See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/236230298

Effect of temperature and initial pH on biohydrogen production from palm oil

mill effluent: Long-term evaluation and microbial community analysis

Article  in  Electronic Journal of Biotechnology · September 2011

DOI: 10.2225/vol14-issue5-fulltext-9

CITATIONS READS

45 238

3 authors, including:

Sompong O-Thong Chonticha Mamimin

None Khon Kaen University
140 PUBLICATIONS   4,403 CITATIONS    31 PUBLICATIONS   684 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Biomethanisation View project

Bacterial cellulose View project

All content following this page was uploaded by Sompong O-Thong on 21 May 2014.

The user has requested enhancement of the downloaded file.

Open Journal Systems Page 1 of 9

Microbial Biotechnology Environmental Biotechnology

Electronic Journal of Biotechnology ISSN: 0717-3458 Vol. 14 No. 5, Issue of September 15, 2011
© 2011 by Pontificia Universidad Católica de Valparaíso -- Chile Received December 21, 2010 / Accepted June 14, 2011
DOI: 10.2225/vol14-issue5-fulltext-9
RESEARCH ARTICLE

Effect of temperature and initial pH on biohydrogen production

from palm oil mill effluent: long-term evaluation and microbial
community analysis

Sompong O-Thong*1 · Chonticha Mamimin1 · Poonsuk Prasertsan2

1Thaksin University, Faculty of Science, Department of Biology, Phatthalung, Thailand

2
Prince of Songkla University, Faculty of Agro-Industry, Department of Industrial Biotechnology, Songkhla, Thailand

*Corresponding author: [email protected]

Financial support: This work was granted by the Thailand Research Fund (TRF), the Commission on Higher Education grant number
MRG5280236, Research Group for Development of Hydrogen Production Process from Biomass by Microorganisms and the MEXT-
ARDA.

Keywords: biohydrogen, long-term evaluation, palm oil mill effluent, response surface methodology, thermophilic condition.

Abstract

Anaerobic sludge from palm oil mill effluent (POME) treatment plant was used as a source of inocula
for the conversion of POME into hydrogen. Optimization of temperature and initial pH for
biohydrogen production from POME was investigated by response surface methodology.
Temperature of 60ºC and initial pHof 5.5 was optimized for anaerobic microflora which gave a
maximum hydrogen production of 4820 ml H2/l-POME corresponding to hydrogen yield of 243 ml
H2/g-sugar. Total sugar consumption and chemical oxygen demand (COD) removal efficiency were
98.7% and 46%, respectively. Long-term hydrogen production in continuous reactor at HRT of 2
days, 1 day and 12 hrs were 4850 ± 90, 4660 ± 99 and 2590 ± 120 ml H2/l-POME, respectively.
Phylogenetic analysis of the mixed culture revealed that members involved hydrogen producers in
both batch and continuous reactors were phylogenetically related to the Thermoanaerobacterium
thermosaccharolyticum. Batch reactor showed more diversity of microorganisms than continuous
reactor. Microbial community structure of batch reactor was comprised of T.
thermosaccharolyticum, T. bryantii, Thermoanaerobacterium sp., Clostridium thermopalmarium and
Clostridium NS5-4, while continuous reactor was comprised of T. thermosaccharolyticum, T. bryantii
and Thermoanaerobacterium sp. POME is good substrate for biohydrogen production under
thermophilic condition with Thermoanaerobacterium species play an important role in hydrogen
fermentation.

Introduction

Biohydrogen is a promising clean fuel as it is ultimately derived from renewable energy sources. It
is also efficient and environmental friendly since its combustion converts to water, gives high
energy yield with less energy intensive processes (Nielsen et al. 2001). One possible biological
approach to producing hydrogen is to convert, often negative valued, organic wastes into hydrogen
rich gas by anaerobic microbial flora (Montgomery, 2004). Disposal of agricultural and industrial
wastes and residues are already an economic burden on communities and industries. Therefore,
biohydrogen production by dark fermentation of wastes can both reduce waste disposal problem
and decrease raw material cost (Zhang et al. 2003). Additionally, the major advantages of dark
fermentative process are high hydrogen production capacities, operation without light sources and
no oxygen limitation problems. These characteristics make it more competitive than other biological
conversion of organic wastes into hydrogen gas (Hawkes et al. 2002). Dark fermentative hydrogen
production gives relatively high theoretical values of hydrogen production. Theoretically, four moles
of hydrogen are produced from glucose concomitantly with 2 moles of acetate and only 2 moles of
hydrogen are produced when butyrate is the main fermentation product. Typically, 60-70% of the

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 2 of 9
aqueous product during sugar fermentation under mesophilic condition is butyrate (Liu et al. 2002).
It is also observed that hydrogen production yield of 1-2 mol H2/mol-hexose are obtained with
mesophiles, while thermophiles display a yield higher than 2 mol H2/mol-hexose (van Niel et al.
2002). Hydrogen yields can be improved by increasing hydrogen production through acetate end
product reaction, and decreasing or preventing butyrate, ethanol and propionate product reaction.
One way to accomplish this is through fermentation process with thermophiles or extreme
thermophiles, operating at temperatures higher than 60ºC (Kadar et al. 2004; O-Thong et al.
2008). Thus, a higher temperature is more feasible for the conversion reaction toward hydrogen
due to favourable thermodynamics conditions.

