Scribd
Upload
60 views

Bioinformatics Class2

This document discusses various data formats used in next-generation sequencing, including FASTA, FASTQ, BAM, HDF5 and FAST5. It provides details on the components of a FASTQ header and describes how to interpret Phred quality scores. The document also discusses using FastQC to check NGS data quality and provides examples of good and bad metrics. Finally, it lists some common read trimming tools.

Uploaded by

Satish Sahu
Copyright
© © All Rights Reserved
Available Formats
Download as PDF, TXT or read online on Scribd
60 views

Bioinformatics Class2

This document discusses various data formats used in next-generation sequencing, including FASTA, FASTQ, BAM, HDF5 and FAST5. It provides details on the components of a FASTQ header and describes how to interpret Phred quality scores. The document also discusses using FastQC to check NGS data quality and provides examples of good and bad metrics. Finally, it lists some common read trimming tools.

Uploaded by

Satish Sahu
Copyright
© © All Rights Reserved
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 25

Data Formats

Data Quality
Read Mapping

Riddhiman Dhar
Department of Biotechnology
IIT Kharagpur
Data formats

 Roche 454 RAFTAR-454

- FASTA format

 Illumina quad i

- FASTQ format
Data formats
 PacBio
- basecall HDF5 format earlier
- currently BAM format (convertible to fastq format)

How to convert ASCII to Phred Score?


 Ion-torrent Subtract 33 from each of the quality scores to get the Phred score. For example, 'A' is ASCII
letter 65. 'A'-33 = 65-33 = 32. So a quality score of 'A' means Phred 32, or slightly better than
99.9%.
- DAT files (Raw data)
- BAM, FASTQ or VCF format

 Nanopore
- HDF5 format
- FAST5 format
Fastq format
 Fasta format with Quality scores
Fastq format
 Fasta format with Quality scores

 @D00733:181:CAH6EANXX:8:2210:1499:2056 1:N:0:GTAGAG
 NCTTTGTACTATGACCGATACACTCAACCGGCGAAAAGTGGAACTTGAGAATTGATGTCTTCATCTTATT
ATCTGTCTCTTATACACATCTCCGAGCCCACGAGACGTAGAGGAATCTCGTATGC
 +
 #<=BBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG@GGGGGGGGGGGGGEGGEGG8CEGGG
GGGG
 @D00733:181:CAH6EANXX:8:2210:1668:2177 1:N:0:GTAGAG
 GCTTTTTTTACGGCAGCATTTTTTTTTCAACTCTGATCGCCCCTTTACTGCTCCCTCCGCCCAAATTCCA
TTGCAGTTCAAATGTATACTGAAAAAAACCCCATTGCTATTGTTAAACAGTGAAC
 +
 BBCCCGGGGBFGGGGGGEGGGGGGGGGGGGCGFECCGGGGGGGGGGCDGGGGGGGGED>BGG
GGBD@CGGEG>CCFGDCCGCDGG8FCGG=FEGGGGGGGDGDDEGG/6D@/DGGCB//6C9CD/
Header: @D00733:181:CAH6EANXX:8:2210:1668:2177 1:N:0:GTAGAG
Element Requirements Description
@ @ Each sequence identifier line starts
with @
<instrument> Characters allowed: Instrument ID
a–z, A–Z, 0–9 and underscore
<run number> Numerical Run number on instrument
<flowcell ID> Characters allowed:
a–z, A–Z, 0–9
<lane> Numerical Lane number
<tile> Numerical Tile number
<x_pos> Numerical X coordinate of cluster
<y_pos> Numerical Y coordinate of cluster
<read> Numerical Read number. 1 can be single read
or Read 2 of paired-end
<is filtered> Y or N Y if the read is filtered (did not
pass), N otherwise
<control number> Numerical 0 when none of the control bits are
on, otherwise it is an even number.
On HiSeq X and NextSeq systems,
control specification is not
performed and this number is
always 0.
<sample number> Numerical Sample number from sample sheet
Quality score – ASCII table
HDF5 format

 Hierarchical Data Format (HDF)


 Nested data

- Groups

- Datasets

- Attributes
FAST5 format

 Specifically structured HDF5 data

 “Raw” data and “Analysis” data

 Raw data – values of pico-amp currents in nanopore

 Analysis data – basecall data


Checking NGS Data Quality

FastQC
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Checking NGS Data Quality

FastQC
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Per base quality score
Per base quality score

Good data!
Per base quality score

Bad data!
Per sequence quality scores
Per sequence quality scores

Good data!
Per sequence quality scores

Not so good!
Per base sequence content
Per sequence GC content
Per Base N content
Sequence length distribution
Duplicate Sequences
Over-represented k-mers
Adapter content
Read trimming tools

 Trimmomatic
http://www.usadellab.org/cms/?page=trimmomatic

 bbduk
https://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-
guide/bbduk-guide/

 Cutadapt
https://pypi.org/project/cutadapt/1.3/

You might also like