JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2002, p. 3814–3817 Vol. 40, No.

10
0095-1137/02/$04.00⫹0 DOI: 10.1128/JCM.40.10.3814–3817.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Direct Detection and Differentiation of Legionella spp. and Legionella

pneumophila in Clinical Specimens by Dual-Color Real-Time
PCR and Melting Curve Analysis
Udo Reischl,1* Hans-Jörg Linde,1 Norbert Lehn,1 Olfert Landt,2 Kevin Barratt,3
and Nele Wellinghausen4
Institute of Medical Microbiology and Hygiene, University of Regensburg, D-93053 Regensburg,1 TIB Molbiol GmbH,
Tempelhofer Weg 11-12, D-10829 Berlin,2 and Institute of Medical Microbiology and Hygiene, University of Ulm,
D-89081 Ulm,4 Germany, and Health Waikato Laboratory, Hamilton, New Zealand3
Received 6 September 2001/Returned for modification 28 May 2002/Accepted 23 July 2002

A dual-color LightCycler PCR assay targeting the 16S rDNA gene of Legionella spp. was established. By using
two pairs of hybridization probes, Legionella spp. and Legionella pneumophila could be detected and differen-
tiated simultaneously. With 26 culture-positive and 42 culture-negative respiratory specimens from patients
with atypical pneumonia, 100% sensitivity and specificity was observed for L. pneumophila.

Legionellae are ubiquitous in environmental water sources protocols have been reported that target specific regions within
and may cause sporadic as well as epidemic cases of atypical 16S ribosomal DNA (rDNA) (4, 7, 9, 17, 19), 5S rDNA (7), or
pneumonia after inhalation or aspiration of contaminated wa- the macrophage infectivity potentiator (mip) gene (1, 7, 11, 12,
ter droplets. Presently, 42 species with 64 serogroups are 14, 15, 18, 19).
known (2), many of which cause disease in humans (13, 16, 20). Here we have described the development of a sensitive and
Legionella pneumophila is the most common pathogenic spe- specific hybridization probe-based dual-color real-time PCR
cies, accounting for up to 90% of legionellosis cases (20). assay for the simultaneous detection and differentiation of
Mortality of patients with pneumonia may exceed 30% for Legionella spp. and L. pneumophila in clinical specimens. In
elderly and immunocompromised patients (3), and prognosis order to meet the requirements of true rapid diagnostics, the
of patients depends in part on rapid identification of the caus- LightCycler device (Roche Diagnostics, Mannheim, Germany)
ative agent (8). was used for rapid thermal cycling and dual-color monitoring
Diagnostic culture is considered the gold standard for the of specific PCR products. Amplification was based on a previ-
laboratory detection of Legionella infections, but legionellae ously published Legionella-specific primer pair (4, 9), flanking
are slow-growing and fastidious bacteria and successful culture a segment within the bacterial multicopy 16S rRNA gene. For

Downloaded from https://journals.asm.org/journal/jcm on 24 September 2022 by 180.244.160.137.

