Original Papers

ASN Neuro
Volume 13: 1–18
Microglial- and Astrocyte-Specific Expression © The Author(s) 2021
Article reuse guidelines:
of Purinergic Signaling Components and sagepub.com/journals-permissions
DOI: 10.1177/17590914211044882
Inflammatory Mediators in the Rat journals.sagepub.com/home/asn

Hippocampus During Trimethyltin-Induced

Neurodegeneration

Milorad Dragić1, Nataša Mitrović2, Marija Adžić1,3,

Nadežda Nedeljković1, and Ivana Grković2

Abstract
The present study examined the involvement of purinergic signaling components in the rat model of hippocampal degener-
ation induced by trimethyltin (TMT) intoxication (8 mg/kg, single intraperitoneal injection), which results in behavioral and
neurological dysfunction similar to neurodegenerative disorders. We investigated spatial and temporal patterns of ecto-nucle-
oside triphosphate diphosphohydrolase 1 (NTPDase1/CD39) and ecto-5′ nucleotidase (eN/CD73) activity, their cell-specific
localization, and analyzed gene expression pattern and/or cellular localization of purinoreceptors and proinflammatory medi-
ators associated with reactive glial cells. Our study demonstrated that all Iba1+ cells at the injured area, irrespective of their
morphology, upregulated NTPDase1/CD39, while induction of eN/CD73 has been observed at amoeboid Iba1+ cells local-
ized within the hippocampal neuronal layers with pronounced cell death. Marked induction of P2Y12R, P2Y6R, and P2X4-mes-
senger RNA at the early stage of TMT-induced neurodegeneration might reflect the functional properties, migration, and
chemotaxis of microglia, while induction of P2X7R at amoeboid cells probably modulates their phagocytic role. Reactive astro-
cytes expressed adenosine A1, A2A, and P2Y1 receptors, revealed induction of complement component C3, inducible nitric
oxide synthase, nuclear factor-kB, and proinflammatory cytokines at the late stage of TMT-induced neurodegeneration. An
increased set of purinergic system components on activated microglia (NTPDase1/CD39, eN/CD73, and P2X7) and astro-
cytes (A1R, A2AR, and P2Y1), and loss of homeostatic glial and neuronal purinergic pathways (P2Y12 and A1R) may shift puri-
nergic signaling balance toward excitotoxicity and inflammation, thus favoring progression of pathological events. These
findings may contribute to a better understanding of the involvement of purinergic signaling components in the progression
of neurodegenerative disorders that could be target molecules for the development of novel therapies.

Keywords
astrocyte-derived inflammation, eN/CD73, hippocampal neurodegeneration, microglial polarization, NTPDase1/CD39,
purinergic receptors
Received May 19, 2021; Revised August 18, 2021; Accepted for publication August 20, 2021

Introduction 1
Department for General Physiology and Biophysics, Faculty of Biology,
Neurotoxicants, such as trimethyltin (TMT)-chloride, have been University of Belgrade, Belgrade, Serbia
2
reported as risk factors for the development of neurodegenera- Department of Molecular Biology and Endocrinology, VINČA Institute of
Nuclear Sciences-National Institute of thе Republic of Serbia, University of
tive disorders (Kotake, 2012; Pompili et al., 2020; Belgrade, Belgrade, Serbia
Yegambaram et al., 2015). In rats, TMT selectively targets the 3
Center for Laser Microscopy, Faculty of Biology, University of Belgrade,
limbic region, particularly the hippocampus, with a similar Belgrade, Serbia
pattern as observed in humans and with comparable behavioral Corresponding Author:
Ivana Grković, Department of Molecular Biology and Endocrinology, VINČA
alterations (Corvino et al., 2013, 2015; Ferraz da Silva et al.,
Institute of Nuclear Sciences - National Institute of the Republic of Serbia,
2017; Geloso et al., 2011; Haga et al., 2002; Lattanzi et al., University of Belgrade, Mike Petrovića Alasa 12-14, P.O.Box 522-090
2013; Lee et al., 2016; Trabucco et al., 2009). TMT-induced neu- 11000 Belgrade, Serbia.
rodegeneration in rats is characterized by early astrocyte Email: [email protected]; [email protected]

Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-
NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution
of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page (https://us.sagepub.com/en-
us/nam/open-access-at-sage).
2 ASN Neuro

activation followed by sustained astrogliosis, the response of et al., 2000; Grkovic et al., 2019b; Matyash et al., 2017;
resident microglial to hippocampal neuronal loss that progres- Robson et al., 2006; Zimmermann et al., 2012). The resulting
sively worsens over 3 weeks (Dragic et al., 2019b, 2021; Haga AMP is hydrolyzed to adenosine by eN/CD73, widely
et al., 2002; Little et al., 2002, 2012), as well as a cognitive expressed in the hippocampus (Grkovic et al., 2019a,
deficit in various tasks similar to human neurodegenerative 2019b; Zimmermann et al., 2012). Adenosine
disorders such as Alzheimer’s disease and temporal lobe G-protein-coupled receptors (A1R, A2AR, A2BR, and A3R)
epilepsy (Chvojkova et al., 2021; Corvino et al., 2013; Geloso mediate modulatory effects of adenosine in an inflammatory
et al., 2011; Lattanzi et al., 2013; Lee et al., 2016; Pompili environment (Hasko & Cronstein, 2013; Nedeljkovic,
et al., 2020; Trabucco et al., 2009; Ye et al., 2020). Thus, 2019). The two ectonucleotidases act together as an immune
TMT neurotoxicity is a valuable tool for studying changes in checkpoint since they determine the ATP/adenosine ratio
molecular signatures of glial cells during the progression of and the inflammatory status of the tissue. Therefore, an
neurodegeneration that accompanies hippocampal dysfunction. altered function of NTPDase1/CD39 and eN/CD73 and dysre-
In general, glial cells, microglia, and astrocytes are crucial gulation of the purinergic signaling are largely implicated in
in monitoring, maintaining, and preserving the metabolic and the pathophysiology of several neurological diseases, includ-
structural integrity of the central nervous system (CNS), and ing Alzheimer’s and Parkinson disease, multiple sclerosis,
respond to noxious stimuli and insults to the brain. and astroglioma (Burnstock, 2017), but their cell-specific
Alterations in CNS homeostasis immediately lead to localization during neurodegeneration is rarely explored.
changes in microglial cells morphology and functional polar- Furthermore, NTPDase1/CD39 and eN/CD73 represent
ization toward one of the two complex phenotypes, detrimen- promising pharmacological targets in the treatment of neuro-
tal that release proinflammatory cytokines and reactive inflammatory processes (Antonioli et al., 2013).
oxygen species (ROS) and reactive nitrogen species or prore- It has been previously described an early change in astrocyte
pair, an antiinflammatory phenotype that express molecular morphology that precedes neuronal loss, particular reactive
markers such as arginase-1 (Arg1) (Illes et al., 2020; Zabel astrocyte phenotypes, and their dynamic remodeling after
& Kirsch, 2013), with a full repertoire of transitional states TMT intoxication (Dragic et al., 2019b). It was also found
between them. In response to brain injury, astrocytes that TMT-induced mitochondrial depolarization is indepen-
assume reactive states that may be discriminated based on dent of extracellular Ca2+ and disturbed antioxidative
the proliferation and induction of proinflammatory mediators defense, but also upregulated main proinflammatory factors
and ROS (Verkhratsky et al., 2014). Furthermore, different and components of signaling pathways responsible for astro-
polarized states of reactive astrocytes are characterized, deter- cyte reactivity, and markers of proinflammatory subtype of
mined as dominantly harmful, a proinflammatory type that astrocytes in vitro (Dragic et al., 2021). Induction of P2X2R
might releases the neurotoxic complement C3 directly in glial cells has been reported after TMT intoxication (Latini
leading to neuron death, and the dominantly neuroprotective et al., 2010), but the involvement of other purinergic signaling
type (Liddelow & Barres, 2017), but also with the repertoire components has not been explored. The main goal of the
of transitional microenvironment-dependent states. present study was to explore the cell-specific localization of
Communication between astrocytes, microglia, and degen- NTPDase1/CD39 and eN/CD73 and the expression of puriner-
erating neurons is mediated via different signaling molecules, gic receptors specific for microglia in the early and the late stage
and one of the strongest is adenosine triphosphate (ATP) of hippocampal neurodegeneration induced by TMT.
(Sperlagh & Illes, 2007). A large amount of extracellular Furthermore, there is no information on whether
ATP, released from injured neurons and activated glial TMT-induced inflammation in rats is caused by reactive micro-
cells, acts as a “danger signal” and activates specific ligand- glia and/or astrocytes. Thus, in the present study, we analyzed
gated P2X channels and G-protein-coupled P2Y receptors NTPDase1/CD39 and eN/CD73, and purinergic receptors
(Burnstock, 2017; Di Virgilio et al., 2009; Sperlagh & Illes, expression patterns in the context of activation of glial cells,
2007), promoting microglial chemotaxis and phagocytosis inflammation, and its potential resolution after TMT intoxica-
as well as the release of proinflammatory cytokines (Bernier tion. We also hypothesized that components of purinergic sig-
et al., 2013; Franke et al., 2012; Haynes et al., 2006; Illes naling may assign functional states of glial cells.
et al., 2020). Enzymes responsible for calibrating
the duration, and degree of P2 receptor activation are func-
tionally coupled membrane-bound ectonucleotidases named Material and Methods
ecto-nucleoside triphosphate diphosphohydrolase 1
(NTPDase1/CD39) and ecto-5′ nucleotidase (eN/CD73) that Animals, Surgical Procedure, and Treatment
rapidly hydrolyze ATP to adenosine (Grkovic et al., 2019a; Two-month-old female rats of the Wistar strain (200–220 g)
Matyash et al., 2017; Zimmermann et al., 2012). maintained in the local animal facility were used in the
NTPDase1/CD39 is dominantly expressed at microglia and study. Appropriate actions were taken to alleviate the pain
endothelial cells and hydrolyzes ATP and adenosine diphos- and discomfort of the animals following the compliance
phate (ADP) to adenosine monophosphate (AMP) (Braun with the European Communities Council Directive (2010/
Dragić et al. 3

