1248 Research Article

VPS35 regulates developing mouse hippocampal

neuronal morphogenesis by promoting retrograde
trafficking of BACE1
Chun-Lei Wang1, Fu-Lei Tang1, Yun Peng1, Cheng-Yong Shen1, Lin Mei1 and Wen-Cheng Xiong1,2,*
1
Institute of Molecular Medicine and Genetics, and Department of Neurology, Medical College of Georgia, Georgia Health Sciences University,
Augusta, GA 30912, USA
2
Charlie Norwood VA Medical Center, Augusta, GA 30912, USA
*Author for correspondence ([email protected])

Biology Open 1, 1248–1257

doi: 10.1242/bio.20122451
Received 4th July 2012
Accepted 17th September 2012

Summary
VPS35, a major component of the retromer, plays an BACE1 (b1-secretase) and altered BACE1 distribution.
important role in the selective endosome-to-Golgi retrieval of Suppression of BACE1 expression in CA1 neurons partially
membrane proteins. Dysfunction of retromer is a risk factor rescued both dendritic and axonal deficits induced by Vps35-
for neurodegenerative disorders, but its function in developing deficiency. These results thus demonstrate that BACE1 acts as
mouse brain remains poorly understood. Here we provide a critical cargo of retromer in vitro and in vivo, and suggest that
evidence for VPS35 promoting dendritic growth and VPS35 plays an essential role in regulating apical dendritic
maturation, and axonal protein transport in developing maturation and in preventing axonal spheroid formation in
Biology Open

mouse hippocampal neurons. Embryonic hippocampal developing hippocampal neurons.

CA1 neurons suppressing Vps35 expression by in utero
electroporation of its micro RNAs displayed shortened apical ß 2012. Published by The Company of Biologists Ltd. This is
dendrites, reduced dendritic spines, and swollen commissural an Open Access article distributed under the terms of the
axons in the neonatal stage, those deficits reflecting a defective Creative Commons Attribution Non-Commercial Share Alike
protein transport/trafficking in developing mouse neurons. License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Further mechanistic studies showed that Vps35 depletion in
neurons resulted in an impaired retrograde trafficking of Key words: VPS35, BACE1, Neural development

Introduction endosome-to-Golgi retrieval function has been well established in

Retromer, a protein complex initially identified in the yeast, is yeast, C. elegans, Drosophila, and in mammalian cultured cells,
essential for retrograde transport of numerous membrane proteins its role in mouse just began to be understood.
from the endosomes to the trans-Golgi network (TGN) (Seaman, Retromer is involved in the pathogenesis of neurodegenerative
2005; Bonifacino and Hurley, 2008). It contains two sub-protein disorders, including Alzheimer’s disease (AD) and Parkinson’s
complexes: one for the cargo-selection, and the other one for disease (PD). The cargo-selective retromer proteins VPS35 and
membrane deformation. The cargo-selective complex is a trimer VPS26 are decreased in the postmortem hippocampus of AD
of vacuolar protein sorting (Vps) proteins VPS35, VPS29, and patients (Small et al., 2005a). Genetic mutations of SorLA, a
VPS26 that sorts cargos into tubules for retrieval to the Golgi VPS10/sotililin family cargo of retromer, and Vps35 are
apparatus. The membrane deformation sub-complex consists of identified in late-onset AD (Rogaeva et al., 2007; Willnow et
sorting nexin (SNX) dimers (Vps5p and Vps17p in yeast, and al., 2010) and PD patients (Vilariño-Güell et al., 2011; Zimprich
sortin nexins 1/3 or 5/6 in vertebrates) (van Weering et al., 2010; et al., 2011), respectively. These observations suggest that
Seaman, 2005; Bonifacino and Hurley, 2008). A growing list of dysfunction of retromer complex may be a general risk factor
retromer cargos has been identified, including cation independent for a growing list of neurodegenerative disorders. This view is
mannose 6-phosphate receptors (CI-MRP) (Arighi et al., 2004), further supported by recent studies using genetically mutant
wntless (a ‘‘receptor’’ for Wnt morphogens) (Belenkaya et al., mouse models of retromer (Muhammad et al., 2008; Wen et al.,
2008; Eaton, 2008; Franch-Marro et al., 2008; Pan et al., 2008; 2011). Both Vps35 and Vps26 heterozygotes exhibit an increase
Port et al., 2008; Yang et al., 2008), Ced1 (a phagocytic receptor) in the production of amyloid b peptide (Ab) (Muhammad et al.,
(Chen et al., 2010), VPS10/sotilin family proteins, such as VPS10 2008; Wen et al., 2011), a 40–42 amino acid peptide derived
in yeast (Iwaki et al., 2006), sortilin and sortilin-related receptor from b- and c-secretase cleavage of APP that is believed to be a
(SorL1 or SorCS1) in vertebrates (Canuel et al., 2008; Kim et al., major culprit of AD. In addition, Vps35 heterozygotes in Tg2576
2010; Okada et al., 2010), and G-protein coupled receptors (e.g., mouse model of AD show earlier onset and enhanced AD-like
Parathyroid hormone receptor and b2-adrenonergic receptor) neuropathology (Wen et al., 2011). Further mechanistic cellular
(Feinstein et al., 2011; Temkin et al., 2011). Although retromer’s studies suggest that loss of retromer function may alter the
 VPS35 in developing hippocampus 1249

trafficking of its cargos, including SorLA, APP, and BACE1,

resulting in an increased Ab production and enhanced AD
neuropathology (Vieira et al., 2010; Willnow et al., 2010; Finan
et al., 2011; Wen et al., 2011). However, the exact mechanism
remains exclusive.
In order to study retromer’s function, we have generated Vps35
mutant mouse, as VPS35 is a major component of retromer cargo
recognition complex and is responsible for cargo recognition and
the complex assembly (Seaman, 2005; Bonifacino and Hurley,
2008; McGough and Cullen, 2011). While hemizygous deletion of
Vps35 gene in Tg2576 mouse model of AD leads to an earlier-onset
AD-like phenotypes, homozygous died early during embryonic
development (,E10, before neurogenesis) (Wen et al., 2011),
preventing us from using this genetic model to address VPS35’s
function during mouse development. We thus used the RNA
interference (RNAi) technology and the in utero electroporation
assay to address this issue. Here, we showed that expression of
miRNAs that suppress Vps35 expression in developing mouse CA1
neurons results in shortened apical dendrites, reduced dendritic
spines, and swollen axons. These results suggest a role for
VPS35/retromer in dendritic arborization or maturation and in
preventing axonal spheroid formation during neonatal hippocampal Fig. 1. Vps35 expression in developing mouse hippocampus. (A) Detection
development. We further investigated the underlying mechanisms of enzymatic LacZ activity in developing Vps35+/m hippocampus. At the
and found that Vps35 depletion in hippocampal neurons resulted in neonatal brain (e.g., P10–P15), LacZ activity detected in CA1–3 hippocampus
was at its peak level. DG and CA1–3 in hippocampus are indicated. Scale bar:
an impaired retrograde trafficking of BACE1 and altered BACE1 200 mm. (B) Western blot analysis of VPS35 protein levels in lysates from
distribution. Suppression of BACE1 expression rescued Vps35 Vps35+/+ and +/m mouse hippocampus during development. Again, a highest
Biology Open

