DNA Aptamer Evolved by Cell-SELEX for Recognition of

Prostate Cancer
Yuanyuan Wang1., Yun Luo1., Tao Bing2, Zheng Chen1, Minhua Lu1, Nan Zhang2, Dihua Shangguan2*,
Xin Gao1*
1 Department of Urology, the third affiliated hospital of Sun Yat-sen University, Guangzhou, Guangdong, China, 2 Beijing National Laboratory for Molecular Sciences, Key
Laboratory of Analytical Chemistry for Living Biosystems, Institute of Chemistry, Chinese Academy of Sciences, Beijing, China

Abstract
Morbidity and mortality of prostate cancer (PCa) have increased in recent years worldwide. Currently existing methods for
diagnosis and treatment do not make the situation improve, especially for hormone refractory prostate cancer (HRPC). The
lack of molecular probes for PCa hindered the early diagnosis of metastasis and accurate staging for PCa. In this work, we
have developed a new aptamer probe Wy-5a against PCa cell line PC-3 by cell-SELEX technique. Wy-5a shows high
specificity to the target cells with dissociation constants in the nanomolar range, and does not recognize other tested PCa
cell lines and other tested tumor cell lines. The staining of clinical tissue sections with fluorescent dye labeled Wy-5a shows
that sections from high risk group with metastasis exhibited stronger fluorescence and sections from Benign Prostatic
Hyperplasia (BPH) did not exhibit notable fluorescence, which suggests that aptamer Wy-5a may bind to protein related to
the progression of PCa. The high affinity and specificity of Wy-5a makes this aptamer hold potential for application in
diagnosis and target therapy of PCa.

Citation: Wang Y, Luo Y, Bing T, Chen Z, Lu M, et al. (2014) DNA Aptamer Evolved by Cell-SELEX for Recognition of Prostate Cancer. PLoS ONE 9(6): e100243.
doi:10.1371/journal.pone.0100243
Editor: Sabato D’Auria, CNR, Italy
Received January 18, 2014; Accepted May 23, 2014; Published June 23, 2014
Copyright: ß 2014 Wang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The authors acknowledge the financial support from National Natural Science Foundation of China (81172430, 81372728, 21205124 and 81201694) and
Grant 973 Program (2011CB935800) and Specialized Research Fund for the Doctoral Program of Higher Education of China (20120171120059). The funders had no
role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: [email protected] (XG); [email protected] (DS)
. These authors contributed equally to this work.

Introduction require suitable molecular probes and biomarkers [7]. Further-

more, the molecular level differences decide phenotype; person-
Prostate cancer (PCa) is the most common non-cutaneous alized treatment is based on these different biomarkers to diagnose
neoplasm in the male population worldwide [1]. Recently, several and distinguish exactly. But the lack of molecular probes for PCa
studies have shown that the incident of PCa is significantly higher cells hindered the early diagnosis of metastasis and accurate
than twenty years ago [2]. The update statistics shows that the staging for PCa. Serum prostate specific antigen (PSA) is a
morbidity of PCa has exceeded lung cancer and become the most biomarker for PCa, and has been widely used for the detection of
common malignant tumor in men. More than 238,590 men will be PCa. The concentration of PSA is also associated with malignant
diagnosed with PCa and 29,720 will die of metastatic PCa in the degree and tumor recurrence. However, PSA is not a specific
United States (US) in 2013, making it the second leading cause of marker of PCa since its serum level increases with Benign Prostatic
cancer death in American men, behind lung cancer [3]. Hyperplasia (BPH) and is affected by many factors such as
Unfortunately, most PCa patients in Asia had advanced local medication (Finasteride), urologic manipulations, inflammation, or
disease or metastases by the time they were diagnosed, and even ejaculation [8,9]. Although, along with the generalization of
mortality rates of PCa may continue to rise in most Asian screening with prostate-specific–antigen (PSA) testing, the diag-
countries. This may be caused by the changes of life or dietary
nostic rate and the early treatment was improved quickly, but the
style and environment [4].
clinical trial in America and Europe show the screening has no
The performance of PCa in the early stage exhibits a relatively
effective on reducing mortality from PCa [10,11]. So to improve
indolent cure in most patients [5]. This feature made PCa hard to
clinical classification and personalized chemotherapy, it is still
be noticed and diagnosed in the early stage. When the patients are
needs to find new biomarkers or probes with more specificity.
in pain, most of them have occured the bone metastasis. Initially,
Recently, a new class of molecular probes termed aptamer has
most PCa patients are sensitive to the androgen deprivation
attracted much attention as molecular probes for disease diagnosis
therapy (ADT), but the duration is heterogeneous, it could last
and therapy. Aptamers are single-stranded oligonucleotides that
from a few months to more than 3 years [6]. Eventually, PCa may
could fold into unique tertiary structures through various
evolve into Hormone Refractory Prostate Cancer (HRPC), which
intramolecular interactions [12]. Similar to antibodies that are
is resistant to conventional therapy. Successful cancer therapy is
wildly used in clinic, aptamers can specifically bind to various
based on early diagnosis and accurate staging, both of which

