Sample 5

31
 Trichobranchidae
Oenonidae

Megascolecidae

Oligochaeta
Tubificidae

Naididae

Hirudinea
-/0+ $ # Neighbour joining phylogenetic tree of Sample 5 (sludge worm) inferred from CO1 mitochondrial DNA gene using PHYLIP. The
tree is rooted with a sequence of , !Numbers at nodes indicates the bootstrap values in percentage (%).

32
 Megascolecidae

Trichobranchidae
Oenonidae

Oligochaeta
Tubificidae

Naididae

Hirudinea
-/0+ $ $ Maximum parsimony phylogenetic tree of Sample 5 (sludge worm) inferred from CO1 mitochondrial DNA gene using PHYLIP.
The tree is rooted with a sequence of , !Numbers at nodes indicates the bootstrap values in percentage (%).

33
 Megascolecidae

Trichobranchidae
Oenonidae

Oligochaeta
Tubificidae

Naididae

Hirudinea
-/0+ $ % Consensus phylogenetic tree of Sample 5 (sludge worm) inferred from CO1 mitochondrial DNA gene using PHYLIP. Two types
of phylogenetic tree namely neighbour9joining and maximum parsimony tree were incorporated. The tree is rooted with a sequence of
, . Numbers at nodes indicate the bootstrap values in percentage (%).

34
 %

% 7(*(- 7,* 33+334+1) (6 ,70( 1 +0)+.0,)+3 1 ,3+9 +0,

Studies on the macroinvertebrates of Tasek Bera have been very scarce in the past
years. Despite being a Ramsar site, an internationally recognized and unique habitat
with economical, social and ecological importance, the information on the community
structure of macroinvertebrates in Tasek Bera, and consequently its relationship to the
wetland ecosystem health is lacking. The primary objective of the present study was to
record the diversity and distribution of macroinvertebates in selected area of Tasek
Bera and the result presented will serve as preliminary records on the current status of
the macroinvertebrates in Tasek Bera.

% 3)0 ./) (1 (6 ,70( 1 +0)+.0,)+3 1 ,3+9 +0,

A relatively low number of macroinvertebrate assemblages were recorded during

the sampling period which was restricted to half day due to the heavy rain. 85
individuals belonging to 8 orders were obtained, all of which were identified to family
level except for order Plecoptera and Coleoptera. The small size of organisms coupled
with their complex morphological attributes served as obstacles to distinguish the
organisms in these two orders into their rightful families. As illustrated in Figure 7.1.,
of all 8 orders, Hemiptera makes up the most dominant taxon of the group with 46%
individuals of the total assemblage, followed by Arachnida (19%), Plecoptera (15%).
While Coleoptera (11%), Odonata (1%), Gastropoda (3%), and Oligochaeta (5%)
represent as the less dominant of the groups. The presence of considerable amount of

35
individuals of order Plecoptera demonstrates a promising status on the ecological
health of Tasek Bera since it is one of the taxon considered sensitive to pollution
including Ephemeroptera and Trichoptera (Wahizatul Afzan et al, 2006).

-/0+ % Composition of taxonomic group of macroinvertebrates found in Tasek

Bera, Pahang

Unlike fish, information on macroinvertebrates, particularly in Malaysia is poorly

represented. Due to their small size, macroinvertebrates are difficult to identify.
Furthermore, their great diversity and large quantity add up to the problem (Shabdin et
al, 2002). The deficiency of the knowledge on the systematic of macroinvertebrates
posed as the major obstacle in the present study. The difficulty lies in the inability to
satisfactorily distinguish and accurately identify insects in larval or pupa stage of the
taxa encountered.

36
% +03 )5 12+ (6 ,70( 1 +0)+.0,)+3 1 ,3+9 +0,

The diversity of macroinvertebrates community of Tasek Bera was evaluated by

using Shannon – Wiener Diversity Index (H’) in view of the fact that diversity is one
of the commonly used concepts to measure disturbances. The relationship between
diversity and disturbances can be seen as a decrease in the diversity when the
disturbances increase (Jorgensen et al, 2005). The index values ranges between 0 and
5, where higher index values demonstrates higher diversity, while low index values
are considered to indicate pollution.