deficiency induced deficits, suggesting a role of BACE1 in level of VPS35 protein was detected in P15 hippocampus. Note that ,50%
contributing to the Vps35 deficiency induced phenotypes during reduction of VPS35 protein was found in lysates from Vps35+/m mice,
demonstrating the antibody specificity.
development. These results thus demonstrate a critical role for
VPS35 in developing hippocampal neurons and yield insights into
further mechanisms of retromer regulated AD pathogenesis in
progenitor cells of CA1 pyramidal neurons in mouse hippocam-
mature neurons.
pus at E15.5 also markedly suppressed endogenous Vps35
expression (supplementary material Fig. S1E). At P10, the
Results
majority of miR-Vps35 transfected neurons had migrated to
Shortened apical dendrites and swollen axons in Vps35
deficient CA1 neurons
pyramidal cell layer of hippocampal CA1 region, however, a
To investigate possible functions of VPS35 in hippocampal mild but significant migration defect was observed in miR-
neurons, we first examined VPS35’s expression in developing Vps35-1 neurons: ,13% of neurons were mislocated out of
and adult mouse hippocampus by taking advantage of the pyramidal cell layer as compared to ,5% in control
Vps35+/m mouse, in which the LacZ gene was ‘‘knocked-in’’ in (supplementary material Fig. S2). This migration defect was
the intron of the Vps35 gene, thus, LacZ expression is controlled not observed in miR-Vps35-3 neurons (,5% mis-distribution),
by the promoter of the Vps35 gene (Wen et al., 2011). The b-gal suggesting that the migration defect happens when VPS35
activity was weakly and diffusely distributed in the hippocampal protein level was largely reduced. In addition, the apical
region of E15.5 mouse embryos, and became highly restricted to dendrites of miR-Vps35-1 neurons were much shorter as
CA1–3 regions of the hippocampus in neonatal stage [e.g., compared to that of control neurons, which formed apical
postnatal day 10 (P10)] (Fig. 1A). The expression appeared to be dendritic tufts in the superficial region of CA1 (Fig. 2A,B). The
peaked at the neonatal stage (P10–P15) of the hippocampus miR-Vps35-3 apical dendrites also displayed a similar but less
(Fig. 1A), and this view was also supported by the Western blot severe phenotype as compared to that of miR-Vps35-1
analysis (Fig. 1B). As P10–P15 is a critical time-window for the (Fig. 2B,C), suggesting a Vps35 dose-dependency. The shortened
establishment of axonal–dendritic sorting, synaptogenesis, and apical dendrite phenotype developed initially at P7, a stage when
circuitry of hippocampal neurons, the peak level of VPS35 control apical dendrites have not fully arborized (supplementary
expression at P10–P15 thus implicate VPS35 in these events. material Fig. S2). The loss of apical dendritic tufts in miR-
We next examined VPS35’s function in developing mouse Vps35-1 expressing CA1 neurons was not corrected at later
CA1 neurons by use of the RNA interference (RNAi) technology stages of the development (e.g., P14 and P25) (Fig. 2C).
and an in utero electroporation assay (supplementary material Moreover, a reduced dendritic spine density with an increased
Fig. S1A–C). Several miRNA-Vps35 (miR-Vps35) constructs spine head size was also observed in the Vps35 deficient CA1
targeting different exons of Vps35 were generated, and miR- neurons (Fig. 2D–F). These morphological dendritic defects
Vps35-1 and miR-Vps35-3 showed high and medial efficiency in suggest the importance of VPS35/retromer in promoting CA1
knocking down Vps35 expression in HEK 293 cells, respectively, dendritic growth or maturation in developing CA1 neurons, and
determined by Western blot assay (supplementary material Fig. reveal a role for VPS35 in keeping healthy dendritic spine
S1D). The in utero electroporation of miR-Vps35-1 into the structure, which is critical for synapse formation and function.
 VPS35 in developing hippocampus 1250

Fig. 2. Defective apical dendritic

arborization and impaired spine
morphology in Vps35 deficient mouse
CA1 neurons. (A) Schematic
illustration of the in utero
electroporation experiments. Control
and miRNA-Vps35 (miR-Vps35)
constructs were in utero electroporated
into E15.5 brains, and neurons and their
dendrites in the hippocampal CA1
region were examined at P10, P14, or
P25 postnatal stages. All images were
counter-stained with Topro-3 (blue).
(B) Shortened apical dendrites at P10
by miR-Vps35-1 and -3 electroporation
compared to control dendrites. A blank
area (yellow arrows) between the distal
end of dendrites and pia surface (dotted
line) was observed in Vps35-
suppressed CA1 regions. Scale bar:
100 mm. (C) Quantification of apical
dendritic lengths at different postnatal
stages. *P,0.01, n53–4 brains for each
group. (D) Impaired spine morphology
in basal and apical dendrites at P25 by
miR-Vps35-1 electroporation compared
to the control. Scale bar: 10 mm.
(E,F) Quantification of spine density
(E) and spine head size (F) in basal and
apical dendrites. *P,0.01, n5300
spines from 3 different brains for
each group.
Biology Open

We then asked if CA1 neuronal axonal outgrowth and and miR-Vps35 expressing neurons (data not shown). However,
morphology were affected by suppression of Vps35 expression. in comparing with the control miRNA expressing axons in the
Hippocampal commissures (HCC), which contain most axons HCC, a marked increase of axonal swellings or spheroid
from CA1 neurons, were examined, and no significant defect was formation (viewed by GFP with area size . 10 mm2) was
observed in viewing axonal length/outgrowth between the control observed in Vps35 deficient axons (Fig. 3A–C). The axonal

