My First Book Chapter

Methods in Microbiology
Volume 50
Recent titles in the series
Volume 26 Yeast Gene Analysis
AJP Brown and MF Tuite
Volume 27 Bacterial Pathogenesis
P Williams, J Ketley and GPC Salmond
Volume 28 Automation
AG Craig and JD Hoheisel
Volume 29 Genetic Methods for Diverse Prokaryotes
MCM Smith and RE Sockett
Volume 30 Marine Microbiology
JH Paul
Volume 31 Molecular Cellular Microbiology
P Sansonetti and A Zychlinsky
Volume 32 Immunology of Infection, 2nd edition
SHE Kaufmann and D Kabelitz
Volume 33 Functional Microbial Genomics
B Wren and N Dorrell
Volume 34 Microbial Imaging
T Savidge and C Pothoulakis
Volume 35 Extremophiles
FA Rainey and A Oren
Volume 36 Yeast Gene Analysis, 2nd edition
I Stansfield and MJR Stark
Volume 37 Immunology of Infection
D Kabelitz and SHE Kaufmann
Volume 38 Taxonomy of Prokaryotes
Fred Rainey and Aharon Oren
Volume 39 Systems Biology of Bacteria
Colin Harwood and Anil Wipat
Volume 40 Microbial Synthetic Biology
Colin Harwood and Anil Wipat
Volume 41 New Approaches to Prokaryotic Systematics
Michael Goodfellow, Iain Sutcliffe, and Jongsik Chun
Volume 42 Current and Emerging Technologies for the Diagnosis of Microbial Infections
Andrew Sails and Yi-Wei Tang
Volume 43 Imaging Bacterial Molecules, Structures and Cells
Colin Harwood and Grant J. Jensen
Volume 44 The Human Microbiome
Colin Harwood
Volume 45 Microbiology of Atypical Environments
Volker Gurtler and Jack T. Trevors
Volume 46 Nanotechnology
Volker Gurtler, Andrew S. Ball and Sarvesh K. Soni
Volume 47 Methods in Microbiology
Charles S. Pavia and Volker Gurtler
Volume 48 Methods in Microbiology
Volker Gurtler
Volume 49 Methods in Silkworm Microbiology
Volker Gurtler and Gangavarapu Subrahmanyam
Methods in Microbiology
Volume 50
Covid-19: Biomedical
Perspectives
Edited by
Charles S. Pavia
Department of Biomedical Sciences,
NYIT College of Osteopathic Medicine,
New York Institute of Technology, Old Westbury;
Division of Infectious Diseases,
New York Medical College, Valhalla,
NY, United States
Volker Gurtler
School of Science,
College of Science Engineering and Health,
RMIT University, Bundoora, VIC, Australia
Academic Press is an imprint of Elsevier
125 London Wall, London, EC2Y 5AS, United Kingdom
The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, United Kingdom
525 B Street, Suite 1650, San Diego, CA 92101, United States
50 Hampshire Street, 5th Floor, Cambridge, MA 02139, United States
First edition 2022
Copyright © 2022 Elsevier Ltd. All rights reserved.
No part of this publication may be reproduced or transmitted in any form or by any means, electronic or
mechanical, including photocopying, recording, or any information storage and retrieval system, without
permission in writing from the publisher. Details on how to seek permission, further information about
the Publisher’s permissions policies and our arrangements with organizations such as the Copyright
Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/
permissions.
This book and the individual contributions contained in it are protected under copyright by the Publisher
(other than as may be noted herein).
Notices
Knowledge and best practice in this field are constantly changing. As new research and experience broaden
our understanding, changes in research methods, professional practices, or medical treatment may
become necessary.
Practitioners and researchers must always rely on their own experience and knowledge in evaluating and
using any information, methods, compounds, or experiments described herein. In using such information
or methods they should be mindful of their own safety and the safety of others, including parties for whom
they have a professional responsibility.
To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any
liability for any injury and/or damage to persons or property as a matter of products liability, negligence or
otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the
material herein.
ISBN: 978-0-323-85061-2
ISSN: 0580-9517 (Series)
For information on all Academic Press publications

visit our website at https://www.elsevier.com/books-and-journals
Publisher: Zoe Kruze

Acquisitions Editor: Sam Mahfoudh
Developmental Editor: Federico Paulo Mendoza
Production Project Manager: Abdulla Sait
Cover Designer: Mark Rogers
Typeset by STRAIVE, India
This book is being dedicated to honour the world-renowned 19th century
biomedical scientist, Louis Pasteur, in memory of the 2022 bicentennial
of his birth in Dole, France, in 1822. He has often been credited as being
the founding father of modern microbiology and immunology. Much of
his work was done in the face of sometimes fierce opposition, but
he eventually succeeded in convincing his opponents that his theories
were correct. In his illustrious career, he made many ground-breaking
discoveries, which included establishing the method that became known
as pasteurization and the germ theory of disease. He also rescued the
wine, beer and silkworm industries from unwanted contaminants that
had crept into their products (more of a concern then than now).
Furthermore, and perhaps most noteworthy, are his contributions in
producing the first effective vaccines against anthrax and rabies.
Collectively, these accomplishments have laid the foundation for
subsequent improvements in hygiene, healthcare, preventive medicine
and vaccine-mediated control of serious and life-threatening diseases.
The many research and healthcare facilities, and other landmarks, that
are located in various parts of the world and bear his name, are a
testament to his long-standing legacy. If Pasteur were alive today,
he would no doubt be at the forefront of trying to develop a safe and
effective vaccine against COVID-19. As the famous physician
Sir William Osler, considered to be the founding father of modern
medicine, pointed out more than a century ago, an anonymous fitting
tribute to Pasteur states: "that he was the most perfect man who entered
the Kingdom of Science".
The Editors
This page intentionally left blank
Contents
Dedication ................................................................................................................. v
Contributors ........................................................................................................... xiii
Preface .................................................................................................................. xvii
CHAPTER 1 Sensitive methods for detection

of SARS-CoV-2 RNA........................................................1
Xi Chen and Simin Xia
1. Introduction ....................................................................................... 1
2. General approaches for the detection of SARS-CoV-2 ................... 3
3. Isothermal amplification methods for sensitive detection of
SARS-CoV-2 .................................................................................... 4
4. Sensitive detection of SARS-CoV-2 via RT-RPA ........................... 5
5. General considerations for designing an ultrasensitive
RT-RPA assay................................................................................ 11
5.1 Primer design ........................................................................... 11
5.2 Probe design............................................................................. 12
5.3 Reaction temperature ............................................................... 12
6. Comparative reviews of recently published RT-RPA assays
for SARS-CoV-2 detection ............................................................. 12
7. Methods section .............................................................................. 17
8. Before you begin............................................................................ 17
9. Key resources table ......................................................................... 17
10. Materials and equipment ................................................................ 19
11. Step-by-step method details ........................................................... 19
11.1 Detection of SARS-CoV-2 N- or S-gene using exo
probes and primers ................................................................ 19
11.2 Detection of SARS-CoV-2 N- or S-gene using nfo
probes and lateral flow strips ................................................ 21
11.3 Optional steps ........................................................................ 22
11.4 Simultaneous dual N- and S-gene detection using paired
exo probe and primers for N-gene and exo probe and
primers for S-gene ................................................................. 22
12. Summary ......................................................................................... 23
Acknowledgement ................................................................................. 24
References.............................................................................................. 24
vii
viii Contents
CHAPTER 2 The seasonal behaviour of COVID-19 and its

galectin-like culprit of the viral spike........................27
Kelsey Caetano-Anolles, Nicolas Hernandez, Fizza Mughal,
Tre Tomaszewski, and Gustavo Caetano-Anolles
1. Introduction..................................................................................... 27
2. The seasonal behaviour of viruses ................................................. 28
2.1 Seasonality of viral diseases.................................................... 28
2.2 Drivers of seasonality in trade-off performance spaces.......... 31
2.3 Finding significant correlations ............................................... 36
2.4 Distinguishing error from chaos in time series ....................... 37
3. The seasonal behaviour of COVID-19 ........................................... 40
3.1 Spatial distribution approaches ................................................ 42
3.2 Temporal distribution approaches........................................... 45
4. Viral genomic make up and seasonality ........................................ 46
4.1 Mutational change in rapidly expanding viral populations .... 49
4.2 A structuring quasispecies as paradigm of viral
mutational change .................................................................... 51
4.3 The mutational landscape of evolving SARS-CoV-2
viruses ...................................................................................... 53
4.4 Viral genomic change and seasonal behaviour ....................... 60
4.5 Genomic change levels appear unlinked to temperature or
latitude ..................................................................................... 63
4.6 Galectin homologues appear likely molecular culprits ........... 64
5. Conclusions and prospects ............................................................. 68
Acknowledgements .............................................................................. 69
Financial disclosures and conflicts of interest ..................................... 69
References ............................................................................................ 69
Further reading ..................................................................................... 79
Glossary ................................................................................................ 79
CHAPTER 3 Current molecular diagnostics assays for
SARS-CoV-2 and emerging variants............................83
Jonathan M. Banks, Kristelle Capistrano, Pari Thakkar,
Hemangi Ranade, Vaidik Soni, Manali Datta, and
Afsar R. Naqvi
1. Introduction..................................................................................... 84
2. SARS-CoV-2 variants of concern .................................................. 85
2.1 B.1.1.7 (Alpha) variant ............................................................ 88
2.2 B.1.351 (Beta) variant ............................................................. 88
2.3 P.1 (Gamma) variant ............................................................... 90
2.4 B.1.617.2 (Delta) variant ......................................................... 90
Contents ix
3. COVID-19 diagnostics ................................................................... 91

3.1 Real-time PCR diagnostics ...................................................... 92
3.2 Serology based COVID-19 diagnostics.................................. 97
3.3 CRISPR diagnostics ............................................................... 101
3.4 Biosensor diagnostics ............................................................ 103
4. Diagnostics in the era of COVID-19 vaccination ........................ 109
5. Conclusion .................................................................................... 111
References .......................................................................................... 112
Further reading ................................................................................... 120
CHAPTER 4 CRISPR use in diagnosis and therapy for COVID-19...123

Pallavi Deol, Aashwina Madhwal, Gaurav Sharma,
Rahul Kaushik, and Yashpal Singh Malik
1. Introduction ................................................................................... 124
2. Diagnostics and therapeutics for SARS-CoV-2 ........................... 125
3. CRISPR/Cas systems.................................................................... 127
3.1 Cas12 ..................................................................................... 128
4. CRISPR-based therapeutics for SARS-Cov-2 .............................. 136
4.1 Disrupting the viral RNA genome........................................ 137
4.2 Disrupting the host cell factors essential for
SARS-CoV-2 infection .......................................................... 143
5. Delivery of CRISPR/Cas components ......................................... 144
6. Limitations of CRISPR/Cas system ............................................. 144
7. Summary ....................................................................................... 145
References .......................................................................................... 146
CHAPTER 5 Recent and advanced nano-technological

strategies for COVID-19 vaccine development..........151
Chinekwu Sherridan Nwagwu, Chinenye Nnenna Ugwu,
John Dike Nwabueze Ogbonna, Adaeze Linda Onugwu,
Chinazom Precious Agbo, Adaeze Chidiebere Echezona,
Ezinwanne Nneoma Ezeibe, Samuel Uzondu,
Frankline Chimaobi Kenechukwu, Paul Achile Akpa,
Mumuni Audu Momoh, Petra Obioma Nnamani,
Clemence Tarirai, Kenneth Chibuzor Ofokansi, and
Anthony Amaechi Attama
1. Introduction ................................................................................... 151
2. The structure and infection mechanism of SARS-COV-2........... 152
3. Pathogenesis and clinical presentation of COVID-19 ................. 153
x Contents
4. Vaccine development strategies and platforms ............................ 155