In the present study, the index value obtained was 1.242, which is quite low.
However, the value correlates with the study reported by IPT9Asian Wetland Bureau
(1993), describing low diversity of invertebrates due to acidic pH of the wetland water
quality. In addition, the sample collection was carried out in littoral zones of the lake,
where low flow limits taxon richness in contrast to riffle zones which support diverse
and abundant macroinvertebrates community (Fong & Nou, 2001). Figure 7.2.
illustrates the different zones found in lake ecosystem.

-/0+ % Different zones of biological communities linked to the physical

characteristic of lake ecosystem, (Water on the Web, 2004).

37
% ! 33+334+1) (6 ,)+0 @/,* )5 1 ,3+9 +0,

According to the biological indicator perspective, the water quality of Tasek Bera
at the site under study was categorized as very good with slight organic pollution as
indicated by Family Biotic Index (FBI) and Average Score per Taxon (ASTP). The
score for FBI and ASTP is 3.96 and 5, respectively. The status correlates with the
current status of the wetland’s water quality, which is Class III (Hassan,
PERHILITAN Tasek Bera, personal communication, 2001). Given the wetland’s
natural function in purifying water and reducing organic loading, the slightly reduced
water quality is to be expected. Murugadas (2002) described the water of Tasek Bera
as containing high amount of organic solutes. Permanent water logging and permanent
anerobic condition of the soil leads to peat fomation which releases tannin and organic
acid into the water. Due to its natural function as water purification system, the
carrying capacity of Tasek Bera natural systems could be different in relation to toxin
and nutrient removal (IPT9Asian Wetland Bureau, 1993), therefore the application of
water quality index to the wetland and its implication could be difrent too.

% (*+7/*,0 1,*53 3 (6 ,70( 1 +0)+.0,)+3

Tan & Yap (2006) in their review on current status of biochemical and molecular
indicators in aquatic ecosystems and its applications in Malaysia, emphasized the need
to characterize the species diversity of Malaysian biological resources through
population genetic. The information is essential to indicate the status of a certain
species within the ecosystem. In the present study, we attempted to use molecular
analysis to verify identification of macroinvertebrates based on morphological
characteristics and consequently to explore the extent to which molecular analysis is
sufficient to act as a possible alternative to morphological identification in taxonomic
classification of organisms.

38
% 3(*,) (1 (6 (),* +1(4 7 (6 ,70( 1 +0)+.0,)+3

Total genomic DNA of macroinvertebrates was isolated by using QIAGEN

DNeasy Blood & Tissue Kit, following studies carried out by Brockhouse and
MacCreadie (2004) and Harper et al (2005) on insects, earthworm, aphids, molluscs,
and weevils. DNA extraction was performed on all ethanol9fixed specimens, and all
samples were vacuum dried prior to extraction (Sambrook et al, 1989). For insect
species, DNA extraction protocol was conducted with 5 individiual per species per
reaction.

Of all macroinvertebrate samples, 2 out of 8 orders demonstrated high DNA yield

through the protocol, namely Oligochaeta and Gastropoda. On the other hand, orders
Arachnida, Odonata, and Coleoptera yielded no results while orders Plecoptera and
Hemiptra produced insignificant results. Since these samples are all of phylum
Insecta, DNA extraction could be rendered difficult due to the significant presence of
exoskeleton comprised of microfibers called chitin. On the contrary, the prepared
samples of pouched snail and sludge worm were only essentially built up of tissues,
hence the high amount of DNA. Besides, Brockhouse and MacCreadie (2004)
reported significant DNA degradation in ethanol9fixed specimens of dragonflies and
water scorpions, whereby no intact DNA left in the cells subsequent to killing by
ethanol. However, it was not proposed in the study as how to tackle the issue apart
from the suggested method by Sambrook et al (1989) of vacuum drying the ethanol9
fixed specimens.