63/EU) for animal experiments, and the research procedures min), sections were incubated with horseradish peroxidase
were approved by the Ethical Committee for the Use of (HRP)-conjugated secondary antibodies (2 h, RT in a humid
Laboratory Animals. Animals were housed 3–4/cage, in a chamber). The list of antibodies used for immunohistochem-
12 h light/dark regime, constant humidity and temperature, istry (IHC) and immunofluorescence (IF) is presented in
and free access to food and water. Table 1. The immunoreaction was visualized with
It was previously shown that TMT-induced hippocampal 3,3′ S-diaminobenzidine-tetrahydrochloride (Abcam, UK),
neurodegeneration and gliosis, the pattern of which was com- which is converted to the insoluble brown precipitate by
parable in adult rats of both sexes (Corvino et al., 2015; HRP. Sections were washed in distilled water, dehydrated
Dragic et al., 2019b; Geloso et al., 2011; Haga et al., 2002; in graded ethanol solutions (70%–100%), cleared in xylene,
Little et al., 2012; Trabucco et al., 2009). However, given and mounted with the use of DPX-mounting medium
that the expression of ectonucleotidases in the brain is modu- (Sigma Aldrich, USA). Sections were analyzed under a
lated/regulated by gonadal steroids and differs in two sexes LEITZ DM RB light microscope (Leica Mikroskopie &
(Grkovic et al., 2019b; Mitrovic et al., 2016, 2017), the Systems GmbH, Wetzlar, Germany), equipped with a
study was performed in female rats, bilaterally ovariecto- LEICA DFC320 CCD camera (Leica Microsystems Ltd,
mized 3 weeks before TMT injection as we described previ- Heerbrugg, Switzerland), and LEICA DFC Twain Software
ously (Dragic et al., 2019b). (Leica, Germany). All images were captured at 40×
On day zero, animals of the TMT group received TMT magnification.
(8 mg/kg dissolved in 1 mL 0.9% w/v saline) (in the form The identical protocol has been applied for double and
of a single intraperitoneal [i.p.] injection), whereas the triple IF staining, with the omission of the methanol/H2O2
control (Ctrl) group received an adequate volume of 0.9% step. After incubation with primary antibodies (Table 1), sec-
saline solution. The animals were returned to their cages, tions were probed with fluorescence dye-labeled secondary
and monitored for unusual signs of behavior until sacrifice, antibodies and mounted with Mowiol (Calbiochem, La
as reported previously (Dragic et al., 2019b). At 7 and 21 Jolla, CA). For double and triple IF staining, primary and sec-
days post intoxication (dpi), animals of TMT and age- ondary antibodies were separately applied for each labeling.
matched Ctrl groups (10 animals/group) were sacrificed by Sections incubated without primary antibodies or with rat pre-
decapitation (Harvard apparatus, Holliston, MA, USA). immune sera were used as negative Ctrls. Sections were ana-
lyzed by a confocal laser-scanning microscope (LSM 510,
Carl Zeiss GmbH, Jena, Germany), using Ar multiline (457,
Histochemistry, Immunohistochemistry, and 478, 488, and 514 nm), HeNe (543 nm), and HeNe (643
Immunofluorescence Microscopy nm) lasers using 63× (2× digital zoom) DIC oil, 40× and
Brains (n = 5 per group) were carefully removed from the monochrome camera AxioCam ICm1 camera (Carl Zeiss
skull, fixed in 4% paraformaldehyde for 24 h, cryoprotected GmbH, Germany).
in graded sucrose (10%–30% in 0.2 M phosphate buffer),
and stored at 4 °C, as described before (Dragic et al.,
2019b; Grkovic et al., 2019b). The brains were cryosectioned Enzyme Histochemistry. Ectonucleotidase enzyme histochem-
in serial 25 µm thick coronal sections and the sections at 3.12– istry based on the ATP/ADP- and AMP-hydrolyzing activities
3.84 mm anteroposterior to Bregma were air-dried and stored of NTPDase1/CD39 and eN/CD73, respectively, have been
at – 20 °C until use. applied (Dragic et al., 2019a; Grkovic et al., 2019b).
Briefly, cryosections were preincubated for 30 min at RT in
Tris-maleate sucrose (TMS) buffer, containing 0.25 M
Nissl Staining. Alterations in hippocampal cytoarchitecture sucrose, 50 mM Tris-maleate, 2 mM MgCl2 (pH 7.4), and 2
induced by TMT injection were evaluated by Nissl staining. mM levamisole, to inhibit tissue nonspecific alkaline phos-
Sections were kept in 0.5% thionine solution for 20 min, phatase. The enzyme reaction was carried out at 37 °C/60
washed in tap water, dehydrated in graded ethanol (70%– min, in TMS buffer, containing 2 mM Pb(NO3)2, 5 mM
100%), cleared in xylene for 2 × 5 min, and covered with MnCl2, 3% dextran T250, and 1 mM substrate (ATP, ADP,
DPX-mounting medium (Sigma Aldrich, USA). or AMP). After thorough washing, slides were immersed in
1% (v/v) (NH4)2S, and the product of enzyme reaction was
Immunohistochemistry and Immunofluorescence. Slides were visualized as an insoluble brown precipitate at a site of the
kept at room temperature (RT) for 30 min before staining. enzyme activity. After dehydration in graded ethanol solu-
After washing in phosphate-buffered saline (PBS), slides tions (70%–100% EtOH, and 100% xylol), slides were
were put in 0.3% H2O2 in methanol for 20 min, to block mounted with a DPX-mounting medium (Sigma Aldrich,
endogenous peroxidase, and then immersed in 5% donkey USA). The sections were examined under a LEITZ DM RB
normal serum at RT for 1 h to block nonspecific binding. light microscope (Leica Mikroskopie & Systems GmbH,
Sections were probed with primary antibodies, overnight at Wetzlar, Germany), equipped with a LEICA DFC320 CCD
4 °C in a humid chamber. After washing in PBS (3 × 5 camera (Leica Microsystems Ltd, Heerbrugg, Switzerland)
4 ASN Neuro

Table 1. List of Antibodies.

Used
Antibody Source and type dilution Manufacturer

Iba1 Goat, polyclonal 1:400IHC, IF Abcam ab5076, RRID: AB_2224402

CD73, rNu-9L(I4,I5) Rabbit, polyclonal 1:300IHC, IF Ectonucleotidases-ab.com
CD39, mN1-2C(I4,I5) Guinea pig, 1:200IF Ectonucleotidases-ab.com
polyclonal
Arg1 Rabbit, polyclonal 1:200IF Sigma AV45673, RRID: AB_1844986
iNOS Rabbit, polyclonal 1:200IF Abcam ab15323, RRID: AB_301857
CD68 Rabbit, polyclonal 1:200IF Abcam ab125212, RRID: AB_10975465
P2Y12 Rabbit, polyclonal 1:300IF Sigma P4817, RRID: AB_261954
GFAP Mouse, monoclonal 1:100IF UC Davis/NIH NeuroMab Facility (73–240), RRID:
AB_10672298
GFAP Rabbit, polyclonal 1:500IF DAKO, Agilent Z0334, RRID: AB_10013382
C3 Goat, polyclonal 1:300IF Thermo Fisher Scientific PA1-29715 RRID: AB_AB_2066730
TNF-α Goat, polyclonal 1:100IF Santa Cruz Biotechnology, sc-1350, RRID: AB_2204365
IL-10 Goat, polyclonal 1:100IF Santa Cruz Biotechnology, sc-1783, RRID: AB_2125115
NF-kB Rabbit, polyclonal 1:100IF Santa Cruz Biotechnology, sc-109, RRID: AB_632039
IL-1β/IL-1F2 Goat, polyclonal 1:100IF R&D Systems, AF-501-NA, RRID: AB_ 354508
P2Y1 Rabbit, polyclonal 1:300IF Alomone Labs; APR-0009, RRID: AB_2040070
A2A Rabbit, polyclonal 1:300 IF Abcam, ab3461, RRID: AB_303823
P2X7 Rabbit, polyclonal 1:400 IF Alomone Labs, APR-004, RRID: AB_2040068
A1 R Rabbit, polyclonal 1:200 IF Novus Biologicals, NB300-549, RRID: AB_10002337
Anti-mouse IgG Alexa Fluor 488 Donkey, polyclonal 1:400IF Invitrogen A21202, RRID: AB_141607
Anti-goat IgG Alexa Fluor 488 Donkey, polyclonal 1:400IF Invitrogen A-11055, RRID: AB_142672
Anti-rabbit IgG Alexa Fluor 555 Donkey, polyclonal 1:400IF Invitrogen A-21428, RRID: AB_141784
Anti-mouse IgG Alexa Fluor 647 Donkey, polyclonal 1:400IF Thermo Fisher Scientific A-31571, RRID: AB_162542
Anti-goat HRP-conjugated IgG Rabbit, polyclonal 1:200IHC R&D Systems, HAF017 RRID: AB_56258
Anti-rabbit IgG Alexa Fluor 488 Donkey, polyclonal 1:400IF Invitrogen A-21206, RRID: AB_141708
Anti-guinea pig IgG Alexa Fluor Goat, polyclonal 1:200IF Invitrogen A-21435, RRID: AB_2535856
555
Anti-mouse HRP-conjugated IgG Goat, polyclonal 1:200IHC R&D Systems, HAF007 RRID: AB_562588
Anti-goat HRP-conjugated IgG Rabbit, polyclonal 1:200IHC R&D Systems, HAF017 RRID: AB_56258
Note. Arg1 = arginase-1; GFAP = glial fibrillary acidic protein; HRP = horseradish peroxide; IF = immunofluorescence; IgG = immunoglobulin G; IHC =
immunohistochemistry; IL-10 = interleukin-10; IL-1F2 = interleukin-1F2; IL-1β = interleukin-1β; iNOS = inducible nitric oxide synthase; NF-kB = nuclear
factor-kB; TNF-α = tumor necrosis factor-α.

and analyzed using LEICA DFC Twain Software (Leica, fluorescence intensities are perfectly, but inversely, related
Germany). to one another). Values near zero reflect distributions of
probes that are uncorrelated with one another. The results
are expressed as mean PCC ± standard error of the mean
IF Quantification. Raw multiimage IF micrographs were used (SEM).
to measure integrated fluorescence density expressed as arbi-
trary units (AUs) and the density confined within five prede-
fined regions of interest (ROIs), with background
Gene Expression Analysis by Quantitative Reverse
fluorescence subtraction for at least three images per ROI
and n = 5 sections per animal per group (JACoP ImageJ
Transcriptase-Polymerase Chain Reaction
plugin). A degree of overlap and correlation between multiple Total RNA was extracted from the hippocampal formation
channels was estimated by calculating Pearson’s correlation (7 and 21 dpi and appropriate age-matched Ctrls, n = 5
coefficient (PCC) (Dunn et al., 2011). PCC is a statistical animals per group) using TRIzol Reagent (Invitrogen,
parameter that reflects both cooccurrence (degree at which Carlsbad, CA, USA), according to the manufacturer’s instruc-
intensities of two channels for each pixel are beyond or tions. Purity and the concentration of isolated RNA were
above the threshold), and correlation (pixel-for-pixel propor- assessed by OD260/OD280 and OD260, respectively.
tionality in the signal levels of the two channels). PCC values Complementary DNA (cDNA) was synthesized using a
range from 1 (for two images whose fluorescence intensities High-Capacity cDNA Reverse Transcription Kit
are perfectly, linearly related) to -1 (for two images whose (ThermoFisher Scientific, MA, USA) and stored at –20 °C
Dragić et al. 5

Table 2. Primer Sequences Used for RT-qPCR.