Fig. 3. Axonal spheroids in Vps35 deficient

mouse CA1 neurons. (A) In utero
electroporation of control, miR-Vps35-1 or -3
was performed at E15.5 and brains were
examined at P10, P14, and P25. All images were
counter-stained with Topro-3 (blue). Axonal
morphology in HCC region was examined.
(B) Representative images for increased axonal
spheroids in HCC region at P10 by miR-Vps35-1
and -3. Dotted blue lines indicate the midline of
the brain. Scale bar: 50 mm. (C) Quantification
of axonal swelling size. *P,0.01, n5300
spheroids from 6 different brains for each group.
(D) More severe spheroid formation on the
contralateral side of HCC than that on the
ipsilateral side. The spatial distribution pattern of
axonal spheroids by miR-Vps35-1
electroporation was quantified and illustrated,
and each dot represents a spheroid with size
. 10 mm2. Data were from 6 brains at P10.
 VPS35 in developing hippocampus 1251

spheroid formation appeared to be more severe in the distal axons due to Vps35 deficiency. Interestingly, APP and BACE1, but not
or in HCC after crossing midline as compared with that before SorLA, were identified in the spheroids (Fig. 4A,B,D). Also detected
crossing (Fig. 3D), and more obvious in miR-Vps35-1 expressing in the spheroids was the late endosome/early lysosome marker,
neurons as compared with that of miR-Vps35-3 (Fig. 3B,C). The LAMP1, but not early endosome marker, EEA1 (Fig. 4A,D). The
axonal spheroid phenotype was not confined to HCC, but also absence of SorLA and EEA1 signals in the spheroids was not due to
present in callosal axons (CC) from cortical pyramidal neurons the inefficiency of the antibodies, as these antibodies recognized
(data not shown). SorLA and EEA1 proteins as punctae patterns in CA1 soma
Taken together, loss of VPS35 expression in hippocampal neurons and dendritic, particular basal dendritic compartments (Fig. 4B).
caused apical dendrite growth defects, spine malformation, and Together, these results implicate that BACE1 and APP, possibly in
swollen commissural axons, particularly in distal regions of dendrites the late endosomes, may require VPS35/retromer for their retrograde
and axons, during hippocampal development. trafficking.
We further tested this view by examining BACE1’s
Defective retrograde trafficking of BACE1 in Vps35 deficient distribution and trafficking in Vps35 deficient neurons in
hippocampal neurons culture and in vivo using BACE1-mCherry. BACE1-mCherry
The axonal swellings in Vps35 deficient neurons may reflect in a was predominantly distributed at the peri-nuclear vesicles, close
defective protein transport or trafficking. We thus examined if to Golgi apparatus in the soma, and dendritic compartments of
retromer cargos, including APP, SorLA, and BACE1, or subcellular control neurons in culture (Fig. 5A–C). In contrast, the BACE1
organelles (early and late endosomes) were ‘‘trapped’’ in the spheroids punctae in Vps35 depleted neurons were enlarged in size, and no
Biology Open

Fig. 4. Protein components in axonal spheroids induced by Vps35 deficiency. (A,B) In utero electroporation with miR-Vps35-1 was performed at E15.5 and brain
slices at P14 were immunostained with different antibodies (APP, SORLA, EEA1 and LAMP1). Projected images from z-stack confocal scanning showing
immunosignal (red) in HCC (A) and cell body (B) regions. Note that APP and LAMP1, but not SORLA and EEA1, appeared to be enriched in spheroids (A). Scale
bar: 2.5 mm (A); 5.0 mm (B). (C) Co-electroporation of miR-Vps35-1 with BACE1-mCherry was performed at E15.5 and brain slices at P10 were scanned under
confocal microscope. Note that BACE1-mCherry fusion proteins (red) were enriched in spheroids. Scale bar: 50 mm. (D) The percentages of spheroids enriched in
indicated proteins were quantified. APP: 93.8%, n516; SORLA: 0%, n518; EEA1: 0%, n510; LAMP1: 95.2%, n521; BACE1-mCherry: 100%, n550.
 VPS35 in developing hippocampus 1252

longer confined to the Golgi apparatus (Fig. 5A–C), suggesting exhibited both active anterograde and retrograde movement
the necessity of VPS35 in enriching BACE1 localization to the along neurites in the control neurons (Fig. 7A–D). In contrast,
Golgi apparatus and proximal dendrites in neurons. Also Vps35 depletion resulted in a defective retrograde movement of
observed was GFP ‘‘aggregates’’ or spheroid-like punctae in BACE1-mCherry towards the soma, without obvious effect on its
Vps35 deficient neurites (Fig. 5D,E). Further support for Vps35 anterograde movement (Fig. 7A–D). Consequently, the ratio of
regulating BACE1 trafficking in vivo was the observation of BACE1-mCherry vesicle in the stationary phase was increased in
altered BACE1-mCherry distribution in Vps35 deficient mouse the Vps35 deficient neurons (Fig. 7E). These results thus
CA1 neurons by in utero electroporation (Fig. 6). It was largely demonstrate that Vps35 depletion impaired retrograde
distributed in the major apical dendrites of the control CA1 trafficking/transport of BACE1 in neurons.
neurons, with peak level at the apical side of proximal dendrites,
where Golgi or TGN is located (Fig. 6A,B) (data not shown). Rescue of Vps35 deficiency induced dendritic and axonal
However, in CA1 neurons expressing miR-Vps35-1, BACE1- deficits in CA1 neurons suppressing BACE-1 expression
mCherry was distributed in both apical and basal dendrites We next asked if BACE1 contributes to Vps35 deficiency
without the enrichment at the proximal apical dendrites induced CA1 neuropathology. To this end, we examined whether
(Fig. 6B,C). Many BACE1-puncta were shifted to the basal suppressing BACE1 can rescue Vps35 deficiency induced
side (Fig. 6C) and enlarged in size (Fig. 6D), in addition to be dendritic and/or axonal phenotypes. The plasmids encoding
detected in the axonal spheroids in Vps35 deficient CA1 neurons miRNA-Bace1 (miR-Bace1) were generated, and the miR-
(Fig. 6E). These results suggest that VPS35 may promote Bace1-1 suppressed BACE1 expression specifically and
endosome-to-Golgi retrograde trafficking of BACE1 not only efficiently (supplementary material Fig. S3A). This plasmid
in primary rat hippocampal neurons, but also in mouse CA1 was thus co-electroporated with miR-Vps35-1 in mouse embryos
neurons, not only in dendrites, but also in axons. (E15.5), and their apical dendrites and axons at P10 were
To further test if BACE1’s retrograde trafficking is affected in evaluated in comparison with that expressing miR-Vps35-1 with
Vps35 deficient neurons, we viewed BACE1-mCherry’s the control (Fig. 8A). Remarkably, both distal dendritic loss and
movement in control and Vps35 depleted neurons by time- axonal spheroid formation were greatly rescued when miR-
lapse imaging analysis. BACE1-mCherry labeled vesicles Bace1-1 was co-expressed (Fig. 8A–C). This rescue effect was
Biology Open