39
% 4;* 6 7,) (1 (6 5)(780(4+ 2,3+ /./1 ) 4) +1+

In the present study, cytochrome oxidase subunit 1 (COI) primers were used as the
molecular marker for amplification of COI mitochondrial DNA region in the
macroinvertebrates samples. COI region was chosen because it has been extensively
utilized in studies of ecology. Its small size, and given the abundant conserved genes
in the mtDNA will allow amplification of universal primers in a range of organisms
(Freeland, 2005). Since the samples for amplification in this study extended to two
different orders (Oligochaeta and Gastropoda), the use of universal COI primer was
expected to be useful.

In this study, gradient PCR method was performed on both samples because of the
possible different parameters required by each samples. However, only Sample 5
(Oligochaeta) was successfully amplified and produced viable DNA products while
Sample 1 (Gastropoda) yielded no results. The temperature range for successful
amplified product correlates to the optimum temperature of COI primer (47oC).

So far, the use of primers for macroinvertebrates studies is random and diverse
(Brockhouse and MacCreadie, 2004; Claxton and Boulding, 1998; Harper et al, 2005),
hence the use of universal primer still cannot guarantee amplification of DNA in all
organisms. For instance, Claxton and Boulding (1998) cited a study conducted by
Baldwin et al (1996) which uses the univeral Folmer primer for analysis of veligers,
the same primer failed to amplify veligers mtDNA due to the presence of non9
dresseneid mtDNA, therefore requiring the design of another specific primers.

40
% ! 85*(-+1+) 7 1,*53 3 (6 */2-+ (04A3 4) +1+

Since only Sample 5 (Oligochaeta) was successfully amplified in the present

study, it was sequenced to be proceeded to the phylogenetic analysis step. The
resulting sequence was compared to the Gene Bank collection to obtain several other
corresponding sequences. Phylogenetic analysis was carried out subsequently,
generating three different threes to elucidate the relationship of Sample 5 to the
corresponding sequences in order to verify its taxonomy clasification.

In general, phylogenetic analyses of 14 partial sequences of COI mtDNA gene by

using neighbour9joining method, maximum parsimony method, and the consensus
phylogenetic tree summarizing the inference of the two earlier methods show the
presence of 2 orders Oligochaeta (earthworm) and Hirudinea (leeches). 5 Oligochaeta
families were present namely Naididae, Tubificidae, Megascolecidae, Oenenidae, and
Trichobranchidae. All species was distributed accordingly to their families except for
/ , which is supposedly a member of Tubificidae family. In
relation to the agreement of consensus tree for neighbour9joining and maximum
parsimony method, the relationship between members of all families was accurately
potrayed i.e. all members of the same family clustered together, although in maximum
parsimony tree it was not quite resolved and unclear.

In view of taxonomic validity, all trees showed the same clustering pattern,
unanimously demonstrating the presence of close genetic relationship between Sample
5 and $ ' $ ', a member of Tubificidae. However, the confidence level, as
demonstrated by the bootstrap values was average, which was 50 and 28, in
neighbour9joining and maximum parsimony method, respectively. Advanced
molecular method is suggested to be conducted to verify and determine the actual
status of Sample 5.

41
 &

In the present study, it was found that the area under assessment in Tasek Bera
demonstrated low diversity of macroinvertebrates with water quality possibly
contaminated with slight organic pollution. Whereas one of the dominant taxa found
during the study, namely order Plecoptera, plays a key role as biological indicator for
wetland health. The information obtained is crucial in serving as baseline data for
various agencies including governmental, academic institutions, and non9
governmental agencies (NGOs) to take actions for better and more efficient
management of Tasek Bera as Ramsar site.