PLOS ONE | www.plosone.org 1 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Figure 1. Schematic representation of the cell-based aptamer selection.

doi:10.1371/journal.pone.0100243.g001

targets that range from small organic molecules to proteins Results and Discussion
[13,14]. Comparing to antibodies, aptamers have low-molecular
weight, higher stability, rapid tissue penetration, lack of immuno- Aptamer selection against PC-3 cells
genicity [15–18], and especially, aptamers can be chemically The process of aptamer selection is shown in Figure 1. The
synthesized and modified [19]. These advantages make aptamers target cell line PC-3 is a typical cell line from androgen
versatile tools for diagnostics [20], Image Cytometry [21] and independent cancer patient with osseous metastasis. Androgen
targeted therapeutics [22]. independent cancer patients with osseous metastasis are the most
Aptamers are generated by the SELEX technology (System- difficult to treat. In order to generate aptamers with high
atic Evolution of Ligands by Exponential enrichment) [20,23]. specificity, we used more than one kind of cell line as negative
Cell-SELEX is an aptamer selection procedure using whole cells control for counter selection, including nontumor-immortalized
as target, which generates cell-specific aptamers by employing prostate epithelial cells line RWPE-1, human hepatic carcinoma
the differences at the molecular level between any two cell lines cell line SMMC-7721 and Human cervical cancer cell line Hela.
[19,24–27]. By Cell-SELEX, a panel of aptamers that specically For the first round selection, the target cells were incubated with
bind to target cell line can be identified without prior knowing the random DNA library pool. After washing, the remained
the exact membrane proteins. In the process of enrichment, the sequences on cells were amplified by polymerase chain reaction
living cells assure the targets existing on the membrane keep (PCR), and separated into single-stranded sequences for the
their nature formation, so the obtained aptamers will maintain second round selection. From the second round selection, the
the same affinity and specificity in their cellular applications negative cells were incubated with the enriched pool before the
[28]. In this paper, we describe the aptamer selection against target cell binding in order to eliminate the sequences that bound
PC-3 cells (a PCa cell line). Through cell-SELEX, we identified to the common molecules present on the surface of target cells and
a DNA aptamer, which specifically binds to PC-3 cells and control cells. For every two or three rounds of selection, the
can distinguish BPH samples and high risk PCa samples from aptamer enrichment was monitored by flow cytometry and
clinic. confocal imaging. If aptamer sequences were enriched, the
fluorescence intensity on the surface of PC-3 cells became stronger
after incubation of cells with the selected pools. As shown in Figure

PLOS ONE | www.plosone.org 2 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Figure 2. Binding assay of selected pools to PC-3 and SMMC-7721 cells. Flow cytometry assay of selected pools binding to target cell line
PC-3 (A) and negative control cell line SMMC-7721(B), Blank is the background fluorescence of untreated cells. Lib is FITC-labeled DNA library as
negative control. (C) Confocal imaging of PC-3 cells stained by the 15th-round selected pool labeled by FITC (6100 oil immersion lens).
doi:10.1371/journal.pone.0100243.g002

2A, the fluorescence intensity on the surface of PC-3 cells greatly binding to other cell types (Figure S1); therefore this sequence was
increased in the first ten rounds of selection, and the fluorescence further characterized. The secondary structure prediction [32]
enhancement on the control cells (SMMC-7721, Figure 2B) was showed that Wy-5a adopted a stem-loop structure with a one-base
much smaller, indicating that aptamers for target cells were greatly bulge on the stem (Figure 3). Removing the one-base bulge, a
enriched. However, after performed further five rounds of perfect stem-loop structure sequence Wy-5b (Table 1) was also
selection, although the fluorescence on PC-3 cells was still stronger synthesized for further characterization. Binding assay showed that
than on control cells, the fluorescence enhancement on PC-3 cells Wy-5a and Wy-5b specifically bound to PC-3 cells (Figure 3). The
became slower and that on control cells became faster, which equilibrium dissociation constants (Kd) of Wy-5a and Wy-5b were
suggests that more nonspecific sequences that bound to both cell calculated to be 73.59611.01 and 173.1644.67, indicating that
lines were enriched. Confocal imaging (Figure 2C) showed that aptamer Wy-5a has higher affinity to PC-3 cells than Wy-5b. The
aptamers bound on the membrane of the target cells. After higher affinity of Wy-5a suggests that the one-base bulge on the
another two rounds of selection with stronger counter selection, stem of Wy-5a may involve the binding to its target. Because of the
the 17th round pool was cloned and 50 clones were sequenced. higher affinity of Wy-5a, it was further characterized as a novel
probe for PCa detection.
Identification of aptamers against target cells
After alignment, the obtained sequences of 50 clones were Specificity of Selected Aptamers
found to distribute into 5 families according to the similarities of The specificity of Wy-5a to other tumor cell lines was
thier sequences. Through analyzing the predicted secondary investigated by flow cytometry and confocal imaging (Figure 4).
structure of the sequences in each family [29–31], six sequences Among all the tested cell lines, Wy-5a only bound to PC-3 cell line,
were truncated and synthesized for binding assay (sequences not did not bind to other PCa cell lines (such as DU145, from PCa
shown). Flow cytometry assay showed that a sequence, Wy-5a brain metastasis with moderate metastatic potential; 22RV-1, from
exhibited the strongest binding to PC-3 cells and the weakest local PCa without metastatic potential),and other cancer cell lines,