4.1 Live attenuated viral vaccines ............................................... 156
4.2 Inactivated pathogen vaccines ............................................... 158
4.3 Protein subunit vaccines ........................................................ 163
4.4 Virus-like particle vaccines ................................................... 164
4.5 Vectored vaccines .................................................................. 164
4.6 Nucleic acid vaccines ............................................................ 165
5. Relevant SARS-CoV-2 antigen explored in the design of
vaccines ......................................................................................... 166
5.1 Structural, sub-structural, and non-structural proteins .......... 166
5.2 Spike (S) protein.................................................................... 166
5.3 Membrane (M) protein .......................................................... 169
5.4 Nucleocapsid (N) protein ...................................................... 169
5.5 Envelop (E) protein............................................................... 170
6. Nano-based strategies for COVID-19 vaccine development ....... 170
6.1 Nano-carriers for antigen delivery ........................................ 171
6.2 Nano-vaccine adjuvants ......................................................... 174
6.3 Delivery devices .................................................................... 175
6.4 Novel alternative routes of administration............................ 176
7. Benefits and challenges of nanotechnology in COVID-19
vaccine development .................................................................... 178
8. Conclusion and future perspectives.............................................. 179
References .......................................................................................... 180
CHAPTER 6 A review of hypersensitivity methods to detect

immune responses to SARS-CoV-2............................189
Fernando Dı́az-Espada, Victor Matheu, and Yvelise Barrios
1. Historical perspective ................................................................... 190
2. General overview, classification and description of
hypersensitivity reactions ............................................................. 193
2.1 Type I hypersensitivity-immediate/IgE mediated ................. 193
2.2 Type II hypersensitivity-IIa/IIb antibody mediated .............. 196
2.3 Type III hypersensitivity-immune complex-mediated .......... 198
2.4 Type IV hypersensitivity-IVa/IVb/IVc/IVd-T cell
mediated ................................................................................. 200
3. Skin test application of hypersensitivity reactions: In vivo
measurements of immune responses ............................................ 205
4. In vitro methods to measure immune responses after
SARS-Cov-2 infection .................................................................. 206
4.1 SARS-CoV-2 protein description .......................................... 206
Contents xi
4.2 Understanding the adaptive immune response in covid19

patients ................................................................................... 207
4.3 In vitro methods to measure SARS-CoV-2 cellular
immune responses .................................................................. 209
5. A novel application of a DTH method to measure immune
responses after SARS-CoV-2 infection ........................................ 211
6. DTH to measure immunogenicity elicited by covid vaccines ..... 213
7. Future prospects of DTH to study SARS-CoV-2
immunogenicity ............................................................................ 214
Acknowledgements ............................................................................ 214
References .......................................................................................... 214
CHAPTER 7 Hesitancy to get vaccinated against COVID-19

and how it might be overcome...................................223
Charles S. Pavia
CHAPTER 8 The emergence of SARS-CoV-2 variants of concern

in Australia by haplotype coalescence reveals a
continental link to COVID-19 seasonality..................233
Tre Tomaszewski, Volker Gurtler, Kelsey Caetano-Anolles,
and Gustavo Caetano-Anoll
es
1. Introduction ................................................................................... 233
2. Methods ........................................................................................ 235
3. VOCs in Australia ........................................................................ 236
4. Prevalence of amino acid variants in Australia ........................... 240
4.1 The emergence of first haplotypes ........................................ 240
4.2 Emergence of haplotypes associated with VOCs alpha,
delta and omicron.................................................................. 243
4.3 Amino acid variants and haplotypes shared by VOCs......... 245
4.4 Amino acid variants that are not part of established VOC
constellations ......................................................................... 246
5. A network view of haplotype diversity and VOC emergence ..... 246
5.1 Haplotype and variant reuse .................................................. 246
5.2 Haplotype size and coalescence ............................................ 249
5.3 Haplotypes and protein interactions ...................................... 249
5.4 VOC omicron haplotype variants cluster along the
S-protein sequence ................................................................. 251
5.5 Haplotypes follow the three phases of the COVID-19
pandemic................................................................................ 253
xii Contents
6. Continental links to seasonality.................................................... 254

6.1 Core haplotypes of VOCs reveal latitude-linked patterns
of seasonality......................................................................... 254
6.2 Free-standing markers also support seasonal behavior in
Australia ................................................................................. 256
7. Discussion..................................................................................... 258
7.1 Mutational landscapes of viral evolution.............................. 260
7.2 VOC emergence by haplotype coalescence .......................... 261
7.3 Haplotypes and seasonal behavior ........................................ 262
7.4 Conclusions............................................................................ 264
References .......................................................................................... 265
CHAPTER 9 COVID-19 vaccines for high risk and

immunocompromised patients...................................269
Charles S. Pavia and Maria M. Plummer
1. Introduction................................................................................... 269
2. Development of COVID-19 vaccines .......................................... 270
3. The use of COVID-19 vaccines for the high-risk patient
population with the emphasis on HIV-infected patients .............. 272
Funding .............................................................................................. 277
Author contribution ............................................................................ 277
Conflict of interest ............................................................................. 277
References .......................................................................................... 277
Contributors
Chinazom Precious Agbo
Drug Delivery & Nanomedicines Research Laboratory, Department of
Pharmaceutics, University of Nigeria, Nsukka, Enugu State, Nigeria
Paul Achile Akpa
Anthony Amaechi Attama
Jonathan M. Banks
Department of Periodontics, College of Dentistry, University of Illinois Chicago,
Chicago, IL, United States
Yvelise Barrios
Laboratorio Immunologı́a Central Lab, Planta 0, Edificio Principal, Hospital
Universitario de Canarias, Tenerife, Spain
Gustavo Caetano-Anoll es
Evolutionary Bioinformatics Laboratory, Department of Crop Sciences, University
of Illinois, Urbana, IL, United States
Kelsey Caetano-Anolles
Callout Biotech, Albuquerque, NM, United States
Kristelle Capistrano
Xi Chen
The HIT Center for Life Sciences (HCLS), Harbin Institute of Technology, Harbin,
Heilongjiang Province, People’s Republic of China
Manali Datta
Amity Institute of Biotechnology, Amity University Rajasthan, Jaipur, Rajasthan,
India
Pallavi Deol
Virology Lab, Centre for Animal Disease Research and Diagnosis, ICAR-Indian
Veterinary Research Institute, Bareilly, India
Fernando Dı́az-Espada
Department of Immunology, Clı́nica Puerta de Hierro, Madrid, Spain
Adaeze Chidiebere Echezona
xiii
xiv Contributors
Ezinwanne Nneoma Ezeibe

Department of Pharmaceutical Microbiology and Biotechnology, University of
Nigeria, Nsukka, Enugu state, Nigeria
Volker Gurtler
RMIT University, Melbourne, VIC, Australia
Nicolas Hernandez
Rahul Kaushik
Laboratory for Structural Bioinformatics, Center for Biosystems Dynamics
Research, RIKEN, Yokohama, Japan
Frankline Chimaobi Kenechukwu
Aashwina Madhwal
Division of Pathology, ICAR-Indian Veterinary Research Institute, Bareilly, India
Yashpal Singh Malik
College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal
Sciences University, Ludhiana, India
Victor Matheu
Servicio de Alergologı́a, Floor-2, Edificio de Actividades Ambulatorias, Hospital
Universitario de Canarias, Tenerife, Spain
Mumuni Audu Momoh
Fizza Mughal
Afsar R. Naqvi
Petra Obioma Nnamani
Chinekwu Sherridan Nwagwu
Kenneth Chibuzor Ofokansi
Contributors xv
John Dike Nwabueze Ogbonna

Adaeze Linda Onugwu
Charles S. Pavia
Department of Biomedical Sciences, NYIT College of Osteopathic Medicine,
New York Institute of Technology, Old Westbury; Division of Infectious Diseases,
New York Medical College, Valhalla, NY, United States
Maria M. Plummer
Department of Clinical Specialties, Division of Pathology, NYIT College of
Osteopathic Medicine, New York Institute of Technology, Old Westbury, NY,
United States
Hemangi Ranade
Amity Institute of Biotechnology, Amity University Rajasthan, Jaipur, Rajasthan,
India
Gaurav Sharma
Virology Lab, Centre for Animal Disease Research and Diagnosis, ICAR-Indian
Veterinary Research Institute, Bareilly, India
Vaidik Soni
Clemence Tarirai
Department of Pharmaceutical Sciences, Tshwane University of Technology,
Pretoria, South Africa
Pari Thakkar
Tre Tomaszewski
Chinenye Nnenna Ugwu
Department of Pharmaceutical Microbiology and Biotechnology, University of
Nigeria, Nsukka, Enugu state, Nigeria
Samuel Uzondu
Simin Xia
Preface
With a few exceptions, not since the 1918 flu pandemic has the world experienced
such a public health crisis as the one associated with COVID-19. Fortunately, several
vaccines with high levels of proven efficacy have been developed within a relatively
short time in several countries to combat this disease, although it is still unknown
how long protection will be afforded by this preventive measure. Also, since the
beginning of the pandemic in late 2019, much has been learned about the biology,
epidemiology, diagnosis, and clinical aspects of COVID-19, especially as they per-
tain to a more complete understanding on its pathogenesis and treatment regimens
for patients who develop serious illness after being infected with the causative agent,
a unique coronavirus, designated as SARS-CoV-2. As an example of the explosive
nature of this information, a search of the “PubMed” Internet publication retrieval
site revealed that, as of November 2021 and covering the previous 2 years, a total
of almost 200,00 peer-reviewed articles can be found there after entering the term
“COVID-19.”
The 9 chapters in this book try to encompass some of the key biomedical issues
associated with COVID-19 from vaccine development and challenges with its dis-
tribution and receptivity to detection methods, two chapters on seasonality (one of
these applying the methods explained in the first chapter on seasonality to the
Australian experience of isolation and strict lock downs), animal models, and cellular
immune responses. In this regard, Chapters 1 & 3 contain methods for detection of
SARS-CoV-2 RNA; Chapter 2 contains an approach for determining the seasonal
behaviour of COVID-19 and Chapter 8 applies this approach to the Australian
experience; Chapter 4 contains methods using CRISPR to diagnose an treat
COVID-19; Chapter 5 discusses recent and advanced nano-technological strategies
for COVID-19 vaccine development; Chapter 6 reviews hypersensitivity methods to
detect immune responses to SARS-CoV-2; Chapter 7 hesitancy to get vaccinated
against COVID-19; and Chapter 9 COVID-19 vaccines for high risk and immuno-
compromised patients. Collectively, this information is meant to be presented in a
clear and concise manner so that anyone interested in this topic will benefit from
it, but is intended to be especially useful to public health agencies, clinicians,
laboratory personnel, and various groups of scientific investigators.
The Editors
Charles S. Pavia
and
Volker Gurtler
xvii
CHAPTER
Sensitive methods
for detection of
SARS-CoV-2 RNA
1
Xi Chen* and Simin Xia
*Corresponding author: e-mail address: [email protected]
1 Introduction
Since December 2019, an outbreak of COVID-19 caused by severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2) virus occurred and soon spread to the entire
world (Wang, Horby, Hayden, & Gao, 2020). The COVID-19 pandemic has led to a
dramatic loss of human life worldwide and presents an unprecedented challenge to
publish health and food systems; the global economic growth was largely slowed
down and social activities were greatly disrupted. As of July 1, 2021, COVID-19
has infected over 182 million people worldwide with over 3.9 million reported
casualties. COVID-19 is caused by an RNA virus named severe acute respiratory
syndrome coronavirus 2 (Chen et al., 2020). SARS-CoV-2 virus is a coronavirus
belonging to the beta family of coronaviruses that also includes SARS-CoV, Middle
East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43
(HCoV-OC3), and human coronavirus HKU1 (HCoV-HKU1). These beta-viruses
are enveloped, positive-sense, single-stranded RNA viruses of zoonotic origin. As
for SARS-CoV-2, this virus contains four structural proteins, namely the envelope
protein (E), spike protein (S), membrane protein (M), and the nucleocapsid
(N) protein (Fig. 1). The S, M, and E proteins form the envelope of the virus while
the N protein is associated with the single-stranded RNA genome forming nucleo-
capsid inside the envelope.
According to initial studies, this disease caused by SARS-CoV-2 showed a high
transmissibility with a basic reproduction number R0 ¼ 1.4–5.5 (WHO, 2020; Zhao
et al., 2020), likely to be below 5 and above 3 (Chen, 2020) and therefore it is highly
desired to perform early testing of SARS-CoV-2 for timely screening of infected
individuals and to stop the spread of this disease from a location to its surroundings.
Because detection sensitivity is the key to reduce false negative results, a detection
method with a high level of sensitivity can minimize non-diagnosed infected
individuals and reduce the chance of further cross transmission (Fig. 2).
Methods in Microbiology, Volume 50, ISSN 0580-9517, https://doi.org/10.1016/bs.mim.2021.06.001
1
2 CHAPTER 1 Sensitive methods for detection of SARS-CoV-2 RNA
FIG. 1
Schematic illustration of the structure of coronavirus SARS-CoV-2 and its single-stranded
RNA genome. The sequence information of the single-stranded RNA genome of SARS-CoV-2
serves as the basis for the development of nucleic acid-based diagnosis.
FIG. 2
Sensitive detection methods will be highly beneficial to prevent the spread of COVID-19. High
sensitivity of diagnostic methods ensures low false negative results and therefore reduces the
latent cross transmission of non-diagnosed but actually infected individuals to their closely
contacted people.
2 General approaches for the detection of SARS-CoV-2 3
2 General approaches for the detection of SARS-CoV-2