Thermophilic bacteria are considered as more promising microorganisms than mesophilic bacteria
for hydrogen production. Thermophilic bacteria are able to utilize a wide range of organic wastes.
Thermophilic mixed culture has been examined for their potential as hydrogen producers. High
hydrogen production rate and less variety of fermentation end products were observed under
thermophilic conditions compared to mesophilic ones (Ahn et al. 2005; O-Thong et al. 2008). These
properties make application of thermophiles for hydrogen production economically and technical
feasible. Among a large number of microbial species, strictly anaerobes, Clostridium,
Thermoanaerobacterium, Caldicellulosiruptor and Thermoanaerobacter, are efficient hydrogen
producers via fermentation process under thermophilic condition (Ueno et al. 2001; Shin and Youn,
2005; O-Thong et al. 2009). To date, the majority of research has been focused mainly on using
organic wastes and wastewater from food industry to produce hydrogen with mixed culture.
Advantages of using mixed culture over pure culture are lower cost (saving in sterilization cost),
septic organic wastes can be used as substrate, and process using mixed culture gave stable yield
of hydrogen production from non-sterile organic wastes (Noike and Mizuno, 2000). Anaerobic
microorganisms from palm oil mill wastewater treatment plant have been utilized as inocula for
hydrogen production from glucose in batch cultivation (Morimoto et al. 2004; Atif et al. 2005).
Mixed culture was also used as inoculum for hydrogen production from POME under mesophilic
condition and achieved both hydrogen production (0.42 L/g CODdestroyed) and COD reduction
(40%) (Vijayarahavan and Ahmad, 2006). Our previously report studied on the statistical
optimization of chemicals parameters such as C/N, C/P and iron concentration in cultural conditions
for hydrogen production from POME by thermophilic mixed culture. Simultaneous hydrogen
production (6.33 l H2/l-POME) and COD removal (55%) were achieved (O-Thong et al. 2008).
However, it cannot obtain long term stability of process operation via optimum nutrient. Only trace
amount of hydrogen yield was obtained from previously reports because the fermentative hydrogen
production is affected by many parameters such as pH, temperature and the nature of the microbial
communities. The effect of pH is known to be crucial due to its effects on hydrogenase activity,
metabolism pathways, and microbial communities (Fang and Liu, 2002). The microbial community
is very important parameter for the success in biological hydrogen production process and is the
key factor to bring sustainable biohydrogen production and industrial implementation (Iyer et al.
2004; Ren et al. 2006).

This work focused on the statistical optimization of physico-chemical parameters (pH, temperature)
in cultural conditions for biohydrogen production from palm oil mill effluent (POME) in batch and
continuous reactor, their interaction on hydrogen production, long-term evaluation of optimization
condition and investigated the responsible microbial community using PCR–DGGE technique.

Materials and Methods

Inoculum preparation and palm oil mill effluent

The seed microflora for hydrogen production was enriched from anaerobic sludge collecting from
palm oil mill wastewater treatment plant. The sludge was settled and collected after decanting the
supernatant. Seed microflora was prepared by load-shock pre-treatment to remove methanogenic
bioactivity (O-Thong et al. 2009). Sludge was subsequently enriched in a synthetic medium
consisting of sucrose (20 gCOD/l), NH4HCO3 5.2 g/l, K2HPO4 0.125 g/l, MgCl2·7H2O 0.1 g/l,
FeSO4·7H2O 0.025 g/l, MnSO4·6H2O 0.015 g/l, CuSO4·5H2O 0.005 g/l, CoCl2·5H2O 0.0001 g/l, and
NaHCO3 6.7 g/l and the initial pH value was adjusted to 5.5 (Fan et al. 2004). The enriched sludge
having a volatile suspended solids (VSS) concentration of 2.0 g/l was acclimatized with 10%, 30%
60% and 100% of POME, respectively. The acclimatized sludge was operated in semi-continuous
process by removing 50% of culture medium and adding 50% fresh POME into the reactor every 48
hrs. Raw POME was collected from the receiving tank of Trang Palm Oil Co, Ltd. in Southern
Thailand. Raw POME has brown colour, pH 4.2-4.5, a temperature of 70-80ºC. The chemical
characteristics of the POME are given in Table 1. The POME was stored at a temperature range of 0-
4ºC until used.