requires selective media and prolonged incubation periods. the detection of Legionella spp. a pair of LightCycler Red640-
Furthermore, diagnostic culture is often requested after initi- labeled hybridization probes (Leg-HP-1 and Leg-HP-2) was
ating antibiotic therapy, which lowers the recovery rate sub- selected complementary to a region conserved among all Le-
stantially. Direct fluorescent antibody assays (DFA) on respi- gionella spp. For the detection of L. pneumophila, a pair of
ratory secretions or urinary antigen detection tests can be LightCycler Red705-labeled hybridization probes (Lpn-HP-1
performed rapidly but have limitations. DFA has low sensitiv- and Lpn-HP-2) was selected complementary to an L. pneumo-
ity, and cross-reactions with other bacteria may result in false- phila-specific region within the amplicon. Sequence alignments
positive results. Urinary antigen testing has up to 85% sensi- of sensor hybridization probe Lpn-HP-1 revealed a perfect
tivity but detects only a limited range of pathogenic Legionella match to L. pneumophila 16S rDNA but at least two nucleotide
species (5, 10). mismatches between its sequence and 16S rDNA sequences of
Serological methods are also widely used in clinical labora- all other bacterial species. Oligonucleotide primers and fluo-
tories, but they are not helpful for rapid diagnosis of acute rescence-labeled hybridization probes were obtained from TIB
legionellosis, since seroconversion of the infected patients is Molbiol (Berlin, Germany). Nucleotide sequences and posi-
delayed (about 50% of patients develop specific antibodies tions are listed in Table 1.
more than 2 weeks after onset of clinical symptoms) or is even An initial evaluation of the PCR assay was performed with
absent in some cases (6). 68 bronchoalveolar lavage (BAL) specimens from patients
For these reasons, nucleic acid amplification techniques are with atypical pneumonia which tested positive (n ⫽ 26) or
attractive tools for detection of Legionella species in clinical as negative (n ⫽ 42) for L. pneumophila in diagnostic culture.
well as in environmental samples. A variety of diagnostic PCR Three of the Legionella-negative BAL specimens were spiked
with about 106 CFU of cultured Legionella longbeachae (ATCC
33462) (American Type Culture Collection, Manassas, Va.),
* Corresponding author. Mailing address: Institut für Medizinische Legionella micdadei (ATCC 33218), or Legionella bozemanii
Mikrobiologie und Hygiene, Universität Regensburg, Franz-Josef-
Strau␤-Allee 11, D-93053 Regensburg, Germany. Phone: 49-941-
(ATCC 33217) organisms. For template DNA preparation,
944-6450. Fax: 49-941-944-6402. E-mail: [email protected] 500-␮l aliquots of the BAL specimens were centrifuged for 2
-regensburg.de. min at 8,000 ⫻ g, and the resulting pellet plus 100 ␮l of the

3814
VOL. 40, 2002 NOTES 3815

TABLE 1. Oligonucleotide primers and LightCycler hybridization probes used in the PCR assaya
Nucleotide
Oligonucleotide Sequenceb Reference
position

Leg-1 AGGGTTGATAGGTTAAGAGC 451–470 9

Leg-2 CCAACAGCTAGTTGACATCG 836–817 9
Leg-HP-1 AGTGGCGAAGGCGGCTACCT-[FL] 721–740 19
Leg-HP-2 [Red 640]-TACTGACACTGAGGCACGAAAGCGT-[Ph] 748–772 19
Lpn-HP-1 CCAGTATTATCTGACCGTCCCA-[FL] 646–625 Present study
Lpn-HP-2 [Red705]-TAAGCCCAGGAATTTCACAGATAACTT-[Ph] 621–595 Present study
a
The target gene in each case was 16S rDNA, and the GenBank accession number was M59157.
b
[FL], fluorescein; [Red 640], LightCycler-Red 640-N-hydroxy-succinimide ester; [Red 705], LightCycler-Red 705-phosphoramidite; [Ph], 3⬘-phosphate.

supernatant was processed with the High Pure PCR Template Probes mix (Roche Diagnostics), which contains DNA poly-
Preparation kit (Roche Diagnostics) according to the manu- merase, reaction buffer, deoxynucleoside triphosphates in a
facturers instructions. Amplification mixtures consisted of 2 ␮l ready-to-use formulation, 3 mM MgCl2, 0.5 ␮M concentrations
of 10⫻ LightCycler-FastStart DNA Master Hybridization of each primer oligonucleotide, 0.2 ␮M concentrations of each

Downloaded from https://journals.asm.org/journal/jcm on 24 September 2022 by 180.244.160.137.