There are several different types of diagnostic approaches used in the current
pandemic, which can be mainly classified into the following three categories:
(i) computed tomography (CT) chest scan, (ii) antigen-antibody interaction-based
serological tests, and (iii) nucleic acid (NA)-based tests (Kilic, Weissleder, &
Lee, 2020; Qin, Peng, Baravik, & Liu, 2020). The CT chest scan (Ai et al., 2020)
detects the pathological change of the respiratory system including the lung by
visualization of the transmission of the X-ray through the chest. Typically, a brighter
image that reveals a low transmission of the X-ray through the chest could potentially
indicate the infection by SARS-CoV-2. However, the specificity of CT chest scan is
low because the symptomatic features of COVID-19 CT scan are similar to those of
other types of viral pneumonia; and hence this method is generally considered as an
auxiliary method for SARS-CoV-2 diagnosis. Serological testing is based on the de-
tection of antibodies generated by the immune system which can be used to confirm
the infection of SARS-CoV-2 (Amanat et al., 2020; Udugama et al., 2020). However,
it typically takes 1–2 weeks before the body can generate detectable antibodies for
serological testing; as a result, this approach is not well suited for early-stage diag-
nosis. Other issues associated with serological tests are the high variability and some-
times low sensitivity and specificity (Tang et al., 2020). Nucleic acid-based detection
is the detection of the RNA genomic materials of the SARS-CoV-2, usually using
nucleic acid amplification approaches, which has been considered as the gold
standard for SARS-CoV-2 viral detection.
Reverse transcription-polymerase chain amplification (RT-PCR) has been
widely used for the detection of viral RNA for many years. RT-PCR requires a first
reverse transcription to produce a cDNA from the viral RNA, and then amplification
of cDNA via polymerase chain reaction. During amplification, a fluorescent probe,
either a fluorogenic dye (e.g. SYBR safe) or a rationally designed probe (e.g.
TagMan probe) is included in the PCR reaction which will respond to the ampli-
fied DNA to produce fluorescent signals. As a result, the amplification could be
detected in real-time via fluorescence using a real-time quantitative PCR machine.
A drawback of RT-PCR diagnosis is the high cost of the PCR machine and the
expertise required to design the program and to conduct the analysis. In fact,
RT-PCR is among the first reported and approved SARS-CoV-2 detection methods
(Chu et al., 2020; Corman et al., 2020). At the earliest time after the COVID-19 out-
break, Drosten et al. reported the detection of SARS-CoV-2 by real-time RT-PCR
method. The PCR primers and probes were designed for the detection of RdRp gene,
E-gene and N-gene. Although single-copy sensitivity was not achieved, this RT-PCR
assay was found to be still quite sensitive with 5.2 copies per reaction at 95% detec-
tion probability for E-gene and 3.8 copies per reaction at 95% detection probability
for RdRp gene using non-clinical samples; the sensitivity for the N-gene is less and
hence was not subjected to intensive evaluation (Corman et al., 2020). Another
RT-PCR based approach for the molecular diagnosis of SARS-CoV-2 introduced
in the very beginning of the pandemic detects the ORF1b and N-gene of SARS-
CoV-2 with a sensitivity up to 10 copies per reaction using none-RNA testing
sample (Chu et al., 2020).
3 Isothermal amplification methods for sensitive detection of

SARS-CoV-2
Isothermal nucleic acid amplification approaches are emerging as new promising
methods for detection of viral RNA (James & Alawneh, 2020; Zhao, Chen, Li,
Wang, & Fan, 2015). In isothermal nucleic acid amplification, no thermal cycles
are needed and therefore, exempted from using sophisticated thermocyclers. The re-
spective detection device is hence simpler, more portable and meet the requirement
of so-called point of care (POC) testing (Dinnes et al., 2020; Dohla et al., 2020).
Sometimes, lateral flow strips can also be used to facilitate the diagnosis so that
the testing can be applied in a POC, or even home-based fashion. Further, isothermal
amplification approaches can achieve a very high sensitivity, with up to single-copy
sensitivity per reaction. The ultrahigh sensitivity makes these approaches suitable for
early-stage diagnosis of virus infections. Therefore, isothermal nucleic acid
amplification has been considered as a promising method for the detection of virus
infection and could compensate with the currently widely used RT-PCR methods.
Indeed, as for SARS-CoV-2, isothermal amplification detection methods have
already been considered as highly promising detection tools (Shen et al., 2020). Early
development of isothermal amplification techniques include LAMP (loop-mediated
isothermal amplification) (Notomi et al., 2000; Wong, Othman, Lau, Radu, & Chee,
2018), NASBA (nucleic acid sequence-based amplification) (Compton, 1991), HDA
(helicase-dependent amplification) (Vincent, Xu, & Kong, 2004), EXPAR (expo-
nential amplification reaction of nucleic acids), and SDA (strand-displacement
amplification) (Walker et al., 1992). Among these isothermal detection methods,
LAMP coupled with reverse transcription, i.e. RT-LAMP, seems to be the most pop-
ular in SARS-CoV-2 analysis (Kashir & Yaqinuddin, 2020). In RT-LAMP, four or
six primers that target 6–8 regions in the genome are designed in combination with
the use of Bsm DNA polymerase. Along with the proceeding LAMP reaction, pairs
of primers generate a dumbbell-shaped DNA structure, which functions as the
LAMP initiator. In this method, around 109 DNA copies can be generated within
an hour and the reaction takes place at constant temperature in the range of
60–65 °C. Since magnesium pyrophosphate is generated as a byproduct during
LAMP, metal-sensitive indicators or pH-sensitive dyes can be employed for visual
detection. An advantage of the RT-LAMP approach is that regular primers are used
which do not necessitate the design of specially functionalized primers or probes;
hence this feature is helpful to reduce the cost of a RT-LAMP reaction. On the other
hand, LAMP, NASBA and HDA methods do not require thermocycle machines for
4 Sensitive detection of SARS-CoV-2 via RT-RPA 5
amplification; however, specifically designed heating devices are still needed. In

addition, LAMP requires the use of 4–6 primers, which makes primer design more
complicated than other methods. Furthermore, LAMP, NASBA or HDA typically
needs at least 60 min to complete the amplification reaction, which is longer than
RT-RPA.
Recently some more contemporary isothermal amplification methods have
been introduced, for example, NEAR, DETECR, STOP and so on. NEAR (nicking
enzyme amplification reaction) or nicking enzyme-assisted amplification (NEAA)
uses not only strand-displacement DNA polymerase (e.g. Bst polymerase), but also
nicking endonuclease enzymes to exponentially amplify short oligonucleotides
(Wang et al., 2018). Thousands of copies of DNA fragment can be produced from
only one restriction site making this approach a unique technique with rather high
amplification efficiency. On the other hand, a drawback of NEAR is the formation
of non-specific products which limits detection sensitivity. DETECTR (DNA
endonuclease-targeted CRISPR trans reporter) method (Chen et al., 2018) is associ-
ated with CRISPR-based detection approaches that involves the use of the genome
editing Cas12a enzymes. DETECTR uses a crRNA-Cas12a complex to recognize
amplified DNA targets and binding of the crRNA-Cas12a complex to target DNA
induced discrimination cleavage of non-target FQ-DNA reporters. Similar CRISPR-
based approaches include SHERLOCK detection (Gootenberg et al., 2017) in
one-pot (STOP) that uses Cas13a enzyme.
4 Sensitive detection of SARS-CoV-2 via RT-RPA

Reverse transcription recombinase polymerase amplification (RT-RPA) is a widely
recognized isothermal amplification assay for the amplification of RNA, which
combines reverse transcription that converts RNA to cDNA, and recombinase poly-
merase amplification (RPA) that amplifies cDNA under isothermal conditions. RPA
sometimes is also called ERA (enzymatic recombinase amplification) as a modified/
improved version of RPA according to the commercially supplied kit from the
company GenDx (http://gendx.cn), or RAA (recombinase aided amplification)
(Wu et al., 2020; Xue et al., 2020). RPA is a molecular technology introduced by
Piepenburg, Williams, Stemple, and Armes (2006) using proteins involved in
cellular DNA synthesis, recombination and repair (Piepenburg et al., 2006). The
RPA process starts when a recombinase protein binds to primers in the presence
of ATP and a crowding agent (e.g. a high molecular weight polyethylene glycol),
forming a recombinase-primer complex (step I). The complex then interrogates
double-stranded DNA seeking a homologous sequence and facilitates strand hybrid-
ization with the primer at the cognate site (step II & III). In the meanwhile, single-
stranded binding protein (SSB) is added in the reaction mixture to stabilize the
dissociated single-stranded DNA and prevent the ejection of the inserted primer
by branch migration, and facilitate the amplification to proceed at room temperature.
The DNA polymerase (e.g. Bsu) will bind to the 30 end of the primer to elongate the
FIG. 3
The general principle of recombinase polymerase amplification. Step I: recombinase and
primer form complexes and target homologous DNA; step II: strand exchange forms a D-loop;
herein, the brownish and blue-coloured arrows refer to the forward and reverse primers,
respectively, upon annealing with their templates; step III: polymerase initiates synthesis; step
IV: parental strands separate & synthesis continues; herein, the hollow boxed arrows refer to
the directions of the polymerization reaction; step V: two duplexes form. Abbreviation(s):
SSB, single-stranded DNA binding protein.
primer in the presence of dNTPs (step IV & V). Cyclic repetition of this process
results in the exponential amplification of a DNA (Fig. 3) (Piepenburg et al., 2006).
In order to employ RPA for the amplification of RNA, additional reverse tran-
scriptase was added in order to convert RNA to cDNA for subsequent RPA ampli-
fication. In addition, since RNA is a much less stable species compared to DNA
and is highly prone to degradation by the ubiquitously existing RNase, RNase inhib-
itor protein was added into the RT-RPA reaction. In order to facilely detect the
amplification product, a probe and a nuclease was used. Moreover, creatine kinase,
phosphocreatine and ATP were needed to generate energy for the reaction. Therefore,
a practical RT-RPA based detection reaction requires at least seven enzymes/proteins
including: (i) strand-displacing DNA polymerase, (ii) recombinase, (iii) recombination-
mediator protein (RMP), (iv) single-strand DNA binding protein, (v) RNase inhibitor,
(vi) creatine kinase, and (vii) nuclease; in addition, multiple necessary reagents are
also required like dNTPs, creatine, the crowding agent—polyethylene glycol, the
activator Mg(OAc)2, the forward and reverse primers, and a probe. For the most re-
liable test, viral RNA samples need to be purified via a standard RNA purification
process rather than using a non-purified viral sample. The list of proteins, enzymes,
reagents necessary for conducting an RT-RPA reaction with their recommended con-
centrations are summarized in Table 1 (Chen et al., 2020). The concentrations of
primers, probes, RNase inhibitor and nucleases used in our hand for exo-probe,
nfo-probe and multiplexing RT-RPA reaction have also been given (Table 1).
Table 1 List of concentrations of primers, probes, nucleases, inhibitors and