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 3 of 9
Experimental design and data analysis

The experiment was performed in 1.0 l infusion bottles with working volume of 650 ml. 190 ml of
inocula corresponding to 30% v/v, 50 ml nutrient solution and 410 ml of POME were added into
infusion bottles. Each liter of nutrient solution contained 2.0 g NH4HCO3, 1.0 g of KH2PO4, 0.01 g
MgSO4x7H2O, 0.001 g NaCl, 0.001 g Na2MoO4x2H2O, 0.001 g CaCl2 x2H2O, 0.0015 g
MnSO4x7H2O, 0.00278 g FeCl2 (Lay et al. 1999). The experiments were incubated at a
temperature range of 35-75ºC and initial pH values range from 4.5-6.5. The initial pH values were
adjusted using either 2 M NaOH or 2 M HCl. The evolved gas was collected with a gas collecting
bag (Cali-5-bond, Calibrated Instruments, Inc.) and measured by water displacement method in a
graduated cylinder filled with acidic water (pH ≤ 3) in order to prevent dissolution of the gas
components (Owen et al. 1979). Factorial central composite experimental design (Box et al. 1978)
was used to optimize the pH and temperature for hydrogen production from POME by thermophilic
mixed culture. The cumulative hydrogen production curves were obtained over the time course of
batch experiment. Central composite experimental design matrix with corresponding result under
various pH and temperature are summarized in Table 2. The corresponding values of specific
hydrogen production (Ps) and hydrogen production potential (P) were obtained by fitting with
modified Gompertz equation (Equation 1) (Lay et al. 1999). R2 for all parameters was larger than
0.95, indicating that the parameters were statistically significant.

[Equation 1]

Where, H(t) (ml) = represents the cumulative volume of hydrogen production, P (ml) = the
hydrogen production potential, Rm (ml/h) = the maximum production rate, and λ (h) = the lag
time. The values of P, Rm and λ for each batch were determined by best fitting the hydrogen
production data in the above equation using the Matlab 6.0 with optimization toolbox 2.1
(MathWorks, USA). The hydrogen yield (YPS) (ml H2/g-sugar) was calculated by diving P with the
initial quantity of total sugar in POME. The maximum specific hydrogen production rates (Rm) (ml
H2/g-VSS/h) was calculated by dividing Rm with the initial sludge VSS. Quadratic model was used
to evaluate the optimization of environmental factors, including initial pH and temperature.

[Equation
2]

Where Yi = predicted response; x1 and x2 = parameters; β0 = offset term; β1and β2= linear
coefficients; β11 and β22= squared coefficients; and β12= interaction coefficients. Multiple
regression with stepwise for Equation 2 was performed using Statistica program (Statsoft, USA).

Continuous hydrogen production

Enriched microflora and optimum condition from batch tests and semi-continuous were applied to
continuously hydrogen production from POME. Three identical 1.2 l glass continuous stirred tank
(CSTR) reactors with 0.9 l working volume were used for continuous experiment. Experimental
setup consists of feed bottle, feed pump, reactor, effluent bottle and gas meter. The temperature
was controlled at 60ºC by circulating hot water inside the water jacket of the reactors. Mixing was
provided by a magnetic stirrer located underneath the reactor. The initial anaerobic condition in the
reactor was established by replacing the gaseous phase with nitrogen. The POME was continuously
pumped into reactors six times a day at 4 hrs intervals, each time 122 ml POME for HRT 48 hrs,
225 ml POME for HRT 24 hrs and 450 ml POME for HRT 12 hrs. The amounts of evolved gas,
soluble metabolites, and responsible microbial community were investigated. The reactors were
operated until the system reached steady state. The steady-state condition was reached when
hydrogen gas content, biogas volume and the volatile fatty acids (VFA) concentration in the
effluent were stable (less than 10% variation) for a week.

Analytical methods

The biogas composition was measured by gas chromatography equipped with thermal conductivity

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 4 of 9
detectors (GC-TCD). Hydrogen gas was analyzed by GC-TCD fitted with an 1.5 m stainless steel
column SS350A packed with a molecular sieve (80/100 mesh). Nitrogen was used as a carrier gas
at a flow rate of 30 ml/min. The temperatures of the injection port, oven and detector were 100,
50 and 100ºC, respectively (Morimoto et al. 2004). Methane and carbon dioxide were analyzed by
GC-TCD fitted with 3.3 ft stainless steel column packed with Porapak T (60/80 mesh). Helium was
used as a carrier gas at a flow rate of 35 ml/min. The temperatures of the injection port, oven and
detector were at 150, 50 and 100ºC, respectively (Chang and Liu, 2004). The gas sample of 100 µL
was injected in duplicate. Volatile fatty acids (VFA) were analyzed by gas chromatography (Hewlett
Packard, HP 6850 series) equipped with a flame ionization detector. A column capillary packed with
nitroterephthalic acid-modified polyethleneglycol and with a length of 30 meter was used. The
temperature of the injection port was 250ºC. The chromatography was performed using the
following program: 100ºC for 5 min, 100-250ºC with a ramping of 10ºC/min, 250ºC for 12 min.
The detector temperature was 300ºC. Chemical oxygen demand (COD), pH, suspended solid (SS),
total suspended solid, oil concentration, total phosphorus and total Kjeldahl nitrogen were
determined in accordance with the procedures described in the Standard Methods (Clescerl et al.
1998). Ammonium-nitrogen and phosphate concentrations were analyzed using commercial test
kits from Spectroquant (Merck Ltd., Germany). The total sugar content was analyzed by the
anthrone method (Morris, 1948).