PLOS ONE | www.plosone.org 3 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Figure 3. Binding curves of FITC-labeled aptamer sequences to PC-3 cells (Wy-5a and wy-5b, left) and the predicted secondary
structure of Wy-5a and wy-5b (right). The concentrations of DNA are 0, 1.0, 2.0, 4.0, 8.0, 16, 32, 64, 128 and 256 nM. The negative control
sequence was FITC-labeled DNA library (Lib). The predicted secondary structure of Wy-5a and wy-5b (right), were rebuild by the tool provided by
Integrated DNA Technologies (IDT). [www.IDTdna.com/page/scitools].
doi:10.1371/journal.pone.0100243.g003

including Lung cancer cell line (A549), Human breast cancer cell Wy-5a might internalize into cells. In the confocal image of PC-3
line (MCF-7), Human cervical cancer cell line (HeLa), Hepatoma cell after incubation with Wy-5a at 37uC for 2 h (Figure 6), strong
cell line (SMMC-7721), Colon cancer cell lines (LoVo and HCT- fluorescence signal was observed on cell membrane and weak
8), leukemia cell line (Jurkat) and chronic myelogenous leukemia fluorescence signal was found in whole cells. But the the confocal
cell line (K562) (table S1). These results indicate that aptamer Wy- image of cells icubated DNA library did not show significant
5a has excellent specificity to the target cell line. The high fluorescence signal except for some nonspecific bright spots
specificity makes Wy-5a has the potential for application in dispersedly adsorbed on cells. These results suggest that Wy-5a
detection of metastasis PCa or a tool for target therapy. may be involved in receptor-mediated endocytosis.

The binding sites of the aptamer on the target cells The staining of clinical PCa slides
The confocal imaging has shown that the obtained aptamers Above results hav shown that aptamer Wy-5a has excellent
bound on cell surface (Figure 2C and Figure 4 Row A), thus a specificity to PC-3 cells over DU145 and 22RV-1 cells. PC-3 cell
proteinase digestion experiment was carried out to verify whether line was initiated from a bone metastasis of a grade IV androgen
the target molecule is a membrane protein. As shown in Figure 5, independent PCa patient. Furthermore, the skeletal involvement is
after treatment with trypsin or proteinase K for 2 min, PC-3 cells the most common metastatic site in advanced-stage PCa, observed
almost did not bind Wy-5a, indicating that the target molecule of in up to 80% of patients [35]. DU145 was derived from PCa brain
aptamer Wy-5 is a membrane protein. metastasis with moderate metastatic potential, and are not
hormone-sensitive [36]; 22RV-1 is a human PCa cell line without
The internalization of Wy-5a metastatic potential derived from a xenograft in mice [37].
Previous studies have shown that oligonucleotides longer than Therefore the target protein of Wy-5a may have correlation with
25 bases could not freely penetrate the membrane [33,34]. Wy-5a aggressiveness or metastasis. Thus aptamer Wy-5a may have the
is a 52-base oligonucleotide, it targets a membrane protein. In potential in tumor classification and staging. In order to test the
order to investigate whether Wy-5a can internalize into cells feasibility of Wy-5a for tumor classification and staging, we used
through receptor-mediated endocytosis, PC-3 cells were incubated this aptamer to stain PCa tissue sections from clinical patients. The
with Wy-5a at 37uC for 2 h. The increase of tempreture from 4uC negative control is BPH tissues, a prevalent noncancerous change
to 37uC did not much affect the binding of Wy-5a to PC-3 cells in aged man. Tumor tissues were gotten from patients with PCa
(Figure S2). The flow cytometry assay (Figure 6) showed that pre- (identified by senior pathologist, the third affiliated hospital of Sun
treatment of cells with trypsin caused almost complete loss of Yat-Sen University). The sections were cut from formalin-fixed
aptamer binding (compared with unbound DNA labrary). paraffin-embedded (FFPE) tissues, and the membrane antigens
However, treatment of cell with trypsin after aptamer binding were repaired by boiling EDTA Antigen Retrieval Solution before
only caused partial loss of aptamer binding, suggesting that some staining. As shown in Figure 7, after stained by FITC (fluorescein

Table 1. Sequences and Kds of selected aptamers for the PC-3 cells.