Fig. 5. Altered BACE1 distribution in primary hippocampal neurons expressing miR-Vps35-1. Co-transfection of BACE1-mCherry with control or miR-Vps35-
1 was performed in primary rat hippocampal neurons (E18) at DIV 5. Confocal imaging analysis of transfected neurons at DIV 9 was carried out and representative
images were shown (A,D). Scale bar: 5 mm. The middle and lower panels showed the amplified images of the boxed areas. (B) Quantification analysis of the density
of BACE1-mCherry fluorescence crossing the lines indicated in lower panels of A. (C) Quantification analysis of the percentage of BACE1-mCherry puncta in soma
(black column) vs dendrite (orange column) regions. (E) Quantification analysis of the size of GFP-aggregates from D. The sizes of the top 100 GFP aggregates were
showed as the grouped column scatter. The line in the scatter indicated the median. *, P,0.05.
 VPS35 in developing hippocampus 1253

not due to the inhibition of miR-Vps35-1’s suppressing activity

on Vps35 expression, as Vps35’s expression in CA1 neurons
was also markedly reduced by both electroporations (miR-
Vps35+control vs miR-Vps35-1+miR-Bace1) (supplementary
material Fig. S3B). These results suggest that the morphological
changes in Vps35 deficient CA1 neurons are BACE1-dependent.

Discussion
In this paper, we showed that loss of Vps35 expression in
developing mouse hippocampal neurons results in developmental
defects, including shorter apical dendrites, reduced dendritic
spines, and increased swollen axons. We further showed that
BACE1, a critical cargo of retromer in CA1 neurons, contributes
to Vps35 deficiency induced CA1 neuropathology during
development. These observations thus establish an important role
for VPS35 in promoting retrograde transport of BACE1 in
developing hippocampal neurons, leading to a working model
depicted in Fig. 8D, and providing insights into the pathogenesis
of neurodegenerative disorders in adults.
Using in utero electroporation of miRNA to suppress Vps35
expression in embryonic CA1 neurons in a wild type background,
we are able to assess the cell autonomous function of
Vps35/retromer during mouse hippocampal development. The
morphological phenotypes due to Vps35 depletion in developing
CA1 neurons suggest a dependence of VPS35/retromer in
hippocampal neuron morphogenesis in vivo. In carefully
Biology Open

examining the phenotypes, it was revealed that the loss of apical

dendritic tuft was restricted to the distal, but not proximal, regions of
Vps35 deficient CA1 neurons, and the axonal swollen were more
severe in HCC after midline crossing (Fig. 3D). These observations
thus suggest that VPS35/retromer may have a more important role in
the distal regions of dendrites and axons, implicating a neuronal
regional dependence of VPS35. The regional dependence between
proximal and distal dendrites of CA1 neurons is also reported in
adult rat hippocampal slices, in which L-LTD (longer-lasting forms
of long term depression) is induced in the distal, but not proximal,
apical dendrites of CA1 neurons (Parvez et al., 2010). In addition,
the cytoplasmic dynein heavy chain 1, a motor moving toward the
minus ends of microtubules, also functions in a regional dependent
manner (Hirokawa et al., 2010). It is essential for retrograde
transport of cargos in distal dendrites and axons, but not in proximal
dendrites, where dynein conveys cargos to both the periphery and
soma regions (Hirokawa et al., 2010) (Fig. 8D). This regional
dependent dynein-mediated transport is believed due to the mixed
polarity of the microtubules in the proximal dendrites, but highly
Fig. 6. Altered BACE1 distribution in Vps35 deficient mouse CA1
neurons. Co-electroporation of BACE1-mCherry with control miRNA or miR- polarized microtubules in the distal dendrites and axons (Conde and
Vps35-1 was performed at E15.5 embryos in utero and brain slices were Cáceres, 2009; Hirokawa et al., 2010). In light of these observations,
examined at P10. (A) Representative images showing BACE1-mCherry we speculate that the regional dependent phenotypes in Vps35
distribution in the proximal apical dendrites of the CA1 neurons. Inserts of deficient CA1 neurons may reflect in its function in promoting
enlarged images showing basal shift of BACE-mCherry signal in VPS35
deficient neurons. Scale bar: 5 mm. (B) Sample images at higher magnification dynein mediated retrograde transport of cargos (Fig. 8D). Further
showing BACE1-mCherry aggregation and basally shifted redistribution. Scale support for this view are observations that SNX5/6, a subcomponent
bar: 2.5 mm. (C) Quantification analysis of BACE1-mCherry distribution in of retromer, interacts with not only BACE1 (Okada et al., 2010), but
miR-VPS35-1 neurons and control neurons. Basal shift index (BSI; see also p150Glued component of dynactin, an activator of dynein motor
Materials and Methods) was introduced to judge the degree of BACE-mCherry
complex (Hong et al., 2009; Wassmer et al., 2009), and that
redistribution from apical to basal side of the neuron. Bars showing average BSI
(Control: 46.8; miR-VPS35-1: 87.5; n554 from 3 brains for each group). impaired retrograde, but not anterograde, movement of BACE1 was
(D) Quantification analysis of BACE1-mCherry aggregation in miR-VPS35-1 observed in Vps35 deficient neurons (Fig. 7). These results thus
neurons and control neurons. The size of BACE1-mCherry puncta was reveal a molecular link underlying VPS35/retromer regulating
measured (see Materials and Methods) (n5300 from 3 brains for each group). dynein mediated retrograde transport (Fig. 8D).
The bars showing average size of BACE1-mCherry puncta (Control: 0.57 mm2;
miR-VPS35-1: 1.29 mm2). (E) Representative images of BACE1-mCherry BACE1, an essential membrane proteinase for APP metabolism,
distribution in control and Vps35 deficient CA1 axons in HCC region. Scale is involved in AD pathogenesis (Vassar and Kandalepas, 2011). It
bar: 50 mm. is believed to be a cargo of retromer based on cell culture studies
 VPS35 in developing hippocampus 1254
Biology Open

Fig. 7. Defective BACE1-mCherry retrograde trafficking in primary hippocampal neurons expressing miR-Vps35-1. (A) Representative images showing
distribution patterns of BACE1-labeled vesicles in control and miR-Vps35-1 expressing hippocampal neurons. Neurons were co-transfected with BACE1-mCherry
with control and miR-Vps35-1 at DIV5 and followed by time-lapse imaging analysis 48 hours after transfection. Scale bar: 2 mm. (B) Representative kymographs
showing the mobility of BACE1 positive vesicles/endosomes during 15-min recordings in control and miR-Vps35 expressing neurons. Vertical lines represent
stationary BACE1-vesicles; oblique lines or curves to the right represent anterograde movements and lines to the left indicate retrograde transport. (C–E) Relative
mobility (anterograde, retrograde, and stationary) of BACE1-vesicles in control and miR-Vps35-1 expressing neurons. Data were quantified from the total number of
17 BACE1-vesicles in neurons from .3 experiments, as indicated in parentheses. Error bars: S.D. *P,0.01.
 VPS35 in developing hippocampus 1255
Biology Open