Gene Sequence (5′ - −3′ ) Length (bp)

NTPDase1 (Entpd1) TCAAGGACCCGTGCTTTTAC 150

TCTGGTGGCACTGTTCGTAG
eN (Nt5e) CAAATCTGCCTCTGGAAAGC 160
ACCTTCCAGAAGGACCCTGT
P2X4R (P2rx4) ACCAGGAAACGGACTCTGTG 168
TCACGGTGACGATCATGTTGG
P2X7R (P2rx7) ATTGTTAGGCCAATGGCAAG 190
AACACCTTCACCGTCTCCAC
P2Y2R (P2ry2) TCACCCGCACCCTCTATTAC 139
GCCAGGAAGTAGAGCACAGG
P2Y6R (P2ry6) CAGTTATGGAGCGGGACAAT 104
GTAAACTGGGGGTAGCAGCA
P2Y12R (P2ry12) CGAAACCAAGTCACTGAGAGGA 162
CCAGGAATGGAGGTGGTGTTG
P2Y1R (P2ry1) CTGGATCTTCGGGGATGTTA 138
CTGCCCAGAGACTTGAGAGG
A1R (Adora1) GTGATTTGGGCTGTGAAGGT 194
GAGCTCTGGGTGAGGATGAG
A2AR (Adora2a) TGCAGAACGTCACCAACTTC 141
CAAAACAGGCGAAGAAGAGG
A2BR (Adora2b) CGTCCCGCTCAGGTATAAAG 104
CCAGGAAAGGAGTCAGTCCA
A3R (Adora3) TTCTTGTTTGCCTTGTGCTG 129
AGGGTTCATCATGGAGTTCG
IL-1β (Il1b) CACCTCTCAAGCAGAGCACAG 79
GGGTTCCATGGTGAAGTCAAC
TNFα (Tnf) CCCCCATTACTCTGACCCCT 88
CCCAGAGCCACAATTCCCTT
IL-6 (Il6) CCGGAGAGGAGACTTCACAG 160
ACAGTGCATCATCGCTGTTC
IL-10 (Il10) GCTCAGCACTGCTATGTTGC 106
GTCTGGCTGACTGGGAAGTG
C3 (C3) GCGGTACTACCAGACCATCG CTTCTGGCACGACCTTCAGT 166
iNOS (Nos2) ACACAGTGTCGCTGGTTTGA 125
AACTCTGCTGTTCTCCGTGG
Arg1 (Arg1) CTGTGGTAGCAGAGACCCAGA 161
GGTTGTCAGCGGAGTGTTGA
S100a10 (S100a10) GTACCCACACCTTGATGCGT 130
CGAAAGCTCCTCTGTCATTGG
CycA (Ppia) CAAAGTTCCAAAGACAGCAGAAAA 114
CCACCCTGGCACATGAAT
HPRT1 (Hprt1) GGTCCATTCCTATGACTGTAGATTTT 126
CAATCAAGACGTTCTTTCCAGTT
GAPDH (Gapdh) CAACTCCCTCAAGATTGTCAGCAA 118
GGCATGGACTGTGGTCATGA
Note. Arg1 = arginase-1; CycA = cyclophilin A; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; HPRT1 = hypoxanthine phosphoribosyltransferase 1;
IL-10 = interleukin-10; IL-1β = interleukin-1β; IL-6 = interleukin-6; iNOS = inducible nitric oxide synthase; RT-qPCR=quantitative reverse
transcriptase-polymerase chain reaction; TNF-α = tumor necrosis factor-α.

until use. Quantitative real-time polymerase chain reaction annealing at 60 °C, 30 s amplification at 72 °C, and 5 s fluores-
(PCR) was performed using Power SYBR™ Green PCR cence measurement at 72 °C. Primer sequences used for the
Master Mix (Applied Biosystems, MA, USA) and ABI Prism amplification are given in Table 2. To compare the relative
7000 Sequence Detection System (Applied Biosystems, MA, expression levels of the studied transcripts, we validated three
USA) under the following conditions: 10 min of enzyme activa- housekeeping genes: glyceraldehyde-3-phosphate dehydroge-
tion at 95 °C, 40 cycles of 15 s denaturation at 95 °C, 30 s nase (Gapdh), cyclophilin A (CycA), and hypoxanthine-
6 ASN Neuro

guanine phosphoribosyltransferase (Hprt). Cycle threshold cells populated the synaptic layers in the entire CA1 and the
(Ct) values in all examined animals for all housekeeping hilar/pCA3 sectors, while Iba1+cells in the neuronal cell
genes were within the same half of the same cycle making layers attained amoeboid morphology (Figure 1c and d). At
it all acceptable as a reference gene. The expression profiles 21 dpi, most of the heavily labeled Iba1+ cells with pro-
of genes that we studied were comparable when normalized nounced amoeboid morphology were located in the pyramidal
to all housekeeping genes. Thus, for relative quantification cell layer and especially in p/mCA3 region. Interestingly, rod
of target genes, we used the 2−ΔΔCt method, using CycA as Iba1-ir cells were not observed in the hilar/pCA3, whereas the
a reference gene. Samples obtained from five animals for hilar area and granular cell layer appeared completely without
each experimental group were run in duplicate. Iba1-ir at the latest time point (Figure 1c).
Amplification efficacy was assessed by the generation of
internal standard curves by several-fold dilutions of generated
cDNA while melting curve analysis at the end of each exper- Expression of NTPDase1/CD39, eN/CD73, and
iment was used to confirm the formation of a single PCR
product. The results were expressed as the abundance of Purinoreceptors Involved in Microglial Reactivity
target messenger RNA (mRNA)/CycA-mRNA at 7 and 21 The main goal of the present study was to explore the involve-
dpi relative to a corresponding Ctrl ± standard deviation ment of the purinergic signaling system in TMT-induced hip-
(SD). Relative expressions of target genes normalized pocampal neurodegeneration and gliosis. We first analyzed
against CycA used as a housekeeping gene are shown in the expression of genes encoding NTPDase1/CD39 and eN/
Supplementary Table 1. CD73. There was a significant increase in the relative expres-
sion of NTPDase1/CD39-mRNA in the hippocampal tissue at
7 and 21 dpi (p < .01 and p < .0001, respectively) when com-
Statistical Analysis pared with age-match Ctrls. Although the relative expression
Data were analyzed for normality and appropriate parametric of eN/CD73-mRNA in the hippocampal tissue at 7 dpi did not
tests were used. All values are presented as mean ± SD or change, the enzyme mRNA levels significantly increased at
SEM. Between-group comparisons for 7 and 21 dpi were ana- 21 dpi when compared with age-match Ctrl (p < .01)
lyzed using an unpaired t-test. The values of p < .05 or less (Figure 2a).
were considered statistically significant. For all statistical The pattern of the enzyme activity in the hippocampus and
analyses, Graphpad Prism 5.04 (Graphpad) software was the localization of upregulated NTPDase1/CD39 in response to
used. TMT were determined by enzyme histochemistry using ATP
and ADP as a substrate (Braun et al., 2000; Grkovic et al.,
2019b). In accordance with well-known data (Braun et al.,
Results 2000; Grkovic et al., 2019b; Robson et al., 2006), the typical
Spatiotemporal Patterns of Neurodegeneration and patterns of histochemical reaction for ATPase/ADPase activi-
ties were observed in Ctrl hippocampi, labeling synaptic
Gliosis After TMT Exposure layers, ramified microglia, and endothelial cells typical for
TMT-induced hippocampal degeneration was confirmed by NTPDase1/CD39 (Figure 2b). In the first four days after intox-
Nissl staining (Figure 1a). As we have shown previously ication (data not shown), reduction of staining in neuropil
(Dragic et al., 2019b), cell injury was observed in the hilar/ through hippocampus was noticed particularly when ADP
proximal CA3 (hilus/pCA3) at 7 dpi. This is followed by was used as a substrate. This reduction was accompanied by
the almost complete disappearance of staining in neuronal a parallel increase of lead-phosphate deposition that nicely
somata in CA1 and the proximal and medial CA3 delineated cellular membranes of microglia. At 7 dpi lead-
(p/mCA3) regions at 21 dpi (Figure 1a), as already reported phosphate depositions delineated reactive microglia that
(Geloso et al., 2011; Haga et al., 2002; Latini et al., 2010; covered the strata but also entered the neuronal layers
Little et al., 2012). As reported previously (Dragic et al., (Figure 2b). At 21 dpi, activated microglia accounted for
2019b), immunostaining of astrocyte marker glial fibrillary most of the enhanced ATPase/ADPase activities, revealing
acidic protein (GFAP) showed the presence of pronounced strong staining of CA strata, while dentate gyrus (DG) was
astrogliosis at 7 dpi as well as 21 dpi (Figure 1b). mostly without reaction (Figure 2b). The obtained patterns of
A great morphological diversity of reactive microglia was ATP/ADP enzyme activities closely corresponded to Iba1-ir
observed (Figure 1c and d). Specifically, highly ramified (Figure 1c), suggesting that reactive microglial cells upregu-
Iba1-immunoreactive (ir) cells, evenly distributed in the Ctrl lated NTPDase1/CD39 after the exposure to TMT.
hippocampal tissue (Figure 1c), were gradually transformed eN/CD73 activity and localization in response to TMT
to rod Iba1-ir cells in synaptic layers of CA1 and the hilar/ were determined using AMP-based enzyme histochemistry
pCA3 at 4 dpi (data not shown). Besides rod shape, a range (Figure 2c) and eN/CD73-directed immunocytochemistry
of other reactive Iba1-ir morphotypes was observed, from (Figure 2d). In intact hippocampal tissue, diffuse histochemi-
hyperramified to bushy/amoeboid. At 7 dpi, rod Iba1-ir cal reaction and eN/CD73-ir were observed in synaptic layers,
Dragić et al. 7