Aptamers Sequences Kd (nM)

Wy-5a TGCCACTACAGCTGGTTCGGTTTGGTGACTTCGTTCTTCGTTGTGGTGCTTAGTGGC 73.59611.01

Wy-5b TGCCACTAAGCTGGTTCGGTTTGGTGACTTCGTTCTTCGTTGTGGTGCTTAGTGGC 173.1644.67

doi:10.1371/journal.pone.0100243.t001

PLOS ONE | www.plosone.org 4 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Figure 4. The specificity assay of aptmer Wy-5a to different cell lines. Row A, target cell line PC-3; Row B, SMMC-7721; Row C, HeLa; Row D,
22RV-1. Colum 1, fluorescence images; Colum 2, overlay of fluorescence images and bright field images, Colum 3, Histogram Plot of Flow cytometry.
Blank is the background fluorescence of untreated cells respectively; Lib is FITC-labeled DNA library as negative control.
doi:10.1371/journal.pone.0100243.g004

PLOS ONE | www.plosone.org 5 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Figure 5. The binding of selected aptamer to PC-3 cells pre-treated with trypsin (A) or proteinase-K (B). After treatment with trypsin or
proteinase K, PC-3 cells almost did not bind Wy-5a. Blank is the background fluorescence of untreated cells respectively.
doi:10.1371/journal.pone.0100243.g005

isothiocyanate) labeled aptamer Wy-5a, the cancer tissues indicated that the target protein of Wy-5a highly expressed in
exhibited strong fluorescence signal. However the fluorescence these high score patients with metastasis. The Gleason grading
signal was hardly observed on the slide of BPH tissue. system is a powerful tool to prognosticate and aid in the treatment
The staining of all slides was summarized in Table 2. Totally, all of men with PCa. Based on pathological structure of gland
the 10 BPH slides from different patients showed negative results epithelial, the tissue image is classified into five types. From the
and 20 cancer slides out of 28 cases of cancer tissue showed first to the fifth type, the degree of differentiation gradually
positive results. Only 8 cases of cancer slides could not be stained reduced [38]. Since Gleason score reflects the malignancy degree
by the aptamer. Comparing the Gleason score of cancer tissues of PCa, these results may imply that the target protein of Wy-5a
and the medical record of the patients, we found an interesting maybe have some relationship with the malignant degree or
phenomenon: the slides from patients with high Gleason score (. aggressiveness or progression of tumor. Further protein identifi-
6) with bone metastasis showed stronger fluorescence on the cell cation and evaluation will be carried out to illuminate this issue.
membrane than low score (#6) without metastasis (Figure 7). This

Figure 6. Cell-specific internalization of aptamer Wy-5a assessed by flow cytometry assay (left) and confocal imaging (right). W/O
treatment: Cells were incubated with Wy-5a; Pretreatment: cells were pretreated by trypsin and then incubated Wy-5a; aftertreatment: cells were
incubated Wy-5a and then treated by trypsin; Lib: negtive control, cells were incubated with FITC-labeled DNA library; blank: is the background
fluorescence of untreated cells.
doi:10.1371/journal.pone.0100243.g006

PLOS ONE | www.plosone.org 6 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Figure 7. The clinical slides stained by 250 nM FITC-labeled Wy-5a. Rarely fluorescence signal (2) was observed on BPH slides. In well-
differentiated prostate cancer, Gleason score: 2+3, no proof of other organ metastasis, very weak fluorescence signal (+) was observed. In low-
differentiated prostate cancer patient, Gleason score: 5+5, with bone metastasis, strong fluorescence signal (+++) was observed. (Colum 1) HE
staining of paraffin section from clinical sample, (Colum 2) Bright field of confocal, (Colum 3) Fluorescence signal of confocal.
doi:10.1371/journal.pone.0100243.g007

This set of results suggests aptamer Wy-5a has the potential to However, heterogeneous duration indicated that the types and
serve as probe for the diagnosis of PCa. manifestations of the patients are various. Accurate classification of
The PCa patients with recurrence or in advanced stage will type or grade is helpful to improve the efficiency of therapy.
eventually become HRPC and show no responds to ADT [6]. The Therefore more diagnostic reagents are needed in order to choose
development of its drug resistance in addition to hormone the optimum personalized therapy. Some chemotherapeutics are
refractoriness, make the effect of treatment frustrating [39]. effective in vitro, but lack of cell-selectivity, serious toxicity and

Table 2. Assessment of clinical slides stained by dye labeled aptamer.

BPH benign lesion (10 cases) Low Gleason score* without metastasis (13 cases) High Gleason score** with metastasis (15 cases)

2 10 5 3
+ — 6 1
++ — 2 5
+++ — — 6

*Low Gleason score: #6, **high Gleason score.6.