Fig. 8. Rescue of Vps35 deficiency induced axonal spheroids and apical dendritic arborization defect by suppressing BACE1 expression. Co-electroporation
of miR-VPS35-1 with control construct or miR-BACE1 was performed at E15.5 in utero and brains were examined at P10. (A) Effects of miR-BACE1 on miR-
VPS35 induced axon- and dendrite-defects. Upper panels, similar distribution pattern and cell density of electroporated cells between miR-VPS35-1+control and
miR-VPS35-1+miR-BACE1 shown in low magnification. Middle panels, apical dendrites in the distal region were much longer in miR-VPS35-1+miR-BACE1 than
in miR-VPS35-1+control. Lower panels, spheroids in miR-VPS35-1+miR-BACE1 expressing axons in HCC and CC regions were greatly reduced compared to that in
miR-VPS35-1+control. Scale bar: 50 mm. (B) Quantification of apical dendrite growth by measuring normalized length of apical dendrites. miR-VPS35-1+miR-
BACE1 expression dendrites were significantly longer than control miR-VPS35-1 dendrites (*P,0.01). (C) Quantification of axon spheroid formation by measuring
the size of swellings in commissural axons (n5300 from 3 brains for each group). Bars showing average size of selected swellings (miR-VPS35-1+control: 9.16 mm2;
miR-VPS35-1+miR-BACE1: 5.36 mm2). The percentage of spheroids (.10 mm2) is 29% for miR-VPS35-1+control and 5% for miR-VPS35-1+miR-BACE1.
(D) Schematic illustration of a working model for VPS35 containing retromer in promoting retrograde transport of BACE1.

(Okada et al., 2010; Finan et al., 2011). Our current work supports implicated in actin remodeling as it interacts with WASH protein
this notion and provides further evidence for BACE1 as a cargo of complex (Seaman, 2007; Gomez and Billadeau, 2009; Harbour et
retromer not only in neuronal culture but also in mouse. Our al., 2012), an important complex for actin remodeling, receptor
studies also suggest that the BACE1 contributes to the Vps35 endocytosis, and tubulin cross talk. Thus, it is conceivable that
deficiency induced phenotypes, as suppressing BACE1 expression loss of Vps35 function may results in an impaired WASH1
in CA1 neurons rescued the phenotypes (Fig. 8), revealing the mediated actin remodeling in dendrites, leading to a reduction in
importance to control BACE1 trafficking and distribution by dendritic spine density but increase in the spine head size.
retromer. However, this speculation requires further investigation.
In addition to a defective retrograde trafficking of BACE1, It is worth noting that VPS35 deficiency induced dendritic and
Vps35 depletion in CA1 neurons also results in a loss of dendritic axonal phenotypes in developing brain resemble to the
spine. Dendritic spines are small actin-rich protrusions that form morphological changes observed in neurodegenerative diseases
the postsynaptic part of most excitatory synapses (Hoogenraad in adult. However, we did not observe obvious neuronal loss even
and Akhmanova, 2010). They are highly dynamic structures and at 6-month-old Vps35+/m mice (data not shown), suggesting that
play crucial roles in synaptic functions during learning and ,50% reduction in VPS35 expression alone in neurons does not
memory (Hoogenraad and Akhmanova, 2010; Svitkina et al., result in neurodegeneration in young animals. Due to the
2010). It is unclear how VPS35 regulates dendritic spine limitation of our in vivo knock-down approach, which does not
dynamics. The decreased dendritic spines may be due to a allow longer term (e.g., . 40 days after electroporation)
defective membrane protein trafficking and/or actin remodeling expression of the miRNAs, we are unable to address whether
in Vps35 deficient CA1 neurons. In fact, retromer/VPS35 is VPS35 deficiency causes neuronal degeneration in older mice.
 VPS35 in developing hippocampus 1256

This will again need more systematic studies by employing ferricyanide, and 0.1% X-gal) in dark at 37 ˚C for 8 hours as described previously
(Lee et al., 2010; Zhou et al., 2010; Wen et al., 2011).
strategies such as conditional knock-out of Vps35. Nevertheless,
the molecular mechanisms for VPS35 deficiency induced deficits
In utero electroporation
in developing hippocampus may facilitate the pathogenic The in utero electroporation was carried out as described previously with some
dissection of mechanisms underlying Vps35-loss associated modifications (Wang et al., 2007). Briefly, pregnant mice at E15.5 anesthetized
neurodegeneration in mature neurons. and maintained through isoflurane inhalation were subjected to abdominal incision
to expose the uterus. Through the uterine wall, embryos were visualized, and
In summary, the data presented in this manuscript suggest an plasmids (1.5 mg/ml for each) were injected into the lateral ventricle through a
important function of VPS35 in dendritic growth or maturation glass capillary. Embryos will then subjected to electroporation (ten 50-ms, 33v
and in preventing axonal spheroid formation during mouse pulses at an interval of 1 s) through ECM-830 (BTX, Holliston, MA). Uterine
horns were repositioned into the abdominal cavity before the abdominal wall and
hippocampal development. These functions may be due to the skin were sutured. Pups were reared to different postnatal stages. Under deep
retromer regulation of dynactin/dynein mediated retrograde anesthesia, mice were perfused transcardially with 0.1 m phosphate buffer (PBS)
transport of membrane proteins, such as BACE1. It remains an followed by 4% paraformaldehyde in PBS, pH 7.4. At each time-point, at least six
open question whether the early developmental defects induced pups (three for each construct mix) were used for data analysis in each set of
experiments. The brains of the pups were overnight-fixed and cut into floating
by VPS35 deficiency may partially contribute to the evolvement slices at different thickness according to the age (80 mm for P10, 100 mm for P14
of neurodegeneration by VPS35 mutation observed in human and 120 mm for P.21) using Leica vibratome cutting system. The slices were
genetic diseases including AD and PD. subjected to the confocal imaging analyses.