Microbial community analysis

Total genomic deoxyribonucleic acid (DNA) was extracted from semi continuous experiment sludge
samples using the Ultraclean Soil DNA Kit (MoBio Laboratory Inc., USA). The region of the 16S
rRNA genes corresponding to position 340 to 518 in the 16S rRNA of Escherichia coli was PCR-
amplified using the forward primer; L340f with a GC clamp at the 5’ end (5’-
CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3’) and the
reverse primer; K517r (5’-ATTACCGCGGCTGCTGG-3’) (Muyzer et al. 1993). PCR amplification was
conducted in an automated thermal cycler using the following protocol; initial denaturation for 5
min at 94ºC, 30 cycles of denaturation for 1 min at 95ºC/annealing for 30 sec at 55ºC/extension
for 1 min at 72ºC, followed by a final extension for 7 min at 72ºC. The DGGE analysis of the PCR
products was performed by electrophoresis for 20 min at 20 V and 15 hrs at 70 V through a 7.5%
polyacrylamide gel containing a linear gradient of denaturant (100% denaturant corresponds to 7
M urea and 40%(v/v) formamide deionised with AG501-X8 mixed bed resin) ranging from 30% to
60% in 0.5 x TAE buffer at a constant temperature of 60ºC (DGGE unit, V20-HCDC, Scie-Plas
Limited, UK). The gel was stained with Sybr-Gold (1000x concentration) for 1 hr and visualized on
a UV transilluminator. Most of the bands were excised from the gel and re-amplified with the
forward primer without a GC clamp and the reverse primer. After re-amplification, PCR products
were purified using E.Z.N.A cycle pure kit (Omega Bio-tek, USA) and sequenced using primer
K517r and an ABI PRISM Big Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems,
USA) in accordance with the manufacturer’s instructions. Closest matches for partial 16S rRNA
gene sequences were identified by database searches in GenBank using BLAST (Altschul et al.
1997).

Results and Discussion

Effects of initial pH and temperature on enriched microflora

The effects of initial pH and temperature were studied using central composite design methodology
with the aims of modelling and optimization on the conversion of POME to hydrogen by enriched
microflora. The contour plots in Figure 1 were constructed using the equations listed in Table 3.
The regression models of all equations were considered to represent the experimental data
accurately as all values of R2 are close to 1.0. The optimum conditions were found to be at the
temperature of 60 ± 1ºC and initial pH at 5.5 ± 0.1. The pH and temperature both had a significant
interaction on hydrogen production (YP), hydrogen yield (YPS), total sugar consumption (YSC) and
COD removal efficiency (YCOD). Maximum values of YP, YPS, YSC and YCOD were 48120 ml H2/l-
POME, 243 ml H2/g-sugar, 98.75%, 45%, respectively. The optimum point within the contour level
of 4812 ml H2/l-POME lies between 5.5-5.6 on pH axis and 60-61ºC on temperature axis (Figure
1a). To assess the amount of hydrogen gas of enriched microflora, equation 4 was used to
construct the contour graph as shown in Figure 1b which provides the hydrogen yield of 243 ml
H2/g-sugar. The total sugar consumption was plotted in contour graph against pH and temperature
(Figure 1d) created using Equation 5, giving the maximum value of 98.75% at pH 5.6 and
temperature 61ºC, respectively. It is interesting to note that the optimum point of total sugar
consumption was similar to that of hydrogen production and hydrogen yield. It may imply that
evolved hydrogen come from total sugar degradation. The contour graph of COD removal efficiency

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 5 of 9

derived from the quadratic model Equation 6 (Figure 1c) gave the highest value of 45%. The
goodness of model was checked by R2 values, it also indicate that only 4-7% of the total variable is
not explained by the model Equation 3, Equation 4, Equation 5 and Equation 6. These hydrogen
productions and COD removal efficiency agree with those obtained in previous reports (Atif et al.
2005; Fakhru’l-Razi et al. 2005; Vijayarahavan and Ahmad, 2006). Throughout this study, the
hydrogen content in the biogas was in the range of 38.5-47% and no methane was found.