FIG. 1. Evaluation of the dual-color Legionella PCR assay with clinical specimens. A representative set of 23 L. pneumophila culture-positive
BAL specimens, 4 Legionella culture-negative BAL specimens, and 3 Legionella culture-negative BAL specimens spiked with cultured L.
longbeachae, L. micdadei, or L. bozemanii organisms was analyzed. Ten nanograms of L. pneumophila serogroup 1 (ATCC 33152) template DNA
was used as a positive control. (A) Fluorescence readout at 640 nm showing the LightCycler results with the Legionella spp.-specific set of
hybridization probes Leg-HP-1 and Leg-HP-2. (B) Fluorescence readout at 705 nm showing the LightCycler results with the L. pneumophila-
specific set of hybridization probes Lpn-HP-1 and Lpn-HP-2.
3816 NOTES J. CLIN. MICROBIOL.

coplasma pneumoniae, Chlamydia pneumoniae, Streptococcus

pneumoniae, Haemophilus influenzae, Staphylococcus aureus,
and Moraxella catarrhalis. Positive PCR results, as evidenced by
probe fluorescence, were observed only with Legionella spp.,
and all L. pneumophila isolates were distinguished by their
characteristic Tm in melting curve analysis at 705 nm (data not
shown).
To determine the lowest number of L. pneumophila cells
detectable by the assay, serial dilutions of genomic DNA pre-
pared from cultured L. pneumophila serogroup 1 (ATCC
33152) were tested. An analytical sensitivity of 10 fg of tem-
plate DNA was determined for both pairs of hybridization
probes, which corresponded to about 3 genome equivalents
per PCR. Therefore, our assay concept should be sensitive
enough for the direct detection of Legionella organisms in
suitable patient specimens, such as BAL or tracheal secretions.
A cross-reaction of the L. pneumophila-specific set of hy-
bridization probes with some non-L. pneumophila species was
observed in the LightCycler amplification plots (Fig. 1B), thus
FIG. 2. Melting curve analysis performed on the L. pneumophila-
specific set of hybridization probes (fluorescence readout at 705 nm).
requiring melting curve analysis for unambiguous identifica-
Melting curves corresponding to L. micdadei-, L. longbeachae-, L. tion of L. pneumophila. Such partial hybridization events of
bozemanii-, and L. pneumophila-specific amplicons are indicated by probes Lpn-HP-1 and Lpn-HP-2 with amplicons generated
arrows. from non-L. pneumophila species can be abolished by applying
more stringent annealing temperatures between 56 to 60°C or
a touchdown protocol from 60 to 56°C, but this slightly reduces
hybridization probe oligonucleotide, and 2 ␮l of template
total assay sensitivity to about 10 Legionella genome equiva-
DNA in a final volume of 20 ␮l. After an initial denaturation
lents per PCR.
step for 10 min at 95°C to activate the FastStart Taq DNA
In clinical practice, a variety of discordant results with DFA,
polymerase, the thermocycle program included 50 cycles of
urinary antigen, serology, and culture may be observed with
three steps each, comprised of heating at 20°C/s to 95°C with a
patient specimens. For evaluation of our novel PCR assay, the
5-s hold, cooling at 20°C/s to 55°C with a 10-s hold, and heating
selection of L. pneumophila culture-positive and culture-nega-
at 20°C/s to 72°C with a 20-s hold. Following amplification a
tive specimens was intentional in order to compare the results
LightCycler melting curve analysis was performed with a heat-
with the gold standard. Since results of DFA, urinary antigen,
ing rate of 0.2°C/s starting at 40°C. Fluorescence values of each
and serology were not available for all patients, the overall
capillary were measured at 640 and 705 nm (dual-color op-

Downloaded from https://journals.asm.org/journal/jcm on 24 September 2022 by 180.244.160.137.