Materials and Methods Immunofluorescence staining and confocal imaging analysis

For immunofluorescence staining of brain slices, age-matched electroporated
Reagents and animals littermates were perfused transcardially with 4% paraformaldehyde in PBS and
Rabbit polyclonal anti-VPS35 antibody was generated using the antigen of GST–
brain tissues were post-fixed at 4 ˚C for 24 hours. Floating slices (50 mm in
VPS35D1 fusion protein as described (Small et al., 2005b; Wen et al., 2011). thickness) were incubated with indicated 1st and 2nd antibodies as described
Vps35 mutant mice were generated by injection of mutant embryonic stem (ES) previously (Wen et al., 2011). The immunostained slices were then incubated with
cells obtained from Bay Genomics as described previously (Wen et al., 2011). The the PBS for an hour before imaging. For immunofluorescence staining analysis of
wild type pregnant mice in CD1 background were used for in utero transfected neurons, primary cultured neurons on the coverslips were fixed with
electroporation. All experimental procedures were approved by the Animal 4% paraformaldehyde and 4% sucrose at room temperature for 45 min,
Subjects Committee at the Georgia Health Sciences University, according to US permeabilized in 0.15% Triton X-100 for 8 min, and then subjected to co-
National Institutes of Health guidelines. immunostaining analysis using indicated antibodies as described previously (Zhu
et al., 2007). Confocal images were obtained using Nikon C1 confocal system (for
Biology Open

Expression plasmids brain slices) or Zeiss LSM 510 (for culture neurons).
The miRNA-Vps35 or miRNA-BACE1 expression vectors were initially generated
by the BLOCK-iT Pol II miR RNAi expression System (Invitrogen, Carlsbad, CA) Image acquisition and data analysis
according to the manufacturer’s instruction (Wen et al., 2011). Oligonucleotide All the measurements on the brain sections were performed at the approximate
sequences for miRNA constructs were below. level of bregma 22.18. For analysis of apical dendritic length of CA1 pyramidal
miR-VPS35-1: neurons, the total area of EGFP labeled apical dendrites from the exit point of
59 TGCTGTAACGTTCCACATTTACACCTGTTTTGGCCACTGACTGACA- pyramidal cell layer to the distal end of apical dendrites were measured and
GGTGTAAGTGGAACGTTA39 (sense); normalized to the total area from the exit point of pyramidal cell layer to the pia
59 CCTGTAACGTTCCACTTACACCTGTCAGTCAGTGGCCAAAACAGG- surface (the boundary between CA1 and dentate gyrus). One normalized value of
TGTAAATGTGGAACGTTAC39 (antisense); apical dendrite length was obtained from one brain and a total of 3–4 brains were
Targeting sequence: AGGTGTAAATGTGGAACGTTA measured for each group. For analysis of spine morphology, a total of about 2 mm
miR-VPS35-3: dendrites from 3 brains for each group were examined. Spine density was
59 TGCTGTAATTCAGCCAGCTCAGCTTTGTTTTGGCCACTGACTGACA- calculated as the average number on a 20 mm length scale. For analysis of spine
AAGCTGATGGCTGAATTA39 (sense); size, 100 largest spines from each section (one section from one brain) were
59 CCTGTAATTCAGCCATCAGCTTTGTCAGTCAGTGGCCAAAACAAA- identified and their head sizes were measured. 300 values of each group were
GTGAGCTGGCTGAATTAC39 (antisense); pooled together for comparison between groups. For analysis of axonal spheroid
Targeting sequence: AAAGCTGAGCTGGCTGAATTA formation in commissural axons, the sizes of 100 largest swellings from each
miR-BACE1: section (one section from one brain) were measured and a total of 3 brains were
59 TGCTGAATGTTGGCACGCACAGTGACGTTTTGGCCACTGACTGAC- examined for each group. 300 values of each group were pooled together for
GCACTGTGTGCCAACATT39 (sense); comparison between groups. For analysis of distribution pattern of axonal
59 CCTGAATGTTGGCACACAGTGACGTCAGTCAGTGGCCAAAACGTC- spheroids, the sizes of axonal swellings (. 10 mm2) and their distances relative to
ACTGTGCGTGCCAACATTC39 (antisense); the brain midline were measured and a total of 6 brains electroporated with
Targeting sequence: GTCACTGTGCGTGCCAACATT miVPS35-1 were examined. The size and distance of each spheroid was plotted.
The miRNA sequence fragments were initially subcloned into pcDNATM For analysis of BACE1-mCherry puncta size, 5 neurons from one brain were
6.2-GW/EmGFP-miR vector. To allow miRNA plasmids suitable for in vivo randomly chosen and 20 largest punctae from each neuron were measured for their
expression, the miRNA sequence fragments in pcDNATM6.2-GW/EmGFP-miR sizes. A total of 300 punctae from each group (n53) were pooled together for
vector were released by SalI and XhoI restriction digestion and subcloned into comparison between groups. For analysis of BACE-mCherry distribution, the ratio
CAG-IRES-EGFP expression plasmid at the XhoI site. Their suppressing effects of BACE1-mCherry intensity on the basal side to that on the apical side was
were verified by Western blot analysis of lysates co-expressing miRNA plasmids calculated and the ratio6100 was defined as a basal shift index. The values in each
with Vps35 or BACE1 expressing plasmids. group (n554 from 3 animals) were pooled together for comparison between
The cDNAs encoding full length Vps35 was amplified by PCR and sub-cloned groups.
into mammalian expression vectors downstream of a signal peptide and a Flag
epitope tag (MDYKDDDDKGP) and under control of the CMV promoter as
described previously (Ren et al., 2004; Xie et al., 2005; Wen et al., 2011). The
Cell culture, transient transfection, and kymographs
HEK293 cells were maintained in Dulbecco modified Eagle medium
plasmid encoding BACE1-mCherry was generated by fusion of the mCherry to the
supplemented with 10% fetal calf serum, and 100 units/mL of penicillin G and
C-terminus of the RT-PCR amplified mouse BACE1 in a mammalian expression
streptomycin (Gibco). Primary rat E18 hippocampal neurons were cultured as
vector under control of the CAG promoter. The plasmid of BACE1-HA was kindly
previously described (Zhu et al., 2007). Calcium phosphate method was used for
provided by Dr R.Q. Yan (Cleveland Clinic) (He et al., 2004). The authenticity of
transfection of HEK293 cells. Forty-eight hours following transfection, cells were
all constructs was verified by DNA sequencing and Western blot analysis.
lysed in modified RIPA immunoprecipitation assay buffer (50 mM Tris-HCl,
pH 7.4, 150 mM sodium chloride, 1% NP40, 0.25% sodium-deoxycholate,
b-Gal detection proteinase inhibitors). Lysates and medium were subjected to immunoblotting
Whole amount Vps35+/m embryos at different stage of development or brain analyses. Neurons were transfected with various constructs at DIV3 using the
sections derived from various stages of Vps35+/m embryos were fixed with 0.5% calcium phosphate method followed by immunocytochemistry or time-lapse
glutaraldehyde and incubated with X-gal solution (2 mM MgCl2, 5 mM potassium imaging analysis 48 hours after transfection as described previously (Zhu et al.,
 VPS35 in developing hippocampus 1257