Figure 1. Spatiotemporal pattern of hippocampal neurodegeneration and gliosis after TMT exposure (a) thionine staining of coronal
sections obtained from control animals and at 7 and 21 dpi. Arrowheads indicated injured neuronal cell layers in the hippocampus. Scale bar
= 500 μm. (b) Immunohistochemical staining of GFAP in control animals and at 7 and 21 dpi. Scale bar = 500 μm. (c) Immunohistochemical
staining of Iba1 in the whole hippocampal area and corresponding enlarged CA1 and mCA3 at 7 and 21 dpi. Scale bar = 500 μm (under 5×
magnification), and 100 μm (under 20× magnification). (d) Representative images of different Iba1-ir morphological phenotypes are observed
in control and after TMT exposure.
Note. dpi = days post intoxication; GFAP = glial fibrillary acidic protein; ir = immunoreactive; mCA3 = medial CA3; TMT = trimethyltin.

while neuronal cell layers remained unstained, as were shown Iba1-ir at amoeboid cells infiltrated within neuronal cell
previously (Dragic et al., 2019a; Grkovic et al., 2019b). From layers, while colocalization with GFAP-ir was not observed.
7 dpi and afterward, products of AMPase activity were accu- The colocalization of main microglial ectonucleotidase
mulated in the neuronal strata, infiltrating within neuronal cell NTPDase1/CD39, and eN/CD73 was demonstrated by
layers (Figure 2c). eN/CD73-ir completely reflected patterns double-IF labeling, which showed colocalization of
observed by AMPase, depicted individual round-shaped ele- NTPDase1/CD39 and eN/CD73 at amoeboid cells, while
ments that covered neuronal layers and were most noticeable ramified and rod NTPDase1/CD39-ir cells within synaptic
at the late stage of TMT-induced neurodegeneration (21 dpi, layers did not show eN/CD73-ir (Figure 3b). The degree of
Figure 2d). Cellular localization of eN/CD73-ir was deter- colocalization was estimated by the Pearson correlation coef-
mined by triple IF directed to GFAP, Iba1, and eN/CD73 ficient (PCC) (Figure 3c). The raising PCC values indicated
(Figure 3a). At 7 and 21 dpi, eN/CD73-ir overlapped with increase in colocalization of Iba1/eN/CD73 (p < .0001) and
8 ASN Neuro

Figure 2. Expression and activity of NTPDase1/CD39 and eN/CD73 in the hippocampal region after TMT exposure (a) RT-qPCR analysis
of genes encoding NTPDase1/CD39 and eN/CD73 in the Ctrl hippocampal tissue, 7 and 21 dpi, respectively. Bars represent mean mRNA
expression of target gene relative to CycA ± SD. Significance shown inside the graphs: *p < .05 or less compared to age-match Ctrl. In the
presence of ATP or ADP (b) and AMP (c) as substrate, enzyme histochemistry labeled cells and structures correspond to ectonucleotidase
activities in the hippocampal region of Ctrl, 7 and 21 dpi. Microglial cells were clearly labeled by ATP and ADP enzyme histochemistry. High
magnifications of microglial morphotypes observed by ADPase enzyme histochemistry were inserted. (d) eN/CD73-ir in the hippocampal
region of Ctrl section, 7 and 21 dpi. Rectangles show eN/CD73-ir areas—CA1, hil/pCA3 and mCA3 captured under higher magnification.
eN/CD73 depicted individual round-shaped elements in the neuronal layers and were most noticeable at 21 dpi. Scale bar = 500 μm (under
5× magnification), and 50 μm (under 40× magnification).
Note. ADP = adenosine diphosphate; AMP = adenosine monophosphate; ATP = adenosine triphosphate; Ctrl = control; CycA = cyclophilin
A; dpi = days post intoxication; eN/CD73 = ecto-5′ nucleotidase; hil/pCA3 = hilar/proximal CA3; ir = immunoreactive; mCA3 = medial CA3;
mRNA = messenger RNA; NTPDase1/CD39 = ectonucleoside triphosphate diphosphohydrolase 1; RT-qPCR = quantitative reverse
transcriptase-polymerase chain reaction; SD = standard deviation; TMT = trimethyltin.

NTPDase1/CD39-eN/CD73 (p < .0001) signals at both time Iba1+ cells, and the colocalization with eN/CD73 at amoeboid
points after TMT exposure, whereas negative PCC values Iba1+ cells after TMT exposure (Figure 3c).
for GFAP-ir and eN/CD73-ir (p = .32) corroborated the lack Since the role of extracellular ATP is closely related to its
of astrocytic expression of eN/CD73 after TMT. The results breakdown products, changes in mRNA expression of ATP/
pointed to the marked induction of NTPDase1/CD39 by ADP-sensitive P2 and adenosine P1 receptors in the
Dragić et al. 9

Figure 3. Identification of cells that upregulate eN/CD73 in the hippocampal region after TMT exposure (a) triple IF labeling directed to
eN/CD73 (red), astrocyte marker GFAP (blue), and microglial marker Iba1 (green) in the Ctrl, 7 and 21 dpi hippocampi. Overlaid images
(merge) reveal the overlapping signal corresponding to Iba1-ir and eN/CD73-ir at 7 and 21 dpi. (b) Double-IF labeling directed to NTPDase1/
CD39 (red) and eN/CD73 (green), showing the overlapping signals (merge) at 7 and 21 dpi. Scale bar = 50 μm. (c) PCC indicates the level of
signal overlap between Iba1-ir and eN/CD73-ir, eN/CD73-ir and GFAP-ir and NTPDase1/CD39-ir and eN/CD73-ir. Bars show mean PCC ±
SEM, from 3 ROI selected from 5 sections. Significance shown inside the graphs: *p < .05 or less compared to age-match Ctrl.
Note. Ctrl = control; dpi = days post intoxication; eN/CD73 = ecto-5′ nucleotidase; ir = immunoreactive; NTPDase1/CD39 = ecto-
nucleoside triphosphate diphosphohydrolase 1; GFAP = glial fibrillary acidic protein; IF = immunofluorescence; PCC = Pearson correlation
coefficient; SEM = standard error of the mean; ROI = region of interest; TMT = trimethyltin.
10 ASN Neuro

hippocampus during TMT-induced neurodegeneration were inflammatory markers. Neither of the tested proinflammatory
explored (Figure 4). Regarding ATP/ADP-sensitive P2 recep- cytokines (IL-1β, TNF-α, and IL-10) and C3 (data not shown)
tors mainly expressed by microglia (Illes et al., 2020), a signifi- nor polarization marker iNOS (Figure 6) was found in associ-
cant increase in the relative abundance of P2X4R-, P2Y2R-, ation with Iba1-ir. However, Iba1-ir cells colocalized with
and P2Y6R-mRNA levels were observed, at both 7 dpi Arg1-ir and phagocytic marker CD68-ir at 7 and 21 dpi
(p < .0001, p < .0001, p < .0001, respectively) and 21 dpi (Figure 6). A signal cooccurrence was observed at rod and
(p < .001, p < 0.0001, p < .001, respectively) when compared amoeboid cells at 7 and 21 dpi, while only amoeboid Iba1+
to age-matched Ctrls (Figure 4). The P2Y12R-mRNA level of cells were abundantly labeled with eN/CD73 (Figure 6).
the specific microglial receptor (Illes et al., 2020) was robustly The induction of the chemotaxis microglial marker P2Y12R
increased at 7 dpi (p < .0001) while a slight increase was was also observed at Iba1-ir cells at 7 dpi (Figure 6).
observed at 21 dpi (p < .05) (Figure 4). P2X7R- and Although a slight increase in the relative gene expression of
P2Y1R-mRNA levels were significantly increased at both 7- P2Y12R was observed, Iba1+ cells of amoeboid morphology
(p < .001 and p < .05, respectively) and 21 dpi (p < .01 and p did not colocalize with P2Y12R+ at 21 dpi (Figure 6). It is
< .001, respectively), when compared to age-match Ctrl. important to emphasize that ramified morphology of Iba1+
Furthermore, analysis of adenosine P1 receptors showed an cells (Figure 6) corresponds to Ctrl microglia as well as to
increase in A3R-mRNA levels at both 7 and 21 dpi when com- Iba1+ cells with the same morphology in the hippocampal
pared to age-match Ctrl (p < .001 and p < .01, respectively), areas distant from the site of neurodegeneration at both 7
together with induction of A1R-mRNA relative abundances and 21 dpi. Moreover, P2X7-ir clearly labeled neurons in
at 21 dpi (p < .01, Figure 4). There are no changes in Ctrl hippocampi as well as at 7 dpi (Figure 6), while
A2BR-mRNA relative abundances at both 7 and 21 dpi. P2X7-ir signal clearly overlapped with amoeboid microglia
Relative expressions of target genes for all tested time points at 21 dpi. On the other hand, colocalization of P2X7R with
are shown in Supplemental Table 1. GFAP-ir astrocytes could not be observed in Ctrls and inves-
tigated time points.
The lack of expression of proinflammatory cytokines and
The Inflammatory Status of the Hippocampal Tissue markers by Iba1-ir microglial cells, and clearly labeled
After TMT Exposure iNOS+ and C3+ cells around Iba1+ cells, prompted us to
explore their astroglial expression (Figure 7). Except for neu-
It is known that activated glial cells develop functional pheno- ronal TNF-α-ir at the site of neurodegeneration at 7 dpi, the
types, which may be roughly categorized as proinflammatory signals that correspond to IL-1β, TNF-α, and IL-10 almost
or antiinflammatory. Therefore, we first assessed the inflamma- completely overlapped with GFAP-ir at 7 dpi and/or 21 dpi
tory status of the hippocampal tissue at the early (7 dpi) and the (Figure 7). At 7 dpi, iNOS- and C3-ir were also observed at
late (21 dpi) stage of TMT-induced neurodegeneration by deter- neurons, while almost all GFAP-ir cells at the injured area
mining the expression of several inflammatory markers. As expressed iNOS, nuclear factor-kB (NF-kB), and C3, suggest-
shown in Figure 5, only tumor necrosis factor-α ing that astrocytes were the major source of the inflammatory
(TNF-α)-mRNA level was significantly increased at 7 dpi factors at the late stage of TMT-induced neurodegeneration.
when compared to Ctrl (p < 0.0001), while interleukin The fluorescence intensity of all investigated inflammatory
(IL)-1β-, IL-6-, IL-10-mRNA relative abundances were signifi- markers was significantly increased at both 7 and 21 dpi
cantly increased at 21 dpi (p < .01, p < .01, and p < .001, respec- (Figure 7).
tively, Figure 5). We also examined the main markers of two Since astrocytic P2Y1R is involved in the regulation of
extreme polarization states of microglia/macrophages (inducible several cytokines/chemokines expression (e.g., IL-6, and
nitric oxide synthase [iNOS] and Arg1), as well as C3 and TNF-α) (Kuboyama et al., 2011), and A2AR upregulation
S100a10 as markers that are often used to discriminate in activated glial cells facilitates the release of cytokines
between functional states of astrocytes. iNOS-, C3- and (Paiva et al., 2019), we explore their localization. In addi-
S100a10-mRNA levels were significantly increased at both 7- tion, prolonged adenosine A1R signaling and its cross-talk
(p < .001, p < .0001, p < .001, respectively) and 21 dpi (p < .01, with A2AR might enhance A2AR-mediated neurotoxicity
p < .0001, p < .05, respectively) when compared to age-match in neurodegenerative disorders (Stockwell et al., 2017).
Ctrl (Figure 5). Arg1-mRNA level was decreased at 7 dpi (p < Thus, massive induction of P2Y1R and A2AR was found
.0001), while no changes were detected at 21 dpi when compared on GFAP-ir and C3-ir astrocytes at 7 and 21 dpi, while
to age-match Ctrl (Figure 5). Relative expressions of target genes A1R shifted from neurons to GFAP-ir astrocytes at 7 dpi
for all tested time points are shown in Supplementary Table 1. and fully colocalize with GFAP-ir at 21 dpi at the sites
of neurodegeneration (mCA3 or CA1) (Figure 8). Neither
one of the investigated receptors was not observed at
Functional State of Reactive Microglia and Astrocytes Iba1+ cells, suggesting the involvement of the purinorecep-
Next, we sought to determine the cellular source of inflamma- tors in the proinflammatory astrocyte phenotype after TMT
tion and performed colocalization of Iba1 or GFAP against intoxication.
Dragić et al. 11