To validate the statistical experimental strategies and to gain a better understanding of hydrogen
production efficiency, three batch reactors based on the optimal conditions (pH 5.5 and
temperature 60ºC) were conducted. Confirmation experiments indicated that the obtained optimum
conditions gave reproducible results; giving the value of YP, YPS, YSC and YCOD of 4820 ± 120 ml
H2/l-POME, 228 ± 4.5 ml H2/g-sugar, 94.3 ± 2.2% and 42 ± 3%, respectively, which were very
close to the values, evaluated using the response surface methodology (Table 4). This agreement
reveals that the YP, YPS, YSC and YCOD of enriched cultures were reproducible. Validated experiment
confirmed that high hydrogen conversion resulted from optimum pH and temperature. Khanal et al.
(2004) suggested that pH is a pivotal parameter for biohydrogen production where the intermediate
product (volatile fatty acids) drives the hydrogenase reaction. The enriched of microbial sludge from
POME wastewater treatment plant resulted in high hydrogen producing bacteria at thermophilic
condition. It is interesting to known that what microorganisms play an important role in the
thermophilic conversion of POME into hydrogen.

Continuous hydrogen production

The comparison of hydrogen yields between batch and continuous cultivation are presented in Table
5. More total sugar in POME was decomposed at longer cultivation time (HRT 2 days). The highest
hydrogen production yield of batch and continuous cultivation (HRT 2 days, 1 day and 1 hr) were
4745 ± 80, 4650 ± 90, 4550 ± 99 and 2259 ± 120 ml H2/l-POME, respectively. Biogas from batch
cultivation comprised of hydrogen (40%), carbon dioxide (38%), hydrogen sulphide (780 ppm) and
no methane. Biogas of continuous cultivation comprised of hydrogen ranged between (38.5-47%),
carbon dioxide (35-52%), hydrogen sulphide (620-440 ppm) and no methane gas. The total sugar
consumption in batch and continuous cultivation (HRT 2 days, 1 day and 12 hrs) were 94%, 98%,
96% and 67%, respectively. The COD removal efficiency in batch and continuous cultivation (HRT 2
days, 1 day and 12 hrs) were 42%, 48%, 45% and 23%, respectively. Biogas production stopping
was observed in continuous reactor cultivation after fed fresh medium for 6-12 hrs. The
discontinued hydrogen production after adding fresh medium (during 0-6 hrs) may result from trace
amount of dissolved oxygen contained in POME (Yokoi et al. 1995). This evidence resulted low
hydrogen production yield at short hydraulic retention time (HRT 12 hrs) of continuous cultivation.
Continuous cultivation operated at HRT 1 day yields less hydrogen than operated at HRT 2 days.
These results seem to provide evidence that strictly anaerobic bacteria could play important role as
hydrogen producers in the systems and are influenced by short hydraulic retention time or short
cultivation time (Shin and Youn, 2005).

The change of hydrogen production and volatile fatty acids (VFA) was given in Figure 2. Acetic acid,
butyric acid and formic acid were the main metabolites in batch and continuous processes, but
butyric acid increased significantly in continuous cultivation and became dominated metabolites at
HRT 1 day. The soluble metabolites of continuous cultivation were 6.8-7% formic acid, 30-40%
acetic acid, 42-52% butyric acid, 0.7-0.8% propionic acid and small amount of undetermined
volatile fatty acids (VFA) (8-10%). The hydrogen production was accompanied with the production
of VFA. Butyric acid and acetic acid constituted more than 70% of total metabolites. Butyric acid
and acetic acid are produced during thermophilic hydrogen fermentation by
Thermoanaerobacterium (Ueno et al. 2001). In general, production of these two acids favours the
production of hydrogen. The theoretical hydrogen yield from glucose with acetate formation is 450
ml H2/g-sugar, which is twice as high as that of butyrate formation, 225 ml H2/g sugar (O-Thong et
al. 2008). However, biohydrogen yields were inhibited by self produced acids (van Ginkel and
Logan, 2005). From the result of volatile fatty acids production, it is obvious that at low HRT, more
butyric acid was produced as compare to acetic acid. This might be due to nature of T.
Thermosaccharolyticum as one of the butyric acid producers (O-Thong et al. 2009). The total sugar
consumption in batch and continuous cultivation (HRT 2 days and 1 day) were 94%, 98% and 96%,
respectively. Total sugar consumption showed that hydrogen production is limited by the
bioavailability of the carbohydrates in the POME and therefore solubilisation of the undissolved
carbohydrates could precede the whole process resulting at an even higher hydrogen recovery.