tion). diagnostic sensitivity and specificity of the assay remain to be
All 29 Legionella-positive samples (26 L. pneumophila cul- established in the course of a prospective study.
ture-positive samples and 3 samples spiked with other Legio- The sensitive detection of Legionella on the genus level as
nella species) were correctly amplified and detected with the well as the differentiation between L. pneumophila and non-L.
Legionella spp.-specific set of hybridization probes (Fig. 1A; pneumophila species is important in the case of a clinically
fluorescence readout at 640 nm). Although all of the 29 Le- suspected legionellosis. Using only one pair of primers and two
gionella-positive samples were also detected with the L. pneu- sets of elongation-blocked hybridization probes avoids sensi-
mophila-specific set of hybridization probes (Fig. 1B; fluores- tivity problems generally associated with duplex PCR and dis-
cence readout at 705 nm), L. pneumophila-specific amplicons tinguishes this dual-color protocol from previously described
could be easily distinguished by their characteristic melting real-time PCR assays (1, 7, 17, 19). Following template DNA
temperature (Tm) of above 61°C in LightCycler melting curve preparation, PCR screening of up to 30 clinical specimens plus
analysis (Fig. 2). All 39 Legionella-negative samples tested neg- a positive and a negative control can be performed in a single
ative with both sets of hybridization probes. None of the sam- LightCycler run, resulting in a total assay time of less than
ples showed inhibition as judged by separate amplification of 2.5 h. LightCycler melting curve analysis allows the reliable
the human beta-globin gene by the LightCycler Control kit differentiation of L. pneumophila from other Legionella spe-
DNA (Roche Diagnostics). Compared with the results of di- cies, but there is not enough sequence heterogeneity in the
agnostic culture, the PCR assay results showed 100% specific- hybridization region of probes Lpn-HP-1 and Lpn-HP-2 to
ity and sensitivity for L. pneumophila detection and species separate individual non-L. pneumophila species by Tm analysis.
identification of the 68 BAL specimens investigated. L. bozemanii and L. longbeachae, for example, share an iden-
Assay specificity was further confirmed by testing genomic tical Tm of about 50°C (Fig. 2). In the case of a positive
DNA of 46 Legionella species and serogroups (19), including LightCycler PCR result for the genus Legionella (hybridization
all pathogenic species, all 15 serogroups of L. pneumophila, probes Leg-HP-1 and Leg-HP-2; fluorescence readout at 640
and Legionella-like amoebal pathogen 10 as well as with nm) but a negative result for L. pneumophila (observed Tm
genomic DNA of 26 clinical isolates of gram-negative or gram- with hybridization probes Lpn-HP-1 and Lpn-HP-2 below
positive bacterial species other than Legionella, including My- 61°C; fluorescence readout at 705 nm), the underlying Legio-
VOL. 40, 2002 NOTES 3817