Mg(OAc)2 that need to be additionally supplied in a RT-RPA or RT-ERA reaction
kit for viral RNA detection.
Concentrations Recommended ranges by
Components used in our study other studies
Exo-probe Fw & Rw 500 nM 420 nM, can be varied in the

detection primers range of 150–600 nM
Exo probe 150 nM In the range of 50–150 nM
Exonuclease III 100 U in 50 μL –
Nfo-probe Fw & Rw 400 nM 420 nM, can be varied in
LFD primers 150–600 nM range
Nfo probe 120 nM In the range of 50–150 nM
Endonuclease 10 U in 50 μL –
IV
Duplexing Rw & Fw 100 nM Subjected to testing and
Primers optimization
Exo probes 30 nM
Exonuclease III 100 U in 50 μL
Other RNase 5 U in 50 μL –
necessary A inhibitor
reagents Mg(OAc)2 2 μL Standard 14 mM, can be varied
in the range of 12–30 mM
Note: Other components include (i) RPA enzymes (120 ngμL1 T4 UvsX recombinase, 60 ngμL1 T4
UvsY recombination-mediator protein, 600 ngμL1 T4 gp32 single-stranded binding protein,
30 ngμL1 Bsu or 8.6–12.8 μg Sau DNA strand-displacing polymerase), (ii) energy-supply system
constituents (50 mM phosphocreatine, 100 ngμL1 creatine kinase, and 3 mM ATP), (iii) 200 μM each
dNTPs, (iv) buffering constituents (typically pH 7.9 50 mM Tris/100 mM KOAc), (v) reducing agent 2 mM
DTT, (vi) crowding reagent (5% carbowax 20M), and (vii) reverse transcriptase are generally included
in the commercially available RT-RPA or RT-ERA kit with fixed concentration without the need for further
adjustment (Li, Macdonald, & von Stetten, 2020).
For the detection of viral RNA using RT-RPA, multiple detecting formats are
available. These formats include exo probe, nfo probe, fpg probe, digital (Shen
et al., 2011), nesting, microfluidics (Lutz et al., 2010), solid phase, template gener-
ation, electrochemistry, colorimetric or SNP detection, and so on (Daher, Stewart,
Boissinot, & Bergeron, 2016; Li et al., 2020). Among all these, it seems that using
exo probe for fluorescence detection (Behrmann et al., 2020; Tu et al., 2020) and
using nfo probe coupled with lateral flow strip detection (Zheng et al., 2021) are
the most popular and hence we will mainly focus on these two formats for the
detection of SARS-CoV-2 viral RNA by RT-RPA. Herein, either approach has its
own advantages. For the detection of RNA using exo probe, first forward and reverse
primers that are around 30–35 nucleotides long are designed; the melting tempera-
ture of an oligonucleotide is normally not a critical factor for the performance as a
primer. The primer pairs allow the amplification of a relatively short length DNA
amplicon ideally around 100–200 bp long that is most suited for RPA amplification.
In addition to the primer pair, an exo probe was designed for the fluorogenic
detection of the amplicon in the presence of exonuclease III (exo enzyme). The exo
probe is a modified oligonucleotide featuring an abasic nucleotide analogue—
tetrahydrofuran residue (THF, sometimes referred to as “dSpacer”) that is prone to
cleavage by exo enzyme when the nucleotide is in a double-stranded state. In addition,
the exo probe is usually around 46–52 nucleotides long, with at least 30 nucleotides
located 50 - to the THF site, and a further at least 15-bp long nucleotide located
30 - to the THF site. A blocking group, such as a phosphate, a C3-spacer, a biotin-
TEG or an amine, is situated at its 30 side so that the exo probe cannot act as a primer
and block the probe from polymerase extension. The entire exo probe is able to
specifically hybridize with one chain of the amplicon (THF needs to be counted
as one nucleotide residue). In order to allow this probe to detect the amplicon in
a fluorogenic way, exo probe features a flanking dT-fluorophore (e.g. fluorescein)
on one side of the THF residue and a flanking corresponding dT-quencher group
(typically a suitable Black Hole Quencher (BHQ)) on the other side of the THF site.
In such a way, the dT-fluorophore is temporally quenched by its FRET quencher
(e.g. BHQ1) and the probe will be in a none or weakly fluorescent state. Once RPA
reaction produces an amplicon that can hybridize with the exo probe, the exo probe
is converted from single-stranded state to double-stranded state that allows the
THF residue to be readily cleaved by the exo III enzyme. Hence the quencher
moiety is separated from the probe and the fluorescence of the dT-fluorophore
is restored (Fig. 4). Exo probe allows sensitive detection in RT-RPA based on
the enhancement of fluorescence.
In order to make the sensitive detection approach more field-deployable with
minimal instrumentation, nfo probe could be designed in combination with the
use of lateral flow strips for direct visual detection. In this regard, nfo probe can
hybridize with the amplicon to give a bifunctional amplicon, typically with a biotin
antigenic tag at one end and a FAM antigenic tag at the other end. Similar to the exo
probe, a nfo probe is around 46–52 nucleotides long, features an abasic THF residue
in between, at least 30 nucleotides 50 to the THF site, at least a further 15 nucleotides
FIG. 4
Schematic view of the working principle of a typical exo probe for RT-RPA detection of viral
RNA.
located 30 to the THF side, and a blocking group (e.g. a phosphate) at the 30 side to
block the probe from polymerization. In contrast to exo probe, the nfo probe does not
necessitate any modified dT-fluorophore nor dT-quencher, but requires an affinity
biotin or FAM antigenic tag at the 50 side of the probe. In addition, the primer with
reverse direction to the nfo probe should also be modified with a different affinity tag
(e.g. a FAM tag or a biotin tag) complementary to the nfo probe at the 50 end. Once
the nfo probe hybridizes with the amplicon generated in the RPA amplification
reaction, the nfo probe turns to a double-stranded state, rendering its internal THF
residue susceptible to cleavage by the endonuclease IV, i.e. the nfo enzyme. Then
the 15 bp oligonucleotide 50 to the THF side is released, converting the probe to
a primer and initializing polymerization in the RT-RPA reaction. In the end, a bifunc-
tional amplicon featuring a FAM moiety at one end and a biotin moiety at the other
end is generated, which allows easy visual detection using lateral flow strips (Fig. 5).
Since RT-RPA reaction is highly viscous, a further dilution of the RT-RPA reaction
solution is necessary prior to lateral flow strip analysis.
In the lateral flow (LF) test using a lateral flow strip, the bifunctional amplicon
acts as a “bridge” that connects the gold nanoparticle and the antibody immobilized
in the test line so that the test line turns into a red colour, the colour of the gold nano-
particle (Fig. 6). In brief, the lateral flow strip contains two lines. The first line
which is closer to the absorption pad side is immobilized with α-biotin antibody.
The second control line is fixed with an antibody against α-FAM antibody (i.e.
α-[α-FAM-gold] antibody). A colloidal gold particle region (the gold particle is
coated with α-FAM antibody) is located below the two lines and above the sample
pad. When the sample pad of the test strip is inserted into a diluted RT-RPA reaction
solution, the colloidal gold particle will flow along with the eluent and sequentially
FIG. 5
Schematic view of the working mechanism of a nfo probe in RT-RPA for detection of
viral RNA.
FIG. 6
Schematic view of the working mechanism of lateral flow detection (LFD) for the detection of
bifunctional amplicon, i.e. amplicon with two antigenic labels, produced in RT-RPA reaction.
5 General considerations for designing an ultrasensitive RT-RPA assay 11
cross the test and the control line. Once the double-tagged amplicon is presented in
the RT-RPA reaction, it will bridge the gold particle and the α-biotin antibody in the
test line, turning the test line to a red colour. Meanwhile the control line that contains
α-[α-FAM-gold] antibody will bind the α-FAM antibody-coated gold particle,
suggesting that the LF strip is effective (Fig. 6).
5 General considerations for designing an ultrasensitive

RT-RPA assay
RT-RPA reaction contains multiple proteins/enzymes, ingredients, primers, and a
probe. In addition, multiple factors can also affect the performance of RT-RPA re-
action. Therefore, in order to achieve an optimal performance in RT-RPA reaction
for the diagnosis of viral RNA, several points need to be taken into consideration.
Herein, we will mainly discuss the most important factors that could help the setup
of an optimal RT-RPA reaction for RNA detection. These factors include: (i) primer
design, (ii) probe design, and (iii) temperature.
5.1 Primer design

For either exo probe or nfo probe used in RT-RPA test, the optimal primer length is
30–35 nucleotides, which is usually longer than typical PCR primers. Regarding the
design of a primer pair for RPA, the melting temperature of an oligonucleotide is not
the critical factor for its performance as a primer, but rather its length. In addition, the
optimal length of a primer can also be temperature dependent as RPA reaction can
still take place above or below 37 °C. Oligonucleotides shorter than 30 bp may still
function albeit at a typically slower reaction rate. Longer oligonucleotides may also
be used as a primer to increase the RPA kinetics; yet longer primer may increase the
possibility of secondary-structure formation that could lead to the so-called primer
noise. Moreover, since RPA reaction is best suited for relatively short length DNA
amplification compared to PCR methods, it is advised that the primer pair amplify an
amplicon with a length ideally between 100 and 200 bp, not exceeding 500 bp. Am-
plification of a short length of DNA is also beneficial to achieve an increased prod-
uct/noise ratio because shorter products will be generated in a shorter period of time
and the longer an amplicon is, the more likely primer noise will outcompete target
amplification. In fact, short amplicon is an important criterion for designing ultrasen-
sitive RT-RPA assays. In order to select an appropriate primer pair annealing to an
appropriate region within a nucleic acid target, it is advised that the target region is
characterized by relatively “average” nucleotide sequence composition with a GC
content between 40% and 60%, featuring repetitive sequences, and with minimal di-
rect/inverted repeats, palindromes, etc. More importantly, when RT-RPA is used for
viral nucleic acid detection, the specificity of the primers toward the nucleic acid
target of the virus should be carefully evaluated. This can be tested, via, e.g. BLAST,
to ensure that the designed primers indeed specifically detect certain species, but not
any other species. In order to screen a best Fw and Rw primer pair, different Fw
primer and Rw primers could be paired and evaluated.
5.2 Probe design

Both exo and nfo probes should be 46–52 nucleotides long, featuring at least 30 bp
located 50 to the THF site, and at least a further 15 bp located 30 to THF residue
appended with a blocking group at the 30 group. The 30 block group should always
be added in order to prevent polymerization from the probe. Care should be taken to
avoid the occurrence of primer-probe dimers, although the primer in the same direc-
tion as the probe could partially overlap at its 50 part. In addition, secondary struc-
tures in the probe should be avoided to prevent the probe folding back on itself.
For the design of either exo probe or nfo probe, it needs to be kept in mind that
the THF site occupies one base site, meaning THF needs to replace an existing base
rather than being added as an additional base. For the design of the exo probe, the
most important factor is to identify a pair of dT residues in close proximity to each
other, typically with only 1–5 interval nucleotides. If the distance between the
dT-fluorophore and dT-quencher is too large, quenching could be poor. For the
design of a nfo probe, a 50 -antigenic label needs to be appended in order to pair with
the antigenic label on the opposing primer.
5.3 Reaction temperature