Figure 4. Purinoceptors gene expression in the hippocampal region after TMT exposure The abundances of transcripts coding for P2X4,
P2X7, P2Y1R, P2Y2R, P2Y6R, P2Y12R, A1R, A2AR, A2BR, and A3R were assessed by RT-qPCR at 7 and 21 dpi. Bars represent mean mRNA
expression of target gene relative to CycA ± SD. Significance shown inside the graphs: *p < .05 or less compared to age-match Ctrl.
Note. Ctrl = control; CycA = cyclophilin A; SD = standard deviation; RT-qPCR = quantitative reverse transcriptase-polymerase chain
reaction; dpi = days post intoxication; mRNA = messenger RNA.

Discussion (Tam & Ma, 2014). We also observed that injured neuronal
cell layers of the hippocampal CA areas became sequentially
The results of the present study corroborate the existing data
infiltrated with Iba1+ cells of amoeboid shape, particularly at
on the spatiotemporal pattern of neurodegeneration and
the late stage of neurodegeneration induced by TMT.
gliosis in the rat TMT model (Corvino et al., 2013, 2015;
As a marker of microglia (Almolda et al., 2013; Braun
Haga et al., 2002; Latini et al., 2010; Little et al., 2012;
et al., 2000), NTPDase1/CD39 activity and expression were
Trabucco et al., 2009). As described and analyzed previously
markedly upregulated in all Iba1-ir cells after TMT intoxica-
(Dragic et al., 2019b), reactive astrocytes (from day 2
post-TMT) were polarized toward the jeopardized regions, tion, irrespective of their shape and position. On the other
enclosing it and probably creating a protective glial barrier, hand, as the final and the rate-limiting enzyme in the extracel-
keeping other regions from damage at the early stage of lular degradation of ATP, eN/CD73 showed a selective switch
TMT-induced neurotoxicity (Dragic et al., 2019b). from neuropil to amoeboid Iba1-ir cells, implicating that the
Microglial activation induced by TMT slightly lagged differential induction might be an adaption to specific hippo-
behind astrocyte reactivation, as observed earlier (Haga campal microenvironment, that is, site of injury or specific
et al., 2002), and is manifested as a robust increase in the function. The transition between functional states of reactive
number of Iba1+ cells due to migration or proliferation of res- microglia is accompanied by the morphological transforma-
ident microglia (Little et al., 2002). However, we observed tion of the cells, and among the critical factors that trigger
that synaptic layers in the affected sectors became largely the transition are ATP, adenosine, vitamin E, IL-34, and che-
populated with rod Iba1+ cells, occasionally found in a train mokine fractalkine (Boche et al., 2013; Wollmer et al., 2001).
formation at the early stage of neurodegeneration. Rod micro- Furthermore, NTPDase1/CD39 and eN/CD73 upregulation
glia are usually found at the early stages of neurodegenerative may represent a defense mechanism against excess levels of
disorders in association with undamaged neurons and axons, extracellular ATP originating from damaged cells (Braun
and not in aggregation with other glial cells (Au & Ma, 2017; et al., 2000; Burnstock, 2017). Thus, enhanced activity of
Zabel & Kirsch, 2013), which could be an indicator of their NTPDase1/CD39 may contribute to the prevention of recep-
protective and reparative role (Boche et al., 2013). Rod cells tor desensitization on prolonged exposure to elevated ATP
may provide new cells and transform into amoeboid microglia and prevent activated microglia from overstimulation by
12 ASN Neuro

Figure 5. Proinflammatory status of the rat hippocampal region after TMT exposure The abundance of transcripts coding IL-1β, TNF-α,
IL-6, IL-10, C3, S100a10, iNOS, and Arg1. Bars represent mean mRNA expression of target gene relative to CycA ± SD. Significance shown
inside the graphs: *p < .05 or less compared to age-match Ctrl.
Note. Arg1 = arginase-1; CycA = cyclophilin A; IL-10 = interleukin-10; IL-1β = interleukin-1β; iNOS = inducible nitric oxide synthase; mRNA
= messenger RNA; TMT = trimethyltin; TNF-α = tumor necrosis factor-α; SD = standard deviation.

ATP. The parallel eN/CD73 activity on amoeboid Iba1+ cells 2009; Illes et al., 2020). Furthermore, NTPDase1/CD39 and
probably facilitates the formation of adenosine that exerts eN/CD73 not only catabolize extracellular ATP and provide
neuro- and immunomodulatory actions (Di Virgilio et al., adenosine but also function as clusters of differentiation and

Figure 6. Assessment of the functional state of reactive microglia after TMT exposure. Ramified morphology of Iba1+cells corresponds to
control microglia but also to ramified Iba1+ cells in the hippocampal areas distant from the site of neurodegeneration at both 7 and 21 dpi.
Double immunofluorescent staining of Iba1 and iNOS, Arg1, CD68, P2Y12 receptor (R), and eN/CD73, and triple immunofluorescent
staining of Iba1, GFAP and P2X7R in the injured area 7 and 21 dpi, reveal Iba1-ir morphotypes that expressed Arg1-, CD68-, P2Y12-, P2X7-
as well as eN-ir. Scale bar = 50 μm.
Note. Arg1 = arginase-1; dpi = days post intoxication; eN/CD73 = ecto-5′ nucleotidase; GFAP = glial fibrillary acidic protein; iNOS =
inducible nitric oxide synthase; iNOS = inducible nitric oxide synthase; TMT = trimethyltin.
Dragić et al. 13

Figure 7. Assessment of the functional state of reactive astrocytes after TMT exposure. Double immunofluorescent staining of GFAP and
IL-1β, TNF-α, IL-10, C3, iNOS and NF-kB and corresponding integrated fluorescence density expressed as AUs ± SEM in the injured CA
area at 7 and 21 dpi. Significance shown inside the graphs: *p < .05 or less compared to age-match Ctrl.
Note. AU = arbitrary unit; Ctrl = control; dpi = days post intoxication; GFAP = glial fibrillary acidic protein; IL-10 = interleukin-10; IL-1β =
interleukin-1β; iNOS = inducible nitric oxide synthase; NF-kB = nuclear factor-kB; SEM = standard error of the mean; TMT = trimethyltin;
TNF-α = tumor necrosis factor α.

cell adhesion molecules, which regulate the adhesion and glial 2020). Adenosine also affects extension and chemotaxis to
cell migration through specific interactions with extracellular the site of active neurodegeneration via P2Y12R/A3R coacti-
matrix components (Koizumi et al., 2007). vation (Haynes et al., 2006; Ohsawa et al., 2012). The
Microglial cell migration and chemotaxis depend on puri- ADP-driven process extension was reversed to process retrac-
nergic signaling via P2 receptors (Illes et al., 2020; Koizumi tion during proinflammatory condition coincident with
et al., 2007), which also triggers their shift to amoeboid phe- P2Y12R protein downregulation (Orr et al., 2009), which we
notype (Illes et al., 2020). Thus, we found an increase in rel- observed at the late stage of TMT-induced neurodegeneration.
ative gene expression of P2Y12R specifically at the early stage Additionally, P2Y6R stimulation blocks ATP-dependent
(7 dpi) of TMT-induced neurodegeneration. This receptor is migration of microglia, most likely by shifting its migratory
activated by extracellular ATP released from damaged cells phenotype to an amoeboid/phagocytic one (Bernier et al.,
that trigger microglial processes extension and migration to 2013; Koizumi et al., 2007), and which upregulation persist
the site of injury (Illes et al., 2020). Further, we found an at the late stage (21 dpi) of neurodegeneration. The mRNA
increase in P2X4 relative gene expression that may contribute levels of P2X7R, the ATP-sensitive receptor predominantly
to both migratory as well as secretory properties of microglia, localized on microglial cells in the brain (Illes et al., 2020),
and interacts with the P2Y12R in the regulation of chemotaxis were also increased at both the early and the late stage of
(Illes et al., 2020). At this stage, an increase of P2Y6-mRNA neurodegeneration.
level was observed, a receptor upregulated when neurons Concerning the polarization state of microglia, our data
become damaged and send diffusible uridine showed that Iba1-ir cells coexpressed specific marker
5′ -diphosphate (UDP) signals to microglia (Illes et al., Arg1, and did not colocalize with proinflammatory
14 ASN Neuro