On the other hand, molecular approach of this study demonstrated how

phylogenetic analysis resolved identification of organism to lower taxonomic level in
addition to morphological identification alone, as demonstrated by sample 5 whereby
it was identified to the genus level through molecular approach. Therefore, it is
imperative that more advanced molecular methods be explored to illuminate how
molecular ecology can provide useful tools in the field of conservation biology.

42
 '

This study only provides preliminary records on current distribution and diversity
of macroinvertebrates in a limited study area over a short period of time. The
continuation of baseline inventory of macroinvertebrate community in all areas of
Tasek Bera is recommended. Furthermore, it is also crucial the assessment is carried
out over longer period of time to account for seasonal changes since
macroinvertebrates in littoral zones are susceptible to such changes. The physical9
chemical characteristics of water quality in Tasek Bera was also not encountered in
this study, therefore including the assessment in future studies is crucial to obtain
better resources on the current status of the wetland ecological health.

In addition, this study allows evaluation of any future management plan that are
undertaken in Tasek Bera using the macroinvertebrates data as indicator to monitor
the water quality of Tasek Bera over time, a water quality sampling programmes to
complement monitoring of physical9chemical characteristics can be designed to
provide a comprehensive and extensive water quality monitoring programme.

In terms of studies on molecular ecology, complete sequence of COI and other

genes of protein coding (e.g. Cytochrome b) and non9protein coding (e.g. 16S
mtDNA) are also required in future studies for further clarification on the
phylogenetic relationships of macroinvertebrates.

43
Ambak, M.A., Jalal, K.C.A. (2006) Sustainability issues of reservoir fisheries in
Malaysia. 1 2 $ # + 3, .
9(2): 1659173.
Baldwin, B.S., Black, M., Sanjur, O., Gustafson, R., Lutz, R.A., and Vrijenhoek, R.C.
(1996). A diagnostic molecular marker for zebra mussels ((
4 and potentially co9occuring bivalves: mitochondrial COI. , !
, !/ !/ . 5: 9914.
Barbour, M.T., J. Gerritsen, B.D. Snyder, and J.B. Stribling (1999) "
/ * $ . " 5 " 6
* 7/ , " , Second Edition. EPA 8419
B9999002. U.S. Environmental Protection Agency; Office of Water;
Washington, D.C.
Brockhouse, C.L., and McCreadie, J.W. (2004). , " $1 8 (
, - ( a.
Claxton, W.T., and Boulding, E.G. (1998). A new molecular technique for identifying
field collections of zebra mussel (Dreissena polymorpha) and quagga mussel
(Dreissena bugensis) veliger larvae applied to eastern Lake Erie, Lake Ontario,
and Lake Simcoe. 0 " 2 $9 , 76: 1949198
Dudgeon, D (1999). 69 7+ 7 "0 .
Hong Kong University Press: Hong Kong.
Felsenstein, J. 2004. PHYLIP (Phylogeny Inference Package) version 3.65.
( " ! ( $ 8 7 . $
5 7 !
Fong, M. & Nou, T. (2001). The diversity of benthic macroinvertebrates within the
creeks of the Manly Dam catchment. In: + $ :: ,
Department of Environmental Sciences, University of Technology, Sydney.
Freeland, J.R. (2005). , + . John Wiley & Sons Ltd: England
Gawler, M. (ed.) (2002). 5 . ;$ 5 "6 / * 1
* , . Proceedings of a Workshop held at the 2nd
International Conference on Wetlands and Development (November 1998,
Dakar, Senegal). Wetlands International IUCN, WWF Publication No. 56,
Wageningen, The Netherlands.