‘2’ no staining; ‘+’ faint incomplete staining; ‘++’ moderate complete membrane staining;
‘+++’ strong complete membrane staining [45].
doi:10.1371/journal.pone.0100243.t002

PLOS ONE | www.plosone.org 7 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

side effects limited their usage in vivo. Aptamer mediated targeted Procedure of SELEX
medicine may be a good solution. Until now days, only one RNA The process of cell-SELEX is similar to that described
aptamer aiming at PCa has been generated by traditional SELEX previously [42]. In briefly, the process was carried out as follow
process, i.e. aptamer against PSMA (Prostate Specific Membrane steps (Figure 1). Before each round of SELEX, the target cells PC-
Antigen, only expressed in LNCaP cell line) [40]. For the typically 3 were cultured to 80,90% confluence and the negative cells were
cell line PC-3, there is still no oligonucleotide aptamer evolved. cultured to complete confluence in 60 mm petri dish and washed
Recently aptamer based drug delivery has shown good results three times with precooled PBS. 10 nmol initial ssDNA library
[41]. The high affinity and specificity to PC-3 cell line and to dissolved in 1 mL of binding buffer was denatured at 95uC for
cancer tissues with high risk and metastasis imply that DNA 5 min and kept in ice bath for 15 min, then placed in room
aptamer Wy-5a hold potential in the field of classification, temperature about half an hour before used. After incubating the
detection and target therapy of PCa patients. library pool with the target cells at 4uC for 1 h, the initial library
solution was removed. After washed with washing buffer the
Experimental Section adhesive cells were scraped off and collected in a 2 mL tube,
washed again. The bounded DNAs were eluted by adding 500 ml
Cell culture
of ddH2O into the tube, and heating to 95uC for 5 min. After
Twelve established cell lines were used: RWPE-1 is an
centrifugation, the supernatant was used as the template and
immortalized normal Human prostate epithelial cell line. PC-3,
amplified by the PCR with the primers labeled by FITC or biotin
DU-145 and 22RV-1 are human PCa cell lines. SMMC-7721 is a
(10–15 cycles of 30 sec denature at 95uC, 30 sec annealing at
human hepatic carcinoma cell line. LoVo and Hct-8 cells are
59uC, and 30 sec extension at 72uC, the last round followed by
colorectal carcinoma cell lines. HeLa is a Human cervical cancer
5 min at 72uC; keep the production at 4uC. The Taq polymerase
cell lines. A549 is a Human lung cancer cell line. MCF-7 is a
and dNTPs were obtained from Takara). The FITC-labelled sense
Human breast cancer cell line, Jurkat is an acute T cell leukemia
cell line, K562 is a chronic myelogenous leukemia cell line. ssDNA pool was separated from the PCR product by streptavidin-
RWPE-1, PC-3, DU-145, 22RV-1, SMMC-7721 and LoVo cell coated sepharose beads for the next round selection. From the
lines were purchased from Typical culture preservation commis- second round of selection, the negative cells were incubated with
sion cell bank, Chinese academy of sciences (Shanghai, China). the ssDNA pool first for counter selection, then the negative cells
HeLa, A549, MCF-7, Jurkat and K562 were purchased from the bound with unspecific sequences were removed by centrifuge. The
Institute of Basic Medical Science at the Chinese Academy of supernatant was incubated with target cells to enrich the specific
Medical Sciences (Beijing, China). RWPE-1 was cultured in sequences. The selection process was monitored using flow
Keratinocyte Serum Free Medium (K-SFM) with bovine pituitary cytometry and confocal imaging. From the 2nd to 5th round,
extract (BPE) and human recombinant epidermal growth factor RWPE-1 cells were used for counter selection; from the 6th to 8th
(EGF), the other tumor cell lines were cultured in RPMI 1640 round, SMMC-7721 were used for counter selection; from the 9th
culture medium supplemented with 10% fetal bovine serum (FBS, to 10th round selection, Hela cells were used for counter selection.
GIBCO) and 100 units/mL penicillin streptomycin (Sigma). All After 10th round, HeLa and SMMC-7721 cells were used for
cell lines were maintained at 37uC and 5% CO2 incubator. In the counter selection separately in each round. To obtain aptamers
whole process, every important index of growing on cells must with high affinity and specificity, the pressure of selection was
keep stable and cells were kept in a good state, which establish a enhanced gradually from 1st to 15th selection by decreasing the
stable basis for further experiments. amount of the ssDNA pool (from 100 pmol to 50 pmol), the
incubation time for the target cells (from 60 min to 30 min), and
Buffer the target cell number (from 7.5 million/10 cm dish to 1 million/
Washing buffer was prepared by adding 5 mmol MgCl2 and 3.5 cm dish) and by increasing the number of washes (from two to
4.5 g glucose into 1 L 0.01 M PBS (contain 8 g NaCl, 0.2 g KCl, three). In the last two rounds of strengthened selection (16th–17th),
3.58 g Na2HPO4?12H2O, 0.272 g KH2PO4 per 1 L ddH2O. we reduced the pool to 30 pmol, incubation time to 15 min and
pH = 7.4) without calcium and magnesium. The binding buffer increase the washing to four times with stronger shaking. Totally
was prepared by adding 1 mg/mL bovine serum albumin (BSA, 17 rounds of selection were performed before sequencing. The
Sigma) and 0.1 mg/mL Herring Sperm DNA (Invitrogen) to clone and sequencing were performed by Sangon Biotechnology
washing buffer. Co., Ltd.,