Figure 8. Association of P2Y1 and adenosine receptors with GFAP+ astrocytes in the hippocampus after TMT exposure. Double IF reveals
that GFAP-ir cells colocalized with P2Y1R in the injured hippocampal area at 7 and 21 dpi. Representative micrographs of triple IF staining of
A1R and markers of glial cells (Iba1 and GFAP) reveal neuronal A1R staining in the Ctrl, colocalization with GFAP+ cells at 7 dpi, and
complete overlap of GFAP- and A1R-ir at 21 dpi in the injured hippocampal area, without colocalization with Iba1-ir cells. Representative
triple staining micrographs with C3, GFAP and A2AR reveal colocalization of all three signals in the injured hippocampal area at 7 and 21 dpi.
Scale bar = 50 μm.
Note. GFAP = glial fibrillary acidic protein; TMT = trimethyltin; ir = immunoreactive; Ctrl = control; dpi = days post intoxication; IF =
immunofluorescence.

markers iNOS, NF-kB, C3, and investigated proinflamma- macrophages/microglia to phagocytic state (Xu et al.,
tory cytokines, indicating that reactive microglial cells at 2018). In addition, P2X7-ir, greatly localized on neurons
the site of TMT-induced neurodegeneration were not a at the early stage of neurodegeneration, colocalized with
source of inflammatory molecules. The upregulation of amoeboid Iba1-ir cells at the late stage of neurodegenera-
NTPDase1/CD39 by reactive microglial cells was previ- tion. It is well known that P2X7R expression at amoeboid
ously demonstrated in experimental autoimmune encephalo- microglial cells modulates clearance of extracellular debris
myelitis, where the induction of NTPDase1/CD39 tended to thus affecting their phagocytic role (Campagno &
be associated with Arg1-ir and phagocytic marker CD68-ir Mitchell, 2021). Given that CD39/CD73 tandem effectuate
microglial cells (Jakovljevic et al., 2019). Upregulation and the whole cascade of extracellular ATP degradation, they
specific localization of eN/CD73 on amoeboid Iba1+ cells might be taken as an “immunological switch” that leads to
that were also associated with Arg1- and CD68-ir at the the antiinflammatory cell state (Antonioli et al., 2013),
late stage of neurodegeneration induced by TMT support however, additional experiments are required to test this
results that such eN/CD73 expression might promote hypothesis.
Dragić et al. 15

According to the literature data (Little et al., 2002, 2012) et al., 2020). A high amount of ATP released after TMT intox-
early neurodegenerative response to TMT is not accompanied ication would be degraded by Iba1+/CD39+/CD73+ cells thus
by increased gene expression of most proinflammatory cyto- producing high levels of adenosine around the sites of injury.
kines. We found moderate induction of TNF-α in neurons at Adenosine in such a microenvironment may activate astro-
the early stage of TMT-induced neurodegeneration, while cytic A1R and A2AR supporting their proinflammatory pheno-
almost all GFAP+ cells around damaged areas (CA1 and type (Nedeljkovic, 2019; Paiva et al., 2019; Popoli &
mCA3) were the source of IL-1β, TNF-α, and IL-10 particu- Pepponi, 2012). Additional experiments are necessary to
larly at the late stage of TMT-induced neurodegeneration, fully elucidate the role of adenosine in such a complex path-
supporting in vitro results (Dragic et al., 2021) and studies ological environment. Induction of P2Y1R on reactive astro-
that showed upregulation of other proinflammatory mediators cytes further confirms their detrimental phenotype after
at the later stages of TMT-induced neurodegeneration TMT-induced neurotoxicity, since this receptor is also
(Lattanzi et al., 2013; Liu et al., 2005; Morita et al., 2008). involved in the regulation of several cytokines/chemokines
Furthermore, P2X7R is considered as a major driver of inflam- expression (Kuboyama et al., 2011), and causes astrocytic
mation (Di Virgilio et al., 2017; Erb et al., 2019; Franke et al., hyperactivity and dysfunction in an animal model of neurode-
2012; Peterson et al., 2010), and we observed increased neu- generation (Delekate et al., 2014).
ronal staining with P2X7R at both the early and the late stage In summary, identification of expressional timeline of
of TMT-induced neurodegeneration. A wave of neurodegen- selected purinoreceptors and ectonucleotidases provides a
eration induced by TMT might provide conditions for a sus- framework for the reconstruction of their involvement in the
tained ATP release and prolonged P2X7R activation with initiation and progression of neurodegenerative events after
the resulting postponed induction of IL-1β, together with TMT intoxication. This study suggests that proinflammatory
TNF-α, and IL-6. Reactive astrocytes might initiate upregula- astrocytes phenotype is possibly developed as a response to
tion of P2Y2R, as we observed after TMT intoxication, TMT intoxication. Increased availability of ligands such as
leading to a proinflammatory response (Peterson et al., 2010). ATP and adenosine coupled with a distinct set of activated
We have also observed that reactive astrocytes coex- glial purinergic repertoire (P2X7, A2AR, P2Y1, and A1R)
pressed iNOS, NF-kB, C3, and found increased expression and loss of homeostatic glial and neuronal purinergic path-
of S100a10-mRNA. Taken together with the expression of ways (P2Y12 and A1R) may shift purinergic signaling
main proinflammatory markers, it could be concluded that balance toward excitotoxicity and inflammation, thus ulti-
TMT-induced reactive astrogliosis exerts a complex molecu- mately favoring progression of pathological events.
lar signature with the predominantly inflammatory phenotype Targeting the upstream nucleotide metabolic pathway that
(Escartin et al., 2021), mainly located around the sites of controls adenosine production to modulate neural-immune
ongoing neurodegeneration. These proinflammatory astro- interactions and neurodegeneration-related machinery repre-
cytes at the injured area also upregulate A1R and A2AR recep- sents a promising therapeutic strategy for intervening in
tors. In the hippocampus, adenosine exerts inhibitory function disease progression.
under physiological conditions due to the high expression of
neuronal A1R, modulating important processes such as learn- Acknowledgments
ing and memory (Costenla et al., 2010; Stockwell et al., The research was funded by the Ministry of Education, Science, and
2017). On the other hand, under pathological conditions, an Technological Development of the Republic of Serbia Nos. 451-03-
increase of both mRNA and protein levels and aberrant sig- 1/2021-16/14 –0902102 and 451-03-68/2020-14/200178. The
naling via hippocampal A2AR have been demonstrated to con- authors thank Professor Jean Sevigny from the Faculté de
tribute to active neuroinflammation and cognitive deficits (Hu Médecine, Université Laval, Quebec City, QC, Canada for a kind
et al., 2016), both of which are seen in TMT-induced neuro- gift of rabbit anti-rat NTPDase1/CD39 (mN1-2C) and eN/CD73
degeneration (Geloso et al., 2011). Adenosine signaling via (rNu-9L) antibodies used in this study. We would also like to
neuronal A1R supports survival, exerts neuroprotective thank our Dr. Ivana Bjelobaba, Institute for Biological Research
“Siniša Stanković ,” National Institute of the Republic of Serbia,
effects, and has anticonvulsive properties (Glass et al.,
University of Belgrade, Belgrade, Serbia, for providing us with
1996). Thus, the shift of A1R immunoreactivity from qPCR primers used in this study.
neurons to astrocytes could render neurons vulnerable to sec-
ondary effects of TMT, such as seizures (Trabucco et al., Author Contributions
2009), while prolonged adenosine A1R signaling and its
All authors meet the International Committee of Medical Journal
cross-talk with A2AR might enhance A2AR-mediated neuro-
Editors (ICMJE) criteria for authorship for this article. I.G. conceived
toxicity in neurodegenerative disorders (Stockwell et al., and directed the projects. M.D. and I.G. designed experiments and
2017). Taken together with a concomitant increase of astro- performed all histology, analyzed the data, and wrote the manuscript.
cytic A2AR, these results could be put in perspective of poten- N.M. performed qPCR experiments. M.A. was involved in confocal
tial formation of A1R–A2AR heteromers, which are shown to microscopy and image acquisition. N.N. was involved in data inter-
contribute to dysregulation of glutamate homeostasis and pretation and wrote the manuscript. All authors had full access to all
favor excitotoxicity (Borroto-Escuela et al., 2018; Hou of the data in this study and take complete responsibility for the
16 ASN Neuro