Microbial community analysis

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 6 of 9

The diversity of microbial communities at different processes operation was analyzed and compared
by DGGE technique. The DGGE profile of 16S rRNA gene fragments was shown in Figure 3. The
DGGE profile clearly showed that different microbial population in batch and continuous processes
operations. Batch cultivation showed more diversity of microorganisms than continuous cultivation.
Microbial community structure of batch cultivation was comprised of T. thermosaccharolyticum, T.
bryantii, Thermoanaerobacterium sp, uncultured bacterium (AY999014), Clostridium
thermopalmarium and Clostridium NS5-4, while continuous cultivation comprised of T.
thermosaccharolyticum, T. bryantii and Thermoanaerobacterium sp. Clostridium thermopalmarium
and Clostridium NS5-4 gradually decreased in continuous cultivation and not present at HRT 1 day
and 12 hrs. Each band of DGGE represents the specific species and the intensity of band relative to
dominated species. All process operation was dominated by T. thermosaccharolyticum. Most of the
DGGE related to T. thermosaccharolyticum which may proliferate under the thermophilic anaerobic
conditions that are applied to the system. Soluble metabolites mainly consist of acetic acid and
butyric acid also suggested that the strict anaerobic hydrogen producing bacteria (T.
thermosaccharolyticum) play an important role in the anaerobic cultures enrichment. The major
fermentation metabolites (acetic acid and butyric acid) depend on Thermoanaerobacterium species
that are dominated in the anaerobic sludge (Zhang et al. 2003; Shin and Youn, 2005). Shin and
Youn (2005) also reported that operated under thermophilic condition at pH 5.5, only
Thermoanaerobacterium species was found. This can be inferred from the result that other
microorganisms in original sludge were inactivated at the thermophilic and acidogenic operational
condition, but it was a favourable environment for the growth of Thermoanaerobacterium species
resulted in a predominant species in the system. T. thermosaccharolyticum is a thermophilic
saccharolytic microorganisms involved in acetate and butyrate fermentation that leads to
production of large amount of hydrogen from carbohydrate (Liu et al. 2003; Zhang et al. 2003; Ahn
et al. 2005; Shin and Youn, 2005). The maximum growth of T. thermosaccharolyticum was
obtained at the pH range of 5 to 6 and the optimum temperature for growth was 60ºC. The yields
of hydrogen production from T. thermosaccharolyticum was 2.4 mol H2/ mol glucose (270 ml H2/g-
sugar) that higher yields than Clostridium species and Enterobacter species (Ueno et al. 2001).
Moreover, the microbial community changes in parallel with the decrease HRT from 1 day to 12 hrs.
Previous studies also reported that the decrease in hydrogen yield of hydrogen was due to the
hydraulic retention decrease in the reactor which was dominated by Thermoanaerobacterium
species (Shin and Youn, 2005). Clostridium sp. and Thermoanaerobacterium sp. are strictly
anaerobic bacteria and sensitive to oxygen from fresh POME at continuous operation which
contributed to the decrease of hydrogen production (Liu and Shen, 2004). Oxygen in fresh medium
was influenced to Clostridium sp. more than Thermoanaerobacterium sp., due to every low
population of Clostridium sp. at continuous operation. Some oxygen contained in POME resulting to
a non-strictly anaerobic condition subsequently leading to Thermoanaerobactrium species facing the
long lag phase. The longer lag phase was likely due to the adaptation of the bacteria community by
modifying their physiological state for the new environment (Zhang et al. 2003) after adding fresh
POME. The hydraulic retention time or cultivation time could be an important factor to maintain a
constant Thermoanaerobacterium-rich sludge.

Concluding Remarks

It has been proven that POME is good substrate for hydrogen production with approximately 4820
ml H2/l-POME. Initial pH of 5.5 and temperature of 60ºC were the optimal condition for cultivation
of the enriched microflora that is dominated by Thermoanaerobacterium as well as giving the high
yields of hydrogen production from POME. These results confirm that environment factors such as
pH, temperature and hydraulic retention time affect microbial community as well as hydrogen
production yield. Batch cultivation showed more diversity of microorganisms than continuous
cultivation. Microbial community structure of batch cultivation was comprised of T.
thermosaccharolyticum, T. bryantii, Thermoanaerobacterium sp, uncultured bacterium (AY999014),
Clostridium thermopalmarium and Clostridium NS5-4, while continuous cultivation comprised of T.
thermosaccharolyticum, T. bryantii and Thermoanaerobacterium sp. T. thermosaccharolyticum is a
hydrogen producing bacteria that is involved in butyric and acetic acid fermentation of carbohydrate
in POME. The conversion of POME to hydrogen was strongly dependent on microorganisms, thus a
suitable microbial community is an essential factor to obtain efficient and sustainable hydrogen
production. Overall results suggested that enriched anaerobic cultures that are dominated by
Thermoanaerobacterium were suitable for hydrogen production from POME and POME was found to
be good substrate for hydrogen production under thermophilic condition. Conclusively, the POME
generated from processing of palm oil could be regarded as a useful by-product that can be used
for the production of energy in the form of hydrogen.