Most commercially available RPA kits are designed for being conducted at a tem-
perature range of 37–42 °C. If the temperature is higher, enzymes gradually lose
activity inhibiting amplification. When the reaction temperature is lower, the
RPA may also work excellently but at a reduced reaction rate. However, the problem
is that the consumption of the reagents in the RPA reaction still proceeds quickly
even at a reduced temperature. The result is fuel “burn-out” before RPA amplification
produces a reasonable amount of amplicon for detection.
6 Comparative reviews of recently published RT-RPA assays

for SARS-CoV-2 detection
Until now, there have been multiple reports about the detection of SARS-CoV-2 viral
RNA using RT-RPA approach following our initial report in March 2020 and May
2020 (Abd El Wahed et al., 2021; Arizti-Sanz et al., 2020; Behrmann et al., 2020;
Qian et al., 2020; Tu et al., 2020; Wang, Cai, et al., 2020; Xia & Chen, 2020a,
2020b; Xiong et al., 2020; Xue et al., 2020; Zheng et al., 2021). We introduced
an WEPEAR (whole-course encapsulated procedure for exponential amplification
from RNA) that seamlessly combines the reverse transcription (optimally at 37 °C,
in the absence of Mg(OAc)2 catalyst) and the RPA reaction (optimally at 40 °C, in
6 RT-RPA assays for SARS-CoV-2 detection 13
FIG. 7
The WEPEAR protocol seamlessly combines reverse transcription and RPA reactions in one
tube allowing both steps to be conducted under their own optimal temperatures and prevents
the Mg2+ used in the RPA reaction from interacting with the RNA sample and inhibiting
reverse transcription.
the presence of Mg(OAc)2 catalyst) at their own optimal conditions (Fig. 7) (Xia &
Chen, 2020a, 2020b). Because the optimal temperature used for performing reverse
transcription and RPA reaction is different (although a bit close), direct combination
of reverse transcription and RPA reactions in one tube would compromise the entire
amplification, although possible. In addition, the Mg2+ ion used as a catalyst in the
PRA reaction can complex with the RNA to inhibit the transcription step. Hence it is
advantageous to physically separate the reverse transcription step and the PRA am-
plification step. On the other hand, however, it is also highly desirable to perform
reverse transcription and RPA reactions in one-tube without re-opening the lid again
after introducing the detection sample. In this case, it can simplify the testing pro-
cedure and reduce possible contamination during the amplification course, such
as aerosol contamination from the air. The WEPEAR protocol readily solved this
problem by seamlessly combining the RT step and the RPA step in one-pot without
opening the lid at all during the entire detection course (Fig. 7).
In WEPEAR protocol, the RNA sample is added into the reaction solution in a
vial containing all necessary reagents for both RT and RPA reaction aside from the
magnesium activator. In the meanwhile, a small volume of the magnesium acetate
solution catalyst is loaded onto the lid of the reaction vial; due to the surface tension
force, the small volume of the magnesium solution will still sit inside of the inner lid
after gently closing the lid. The reaction vial is first warmed to 37 °C for 60 s to finish
the reverse transcription process. Afterwards, the reaction vial is subjected to brief
centrifugation, vortex, centrifugation again to mix the magnesium catalyst into the
reaction mixture and initialization of the RPA reaction. Finally, the reaction vial is
warmed to 40 °C for 4 min as the pre-reaction step, vortexed, centrifuged again, and
warmed to 40 °C for another 26 min to complete the entire RPA reaction. Herein,
vortexing and centrifuging the reaction again after 4 min is beneficial to enhance
the sensitivity because RT-RPA reaction mixture is quite viscous and the internal
vortex step could help disperse the initially amplified amplicon in the entire reaction
mixture for a more efficient amplification (Fig. 7).
In the WEPEAR-powered RT-PRA approach, two exo probes were designed for
the detection of N-gene and S-gene. Both probes show high sensitivity for the detec-
tion of SARS-CoV-2 RNA. The exo probe for N-gene can detect four copies of RNA
in a reaction while the exo probe for S-gene is able to achieve single-copy sensitivity
in the RT-RPA reaction.
As has been mentioned above, false negative results that are usually caused by
lack of sufficient sensitivity in the detection method should be avoided. False pos-
itive results also need to be minimized for a reliable diagnostic approach. Herein, if
two genes could be simultaneously detected, many false positive results will be ex-
cluded. In our recent report, the exo probe for N-gene is green-colour emissive and
the exo probe for S-gene is red-colour emissive. Hence, it makes it possible to mul-
tiplex the RT-RPA reaction for simultaneous dual-gene detection. We achieved this
simply by reducing the concentrations of both primers and probes to around one fifth
of their original concentration. Real-time dual-gene detection using green and red
channels was readily achieved using an advanced real-time PCR machine. This result
suggested that rational adjustment/reduction of the primer and probe concentrations
is an efficient way to establish a successful multiplexing RT-RPA reaction.
In addition to the exo probes, nfo probe for both N- and S-gene were also
designed for lateral flow test without the need of a real-time PCR machine, nor a blue
light imaging plate. Hence, nfo probe combined with lateral flow strips provide a
more field-deployable way for conducting SARS-CoV-2 detection. Household
detection using this LFD method is also possible simply using a daily used thermos
cup to warm up the reaction vial. Herein, ultrasensitivity has been achieved for both
nfo probes. The sensitivity tested using in vitro transcribed RNA sample reached
four-copy per reaction.
Among other RT-RPA methods for SARS-CoV-2 detection (Table 2), enhanced
RT-RPA has been introduced which is named eRPA protocol (Qian et al., 2020). In-
ternally quenched (exo-IQ) probe was designed for the detection of SARS-CoV-2
N gene (Behrmann et al., 2020). Also, all the required detection setup and reagents
could be included in a suitcase called a “Suitcase Lab” for deployable detection of
SARS-CoV-2 (Behrmann et al., 2020). Moreover, RT-RPA can be coupled with gene
editing enzymes, e.g. Cas12a or Cas13a for viral RNA detection (Arizti-Sanz et al.,
2020; Xiong et al., 2020). RT-RPA has the following advantages over RT-PCR:
(1) the amplification proceeds faster which can be accomplished within 20–30min;
(2) RT-RPA proceeds at a constant temperature without the need of thermocyclers,
and often gives higher sensitivity. For example, there are already several reports
achieving single-copy detection sensitivity for the detection of SARS-CoV-2 using
Table 2 Summarization of recently published RT-RPA methods for sensitive detection of SARS-CoV-2 (as of February 2021).
Entry Gene Type Sequence & structure Duration Sensitivity Specificity Readout References Date
1 and N Fw TTTGGTGGACCCTCAGATTCAACTGGCAGTAAC 1 min (37 °C) 4-copy/ Specific over Green Xia and March 23,
2 Rw GAATTTAAGGTCTTCCTTGCCATGTTGAGTGAG + 30 min reaction SARS-CoV emission Chen 2020
(40 °C) with (50 μL) (2020a) and
Exo-probe TATTATTGGGTAAACCTTGGGGCCGACGTTGTT/
internal vortex Xia and
i6FAMdT/T/idSp/
Chen
A/iBHQ1dT/CGCGCCCCACTG-Phosphate
(2020b)
N Fw TTTGGTGGACCCTCAGATTCAACTGGCAGTAAC 1 min (37 °C) 4-copy/ Specific over LFD May 28,
Rw Biotin-GAATTTAAGGTCTTCCTTGCCATGT + 30 min reaction MERS-CoV 2020
TGAGTGAG (40 °C) with (50 μL) but not
internal vortex SARS-CoV
Nfo-probe 6-FAM-GCGATCAAAACAACGTCGGCCCCAAGGTT
+2 min LF test
TACC/idSp/AATAATACTGCGTCT-Phosphate
S Fw GTCTCTAGTCAGTGTGTTAATCTTACAACCAGAAC 1 min (37 °C) 1-copy/ Specific over Red Xia and May 28,
Rw CATTGGAAAAGAAAGGTAAGAACAAGTCCTGAG + 30 min reaction SARS-CoV emission Chen 2020
(40 °C) with (50 μL) (2020b)
Exo-probe CCTGCATACACTAATTCTTTCACACGTGGT
internal vortex
G/iTAMdT/T/idSp/A/iBHQ2dT/
TACCCTGACAAAGTT-Phosphate
S Fw GTCTCTAGTCAGTGTGTTAATCTTACAACCAGAAC 1 min (37 °C) 4-copy/ Specific over LFD
Rw Biotin-CATTGGAAAAGAAAGGTAAGAACAAGT + 30 min reaction SARS-CoV,
CCTGAG (40 °C) with (50 μL) MERS-CoV
internal vortex
Nfo-probe 6-FAM-CCTGCATACACTAATTCTTTCACACGTGGT
+2 min LF test
G/idSp/TTATTACCCTGACAA-Phosphate
3 N Fw CCTCTTCTCGTTCCTCATCACGTAGTCGCAAC 21 min (42 °C) 10-copy/ Specific over Green Behrmann May 8,
Rw AGTGACAGTTTGGCCTTGTTGTTGTTGGCCTT + internal reaction SARS-CoV, emission et al. (2020) 2020
vortex (57 μL) MERS-CoV,
Exo- CCTGCTAGAATGGCTGGCAATGGCGGTGA/
OC43/229E/
Probe idFAMdT/idSp/C/iBMNQ535dT/
NL63
TGCTCTTGCTTTGC-C3
4 S Fw CTTCAACCTAGGACTTTTCTATTAAAATATAATG 4 min + 20 min 10-copy/ Specific over Green Xue et al. May 22,
Rw GTTGGTTGGACTCTAAAGTTAGAAGTTTGATAG (39 °C) reaction OC43/229E/ emission (2020) 2020
(50 μL) NL63/HKU1
Exo-probe CCATTACAGATGCTGTAGACTGTGCACTTG
ACCC/iFAMdT/C/idSp/C/iBHQ1dT/
CAGAAACAAAGTGTACG-Phosphate
Orf1ab Fw TACGCCAAGCTTTGTTAAAAACAGTACAATTCTG 4 min + 20 min 1-copy/ Green
Rw GGCATTAACAATGAATAATAAGAATCTACAACAGG (39 °C) reaction emission
(50 μL)
Exo-probe TTGTTGGTGTACTGACATTAGATAATCAAG
ATC/iFAMdT/C/idSp/A/iBHQ1dT/
GGTAACTGGTATGATTTCG-Phosphate
5 N Fw CAGTTCAAGAAATTCAACTCCAGGCAGCAGTAG 7 min (39 °C) 10-copy/ Specific over Green Wu et al. July 29,
Rw CAGTTTGGCCTTGTTGTTGTTGGCCTTTAC + 20 min reaction OC43/229E/ emission (2020) 2020
(39 °C) (50 μL) NL63/HKU1,
influenza A/
Exo-probe CAGACATTTTGCTCTCAAGCTGGTTCAATC
B; unknown
/iFAMdT/idSp/iBHQ1dT/CAAGCAGCAGC
for SARS-
AAAG-C3
CoV
6 S Fw TCTTGTTTTATTGCCACTAGTCTCTAGTCAGT 25 min (42 °C) 3-copy/ Specific over LFD Qian et al. November
Rw FAM-GAATGTAAAACTGAGGATCTGAAAACTTTG + 3 min (90 °C) reaction SARS-CoV, (2020) 20, 2020
+ 3 min (RT) (50 μL) MERS-CoV,
+3 min LF test SuperScript 229E/HKU1
Nfo-probe Biotin-TGCATACACTAATTCTTTCACACGTGGT
IV & RNase
H added
Continued
Table 2 Summarization of recently published RT-RPA methods for sensitive detection of SARS-CoV-2 (as of February 2021).—
cont’d
Entry Gene Type Sequence & structure Duration Sensitivity Specificity Readout References Date
7 Orf1ab Fw CCAAGGTAAACCTTTGGAATTTGGTGCCAC 50 min 10-copy/μL Specific over Green Arizti-Sanz November
input SARS-CoV emission et al. (2020) 20, 2020
Rw ACTATCATCATCTAACCAATCTTCTTCTTG or LFD
Cas13a CUCUUCUUCAGGUUGAAGAGCAGCAGAA
crRNA
FQ/FB 6-FAM-rUrUrUrUrUrUrUrUrUrUrUrUrUrU-Biotin
reporter 6-FAM-rUrUrUrUrUrUrU-IABkFQ
8 Orf1ab Fw TTGCCTGGCACGATATTACGCACAACTAATGGT 20 min (42 °C) 1-copy/ Specific over Green Xiong et al. December
Rw CAAGCTGATGTTGCAAAGTCAGTGTACTCTAT + up to reaction MERS-CoV, emission (2020) 15, 2020
120 min (37 °C) (12.5 μL) SARS-CoV, or LFD
Cas12a UAAUUUCUACUAAGUGUAGAUgugcaguug
for Cas12a OC43/HKU1
crRNA guaacaucuguuac
detection
FQ/FB FAM-TTATT-BHQ1
reporter FAM-TTATT-Biotin
N Fw CTTCCTCAAGGAACAACATTGCCAAAAGGCT 20 min (42 °C) 1–10-copy/ Specific over Green
Rw TCTAGCAGGAGAAGTTCCCCTACTGCTGCCTGG + up to reaction SARS-CoV, emission
120 min (37 °C) (12.5 μL) MERS-CoV, or LFD
Cas12a UAAUUUCUACUAAGUGUAGAUuugaacugu
for Cas12a OC43/HKU1
crRNA ugcgacuacgugau
detection
FQ/FB FAM-TTATT-BHQ1
reporter FAM-TTATT-Biotin
9 RdRp Fw TATGCCATTAGTGCAAAGAATAGAGCTCGCAC 15 min 2-copy/ NOT specific Green Abd El January
Rw CAACCACCATAGAATTTGCTTGTTCCAATTAC reaction over SARS- emission Wahed et al. 20, 2021
(50 μL) CoV (2021)
Exo-probe TCCTCTAGTGGCGGCTATTGATTTCAATAA
/iBHQ1dT/idSp/iFAMdT/
TTGATGAAACTGTCTATTG-Phosphate
E Fw GAAGAGACAGGTACGTTAATAGTTAATAGCGTA 15 min 15-copy/ NOT specific Green
Rw AAAAAGAAGGTTTTACAAGACTCACGTTAACsA reaction over SARS- emission
(50 μL) CoV
Exo-probe ATCGAAGCGCAGTAAGGATGGCTAG/iBHQ1dT/
idSp/iFAMdT/AACTAGCAAGAATAC-Phosphate
N Fw CCTCTTCTCGTTCCTCATCACGTAGTCGCAAC 15 min 15-copy/ Specific over Green
Rw AGTGACAGTTTGGCCTTGTTGTTGTTGGCCTT reaction SARS-CoV emission
(50 μL)
Exo-probe TAGAATGGCTGGCAATGGCGGTGATGCTGC
/iBHQ1dT/idSp/iFAMdT/TGCTTTGCTGCTGCTT-
Phosphate
10 N Fw CTAACAAAGACGGCATCATATGGGTT 30 min (39 °C) 10-copy/ Specific over LFD Zheng et al. February
Rw FITC-GGCCTTTACCAGACATTTTGCTCTCA + LFD reaction SARS-CoV, (2021) 1, 2021
(50 μL) OC43/
Nfo-probe Biotin-CTCTTCTCGTTCCTCATCACGTAGTCGCAA
HKU1/
C/dSp/GTTCAAGAAATTCA-Phosphate
NL63/229E,
HBV human
influenza A/
B, RSV A/B,
Abbreviations: FITC, fluorescein isothiocyanate; FAM, fluorescein; 6-FAM, 6-carboxyfluorescein; C3, C3-blocking group; idFAMdT, internal FAM modified dT nucleotide; id6FAMdT, internal 6-FAM modified dT nucleotide; idTAMdT,
internal TAMRA modified dT nucleotide; idSp, internal tetrahydrofuran (THF) spacer; idBHQ1, internal BHQ1 quencher modified dT nucleotide; idBHQ2, internal BHQ2 quencher modified dT nucleotide; iBMNQ535dT, internal
BMNQ535 quencher modified dT nucleotide; s, phosphorothioate backbone.
9 Key resources table 17
RT-RPA (Xia & Chen, 2020a, 2020b; Xue et al., 2020). A comparison of the recently
reported RT-RPA detection against SARS-CoV-2 RNA is summarized in Table 2.
7 Methods section
In the following, we will detail the methods using the WEPEAR protocol for ultra-
sensitive field-deployable detection of SARS-CoV-2 RNA.
Methods section (All Using Basic RT-ERA Kit).
8 Before you begin