2007; Liu et al., 2012). Kymographs were made using extra plugins for ImageJ Muhammad, A., Flores, I., Zhang, H., Yu, R., Staniszewski, A., Planel, E., Herman,
(NIH). The height of the kymographs represents recording time (15 min), and the M., Ho, L., Kreber, R., Honig, L. S. et al. (2008). Retromer deficiency observed in
width represents the length (in mm) of the neurite imaged. Alzheimer’s disease causes hippocampal dysfunction, neurodegeneration, and Ab
accumulation. Proc. Natl. Acad. Sci. USA 105, 7327-7332.
Okada, H., Zhang, W., Peterhoff, C., Hwang, J. C., Nixon, R. A., Ryu, S. H. and
Statistical analysis Kim, T. W. (2010). Proteomic identification of sorting nexin 6 as a negative regulator
Images are representative from at least three repeats. All data were expressed as of BACE1-mediated APP processing. FASEB J. 24, 2783-2794.
mean 6 SD. All data were analyzed by Student’s T-test. The significance level Pan, C. L., Baum, P. D., Gu, M., Jorgensen, E. M., Clark, S. G. and Garriga,
was set at P,0.05. G. (2008). C. elegans AP-2 and retromer control Wnt signaling by regulating mig-14/
Wntless. Dev. Cell 14, 132-139.
Parvez, S., Ramachandran, B. and Frey, J. U. (2010). Functional differences between
Acknowledgements and across different regions of the apical branch of hippocampal CA1 dendrites with
We thank Drs Tae-Wan Kim and Riqiang Yan for reagents, and respect to long-term depression induction and synaptic cross-tagging. J. Neurosci. 30,
members of the Xiong and Mei laboratories for helpful discussions. 5118-5123.
This study was supported in part by grants from NINDS, National Port, F., Kuster, M., Herr, P., Furger, E., Bänziger, C., Hausmann, G. and Basler,
K. (2008). Wingless secretion promotes and requires retromer-dependent cycling of
Institutes of Health (W.C.X. and L.M.), and grant from VA. Wntless. Nat. Cell Biol. 10, 178-185.
Ren, X. R., Ming, G. L., Xie, Y., Hong, Y., Sun, D. M., Zhao, Z. Q., Feng, Z., Wang,
Competing Interests Q., Shim, S., Chen, Z. F. et al. (2004). Focal adhesion kinase in netrin-1 signaling.
The authors have no competing interests to declare. Nat. Neurosci. 7, 1204-1212.
Rogaeva, E., Meng, Y., Lee, J. H., Gu, Y., Kawarai, T., Zou, F., Katayama,
T., Baldwin, C. T., Cheng, R., Hasegawa, H. et al. (2007). The neuronal sortilin-related
References receptor SORL1 is genetically associated with Alzheimer disease. Nat. Genet. 39, 168-177.
Arighi, C. N., Hartnell, L. M., Aguilar, R. C., Haft, C. R. and Bonifacino, J. S. Seaman, M. N. (2005). Recycle your receptors with retromer. Trends Cell Biol. 15, 68-
(2004). Role of the mammalian retromer in sorting of the cation-independent 75.
mannose 6-phosphate receptor. J. Cell Biol. 165, 123-133. Seaman, M. N. (2007). Identification of a novel conserved sorting motif required for
Belenkaya, T. Y., Wu, Y., Tang, X., Zhou, B., Cheng, L., Sharma, Y. V., Yan, D., retromer-mediated endosome-to-TGN retrieval. J. Cell Sci. 120, 2378-2389.
Selva, E. M. and Lin, X. (2008). The retromer complex influences Wnt secretion by Small, S. A., Kent, K., Pierce, A., Leung, C., Kang, M. S., Okada, H., Honig,
recycling wntless from endosomes to the trans-Golgi network. Dev. Cell 14, 120-131. L., Vonsattel, J. P. and Kim, T. W. (2005a). Model-guided microarray implicates
Bonifacino, J. S. and Hurley, J. H. (2008). Retromer. Curr. Opin. Cell Biol. 20, 427- the retromer complex in Alzheimer’s disease. Ann. Neurol. 58, 909-919.
436. Small, S. A., Kent, K., Pierce, A., Leung, C., Kang, M. S., Okada, H., Honig,
Canuel, M., Lefrancois, S., Zeng, J. and Morales, C. R. (2008). AP-1 and retromer L., Vonsattel, J. P. and Kim, T. W. (2005b). Model-guided microarray implicates
play opposite roles in the trafficking of sortilin between the Golgi apparatus and the the retromer complex in Alzheimer’s disease. Ann. Neurol. 58, 909-919.
lysosomes. Biochem. Biophys. Res. Commun. 366, 724-730. Svitkina, T., Lin, W. H., Webb, D. J., Yasuda, R., Wayman, G. A., Van Aelst, L. and
Chen, D., Xiao, H., Zhang, K., Wang, B., Gao, Z., Jian, Y., Qi, X., Sun, J., Miao, Soderling, S. H. (2010). Regulation of the postsynaptic cytoskeleton: roles in
Biology Open