nella species can be identified within about 3 h by direct se- therapy of Legionella pneumonia associated with increased mortality. Eur.
J. Clin. Microbiol. Infect. Dis. 15:286–290.
quencing of the spin-column-purified PCR products. 9. Jonas, D., A. Rosenbaum, S. Weyrich, and S. Bhakdi. 1995. Enzyme-linked
With respect to microbiological practice, the performance immunoassay for detection of PCR-amplified DNA of Legionellae in bron-
characteristics of the described LightCycler assay, such as its choalveolar fluid. J. Clin. Microbiol. 33:1247–1252.
10. Kazandjian, D., R. Chiew, and G. L. Gilbert. 1997. Rapid diagnosis of
speed, single-capillary format, dual-color hybridization probe Legionella pneumophila serogroup 1 infection with the Binax enzyme immu-
detection, and species information obtained with melting curve noassay urinary antigen test. J. Clin. Microbiol. 35:954–956.
analysis, make it a valuable adjunct to the spectrum of direct 11. Kessler, H. H., F. F. Reinthaler, A. Pschaid, K. Pierer, B. Kleinhappl, E.
Eber, and E. Marth. 1993. Rapid detection of Legionella species in bron-
methods like DFA or urinary antigen detection and an attrac- choalveolar lavage fluids with the EnviroAmp Legionella PCR amplification
tive alternative to conventional PCR assays for detection of and detection kit. J. Clin. Microbiol. 31:3325–3328.
Legionella spp. 12. Koide, M., and A. Saito. 1995. Diagnosis of Legionella pneumophila infection
by polymerase chain reaction. Clin. Infect. Dis. 21:199–201.
13. Kool, J. L., D. Bergmire-Sweat, J. C. Butler, E. W. Brown, E. J. Peabody,
REFERENCES D. S. Massi, J. C. Carpenter, J. M. Pruckler, R. F. Benson, and B. S. Fields.
1. Ballard, A. L., N. K. Fry, L. Chan, S. B. Surman, J. V. Lee, T. G. Harrison, 1999. Hospital characteristics associated with colonization of water systems
and K. J. Towner. 2000. Detection of Legionella pneumophila using a real- by legionella and risk of nosocomial legionnaires’ disease: a cohort study of
time PCR hybridization assay. J. Clin. Microbiol. 38:4215–4218. 15 hospitals. Infect. Control Hosp. Epidemiol. 20:798–805.
2. Benson, R. F., and B. S. Fields. 1998. Classification of the genus Legionella. 14. Lindsay, D. S., A. W. Abraham, and R. J. Fallon. 1994. Detection of mip gene
Semin. Respir. Infect. 13:90–99. by PCR for diagnosis of Legionnaires’ disease. J. Clin. Microbiol. 32:3068–
3. Breiman, R. F., and J. C. Butler. 1998. Legionnaires’ disease: clinical, epi- 3069.
demiological, and public health perspectives. Semin. Respir. Infect. 13:84– 15. Murdoch, D. R., E. J. Walford, L. C. Jennings, G. J. Light, M. I. Schousboe,
89. A. Y. Chereshsky, S. T. Chambers, and G. I. Town. 1996. Use of the poly-
4. Cloud, J. L., K. C. Carroll, P. Pixton, M. Erali, and D. R. Hillyard. 2000. merase chain reaction to detect Legionella DNA in urine and serum samples
Detection of Legionella species in respiratory specimens using PCR with from patients with pneumonia. Clin. Infect. Dis. 23:475–480.
sequencing confirmation. J. Clin. Microbiol. 38:1709–1712. 16. Neumeister, B. 1996. Legionella infections: epidemiology, diagnostics, clin-
5. Dominguez, J. A., N. Gali, P. Pedroso, A. Fargas, E. Padilla, J. M. Man- ical aspects, and pathogenesis. Clin. Lab. 42:715–729.
terola, and M. Matas. 1998. Comparison of the Binax Legionella urinary 17. Rantakokko-Jalava, K., and J. Jalava. 2001. Development of conventional
antigen enzyme immunoassay (EIA) with the Biotest Legionella Urin Anti- and real-time PCR assays for detection of legionella DNA in respiratory
gen EIA for detection of legionella antigen in both concentrated and non- specimens. J. Clin. Microbiol. 39:2904–2910.
concentrated urine samples. J. Clin. Microbiol. 36:2718–2722. 18. Ratcliff, R. M., J. A. Lanser, P. A. Manning, and M. W. Heuzenroeder. 1998.
6. Harrison, T. G., and A. G. Taylor. 1998. Timing of seroconversion in Le- Sequence-based classification scheme for the genus Legionella targeting the
gionnaires’ disease. Lancet 2:795. mip gene. J. Clin. Microbiol. 36:1560–1567.
7. Hayden, R. T., J. R. Uhl, X. Qian, M. K. Hopkins, M. C. Aubry, A. H. Limper, 19. Wellinghausen, N., C. Frost, and R. Marre. 2001. Detection of legionellae in
R. V. Lloyd, and F. R. Cockerill. 2001. Direct detection of Legionella species hospital water samples by quantitative real-time LightCycler PCR. Appl.
from bronchoalveolar lavage and open lung biopsy specimens: comparison of Environ. Microbiol. 67: 3985–3993.
LightCycler PCR, in situ hybridization, direct fluorescence antigen detection, 20. Yu, V. L. 2000. Legionella pneumophila (Legionnaires’ disease), p. 2424–
and culture. J. Clin. Microbiol. 39:2618–2626. 2435. In G.L. Mandell, J. E. Bennett, and R. Dolin (ed.), Principles and
8. Heath, C. H., D. I. Grove, and D. F. Looke. 1996. Delay in appropriate practice of infectious disease, 5th ed. Churchill Livingstone, New York, N.Y.

Downloaded from https://journals.asm.org/journal/jcm on 24 September 2022 by 180.244.160.137.