Timing: few days
Design and customer synthesis of exo probes, nfo probes, and respective primers
(few days);
Reconstitution of the obtained exo probes, nfo probes and respective primers to
10 μM as stock solutions; store at 40 °C and thaw them before use;
Preparation of 5 U/μL murine RNase inhibitor in glycerol containing solution and
store at 40 °C before use;
Make exonuclease III at 200 U/μL and endonuclease IV at 10 U/μL; store at
40 °C before use;
Preparation of viral RNA sample using a qualified RNA extraction kit.
9 Key resources table
Reagent or resource Source Identifier
Bacterial and virus strains

DH5α E. coli HaiGene Cat# K10119
Recombinant proteins
Exonuclease III (exo III) Thermo Scientific Cat# EN0191
Murine RNase inhibitor Vazyme Cat# R301-01
Endonuclease IV (nfo enzyme) Vazyme Cat# R301-01
NdeI NEB Cat# R0111S
HindIII NEB Cat# R3104S
Critical commercial assays
T7 high yield transcription kit Vazyme Biotech Cat# TR101-01
Co., Ltd.
Continued
—cont’d
Basic RT-ERA reaction kit GenDx Biotech Co., Cat# KS102
Ltd.
FastPure gel DNA extraction mini kit Vazyme Biotech Cat# DC301
Co., Ltd.
Express RNA purification kit GenDx Biotech Co., Cat# NR202-50T
Ltd
Oligonucleotides
N-gene Exo Fw: LoGenBio N.A.
tttggtggaccctcagattcaactggcagt
aac
N-gene Exo Rw: LoGenBio N.A.
gaatttaaggtcttccttgccatgttgagt
gag
N-gene Exo probe: LoGenBio N.A.
tattattgggtaaaccttggggccgacgtt
gtt/i6FAMdT/t/idSp/a/iBHQ1dT/
cgcgccccactg-Phosphate
N-gene Nfo Fw: LoGenBio N.A.
aac
N-gene Nfo Rw: LoGenBio N.A.
aac
N-gene Nfo probe: 6- LoGenBio N.A.
FAM-gcgatcaaaacaacgtcggccccaaggttt
acc/idSp/aataatactgcgtct-Phosphate
S-gene Exo Fw: LoGenBio N.A.
gtctctagtcagtgtgttaatcttacaacc
agaac
S-gene Exo Rw: LoGenBio N.A.
cattggaaaagaaaggtaagaacaagtcct
gag
S-gene Exo probe: LoGenBio N.A.
cctgcatacactaattctttcacacgtggt
g/iTAMdT/t/idSp/A/iBHQ2dT/
taccctgacaaagtt-Phosphate
S-gene Nfo Fw: LoGenBio N.A.
gtctctagtcagtgtgttaatcttacaacc
agaac
S-gene Nfo Rw: Biotin- LoGenBio N.A.
cattggaaaagaaaggtaagaacaagtcct
gag
S-gene Nfo probe: LoGenBio N.A.
6-FAM-cctgcatacactaattctttcacacgtggt
g/idSp/ttattaccctgacaa-Phosphate
Recombinant DNA
SARS-CoV-2 N-gene plasmid LoGenBio N.A.
11 Step-by-step method details 19
—cont’d
SARS-CoV-2 S-gene plasmid LoGenBio N.A.
SARS-CoV N-gene plasmid LoGenBio N.A.
SARS-CoV S-gene plasmid LoGenBio N.A.
MERS-CoV N-gene plasmid LoGenBio N.A.
MERS-CoV S-gene plasmid LoGenBio N.A.
Software and algorithms
SnapGene viewer SnapGene www.snapgene.com/
snapgene-viewer
BLAST NCBI https://blast.ncbi.nlm.
nih.gov/Blast.cgi
Image J National Institutes of https://imagej.net/
Health (NIH) Downloads
Other
HybriDetect LF strips Amplification Future Cat# WLF8201
DL5000 DNA marker Vazyme Cat# MD102
100 bp DNA ladder Vazyme Cat# MD104
Agarose Biosharp Cat# BS081-100g
50 TAE buffer Alphabio Cat# A1558
SYBR safe DNA gel stain APExBio Cat# A8743
DNA sample loading buffer Alphabio Cat# A1550
10 Materials and equipment

• Mini centrifuge (DLAB, D1008)
• PCR machine (MIULAB, PR-96E)
• Real-time PCR machine (Applied Biosystem, QuantStudio 6Flex)
• Fluorescence spectrometer (Molecular Devices, SpectraMax i3x)
• Pipettes (Eppendorf, 2.5, 10, 20, 200, 1000 μL)
• Horizontal gel electrophoresis kit (LIUYI, DYCP-31C)
• Heating block (DLAB, Mini HCL100)
• Mini blue and white light imaging plate (LIUYI, WD-9403 )
11 Step-by-step method details

11.1 Detection of SARS-CoV-2 N- or S-gene using exo probes and
primers
Timing: around 31 min
1. For a 50 μL reaction system, 2.5 μL of exo forward primer (10 μM), 2.5 μL of exo
reverse primer (10 μM), 0.75 μL of exo FRET probe (10 μM), 1 μL of 5 U/μL of
murine RNase inhibitor, 1 μL of RNA sample, 20 μL of DI-H2O, and 0.5 μL of

200 U/μL exonuclease III were added into 20 μL dissolving buffer (DA solution).
2. The resultant 48 μL of reaction solution was added into the PCR tube
containing dry powder that includes all necessary enzymes and ingredients for
RT-ERA to occur, and then gently pipette to mix the reaction mixture.
3. Meanwhile, 2 μL of Mg(OAc)2 solution as the ERA activator was loaded into the
lid of the PCR tube, then close the lid gently.
4. Afterwards, the reaction vial was incubated in a 37 °C water bath for 60 s to allow
solely transcription to take place.
5. Centrifuge the tube to mix the Mg2+ activator with the RT-ERA reaction mixture,
shake and centrifuge again to collect all liquids to the bottom of the PCR tube.
6. Heat the PCR tube at 40 °C for 4 min using a heating block or PCR machine
or water inside a thermos cup to allow pre-reaction.
7. The PCR tube was shaken and spun again, and incubated at 40 °C for another
26 min to compete the RT-ERA reaction.
8. Visualize the fluorescence signal by putting the PCR tube on top of a mini
blue-light plate and capture the fluorescence image using a smartphone camera;
alternatively, the fluorescence intensity can be quantified using Molecular
Devices SpectraMax i3x with a 96-well plate.
Important notes:
(i) The area around PCR machine where RT-ERA amplification is conducted can
produce invisible aerosols in the air that contain the target amplicon. Hence
the aerosols could potentially contaminate the surrounding areas. As a result,
the area for setting up the RT-ERA reaction and the area for conducting the
RT-ERA amplification should be strictly separated in order to prevent the
contamination of the RT-ERA reaction solution by aerosols in the air.
(ii) Since RNase ubiquitously exists which is detrimental for RNA samples, the
whole working area should be carefully cleaned using DEPEC water and the
equipment used (e.g. mini-centrifuge and pipettes) should also be swiped using
DEPEC water prior to use; in addition, all consumables, e.g. tips, should be
autoclaved after spraying with DEPEC water prior to use.
(iii) Always wear appropriate personal protective equipment (PPE) including at
least a lab coat, goggles, gloves, and a mask; wearing of a mask is required in
order to prevent any foams/droplets that contain RNase and other contaminant to
be expelled from the mouth and nose contaminating the RT-ERA reaction.
(iv) Be highly cautious to avoid any part of your skin from touching the working
bench, equipment and consumables when performing the SARS-CoV-2
detection because skin surfaces have a lot of secretions (like oil) that contain
RNase and other contaminates.
(v) Due to the ultrahigh sensitivity of this RT-ERA test, both positive control and
negative control samples must be included in every test in order to exclude
possible false positive and false negative results.
11 Step-by-step method details 21
11.2 Detection of SARS-CoV-2 N- or S-gene using nfo probes