integrity of the data and accuracy of the data analysis. All authors neuroinflammation. Frontiers in Neuroscience, 12, 43. https://
read, revised, and approved the final manuscript. doi.org/10.3389/fnins.2018.00043
Braun, N., Sevigny, J., Robson, S. C., Enjyoji, K., Guckelberger, O.,
Hammer, K., Di Virgilio, F., & Zimmermann, H. (2000).
Data Availability Statement
Assignment of ecto-nucleoside triphosphate diphosphohydrolase-
The data that support the findings of this study are available from the 1/cd39 expression to microglia and vasculature of the brain.
corresponding author upon reasonable request. European Journal of Neuroscience, 12, 4357–4366.
Burnstock, G. (2017). Purinergic signalling: Therapeutic develop-
Ethics Approval ments. Frontiers in Pharmacology, 8, 661. https://doi.org/10.
3389/fphar.2017.00661
The Ethical Committee approved all animal procedures for the Use
Campagno, K. E., & Mitchell, C. H. (2021). The P2X7 receptor in
of Laboratory Animals of “VINČ A” Institute of Nuclear Sciences
microglial cells modulates the endolysosomal axis, autophagy,
—National Institute of Republic of Serbia, University of Belgrade,
and phagocytosis. Frontiers in Cellular Neuroscience, 15,
Belgrade, Serbia, and animals were treated following the European
645244. https://doi.org/10.3389/fncel.2021.645244
Community Council Directive of 86/609/ EEC for animal
Chvojkova, M., Kubova, H., & Vales, K. (2021). Effects of dizocil-
experiment.
pine, midazolam and their co-application on the trimethyltin
(TMT)-induced rat model of cognitive deficit. Brain Sciences,
Declaration of Conflicting Interests 11. https://doi.org/10.3390/brainsci11030400
The authors declared no potential conflicts of interest with respect to Corvino, V., Di Maria, V., Marchese, E., Lattanzi, W., Biamonte,
the research, authorship, and/or publication of this article. F., Michetti, F., & Geloso, M. C. (2015). Estrogen administra-
tion modulates hippocampal GABAergic subpopulations in the
hippocampus of trimethyltin-treated rats. Frontiers in Cellular
Funding Neuroscience, 9, 433. https://doi.org/10.3389/fncel.2015.00433
The authors disclosed receipt of the following financial support for Corvino, V., Marchese, E., Michetti, F., & Geloso, M. C. (2013).
the research, authorship, and/or publication of this article: This Neuroprotective strategies in hippocampal neurodegeneration
work was supported by the Ministarstvo Prosvete, Nauke i induced by the neurotoxicant trimethyltin. Neurochemical
Tehnološkog Razvoja (grant numbers 451-03-68/2020-14/200178 Research, 38, 240–253. https://doi.org/10.1007/s11064-012-0932-9
and 451-03-1/2021-16/14 –0902102). Costenla, A. R., Cunha, R. A. de Mendonca, A. (2010). Caffeine,
adenosine receptors, and synaptic plasticity. Journal of
ORCID iD Alzheimer’s Disease, 20(Suppl 1), S25–S34. https://doi.org/10.
3233/JAD-2010-091384
Ivana Grković https://orcid.org/0000-0003-4476-7871
Delekate, A., Fuchtemeier, M., Schumacher, T., Ulbrich, C., Foddis,
M., & Petzold, G.C. (2014). Metabotropic P2Y1 receptor signal-
Supplemental Material ling mediates astrocytic hyperactivity in vivo in an Alzheimer’s
Supplemental material for this article is available online. Disease mouse model. Nature Communications, 5, 5422.
https://doi.org/10.1038/ncomms6422
Di Virgilio, F., Ceruti, S., Bramanti, P., & Abbracchio, M.P (2009).
References Purinergic signalling in inflammation of the central nervous
Almolda, B., Gonzalez, B., & Castellano, B. (2013). Microglia system. Trends in Neurosciences, 32, 79–87. https://doi.org/10.
detection by enzymatic histochemistry. Methods in Molecular 1016/j.tins.2008.11.003
Biology, 1041, 243–259. https://doi.org/10.1007/978-1-62703- Di Virgilio, F., Dal Ben, D., Sarti, A. C., Giuliani, A.L., & Falzoni, S.
520-0_22 (2017). The P2X7 receptor in infection and inflammation.
Antonioli, L., Pacher, P., Vizi, E. S., & Haskó, G. (2013). CD39 and Immunity, 47, 15–31. https://doi.org/10.1016/j.immuni.2017.06.
CD73 in immunity and inflammation. Trends in Molecular 020
Medicine, 19, 355–367. https://doi.org/10.1016/j.molmed.2013. Dragic, M., Milicevic, K., Adzic, M., Stevanović , I., Ninković , M.,
03.005 Grković , I., Pavle Andjus, P., & Nedeljković , N. (2021).
Au, N. P. B., & Ma, C. H. E. (2017). Recent advances in the study of Trimethyltin increases intracellular Ca(2+) Via L-type voltage-
bipolar/rod-shaped microglia and their roles in neurodegenera- gated calcium channels and promotes inflammatory phenotype
tion. Frontiers in Aging Neuroscience, 9, 128. https://doi.org/ in rat astrocytes in vitro. Molecular Neurobiology. 58(4):1792-
10.3389/fnagi.2017.00128 1805 https://doi.org/10.1007/s12035-020-02273-x
Bernier, L. P., Ase, A. R., Boue-Grabot, E., & Séguéla, P. (2013). Dragic, M., Zaric, M., Mitrovic, N., Nedeljković , N., & Grković , I.
Inhibition of P2X4 function by P2Y6 UDP receptors in microglia. (2019a). Application of gray level Co-occurrence matrix analysis
Glia, 61, 2038–2049. https://doi.org/10.1002/glia.22574 as a new method for enzyme histochemistry quantification.
Boche, D., Perry, V. H., & Nicoll, J. A. (2013). Review: Activation Microscopy and Microanalysis, 25, 690–698. https://doi.org/10.
patterns of microglia and their identification in the human brain. 1017/S1431927618016306
Neuropathology and Applied Neurobiology, 39, 3–18. https://doi. Dragic, M., Zaric, M., Mitrovic, N., Nedeljković . N., & Grković , I.
org/10.1111/nan.12011 (2019b). Two distinct hippocampal astrocyte morphotypes
Borroto-Escuela, D. O., Hinz, S., Navarro, G., Rafael Franco, R., reveal subfield-different fate during neurodegeneration induced
Müller, C.E., & Fuxe, K. (2018). Understanding the role of aden- by trimethyltin intoxication. Neuroscience, 423, 38–54. https://
osine A2AR heteroreceptor complexes in neurodegeneration and doi.org/10.1016/j.neuroscience.2019.10.022
Dragić et al. 17

Dunn, K. W., Kamocka, M. M., & McDonald, J. H. (2011). A prac- contributes to neurodegeneration and cognitive impairments
tical guide to evaluating colocalization in biological microscopy. in a mouse model of synucleinopathy. Experimental
American Journal of Physiology-Cell Physiology, 300, C723– Neurology, 283, 213–223. https://doi.org/10.1016/j.expneurol.
C742. https://doi.org/10.1152/ajpcell.00462.2010 2016.05.040
Erb, L., Woods, L. T., Khalafalla, M. G., & Weisman, G. A. (2019). Illes, P., Rubini, P., Ulrich, H., Zhao, Y., & Tang, Y. (2020).
Purinergic signaling in Alzheimer’s disease. Brain Research Regulation of microglial functions by purinergic mechanisms in
Bulletin, 151, 25–37. https://doi.org/10.1016/j.brainresbull.2018. the healthy and diseased CNS. Cells, 9:1108. https://doi.org/10.
10.014 3390/cells9051108
Escartin, C., Galea, E. Lakatos, A., O’Callaghan, J. P., Petzold, G. Jakovljevic, M., Lavrnja, I., Bozic, I., Milosevic, A., Bjelobaba, I.,
C., Serrano-Pozo, A., Steinhäuser, C., Volterra, A., Savic, D., Sévigny, J., Pekovic, S., Nedeljkovic, N., & Laketa,
Carmignoto, G., Agarwal, A., Allen, N. J., Araque, A., D. (2019). Induction of NTPDase1/CD39 by reactive microglia
Barbeito, L., Barzilai A., Bergles D. E., Bonvento G., Butt A. and macrophages is associated with the functional state during
M., Chen W. T., Cohen-Salmon M., . . . Verkhratsky A. EAE. Frontiers in Neuroscience, 13, 410. https://doi.org/10.
(2021). Reactive astrocyte nomenclature, definitions, and future 3389/fnins.2019.00410
directions. Nature Neuroscience, 24, 312–325. https://doi.org/ Koizumi, S., Shigemoto-Mogami, Y., Nasu-Tada, K., Shinozaki, Y.,
10.1038/s41593-020-00783-4 Ohsawa, K., Tsuda, M., Joshi, B. V., Jacobson, K. A., Kohsaka,
Ferraz da Silva, I., Freitas-Lima, L. C., Graceli, J. B., & Rodrigues, S., & Inoue, K. (2007). UDP Acting at P2Y6 receptors is a mediator
L. C. M. (2017). Organotins in neuronal damage, brain function, of microglial phagocytosis. Nature, 446, 1091–1095. https://doi.
and behavior: A short review. Frontiers in Endocrinology org/10.1038/nature05704
(Lausanne), 8, 366. https://doi.org/10.3389/fendo.2017.00366 Kotake, Y. (2012). Molecular mechanisms of environmental
Franke, H., Verkhratsky, A., Burnstock, G., & Illes, P. (2012). organotin toxicity in mammals. Biological & Pharmaceutical
Pathophysiology of astroglial purinergic signalling. Purinergic Bulletin, 35, 1876–1880. https://doi.org/10.1248/bpb.b212017
Signalling, 8, 629–657. https://doi.org/10.1007/s11302-012- Kuboyama, K., Harada, H., Tozaki-Saitoh, H., Tsuda, M., Ushijima,
9300-0 K., & Inoue, K. (2011). Astrocytic P2Y(1) receptor is involved in
Geloso, M. C., Corvino, V., & Michetti, F. (2011). Trimethyltin- the regulation of cytokine/chemokine transcription and cerebral
induced hippocampal degeneration as a tool to investigate neurode- damage in a rat model of cerebral ischemia. Journal of
generative processes. Neurochemistry International, 58, 729–738. Cerebral Blood Flow & Metabolism, 31, 1930–1941. https://
https://doi.org/10.1016/j.neuint.2011.03.009 doi.org/10.1038/jcbfm.2011.49
Glass, M., Faull, R. L., Bullock, J. Y., Jansen, K., Mee, E. W., Walker, Latini, L., Geloso, M. C., Corvino, V., Giannetti, S., Florenzano, F.,
E. B., Synek, B. J., & Dragunow, M. (1996). Loss of A1 adenosine Viscomi, M. T., Michetti, F., & Molinari, M. (2010). Trimethyltin
receptors in human temporal lobe epilepsy. Brain Research, 710, intoxication up-regulates nitric oxide synthase in neurons and
56–68. https://doi.org/10.1016/0006-8993(95)01313-X purinergic ionotropic receptor 2 in astrocytes in the hippocampus.
Grkovic, I., Drakulic, D., Martinovic, J., & Mitrovic, N. (2019a). Journal of Neuroscience Research, 88, 500–509.
Role of ectonucleotidases in synapse formation during brain Lattanzi, W., Corvino, V., Di Maria, V., Michetti, F., & Geloso, M.
development: Physiological and pathological implications. C. (2013). Gene expression profiling as a tool to investigate the
Current Neuropharmacology, 17, 84–98. https://doi.org/10. molecular machinery activated during hippocampal neurodegen-
2174/1570159X15666170518151541 eration induced by trimethyltin (TMT) administration.
Grkovic, I., Mitrovic, N., Dragic, M., Adž ić , M., Drakulić , D., & International Journal of Molecular Sciences, 14, 16817–16835.
Nedeljković , N. (2019b). Spatial distribution and expression of https://doi.org/10.3390/ijms140816817
ectonucleotidases in Rat hippocampus after removal of ovaries Lee, S., Yang, M., Kim, J., Kang, S., Kim, J., Kim, J. C., Jung, C.,
and estradiol replacement. Molecular Neurobiology, 56, 1933– Shin, T., Kim, S. H., & Moon, C. (2016). Trimethyltin-induced
1945. https://doi.org/10.1007/s12035-018-1217-3 hippocampal neurodegeneration: A mechanism-based review.
Haga, S., Haga, C., Aizawa, T., & Ikeda, K. (2002). Neuronal degen- Brain Research Bulletin, 125, 187–199. https://doi.org/10.1016/
eration and glial cell-responses following trimethyltin intoxica- j.brainresbull.2016.07.010
tion in the rat. Acta Neuropathologica, 103, 575–582. https:// Liddelow, S. A.Barres, B. A. (2017). Reactive astrocytes:
doi.org/10.1007/s00401-001-0505-5 Production, function, and therapeutic potential. Immunity, 46,
Hasko, G., & Cronstein, B. (2013). Regulation of inflammation by 957–967. https://doi.org/10.1016/j.immuni.2017.06.006
adenosine. Frontiers in Immunology, 4, 85. https://doi.org/10. Little, A. R., Benkovic, S. A., Miller, D. B., & O’Callaghan, J.
3389/fimmu.2013.00085 P. (2002). Chemically induced neuronal damage and gliosis:
Haynes, S. E., Hollopeter, G., Yang, G., Kurpius, D., Dailey, M. E., Enhanced expression of the proinflammatory chemokine,
Gan, W. B., & Julius, D. (2006). The P2Y12 receptor regulates monocyte chemoattractant protein (MCP)-1, without a corre-
microglial activation by extracellular nucleotides. Nature sponding increase in proinflammatory cytokines(1).
Neuroscience, 9, 1512–1519. https://doi.org/10.1038/nn1805 Neuroscience, 115, 307–320. https://doi.org/10.1016/S0306-
Hou, X., Li, Y., Huang, Y., Zhao, H., & Gui, L. (2020). Adenosine 4522(02)00359-7
receptor A1–A2a heteromers regulate EAAT2 expression and Little, A. R., Miller, D. B., Li, S., Kashon, M. L., & O’Callaghan, J.
glutamate uptake via YY1-induced repression of PPARgamma P. (2012). Trimethyltin-induced neurotoxicity: Gene expression
transcription. PPAR Research, 2020, 2410264. https://doi.org/ pathway analysis, q-RT-PCR and immunoblotting reveal early
10.1155/2020/2410264 effects associated with hippocampal damage and gliosis.
Hu, Q., Ren, X., Liu, Y., Li, Z., Zhang, L., Chen, X., He, C., & Chen, Neurotoxicology and Teratology, 34, 72–82. https://doi.org/10.
J. F. (2016). Aberrant adenosine A2A receptor signaling 1016/j.ntt.2011.09.012
18 ASN Neuro