SELEX ssDNA library and PCR primers Flow cytometric analysis

The HPLC-purified library contained a central randomized To monitor the enrichment of aptamer along with the progress
sequence of 45 nucleotides (nt) flanked by 20-nt primer of SELEX, the target cells and negative cells was cultured into
hybridization sites (59-ACGCTCGGATGCCACTACAG-45nt- monolayers with 80,90% confluence, then dissociated the cells by
CTCATGGACGTGCTGGTGAC -39). A fluorescein isothiocy- 0.02% EDTA after washed by PBS once at room temperature.
anate (FITC)-labeled 59-primer (59-FITC-ACGCTCGGATGC- After washed with cold washing buffer twice, cells (26105) were
CACTACAG-39) and a biotinylated (Bio) 39-primer (59-Bio- incubated with FITC-labeled ssDNA pools or selected DNA
GTCACCAGCACGTCCATGAG-39) were used in the PCR sequences (0.25 mM) in 200 mL of binding buffer at 4uC for 30
reactions for the synthesis of double-labeled, double-stranded minutes. Before flow cytometry assay, the cells were washed twice
DNA molecules. After denaturing in alkaline conditions (0.2 M by cold washing buffer and filtered with a 400 mesh cell sieve. The
NaOH), the FITC- conjugated sense ssDNA aptamer is separated fluorescence was determined with FACScan cytometer (Becton
from the biotinylated antisense ssDNA strand by streptavidin- Dickinson) by counting 16104 events. The FITC labeled library
coated sepharose beads (Streptavidin Sepharose High Performan- pool was used as a negative control.
ce)(GE Healthcare, Sweden) and used for next round selection or
binding assay. The selection process was monitored using flow
cytometry assay and confocal imaging.

PLOS ONE | www.plosone.org 8 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

Staining of human tumor tissue sections using selected Confocal image of cells
aptamer The confocal fluorescence microscopy was used to observe the
Paraffin tissue blocks were provided by the pathology depart- binding of aptamers to living cells. 26104 cells were cultured in
ment of 3rd affiliated hospital, Sun Yat-sen university (Guangzhou 35 mm Glass Bottom Dish for more than 1 day to get a well
China). The pretreatment of the sections (5 mm thick) was extension. After washed by cold washing buffer, the cells were
performed as described previously [43,44]. The antigen retrieval incubated with aptamers (0.25 mM) at 4uC for 30 min. After
process is similar with Immunohisto-chemistry. The tissue sections washed twice, cells were imaged by spinning-disk confocal
were deparaffinated in xylene twice (10 min each time) after kept fluorescence microscopy (Olympus IX71, Japan). FITC was
in constant temperature oven at 60uC for 20 min. Use the gradient excited with a 488 nm argon ion laser (Mells Griot, CA).The
ethanol (100%, 95% and 70%) to rehydrate the section and rinse fluorescence signals were observed by a 406 objective (NA 0.90,
the slides in deionized water. After wash in PBS for 5 min, all the UPLSAPO, Olympus, Japan). The images were analyzed by
sections were put in TE buffer (contain 10 mmol Tris, 1 mmol FV10-ASW Version 3.1.
EDTA per 1 L ddH2O, pH = 8.0) and quickly heated to boiling by
microwave oven, then keep the temperature at 95uC for 15 min to The internalization of the aptamer
retrieve antigens and natural cooling to room temperature, then The target cell PC-3 was dissociated by 0.02% EDTA. After
washed three times with fresh PBS. After histological process, The washing, cells were divided into 5 tubes. One tube without any
tissue sections were incubated with binding buffer containing 20% treatment as blank; one tube was incubated with 0.25 mM FITC-
FBS and 0.1 mg/mL Herring Sperm DNA at room temperature labeled DNA Library as negtive control; one tube was incubated
for 60 min and then incubated with 250 nM FITC-labeled with 0.25 mM FITC-labeled Wy-5a as positive control; one tube
aptamers in binding buffer 60 min at 4uC. Then these tissue was pre-treated by 0.05% Trypsin for 10 min and then incubated
sections were washed three times with fresh PBS, dehydrated and with 0.25 mM FITC-labeled Wy-5a (pre-treatment); one tube was
sealed by Antifade Polyvinylpyrrolidone Mounting Medium. incubated with 0.25 mM FITC-labeled Wy-5a and then treated by
Finally, the stained sections were imaged by spinning-disk confocal 0.05% Trypsin for 10 min (after-treatment). All the incubations
fluorescence microscopy (Olympus IX71, Japan). FITC was with DNA were performed at 37uC for 2 h in serum-free RPMI
excited with a 488 nm argon ion laser (Mells Griot, CA).The 1640 medium. Then the five samples were applied for flow
fluorescence signals were observed by a 406 objective (NA 0.90, cytometry assay as described above. For the confocal observation,
UPLSAPO, Olympus, Japan). The images were analyzed by PC-3 cells were incubated with 0.25 mM FITC-labeled Lib or Wy-
FV10-ASW Version 3.1. 5a in serum-free RPMI 1640 medium at 37uC for 2 h then applied
for imaging as described above.
Affinity and specificity of the aptamer
14 cell lines were used to test the specificity of the aptamers by Supporting Information
flow cytometry assay as described above. In order to test the Figure S1 Flow cytometry assays of Cells after incuba-
affinity of different aptamers to PC-3cell, different concentration of tion with tdifferent aptamers. Blank: is the background
aptamers were incubated with 26105 cells at 4uC, and then fluorescence of untreated cells.
analyzed by flow cytometry. The mean fluorescence intensity of (TIF)
each sample was subtracted the mean fluorescence intensity of
background. The equilibrium dissociation constants (Kd) of the Figure S2 Flow cytometry assay of PC-3 cells after
aptamer–cell interaction were obtained by fitting the dependence incubation with Wy-5a at 46C or 376C. The binding ability
of fluorescence intensity of specific binding on the concentration of of Wy-5a show no difference at 4uC or 37uC. Blank: is the
the aptamers to the equation Y = B max X/(Kd+X), using background fluorescence of untreated cells.
SigmaPlot (Jandel, San Rafael, CA) [25]. (TIF)
Table S1 Summary of Wy-5a binding to different cell
Proteinase treatment for cells lines.
PC-3 cells were washed twice on dish by PBS at room (DOC)
temperature, dissociated by 0.02% EDTA. After washed,
26105cells incubated with 200 ml of 0.05% trypsin or 0.1 mg/ Author Contributions
ml proteinase K at 37uC for 2, 5 and 10 min respectively. The Conceived and designed the experiments: DS XG YW YL TB. Performed
reaction was terminated by adding complete medium. After wash, the experiments: YW YL TB NZ. Analyzed the data: YW YL TB NZ DS
the treated cells were incubated with aptamer and applied for flow XG ZC ML. Contributed reagents/materials/analysis tools: ZC ML.
cytometry assay as described previously. Wrote the paper: YW YL TB DS XG.