References

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 7 of 9

AHN, Y.; PARK, E.-J.; OH, Y.-K.; PARK, S.; WEBSTER, G. and WEIGHTMAN, A.J. (2005). Biofilm
microbial community of a thermophilic trickling biofilter used for continuous biohydrogen
production. FEMS Microbiology Letters, vol. 249, no. 1, p. 31-38. [CrossRef]

ALTSCHUL, S.F.; MADDEN, T.L.; SCHAFFER, A.A.; ZHANG, J.; ZHANG, Z.; MILLER, W. and LIPMAN,
D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Research, vol. 25, no. 17, p. 3389-3402. [CrossRef]

ATIF, A.A.Y.; FAKHRU’l-RAZI, A.; NGAN, M.A.; MORIMOTO, M.; IYUKE, S.E. and VEZIROGLU, N.T.
(2005). Fed batch production of hydrogen from palm oil mill effluent using anaerobic microflora.
International Journal of Hydrogen Energy, vol. 30, no. 13-14, p. 1393-1397. [CrossRef]

BOX, G.E.P.; HUNTER, W.G. and HUNTER, J.S. (1978). Statistics for experimenters: An introduction
to design, data analysis, and model building. John Wiley & Sons. 653 p. ISBN 978-0471093152.

CHANG, F.-Y. and LIN, C.-Y. (2004). Biohydrogen production using an up-flow anaerobic sludge
blanket reactor. International Journal of Hydrogen and Energy, vol. 29, no. 1, p. 33-39.
[CrossRef]

CLESCERL, L.; GREENBERG, A.E. and EATON, A.D. (1998). Standard methods for the examination
of water and wastewater. 20th ed. Washington DC, American Public Health Association. 1000 p.
ISBN 0-875-53235-7.

FAKHRU’L-RAZI, A.; YASSIN, A.A.A.; LYUKE, S.E.; NGAN, M.A. and MORIMOTO, M. (2005). Bio-
hydrogen synthesis from wastewater by anaerobic fermentation using microflora. International
Journal of Green Energy, vol. 2, no. 4, p. 387-396. [CrossRef]

FAN, Y.T.; LI, C.L.; LAY, J.-J.; HOU, H.W. and ZHANG, G.S. (2004). Optimization of initial substrate
and pH levels for germination of sporing hydrogen-producing anaerobes in cow dung compost.
Bioresource Technology, vol. 91, no. 2, p. 189-193. [CrossRef]

FANG, H.H.P. and LIU, C. (2002). Effect of pH on hydrogen production from glucose by a mixed
culture. Bioresource Technology, vol. 82, no. 1, p. 87-93. [CrossRef]

HAWKES, F.R.; DINSDALE, R.; HAWKES, D.L. and HUSSY, I. (2002). Sustainable fermentative
hydrogen production: challenges for process optimisation. International Journal of Hydrogen
Energy, vol. 27, no. 11-12, p. 1339-1347. [CrossRef]

IYER, P.; BRUNS, M.A.; ZHANG, H.; VAN GINKEL, S. and LOGAN, B. (2004). H2-Producing bacterial
communities from a heat-treated soil inoculum. Applied Microbiology and Biotechnology, vol. 66,
no. 2, p. 166-173. [CrossRef]

KADAR, Z.; DE VRIJE, T.; VAN NOORDEN, G.E.; BUDDE, M.A.W.; SZENGYEL, Z.; RECZEY, K. and
CLASSEN, P.A.M. (2004). Yields from glucose, xylose, and paper sludge hydrolysate during
hydrogen production by the extreme thermophile Caldicellulosiruptor saccharolyticus. Applied
Biochemistry and Biotechnology, vol. 114, no. 1-3, p. 497-508. [CrossRef]

KHANAL, S.K.; CHEN, W.H.; LI, L. and SUNG, S.W. (2004). Biological hydrogen production: effects
of pH and intermediate products. International Journal of Hydrogen and Energy, vol. 29, no. 11, p.
1123-1131. [CrossRef]

LAY, J.-J.; LEE, Y.-J. and NOIKE, T. (1999). Feasibility of biological hydrogen production from
organic fraction of municipal solid waste. Water Research, vol. 33, no. 11, p. 2579-2568.
[CrossRef]

LIU, W.-T.; CHAN, O.-C. and FANG, H.H.P. (2002). Microbial community dynamics during start-up
of acidogenic anaerobic reactors. Water Research, vol. 36, no. 13, p. 3203-3210. [CrossRef]

LIU, H.; ZHANG, T. and FANG, H.H.P. (2003). Thermophilic H2 production from a cellulose-
containing wastewater. Biotechnology Letters, vol. 25, no. 4, p. 365-369. [CrossRef]

LIU, G. and SHEN, J. (2004). Effects of culture medium and medium conditions on hydrogen

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 8 of 9
production from starch using anaerobic bacteria. Journal of Bioscience Bioengineering, vol. 98, no.
4, p. 251-256. [CrossRef]

MONTGOMERY, R. (2004). Development of biobased products. Bioresource Technology, vol. 91, no.
1, p. 1-29. [CrossRef]

MORIMOTO, M.; ATSUKO, M.; ATIF, A.A.Y.; NGAN, M.A.; FAKHRU'L-RAZI, A.F.; IYUKE, S.E. and
BAKIR, A.M. (2004). Biological production of hydrogen from glucose by natural anaerobic
microflora. International Journal of Hydrogen Energy, vol. 29, no. 7, p. 709-713. [CrossRef]

MORRIS, D.L. (1948). Quantitative determination of carbohydrates with Dreywood’s anthrone

reagent. Science, vol. 107, no. 2775, p. 254-255. [CrossRef]

MUYZER, G.; DE WAAL, E.C. and UITTERLINDEN, A.G. (1993). Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-
amplified genes coding for 16S rRNA. Applied Environment and Microbiology, vol. 59, no. 3, p. 695-
700.