Liu, Y., Imai, H., Sadamatsu, M., Tsunashima, K., & Kato, N. of Neural Transmission (Vienna), 127, 987–998. https://doi.org/
(2005). Cytokines participate in neuronal death induced by trime- 10.1007/s00702-020-02210-1
thyltin in the rat hippocampus via type II glucocorticoid recep- Popoli, P., & Pepponi, R. (2012). Potential therapeutic relevance of
tors. Neuroscience Research, 51, 319–327. https://doi.org/10. adenosine A2B and A2A receptors in the central nervous system.
1016/j.neures.2004.12.005 Cns & Neurological Disorders Drug Targets, 11, 664–674.
Matyash, M., Zabiegalov, O., Wendt, S., Matyash, V., & https://doi.org/10.2174/187152712803581100
Kettenmann, H. (2017). The adenosine generating enzymes Robson, S. C., Sevigny, J.., & Zimmermann, H. (2006). The
CD39/CD73 control microglial processes ramification in the E-NTPDase family of ectonucleotidases: Structure function rela-
mouse brain. PLoS One, 12, e0175012. https://doi.org/10.1371/ tionships and pathophysiological significance. Purinergic
journal.pone.0175012 Signalling, 2, 409–430. https://doi.org/10.1007/s11302-006-9003-5
Mitrovic, N., Gusevac, I., Drakulic, D., Stanojlović , M., Zlatković , Sperlagh, B., & Illes, P. (2007). Purinergic modulation of microglial
J., Sévigny, J., Horvat, A., Nedeljković , N., & Grković , I. cell activation. Purinergic Signalling, 3, 117–127. https://doi.org/
(2016). Regional and sex-related differences in modulating 10.1007/s11302-006-9043-x
effects of female sex steroids on ecto-5′ -nucleotidase expression Stockwell, J., Jakova, E., & Cayabyab, F. S. (2017). Adenosine A1
in the rat cerebral cortex and hippocampus. General and and A2A receptors in the brain: Current research and their role in
Comparative Endocrinology, 235, 100–107. https://doi.org/10. neurodegeneration. Molecules, 22(4), 676. https://doi.org/10.
1016/j.ygcen.2016.06.018 3390/molecules22040676
Mitrovic, N., Zaric, M., Drakulic, D., Martinović , J., Sévigny, J., Tam, W. Y.Ma, C. H. (2014). Bipolar/rod-shaped microglia are pro-
Stanojlović , M., Nedeljković , N., & Grković , I. (2017). liferating microglia with distinct M1/M2 phenotypes. Scientific
17beta-estradiol-induced synaptic rearrangements are accompa- Reports, 4, 7279. https://doi.org/10.1038/srep07279
nied by altered ectonucleotidase activities in male rat hippocam- Trabucco, A., Di Pietro, P., Nori, S. L., Fulceri, F., Fumagalli, L.,
pal synaptosomes. Journal of Molecular Neuroscience, 61, 412– Paparelli, A., & Fornai, F. (2009). Methylated tin toxicity a reap-
422. https://doi.org/10.1007/s12031-016-0877-6 praisal using rodents models. Archives Italiennes de Biologie,
Morita, M., Imai, H., Liu, Y., Xu, X., Sadamatsu, M., Nakagami, R., 147, 141–153. PMID: 20162863.
Shirakawa, T., Nakano, K., Kita, Y., Yoshida, K., Tsunashima, Verkhratsky, A., Parpura, V., Pekna, M., Pekny, M., & Sofroniew,
K., & Kato, N. (2008). FK506-protective effects against trime- M. (2014). Glia in the pathogenesis of neurodegenerative dis-
thyltin neurotoxicity in rats: Hippocampal expression analyses eases. Biochemical Society Transactions, 42, 1291–1301.
reveal the involvement of periarterial osteopontin. https://doi.org/10.1042/BST20140107
Neuroscience, 153, 1135–1145. https://doi.org/10.1016/j. Wollmer, M. A., Lucius, R., Wilms, H., Held-Feindt, J., Sievers, J.,
neuroscience.2008.01.078 & Mentlein, R. (2001). ATP And adenosine induce ramification
Nedeljkovic, N. (2019). Complex regulation of ecto-5′ -nucleotidase/ of microglia in vitro. Journal of Neuroimmunology, 115, 19–
CD73 and A2AR-mediated adenosine signaling at neurovascular 27. https://doi.org/10.1016/S0165-5728(01)00257-0
unit: A link between acute and chronic neuroinflammation. Xu, S., Zhu, W., Shao, M., Zhang, F., Guo, J., Xu, H., Jiang, J., Ma,
Pharmacological Research, 144, 99–115. https://doi.org/10. X., Xia, X., Zhi, X., Zhou, P., & Lu, F. (2018).
1016/j.phrs.2019.04.007 Ecto-5′ -nucleotidase (CD73) attenuates inflammation after
Ohsawa, K., Sanagi, T., Nakamura, Y., Suzuki, E., Inoue, K., & spinal cord injury by promoting macrophages/microglia M2
Kohsaka, S. A. (2012). Adenosine A3 receptor is involved in polarization in mice. Journal of Neuroinflammation, 15, 155.
ADP-induced microglial process extension and migration. https://doi.org/10.1186/s12974-018-1183-8
Journal of Neurochemistry, 121, 217–227. https://doi.org/10. Ye, M., Han, B. H., Kim, J. S., Kim, K., & Shim, I. (2020).
1111/j.1471-4159.2012.07693.x Neuroprotective effect of bean phosphatidylserine on
Orr, A. G., Orr, A. L., Li, X. J., Gross, R. E., & Traynelis, S. F. (2009). TMT-induced memory deficits in a rat model. International
Adenosine A(2A) receptor mediates microglial process retraction. Journal of Molecular Sciences, 21(14), 4901. https://doi.org/
Nature Neuroscience, 12, 872–878. https://doi.org/10.1038/nn.2341 10.3390/ijms21144901
Paiva, I., Carvalho, K.Santos, P., Cellai, L., Pavlou, M. A. S., Jain, Yegambaram, M., Manivannan, B., Beach, T. G., & Halden, R. U.
G., Gnad, T., Pfeifer, A., Vieau, D., Fischer, A., Buée, L., (2015). Role of environmental contaminants in the etiology of
Outeiro, T. F., & Blum, D. (2019). A2a R-induced transcriptional Alzheimer’s disease: A review. Current Alzheimer Research, 12,
deregulation in astrocytes: An in vitro study. Glia, 67, 2329– 116–146. https://doi.org/10.2174/1567205012666150204121719
2342. https://doi.org/10.1002/glia.23688 Zabel, M. K., & Kirsch, W. M. (2013). From development to dys-
Peterson, T. S., Camden, J. M., Wang, Y., Seye, C. I., Wood, W. G. , function: Microglia and the complement cascade in CNS homeo-
Sun, G. Y., Erb, L., Petris, M. J., & Weisman, G. A. (2010). P2y2 stasis. Ageing Research Reviews, 12, 749–756. https://doi.org/10.
nucleotide receptor-mediated responses in brain cells. Molecular 1016/j.arr.2013.02.001
Neurobiology, 41, 356–366. https://doi.org/10.1007/s12035-010- Zimmermann, H., Zebisch, M., & Strater, N. (2012). Cellular func-
8115-7 tion and molecular structure of ecto-nucleotidases. Purinergic
Pompili, E., Fabrizi, C., Fumagalli, L., & Fornai, F. (2020). Signalling, 8, 437–502. https://doi.org/10.1007/s11302-012-
Autophagy in trimethyltin-induced neurodegeneration. Journal 9309-4