References
1. World Health Organization (2008) World Cancer Report. IARC Press. 450 p. 8. Guess HA, Heyse JF, Gormley GJ (1993) The effect of finasteride on prostate-
2. Xia SJ, Cui D, Jiang Q (2012) An overview of prostate diseases and their specific antigen in men with benign prostatic hyperplasia. Prostate 22:31–7.
characteristics specific to Asian men. Asian J Androl 14:458–64. 9. Tchetgen MB, Song JT, Strawderman M, Jacobsen SJ, Oesterling JE (1996)
3. Siegel R, Naishadham D, Jemal A (2013) Cancer statistics, 2013. CA Cancer J Ejaculation increases the serum prostate-specific antigen concentration. Urology
Clin 63:11–30. 47:511–6.
4. Sim HG, Cheng CW (2005) Changing demography of prostate cancer in Asia. 10. Schröder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, et al. (2009)
Eur J Cancer 41:834–45. Screening and prostate-cancer mortality in a randomized European study.
5. Damber JE, Aus G (2008) Prostate cancer. Lancet 371:1710–21. N Engl J Med 360:1320–8.
6. Lin GW, Yao XD, Zhang SL, Dai B, Ma CG, et al. (2009) Prostate-specific 11. Andriole GL, Crawford ED, Grubb RL 3rd, Buys SS, Chia D, et al. (2009)
antigen half-life: a new predictor of progression-free survival and overall survival Mortality results from a randomized prostate-cancer screening trial. N Engl J
in Chinese prostate cancer patients. Asian J Androl 11:443–50. Med 360:1310–9.
7. Etzioni R, Urban N, Ramsey S, McIntosh M, Schwartz S, et al. (2003) The case 12. Kanwar JR, Mohan RR, Kanwar RK, Roy K, Bawa R (2010) Applications of
for early detection. Nat Rev Cancer 3:243–52. aptamers in nanodelivery systems in cancer, eye and inflammatory diseases.
Nanomedicine (Lond) 5:1435–45.