L. and Yang, C. (2010). Retromer is required for apoptotic cell clearance by development, plasticity, and disorders. J. Neurosci. 30, 14937-14942.
phagocytic receptor recycling. Science 327, 1261-1264. Temkin, P., Lauffer, B., Jäger, S., Cimermancic, P., Krogan, N. J. and von Zastrow,
Conde, C. and Cáceres, A. (2009). Microtubule assembly, organization and dynamics M. (2011). SNX27 mediates retromer tubule entry and endosome-to-plasma
in axons and dendrites. Nat. Rev. Neurosci. 10, 319-332. membrane trafficking of signalling receptors. Nat. Cell Biol. 13, 715-721.
Eaton, S. (2008). Retromer retrieves wntless. Dev. Cell 14, 4-6. van Weering, J. R., Verkade, P. and Cullen, P. J. (2010). SNX-BAR proteins in
Feinstein, T. N., Wehbi, V. L., Ardura, J. A., Wheeler, D. S., Ferrandon, S., phosphoinositide-mediated, tubular-based endosomal sorting. Semin. Cell Dev. Biol.
Gardella, T. J. and Vilardaga, J. P. (2011). Retromer terminates the generation of 21, 371-380.
cAMP by internalized PTH receptors. Nat. Chem. Biol. 7, 278-284. Vassar, R. and Kandalepas, P. C. (2011). The b-secretase enzyme BACE1 as a
Finan, G. M., Okada, H. and Kim, T. W. (2011). BACE1 retrograde trafficking is therapeutic target for Alzheimer’s disease. Alzheimers Res. Ther. 3, 20.
uniquely regulated by the cytoplasmic domain of sortilin. J. Biol. Chem. 286, 12602- Vieira, S. I., Rebelo, S., Esselmann, H., Wiltfang, J., Lah, J., Lane, R., Small, S. A.,
12616. Gandy, S., da Cruz E Silva, E. F. and da Cruz E Silva, O. A. (2010). Retrieval of
Franch-Marro, X., Wendler, F., Guidato, S., Griffith, J., Baena-Lopez, A., Itasaki, the Alzheimer’s amyloid precursor protein from the endosome to the TGN is S655
N., Maurice, M. M. and Vincent, J. P. (2008). Wingless secretion requires phosphorylation state-dependent and retromer-mediated. Mol. Neurodegener. 5, 40.
endosome-to-Golgi retrieval of Wntless/Evi/Sprinter by the retromer complex. Nat.
Vilariño-Güell, C., Wider, C., Ross, O. A., Dachsel, J. C., Kachergus, J. M., Lincoln,
Cell Biol. 10, 170-177.
S. J., Soto-Ortolaza, A. I., Cobb, S. A., Wilhoite, G. J., Bacon, J. A. et al. (2011).
Gomez, T. S. and Billadeau, D. D. (2009). A FAM21-containing WASH complex
VPS35 mutations in Parkinson disease. Am. J. Hum. Genet. 89, 162-167.
regulates retromer-dependent sorting. Dev. Cell 17, 699-711.
Wang, C. L., Zhang, L., Zhou, Y., Zhou, J., Yang, X. J., Duan, S. M., Xiong, Z. Q.
Harbour, M. E., Breusegem, S. Y. and Seaman, M. N. (2012). Recruitment of the
and Ding, Y. Q. (2007). Activity-dependent development of callosal projections in
endosomal WASH complex is mediated by the extended ‘tail’ of Fam21 binding to
the somatosensory cortex. J. Neurosci. 27, 11334-11342.
the retromer protein Vps35. Biochem. J. 442, 209-220.
He, W., Lu, Y., Qahwash, I., Hu, X. Y., Chang, A. and Yan, R. (2004). Reticulon Wassmer, T., Attar, N., Harterink, M., van Weering, J. R., Traer, C. J., Oakley,
family members modulate BACE1 activity and amyloid-b peptide generation. Nat. J., Goud, B., Stephens, D. J., Verkade, P., Korswagen, H. C. et al. (2009). The
Med. 10, 959-965. retromer coat complex coordinates endosomal sorting and dynein-mediated transport,
Hirokawa, N., Niwa, S. and Tanaka, Y. (2010). Molecular motors in neurons: transport with carrier recognition by the trans-Golgi network. Dev. Cell 17, 110-122.
mechanisms and roles in brain function, development, and disease. Neuron 68, 610- Wen, L., Tang, F. L., Hong, Y., Luo, S. W., Wang, C. L., He, W., Shen, C., Jung,
638. J. U., Xiong, F., Lee, D. H. et al. (2011). VPS35 haploinsufficiency increases
Hong, Z., Yang, Y., Zhang, C., Niu, Y., Li, K., Zhao, X. and Liu, J. J. (2009). The Alzheimer’s disease neuropathology. J. Cell Biol. 195, 765-779.
retromer component SNX6 interacts with dynactin p150(Glued) and mediates Willnow, T. E., Carlo, A. S., Rohe, M. and Schmidt, V. (2010). SORLA/SORL1, a
endosome-to-TGN transport. Cell Res. 19, 1334-1349. neuronal sorting receptor implicated in Alzheimer’s disease. Rev. Neurosci. 21, 315-329.
Hoogenraad, C. C. and Akhmanova, A. (2010). Dendritic spine plasticity: new Xie, Y., Ding, Y. Q., Hong, Y., Feng, Z., Navarre, S., Xi, C. X., Zhu, X. J., Wang, C. L.,
regulatory roles of dynamic microtubules. Neuroscientist 16, 650-661. Ackerman, S. L., Kozlowski, D. et al. (2005). Phosphatidylinositol transfer protein-a in
Iwaki, T., Hosomi, A., Tokudomi, S., Kusunoki, Y., Fujita, Y., Giga-Hama, netrin-1-induced PLC signalling and neurite outgrowth. Nat. Cell Biol. 7, 1124-1132.
Y., Tanaka, N. and Takegawa, K. (2006). Vacuolar protein sorting receptor in Yang, P. T., Lorenowicz, M. J., Silhankova, M., Coudreuse, D. Y., Betist,
Schizosaccharomyces pombe. Microbiology 152, 1523-1532. M. C. and Korswagen, H. C. (2008). Wnt signaling requires retromer-
Kim, E., Lee, Y., Lee, H. J., Kim, J. S., Song, B. S., Huh, J. W., Lee, S. R., Kim, dependent recycling of MIG-14/Wntless in Wnt-producing cells. Dev. Cell 14,
S. U., Kim, S. H., Hong, Y. et al. (2010). Implication of mouse Vps26b-Vps29- 140-147.
Vps35 retromer complex in sortilin trafficking. Biochem. Biophys. Res. Commun. 403, Zhou, Z., Xie, J., Lee, D., Liu, Y., Jung, J., Zhou, L., Xiong, S., Mei, L. and Xiong,
167-171. W. C. (2010). Neogenin regulation of BMP-induced canonical Smad signaling and
Lee, D.-H., Zhou, L.-J., Zhou, Z., Xie, J.-X., Jung, J.-U., Liu, Y., Xi, C.-X., Mei, endochondral bone formation. Dev. Cell 19, 90-102.
L. and Xiong, W.-C. (2010). Neogenin inhibits HJV secretion and regulates BMP- Zhu, X. J., Wang, C. Z., Dai, P. G., Xie, Y., Song, N. N., Liu, Y., Du, Q. S., Mei, L.,
induced hepcidin expression and iron homeostasis. Blood 115, 3136-3145. Ding, Y. Q. and Xiong, W. C. (2007). Myosin X regulates netrin receptors and
Liu, Y., Peng, Y., Dai, P. G., Du, Q. S., Mei, L. and Xiong, W. C. (2012). Differential functions in axonal path-finding. Nat. Cell Biol. 9, 184-192.
regulation of myosin X movements by its cargos, DCC and neogenin. J. Cell Sci. 125, Zimprich, A., Benet-Pagès, A., Struhal, W., Graf, E., Eck, S. H., Offman, M. N.,
751-762. Haubenberger, D., Spielberger, S., Schulte, E. C., Lichtner, P. et al. (2011). A
McGough, I. J. and Cullen, P. J. (2011). Recent advances in retromer biology. Traffic mutation in VPS35, encoding a subunit of the retromer complex, causes late-onset
12, 963-971. Parkinson disease. Am. J. Hum. Genet. 89, 168-175.