Scribd
Upload
213 views2 pages

Activity #1 - Molecular Phylogenetics Using A Pseudogene

This document describes a molecular phylogenetics activity involving two exercises. The first examines DNA sequences from a pseudogene in four animal species and asks students to analyze differences and construct a phylogenetic tree relating their ancestry. The second looks at amino acid sequences for a protein in five mammals and has similar analysis and tree-building tasks. By comparing genetic sequences, the activity aims to teach students how to trace evolutionary relationships among species.

Uploaded by

Kim
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
213 views2 pages

Activity #1 - Molecular Phylogenetics Using A Pseudogene

This document describes a molecular phylogenetics activity involving two exercises. The first examines DNA sequences from a pseudogene in four animal species and asks students to analyze differences and construct a phylogenetic tree relating their ancestry. The second looks at amino acid sequences for a protein in five mammals and has similar analysis and tree-building tasks. By comparing genetic sequences, the activity aims to teach students how to trace evolutionary relationships among species.

Uploaded by

Kim
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 2

Molecular Phylogenetics Activity

Lents, et. al. John Jay College, C.U.N.Y.

Molecular Phylogenetics Activity


Activity #1 – Molecular phylogenetics using a pseudogene
• Below are four gene sequences. These are taken from four animals that are believed to have “recent shared ancestry” (are closely
related).

• The gene sequences are from a so-called “broken gene” or pseudogene, the evolutionary remnant of a gene, which is now
nonfunctional, in a given species or group of related species. In this case, the gene is called GULO (L-gulonolactone oxidase), which
codes for the enzyme which catalyzes a key step in the synthesis of ascorbic acid (vitamin C). Along the way, some animals have lost
the function of this gene (by random mutation) and must consume vitamin C in their diet.

Procedure:
1. Examine the four gene sequences below and mark any differences among the sequences that you can find.

_
#1 GGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAGG
#2 GGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAGG
#3 GGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAGG
#4 GGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGGG
-

2. Discuss the following questions with your lab partner: Do you notice any specific pattern? What could this pattern mean regarding
the ancestry/relatedness of the four species?

3. Together with your lab partner, make an hypothesis about the ancestry of these four species in the form of a phylogenetic tree.
Draw this tree on a separate sheet of paper and make a few notes explaining why you drew it this way.

Page 1

This study source was downloaded by 100000865776869 from CourseHero.com on 04-19-2023 22:14:54 GMT -05:00
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.

Activity #2 – Molecular phylogenetics using a coding sequence (protein)


• While noncoding DNA sequences are extremely useful in analyzing the shared ancestry of different species, protein-coding DNA
sequences are also useful.
• However, the mutation and evolution of protein-coding sequences of DNA is more “constrained.” Why might this be?
• Below is the amino acid sequence for a protein called SCML1, an enzyme necessary for male embryonic development and male fertility
in mammals. It is encoded by a gene on the X-chromosome.
• The amino acid sequence is only slightly different amongst five mammals, as shown below: ( “…/…” represents a stretch of identical
amino acids, and is this omitted.)

_
#1 MSNS…/…VIKT…/…DDNTI…/…EQLKTVDD…/…DALQN…/…RFHARSLWTNHKRYG…/…KKHSYRLVL…/…YETF…
#2 MSDS…/…VVKT…/…DDNTI…/…EQLRTVND…/…DALQN…/…RFYARSLWTNRKRSG…/…KKHSYRPVL…/…YETF…
#3 MSNS…/…VVKT…/…DDDTI…/…EQLKTVND…/…DAMQN…/…RFHARFLWANRKRYG…/…KKHSYRLVL…/…YETF…
#4 MSNS…/…VVKT…/…DDDTI…/…EQLKTVND…/…DAMQN…/…RFHARSLWTNRKRYG…/…KKYSYRLVA…/…YESF…
#5 MSSS…/…VVKT…/…DDDTI…/…EQQKTVND…/…DAMQN…/…RFRARSLWTNRKRYG…/…KKYSYRLVA…/…YESF…
-

Procedure:
1. Examine the five amino acid sequences above and mark any differences among the sequences that you can find.
2. As in activity #1, use the differences in amino acid sequence to retrace the ancestry of these five mammals. Make an hypothesis in
the form of a phylogenetic tree. Draw this tree on a separate piece of paper, along with your notes explaining it.

Page 2

This study source was downloaded by 100000865776869 from CourseHero.com on 04-19-2023 22:14:54 GMT -05:00
Powered by TCPDF (www.tcpdf.org)

You might also like