PLOS ONE | www.plosone.org 9 June 2014 | Volume 9 | Issue 6 | e100243

 Aptamer for Prostate Cancer

13. Jayasena SD (1999) Aptamers: an emerging class of molecules that rival 31. Shangguan D, Tang Z, Mallikaratchy P, Xiao Z, Tan W (2007) Optimization
antibodies in diagnostics. Clin Chem 45:1628–50. and modifications of aptamers selected from live cancer cell lines. Chembiochem
14. Breaker RR (2004) Natural and engineered nucleic acids as tools to explore 8:603–6.
biology. Nature 432:838–45. 32. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization
15. Osborne SE, Matsumura I, Ellington AD (1997) Aptamers as therapeutic and prediction. Nucleic Acids Res 31:3406–15.
diagnostic reagents: problems and prospects. Curr Opin Chem Biol 1:5–9. 33. Rimmele M (2003) Nucleic acid aptamers as tools and drugs: recent
16. Famulok M, Hartig JS, Mayer G (2007) Functional aptamers and aptazymes in developments. Chembiochem 4:963–71.
biotechnology, diagnostics, andtherapy. Chem Rev 107:3715–43. 34. Patil SD, Rhodes DG, Burgess DJ (2005) DNA-based therapeutics and DNA
17. Navani NK, Li Y (2006) Nucleic acid aptamers and enzymes as sensors. Curr delivery systems: a comprehensive review. AAPS 7:E61–77.
Opin Chem Biol 10:272–81. 35. Bubendorf L, Schöpfer A, Wagner U, Sauter G, Moch H, et al. (2000)
18. Jiang Y, Zhu C, Ling L, Wan L, Fang X, et al. (2003)Specific aptamer-protein Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients. Hum.
interaction studied by atomic force microscopy. Anal Chem 75:2112–6. Pathol 31:578–83.
19. Chen HW, Medley CD, Sefah K, Shangguan D, Tang Z, et al. (2008) Molecular 36. Pulukuri SM, Gondi CS, Lakka SS, Jutla A, Estes N, et al. (2005). RNA
recognition of small-cell lung cancer cells using aptamers. ChemMedChem interference-directed knockdown of urokinase plasminogen activator and
3:991–1001. urokinase plasminogen activator receptor inhibits prostate cancer cell invasion,
20. Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind survival, and tumorigenicity in vivo. J Biol Chem 280: 36529–40.
specific ligands. Nature 346:818–22. 37. Kovar JL, Johnson MA, Volcheck WM, Chen J, Simpson MA (2006)
21. Wessels JT, Busse AC, Mahrt J, Dullin C, Grabbe E, et al. (2007) In vivo
Hyaluronidase expression induces prostate tumor metastasis in an orthotopic
imaging in experimental preclinical tumor research—a review. Cytometry A
mouse model. Am J Pathol 169(4):1415–26.
71:542–9.
38. Montironi R, Mazzuccheli R, Scarpelli M, Lopez-Beltran A, Fellegara G, et al.
22. Keefe AD, Pai S, Ellington A (2010) Aptamers as therapeutics. Nat Rev Drug
(2005) Gleason grading of prostate cancer in needle biopsies or radical
Discov. 9:537–50.
prostatectomy specimens: contemporary approach, current clinical significance
23. Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential
and sources of pathology discrepancies. BJU Int 95:1146–52.
enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science
249:505–10. 39. Alberti C (2013) Taxane- and epothilone-based chemotherapy: from molecule
24. Shangguan D, Li Y, Tang Z, Cao ZC, Chen HW, et al. (2006) Aptamers evolved cargo cytoskeletal logistics to management of castration-resistant prostate
from live cells as effective molecular probes for cancerstudy. Proc Natl Acad Sci carcinoma. Eur Rev Med Pharmacol Sci 17:1658–64.
U S A 103:11838–43. 40. Zhou J, Rossi JJ (2011) Cell-specific aptamer-mediated targeted drug delivery.
25. Xiao Z, Shangguan D, Cao Z, Fang X, Tan W (2008) Cell-specific Oligonucleotides 21:1–10.
internalization study of an aptamer from whole cell selection. Chemistry 41. Min K, Jo H, Song K, Cho M, Chun YS, et al. (2011) Dual-aptamer-based
14:1769–75. delivery vehicle of doxorubicin to both PSMA (+) and PSMA (2) prostate
26. Shangguan D, Meng L, Cao ZC, Xiao Z, Fang X, et al. (2008) Identification of cancers. Biomaterials 32:2124–32.
liver cancer-specific aptamers using whole live cells. Anal Chem 80:721–8. 42. Sefah K, Shangguan D, Xiong X, O’Donoghue MB, Tan W (2010)
27. Zhang K, Sefah K, Tang L, Zhao Z, Zhu G, et al. (2012) A novel aptamer Development of DNA aptamers using Cell-SELEX. Nat Protoc 5:1169–85.
developed for breast cancer cell internalization. ChemMedChem 7:79–84. 43. Zhao Z, Xu L, Shi X, Tan W, Fang X, et al. (2009) Recognition of subtype non-
28. Kanwar JR, Roy K, Kanwar RK (2011) Chimeric aptamers in cancer cell- small cell lung cancer by DNA aptamers selected from living cells. Analyst
targeted drug delivery. Crit Rev Biochem Mol Biol 46:459–77. 134:1808–14.
29. Bing T, Yang X, Mei H, Cao Z, Shangguan D (2010) Conservative secondary 44. Robertson D, Savage K, Reis-Filho JS, Isacke CM (2008) Multiple immuno-
structure motif of streptavidin-binding aptamers generated by different fluorescence labelling of formalin-fixed paraffin-embedded (FFPE) tissue. BMC
laboratories. Bioorg Med Chem 18:1798–805. Cell Biol. 9:13.
30. Yang X, Bing T, Mei H, Fang C, Cao Z, et al. (2011) Characterization and 45. Gown AM (2008) Current issues in ER and HER2 testing by IHC in breast
application of a DNA aptamer binding to L-tryptophan. Analyst 136:577–85. cancer. Mod Pathol 21 Suppl 2:S8–15.

PLOS ONE | www.plosone.org 10 June 2014 | Volume 9 | Issue 6 | e100243