and lateral flow strips
Timing: around 31 min + around 3 min of LFD
1. For a 50 μL reaction system, 2 μL of nfo forward primer (10 μM), 2 μL of nfo
reverse primer (10 μM), 0.6 μL of nfo probe (10 μM), 1 μL of 5 U/μL of murine
RNase inhibitor, 1 μL of RNA sample, 21 μL of DI-H2O, and 1 μL of 10 U/μL
endonuclease IV (nfo enzyme) were added into 20 μL dissolving buffer
(DA solution).
2. The resultant 48 μL of reaction solution were added into a PCR tube containing
dry powder that includes all necessary enzymes and ingredients for RT-ERA to
occur, and then gently pipette to mix the reaction mixture.
3. Meanwhile, 2 μL of Mg(OAc)2 solution as the ERA activator was loaded into
the lid of the PCR tube, and then the lid was closed gently.
4. Afterwards, the reaction vial was incubated in a 37 °C water bath for 60 s to
allow solely transcription to take place.
5. Centrifuge the tube to mix the Mg2+ activator with the RT-ERA reaction
mixture, shake and centrifuge again to collect all liquids to the bottom of the
PCR tube.
6. Warm the PCR tube at 40 °C for 4 min using a heating block, a PCR machine or
water bath inside a thermos cup to allow for pre-reaction.
7. The PCR tube was shaken and centrifuge again, and incubate at 40 °C for
another 26 min to complete the RT-ERA reaction.
8. 10 μL of nfo reaction solution was diluted into 200 μL by DI-H2O in a 1.5 mL
centrifuge tube.
9. The sample pad end of the HybriDetect LF strip was dipped into the diluted
reaction solution.
10. Read the detection result after 2–3 min that if both the test line and control line
turn red, SARS-CoV-2 viral RNA is detected.
Important notes:
(i) The area around the PCR machine where RT-ERA amplification is conducted
can produce invisible aerosols in the air that contain the target amplicon. Hence
the aerosols could potentially contaminate the surrounding areas. As a result,
the area for setting up the RT-ERA reaction and the area for conducting the
RT-ERA amplification should be strictly separated in order to prevent the
contamination of the RT-ERA reaction solution by aerosols in the air.
(ii) Since RNase ubiquitously exists, which is detrimental for RNA samples, the
whole working area should be carefully cleaned using DEPEC water and the
equipment used (e.g. mini-centrifuge and pipettes) should also be swiped using
DEPEC water prior to use; in addition all consumables, e.g. tips, should
be autoclaved after spraying with DEPEC water prior to use.
(iii) Always wear appropriate PPE including at least a lab coat, goggles, gloves, and
mask; wearing of a mask is required in order to prevent any foams/droplets that
contain RNase and other contaminants to be expelled from the mouth and nose
contaminating the RT-ERA reaction.
(iv) Be highly cautious to avoid any part of your skin from touching the working
bench, equipment and consumables when performing the SARS-CoV-2
detection because skin surfaces have a lot of secretions (like oil) that contain
RNase and other contaminates.
(v) Due to the ultrahigh sensitivity of this RT-ERA test, both a positive control and
a negative control samples must be included in every test in order to exclude
possible false positive and false negative results.
(vi) After the LF strip is dipped into the diluted RT-ERA reaction, the results should
be read within the initial few minutes to get a reliable readout because the
test line may still gradually, although slowly, develop some light red colour
after an extended duration even for a blank or negative control sample.
11.3 Optional steps

Timing: <1 min
1. For single-copy sensitivity assay, more internal vortex steps are advised, such as
at 3rd, 6th and 9th min
11.4 Simultaneous dual N- and S-gene detection using paired exo

probe and primers for N-gene and exo probe and primers for S-gene
Timing: >30 min
1. For a 50 μL reaction system, 0.5 μL of exo forward primers (10 μM) for N- and
S- gene (final 100 nM), 0.5 μL of exo reverse primers (10 μM) for N- and S-genes
(final 100 nM), 0.3 μL of exo probes (each 5 μM) for N- and S-genes
(final 30 nM for each exo probe), 1 μL of 5 U/μL of murine RNase inhibitor, 1 μL
RNA sample, 23 μL of DI-H2O, and 0.5 μL of 200 U/μL exonuclease III were
added into 20 μL of DA solution.
2. The resultant 48 μL of reaction solution was added into the PCR tube containing
dry powder that includes all necessary enzymes and ingredients for RT-ERA to
occur; and then gently pipette to mix the reaction mixture.
3. Transfer the PCR mixture to a 0.2 mL 8-strip PCR tubes equipped with
transparent and flat lids.
4. Meanwhile, 2 μL of Mg(OAc)2 solution as the ERA activator was loaded into the
lid of the PCR tube strip, and then close all lids gently.
5. Afterwards, the PCR tube strip was incubated in a 37 °C water bath for 60 s to
allow solely the transcription to take place.
6. Centrifuge the PCR tube strip to mix the Mg(OAc)2 activator into the RT-ERA
reaction mixture, shake and centrifuge again.
7. Load the PCR strips into Applied Biosystem QuantStudioTM 6Flex real-time
PCR machine according to the instructions of the manufacturer.
8. Record the fluorescence increase of both fluorescein and TAMRA channels.
12 Summary 23
12 Summary
In this chapter, we have described nucleic acid-based approaches for sensitive detec-
tion of SARS-CoV-2 with a particular focus on the recombinase polymerase ampli-
fication that belongs to the isothermal amplification category. Sensitivity is the key
to avoid false negative results and would be highly beneficial to prevent the spread of
a pandemic. Some recent reports have already pointed out the necessity to avoid in-
sensitive methods, e.g. some serological tests, for practical SARS-CoV-2 diagnosis.
According to recently published papers, more than one RT-RPA-based reports have
achieved single-copy sensitivity, the highest sensitivity in diagnosis. This is gener-
ally higher than the widely used RT-PCR methods and is clearly higher than other
testing approaches. In order to achieve a high sensitivity, primers and probe should
be rationally designed in order to achieve the best performance. Specificity should
also be taken into account when designing primers and probes for sensitive viral
RNA detection. The region within an RNA genome for RT-RPA amplification also
needs to be carefully taken into account. Unlike the direct detection of DNA using
RPA, the detection of RNA using RPA requires an additional reverse transcription
step. However, the reaction condition of reverse transcription is typically not fully
consistent with the conditions used in RPA; and moreover, some reagents used in
RPA (e.g. the catalyst Mg2+) can potentially inhibit reverse transcription. In order
to make the two steps fully compatible, whole-course encapsulated procedure for
exponential amplification from RNA (WEPEAR) protocol has been introduced
for “sample-in, results-out” one tube detection of viral RNA sample (Xia & Chen,
2020a, 2020b).
RT-RPA has several distinct advantages; however, it also has some limitations.
RT-RPA is performed under a constant temperature, in the range between room tem-
perature to 42 °C without the need for thermocyclers. As a result, highly costly real-
time PCR machine is not compulsory for performing the detection. RT-RPA could be
coupled with either fluorogenic detection using a blue light imaging plate, or lateral
flow strips without any particular imaging devices. All these features make RT-RPA
highly field-deployable and would be rather suited for grassroots clinics. In fact, we
have shown that RT-PRA coupled with LF test using thermos cups as the heating
device can be conducted in a house-hold fashion (Xia & Chen, 2020a, 2020b). An-
other key advantage of RT-RPA is the fast detection rate with a typical sample-to-
readout time in the range of 20–30 min, and even within 20 min. This is clearly
shorter than the RT-LAMP method (usually >60 min) and RT-PCR methods (typi-
cally >2 h). On the other hand, the RT-RPA reaction contains multiple components,
including several enzymes, proteins, energy-supply system, crowding agents, aside
from primers and probes. This makes a standard RT-RPA reaction relatively more
expensive. However, given that no sophisticated instrumentation is required and
that diagnosis time is much shorter, the general cost for performing an RPA assay
could still be reduced to a comparative level to other nucleic acid-based detection
approaches as suggested by some previous evaluations (Londono, Harmon, &
Polston, 2016). Along with the further development of RT-RPA, such as the digital
version, microfluidic version and so on, and the fact that there are several unique
advantages of RT-RPA (e.g. ultrahigh sensitivity), we predict RT-RPA approach will
show great potential for sensitive and field-deployable viral RNA detection in the
future.
Acknowledgement
We thank the research fund from Harbin Institute of Technology, and National Natural Science
Foundation of China (grant No. 32071410 to X.C.) for the support of this work.
References
Abd El Wahed, A., Patel, P., Maier, M., Pietsch, C., Ruster, D., Bohlken-Fascher, S., et al.
(2021). Suitcase lab for rapid detection of SARS-CoV-2 based on recombinase polymerase
amplification assay. Analytical Chemistry, 93(4), 2627–2634.
Ai, T., Yang, Z., Hou, H., Zhan, C., Chen, C., Lv, W., et al. (2020). Correlation of chest CT and
RT-PCR testing for coronavirus disease 2019 (COVID-19) in China: A report of 1014
cases. Radiology, 296(2), E32–E40.
Amanat, F., Stadlbauer, D., Strohmeier, S., Nguyen, T. H. O., Chromikova, V., McMahon, M.,
et al. (2020). A serological assay to detect SARS-CoV-2 seroconversion in humans.
Nature Medicine, 26(7), 1033–1036.
Arizti-Sanz, J., Freije, C. A., Stanton, A. C., Petros, B. A., Boehm, C. K., Siddiqui, S., et al.
(2020). Streamlined inactivation, amplification, and Cas13-based detection of SARS-
CoV-2. Nature Communications, 11(1), 5921.
Behrmann, O., Bachmann, I., Spiegel, M., Schramm, M., Abd El Wahed, A., Dobler, G., et al.
(2020). Rapid detection of SARS-CoV-2 by low volume real-time single tube reverse tran-
scription recombinase polymerase amplification using an exo probe with an internally
linked quencher (Exo-IQ). Clinical Chemistry, 66(8), 1047–1054.
Chen, J. L. (2020). Pathogenicity and transmissibility of 2019-nCoV-A quick overview and
comparison with other emerging viruses. Microbes and Infection, 22(2), 69–71.
Chen, L. J., Liu, W. Y., Zhang, Q., Xu, K., Ye, G. M., Wu, W. C., et al. (2020). RNA based
mNGS approach identifies a novel human coronavirus from two individual pneumonia
cases in 2019 Wuhan outbreak. Emerging Microbes & Infections, 9(1), 313–319.
Chen, J. S., Ma, E., Harrington, L. B., Da Costa, M., Tian, X., Palefsky, J. M., et al. (2018).
CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.
Science, 360(6387), 436–439.
Chu, D. K. W., Pan, Y., Cheng, S. M. S., Hui, K. P. Y., Krishnan, P., Liu, Y. Z., et al. (2020).
Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumo-
nia. Clinical Chemistry, 66(4), 549–555.
Compton, J. (1991). Nucleic-acid sequence-based amplification. Nature, 350(6313), 91–92.
Corman, V. M., Landt, O., Kaiser, M., Molenkamp, R., Meijer, A., Chu, D. K. W., et al. (2020).
Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveil-
lance, 25(3), 23–30.
Daher, R. K., Stewart, G., Boissinot, M., & Bergeron, M. G. (2016). Recombinase polymerase
amplification for diagnostic applications. Clinical Chemistry, 62(7), 947–958.
References 25
Dinnes, J., Deeks, J. J., Adriano, A., Berhane, S., Davenport, C., Dittrich, S., et al. (2020).
Rapid, point-of-care antigen and molecular-based tests for diagnosis of SARS-CoV-2 in-
fection. Cochrane Database of Systematic Reviews, 8, 1–129. https://doi.org/
10.1002/14651858.CD14013705.
Dohla, M., Boesecke, C., Schulte, B., Diegmann, C., Sib, E., Richter, E., et al. (2020). Rapid
point-of-care testing for SARS-CoV-2 in a community screening setting shows low sen-
sitivity. Public Health, 182, 170–172.
Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., et al.
(2017). Nucleic acid detection with CRISPR-Cas13a/C2c2. Science, 356(6336), 438–442.
James, A. S., & Alawneh, J. I. (2020). COVID-19 infection diagnosis: Potential impact of iso-
thermal amplification technology to reduce community transmission of SARS-CoV-2. Di-
agnostics, 10(6), 399.
Kashir, J., & Yaqinuddin, A. (2020). Loop mediated isothermal amplification (LAMP) assays
as a rapid diagnostic for COVID-19. Medical Hypotheses, 141, 109786.
Kilic, T., Weissleder, R., & Lee, H. (2020). Molecular and immunological diagnostic tests of
COVID-19: Current status and challenges. iScience, 23(8), 101406.
Li, J., Macdonald, J., & von Stetten, F. (2020). Review: A comprehensive summary of a de-
cade development of the recombinase polymerase amplification (vol 144, pg 31, 2019).
Analyst, 145(5), 1950–1960.
Londono, M. A., Harmon, C. L., & Polston, J. E. (2016). Evaluation of recombinase polymer-
ase amplification for detection of begomoviruses by plant diagnostic clinics. Virology
Journal, 13, 48.
Lutz, S., Weber, P., Focke, M., Faltin, B., Hoffmann, J., Muller, C., et al. (2010). Microfluidic
lab-on-a-foil for nucleic acid analysis based on isothermal recombinase polymerase am-
plification (RPA). Lab on a Chip, 10(7), 887–893.
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., et al.
(2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research,
28(12), E63.
Piepenburg, O., Williams, C. H., Stemple, D. L., & Armes, N. A. (2006). DNA detection using
recombination proteins. PLoS Biology, 4(7), 1115–1121.
Qian, J., Boswell, S. A., Chidley, C., Lu, Z. X., Pettit, M. E., Gaudio, B. L., et al. (2020). An
enhanced isothermal amplification assay for viral detection. Nature Communications,
11(1), 5920.
Qin, Z., Peng, R., Baravik, I. K., & Liu, X. Y. (2020). Perspective fighting COVID-19: Inte-
grated micro- and nanosystems for viral infection diagnostics. Matter, 3(3), 628–651.
Shen, F., Davydova, E. K., Du, W. B., Kreutz, J. E., Piepenburg, O., & Ismagilov, R. F. (2011).
Digital isothermal quantification of nucleic acids via simultaneous chemical initiation of
recombinase polymerase amplification reactions on SlipChip. Analytical Chemistry,
83(9), 3533–3540.
Shen, M. Z., Zhou, Y., Ye, J. W., Al-Maskri, A. A. A., Kang, Y., Zeng, S., et al. (2020). Recent
advances and perspectives of nucleic acid detection for coronavirus. Journal of Pharma-
ceutical Analysis, 10(2), 97–101.
Tang, M. S., Hock, K. G., Logsdon, N. M., Hayes, J. E., Gronowski, A. M., Anderson, N. W.,
et al. (2020). Clinical performance of two SARS-CoV-2 serologic assays. Clinical Chem-
istry, 66(8), 1055–1062.
Tu, F., Yang, X. T., Xu, S. K., Chen, D. J., Zhou, L., Ge, X. N., et al. (2020). Development of a
fluorescent probe-based real-time reverse transcription recombinase-aided amplification
assay for the rapid detection of classical swine fever virus. Transboundary and Emerging
Diseases. https://doi.org/10.1111/tbed.13849.
Udugama, B., Kadhiresan, P., Kozlowski, H. N., Malekjahani, A., Osborne, M., Li, V. Y. C.,
et al. (2020). Diagnosing COVID-19: The disease and tools for detection. ACS Nano,
14(4), 3822–3835.
Vincent, M., Xu, Y., & Kong, H. M. (2004). Helicase-dependent isothermal DNA amplifica-
tion. EMBO Reports, 5(8), 795–800.
Walker, G. T., Fraiser, M. S., Schram, J. L., Little, M. C., Nadeau, J. G., & Malinowski, D. P.
(1992). Strand displacement amplification—An isothermal, in vitro DNA amplification
technique. Nucleic Acids Research, 20(7), 1691–1696.
Wang, J., Cai, K., He, X., Shen, X., Wang, J., Liu, J., et al. (2020). Multiple-centre clinical
evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNA. Clinical Microbiology
and Infection, 26(8), 1076–1081.
Wang, C., Horby, P. W., Hayden, F. G., & Gao, G. F. (2020). A novel coronavirus outbreak of
global health concern (vol 395, pg 470, 2020). Lancet, 395(10223), 496.
Wang, L., Qian, C., Wu, H., Qian, W. J., Wang, R., & Wu, J. (2018). Technical aspects of
nicking enzyme assisted amplification. Analyst, 143(6), 1444–1453.
WHO. (2020). Statement on the first meeting of the international health regulations
(2005) Emergency committee regarding the outbreak of novel coronavirus (2019-nCoV).
Online Post.
Wong, Y. P., Othman, S., Lau, Y. L., Radu, S., & Chee, H. Y. (2018). Loop-mediated isother-
mal amplification (LAMP): A versatile technique for detection of micro-organisms. Jour-
nal of Applied Microbiology, 124(3), 626–643.
Wu, T., Ge, Y. Y., Zhao, K. C., Zhu, X. J., Chen, Y., Wu, B., et al. (2020). A reverse-
transcription recombinase-aided amplification assay for the rapid detection of N gene
of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2). Virology, 549, 1–4.
Xia, S., & Chen, X. (2020a). Ultrasensitive and whole-course encapsulated field detection of
2019-nCoV gene applying exponential amplification from RNA combined with chemical
probes. ChemRixv. https://doi.org/10.26434/chemrxiv.12012789.
Xia, S., & Chen, X. (2020b). Single-copy sensitive, field-deployable, and simultaneous dual-
gene detection of SARS-CoV-2 RNA via modified RT-RPA. Cell Discovery, 6(1), 37.
Xiong, D., Dai, W. J., Gong, J. J., Li, G. D., Liu, N. S., Wu, W., et al. (2020). Rapid detection of
SARS-CoV-2 with CRISPR-Cas12a. PLoS Biology, 18(12), e3000978.
Xue, G. H., Li, S. L., Zhang, W. W., Du, B., Cui, J. H., Yan, C., et al. (2020). Reverse-
transcription recombinase-aided amplification assay for rapid detection of the 2019 novel
coronavirus (SARS-CoV-2). Analytical Chemistry, 92(14), 9699–9705.
Zhao, Y. X., Chen, F., Li, Q., Wang, L. H., & Fan, C. H. (2015). Isothermal amplification of
nucleic acids. Chemical Reviews, 115(22), 12491–12545.
Zhao, S., Lin, Q. Y., Ran, J. J., Musa, S. S., Yang, G. P., Wang, W. M., et al. (2020). Prelim-
inary estimation of the basic reproduction number of novel coronavirus (2019-nCoV) in
China, from 2019 to 2020: A data-driven analysis in the early phase of the outbreak.
International Journal of Infectious Diseases, 92, 214–217.
Zheng, Y. Z., Chen, J. T., Li, J., Wu, X. J., Wen, J. Z., Liu, X. Z., et al. (2021). Reverse tran-
scription recombinase-aided amplification assay with lateral flow dipstick assay for rapid
detection of 2019 novel coronavirus. Frontiers in Cellular and Infection Microbiology, 11,
613304.
CHAPTER
The seasonal behaviour