NIELSEN, A.T.; AMANDUSSON, H.; BJORKLUND, R.; DANNETUN, H.; EJLERTSSON, J.; EKEDAHL, L.-
G.; LUNDSTRÖM, I. and SVENSSON, B.H. (2001). Hydrogen production from organic waste.
International Journal of Hydrogen Energy, vol. 26, no. 6, p. 547-550. [CrossRef]

NOIKE, T. and MIZUNO, O. (2000). Hydrogen fermentation of organic municipal wastes. Water
Science and Technology, vol. 42, no. 12, p. 155-162.

O-THONG, S.; PRASERTSAN, P.; INTRASUNGKHA, N.; DHAMWICHUKORN, S. and BIRKELAND, N.-
K. (2008). Optimization of simultaneous thermophilic fermentative hydrogen production and COD
reduction from palm oil mill effluent by Thermoanaerobacterium-rich sludge. International Journal
of Hydrogen Energy, vol. 33, no. 4, p. 1221-1231. [CrossRef]

O-THONG, S.; PRASERTSAN, P. and BIRKELAND, N.-K. (2009). Evaluation of methods for preparing
hydrogen-producing seed inocula under thermophilic condition by process performance and
microbial community analysis. Bioresource Technology, vol. 100, no. 2, p. 909-918. [CrossRef]

OWEN, W.F.; STRUCKEY, D.C.; HEALY, J.B.; YOUN, L.Y. and MCCARTY, P.L. (1979). Bioassay for
monitoring biochemical methane potential and anaerobic toxicity. Water Research, vol. 13, no. 6, p.
485-492. [CrossRef]

REN, N.Q.; LI, Y.F.; WANG, A.J.; LI, J.Z.; DING, J. and ZADSAR, M. (2006). Hydrogen production
fermentation: Review of a new approach to environmentally safe energy production. Aquatic
Ecosystem Health and Management, vol. 9, no. 1, p. 39-42. [CrossRef]

SHIN, H.S. and YOUN, J.H. (2005). Conversion of food waste into hydrogen by thermophilic
acidogenesis. Biodegradation, vol. 16, no. 1, p. 33-44. [CrossRef]

UENO, Y.; HARUTA, S.; ISHII, M. and IGARASHI, Y. (2001). Microbial community in anaerobic
hydrogen-producing microflora enriched from sludge compost. Applied Microbiology and
Biotechnology, vol. 57, no. 4, p. 555-562. [CrossRef]

VAN GINKEL, S. and LOGAN, B.E. (2005). Inhibition of biohydrogen production by undissociated
acetic and butyric acids. Environmental Science and Technology, vol. 39, no. 23, p. 9351-9356.
[CrossRef]

VAN NIEL, E.W.J.; BUDDE, M.A.W.; DE HAAS, G.G.; VAN DER WAL, F.J.; MCLASSEN, P.A.M. and
STAMS, A.J.M. (2002). Distinctive properties of high hydrogen producing extreme thermopiles,
Cadicellulosiruptor saccharolyticus and Thermotoga elfii. International Journal of Hydrogen Energy,
vol. 27, no. 11-12, p. 1391-1398. [CrossRef]

VIJAYARAHAVAN, K. and AHMAD, D. (2006). Biohydrogen generation from palm oil mill effluent
using anaerobic contact filter. International Journal of Hydrogen Energy, vol. 31, no. 10, p. 1284-
1291. [CrossRef]

YOKOI, H.; OHKAWARA, T.; HIROSE, J.; HAYASHI, S. and TAKASAKI, Y. (1995). Characteristics of

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361 23/9/2554
Open Journal Systems Page 9 of 9
H2 production by aciduric Enterobacter aerogenes strain H0-39. Journal of Fermentation and
Bioengineering, vol. 80, no. 6, p. 571-574. [CrossRef]

ZHANG, T.; LIU, H. and FANG, H.H.P. (2003). Biohydrogen production from starch in wastewater
under thermophilic condition. Journal of Environmental Management, vol. 69, no. 2, p. 149-156.
[CrossRef]

Note: Electronic Journal of Biotechnology is not responsible if on-line references cited on manuscripts are not available any more after

the date of publication.

http://www.ejbiotechnology.info/index.php/ejbiotechnology/author/proofGalleyFile/774/1361
View publication stats
23/9/2554