8 " $ " $ " " 7

" . Secretariat of the Convention on Biological Diversity,
Montreal, Canada, CBD Technical Series no. 22 and the Secretariat of the
Ramsar Convention, Gland, Switzerland, Ramsar Technical Report no. 1

44
Harper, G.L., King, R.A., Dodd, C.S., Harwood, J.D., Glen, D.M., Bruford, M.W.,
and Symondson, W.O. (2005). Rapid screening of invertebrate predators for
multiple prey DNA targets. Molecular Ecology, 14: 8199827
Hoy, M.A. (2003). 1 , 8 6 1 " * "
. Second Edition. Elsevier Science: USA.
IPT – Asian Wetland Bureau (1993). / 6 5 "/ $ $ <
" " $ , . Asian Wetland Bureau
Publication No. 98
Jessup, B.K., Markowitz, A., Stribling, J.B., Friedman, E., LaBelle, K., and Dziepak,
N. (2003) =< > 1 $ , " "
" . Maryland Department of Natural Resources: United States
Jorgensen, S.E., Costanza, R., Xu, F. (2005). " $+ 1 " $
$+ . CRC Press
Kamarul, R.K., Gires, U., Ridzwan, H. (2006) * $
? " " 6 " 4 $ " $ @ " )
#
Mandaville, S.M. (2002) / , A '
B 7 , 7 " * ! Project H91, Soil & Water Conservation
Society of Metro Halifax. xviii, 48p., Appendices A9B. 120p.
Murugadas TL (compiler). 2002. ( " $ $ 5 "
1 7 " , ?51 , 4 , .
Proceedings of the Workshop on Developing a Proposed Framework for a
Wetland Inventory, Assessment and Monitoring System (WIAMS) in
Malaysia, Sundari R, Davies J and Humphrey C (eds), Kuala Lumpur,
Malaysia, 18919 April 2002, Wetlands International – Malaysia Programme,
Petaling Jaya.
Mustapha Kamal, A.S., Aziz, A., Siti K.D. (1987) "
$ ! Utilization of Inland Water Bodies for Fisheries.
Palumbi: S., A. Martin, S. Romano, W. O. McMillan, L. Stice, and G. Grabowski.
1991 The simple fool's guide to PCR. Version 2.0. Department of Zoology
and Kewalo Marine Laboratory, University of Hawaii, Honolulu, Hi. 96822.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. , 6
! Second edition. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York, USA.
Seiber K.L, Tom S.K, Gregg T.M, Rivera9Poy B, and Takabayashi M. (2006) 5
C $ " 7 6, $ 7
7 " . (online) http://www.jyi.org (10 November 2006)
Shabdin M.L., Fatimah, A., Khairul Adha, A.R. (2002). The macroinvertebrate
community of the fast flowing rivers in the Crocker Range National Park
Sabah, Malaysia. ASEAN Review of Biodiversity and Environmental
Conservation (ARBEC) (online) http://www.arbec.com.my (12 January 2007)

45
Tan, S.G. and Yap, C.K. (2006) Biochemical and molecular indicators in aquatic
ecosystems: Current status and further applications in Malaysia. #
+ 3, , 9(2):2279236
Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997.
The ClustalX9 Windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res. 25:487694882.
Wahizatul Afzan, A., Amiruddin, A. and Raja Noor Balqhis, R.S. (2006) ( $
# 1 5 C $
7
Water on the Web. (2004). Water on the Web B Monitoring Minnesota Lakes on the
Internet and Training Water Science Technicians for the Future 9 A National
On9line Curriculum using Advanced Technologies and Real9Time
Data.(http://WaterOntheWeb.org). University of Minnesota9Duluth, Duluth,
MN 55812.
Yusoff, F.M., Shariff, M. and Gopinath, N. (2006) Diversity of Malaysian aquatic
ecosystems and resources. 1 2 $ # +
3, , 9(2): 119 – 135.
Ziglio, G., Siligardi, M. and Flaim, G. (2006) / , $ 6
"* . John Wiley & Sons Ltd: England.
Zimmerman, M.C. (1993) The use of the biotic index as an indication of water quality.
Tested studies for laboratory teaching, Vol. 5: p 85998 (C.A. Goldman, P.L.
Hauta, M.A O’Donell, S.E. Andrews, and R. van der Heiden, Editors).
Proceedings of the 5th Workshop/Conference of the Association for Biology
Laboratory Education (ALBE). 115 p.

46