of COVID-19 and its
galectin-like culprit
of the viral spike
2
esa, Nicolas Hernandezb, Fizza Mughalb,
Kelsey Caetano-Anoll
Tre Tomaszewskib, and Gustavo Caetano-Anollesb,*
a
b
Evolutionary Bioinformatics Laboratory, Department of Crop Sciences, University of Illinois,
Urbana, IL, United States
1 Introduction
Many diseases have a seasonal cycle occurring once or multiple times a year, or once
every several years. This regular temporal behaviour is observed because the emer-
gence of infectious diseases depends on a multiplicity of factors, including the
seasons, weather and geography, the number of susceptible individuals in a popula-
tion, the severity of the pathogen, host physiology and phenology, and the genomic
makeup of the virus, which can convert a non-infectious pathogen to one that is
infectious for a specific or general population (Dowell, 2001; Martinez, 2018).
The transmission of viral infections associated with seasonal variations has been
referred to as ‘seasonal forcing’ (Rohani, Earn, & Grenfell, 1999) and remains an
active field of exploration. Here we review evidence supporting the seasonal behav-
iour of infectious diseases. We focus on viral diseases and the ravaging coronavirus
disease 2019 (COVID-19).
COVID-19, and the fatal spread of its novel culprit, the severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2) pathogen, has emerged as the largest pan-
demic of the 21st century thus far (Wang, Horby, Hayden, & Gao, 2020). The first
case was reported in the Chinese city of Wuhan in December 2019 (Wu, Zhao, et al.,
2020). Since then the virus has spread over the world with more than 217 million
reported cases and 4.5 million deaths worldwide despite administration of over
5 billion vaccine doses as of September 1, 2021. Coronaviruses are a highly diverse
and globally distributed group of enveloped viruses with single-stranded RNA
genomes. They can infect humans and other mammals and avian species causing
27
28 CHAPTER 2 Seasonal behaviour of COVID-19 and its galectin-like culprit
respiratory, gastrointestinal, hepatic, and neurological diseases. They are part of the
Coronaviridae family, subfamily Orthocoronaviridae, which consists of four coro-
navirus genera (α, β, γ, and δ) (Coronaviridae Study Group, 2020). To date, seven
human coronaviruses (HCoVs) have been identified as highly circulating viruses:
the α-coronaviruses HCoVs-NL63 and HCoVs-229E and the β-coronaviruses
HCoVs-OC43, HCoVs-HKU1, which cause seasonal and usually mild respiratory tract
infections, and the β-coronaviruses MERS-CoV, SARS-CoV-1 and SARS-CoV-2,
which cause severe and life-threatening respiratory disease (Ashour, Elkhatib,
Rahman, & Elshabrawy, 2020). SARS-CoV-2 infects humans and animals across dif-
ferent regions of the world. Many studies have been devoted to the causes of the
COVID-19 outbreak, its geographic distribution, factors that modify virus infectivity,
the effects of seasonal changes on viral transmissibility, and the genomic makeup of the
virus. Like many other respiratory diseases, COVID-19 shows an anticipated connec-
tion between climate and disease dynamics (Smit et al., 2020). It is therefore important
to study the seasonal behaviour of the SARS-CoV-2 virus and host responses that are
associated with infection since this knowledge can help mitigation efforts.
2 The seasonal behaviour of viruses

2.1 Seasonality of viral diseases
Hirsch (1883) was one of the first to lay out foundations for a geographical and
historical pathology, which he presented in handbook format almost a century and
a half ago while describing temporal and spatial patterns of spread of major viral
and bacterial diseases. Inspired by the work of Finke (1792-1795) and the traditions
of Hippocrates, Galen and Avicenna, he analysed patterns in onset and spread of
acute infectious diseases, including influenza, dengue, hantavirus sweating sickness,
smallpox, measles, and scarlet and yellow fever. Recurrent patterns were carefully
recorded and often elaborated. For example: ‘The recurrence of the epidemic of mea-
sles at one particular place …depends solely on two factors, the time of importation
of the morbid poison, and the number of persons susceptible of it’ (Hirsch, 1883). It
took however an additional half a century to analyse periodicities with statistical and
modelling methods (Brownlee, 1918; Soper, 1929), and even longer to start dissect-
ing possible culprits. For example, the idea that recurrent patterns do not necessarily
arise from chains of host-to-host pathogen transmission but rather from changes in
susceptibility to pathogens present year-round in host populations was only recently
elaborated (Dowell, 2001). Despite advances, we are still far from fully understand-
ing why and how diseases wax and wane with the seasons.
There appears to be an epidemic calendar for many viral infectious diseases (see
Glossary). This calendar results in infection peaks occurring at different times during
one or multiple years in patterns that are remarkably consistent. In the Northern
Hemisphere, for example, influenza often occurs during winter (the ‘flu season’),
chickenpox during spring, and poliomyelitis during the summer. Fig. 1 shows early
and more recent examples of periodic incidence recorded for measles and influenza,
2 The seasonal behaviour of viruses 29
FIG. 1
The seasonal behaviour of measles and influenza. (A) The plot shows number of cases of
measles in Glasgow from 1900 to 1927. A noisy succession of biennial and annual cycles can
be observed spanning three periods. (B) Composite influenza virus activity in Chengdu, a
populous subtropical city in Southwestern China, from 2006 to 2015. Monthly positive rates
(in relative scale) were dissected into influenza A subtypes and influenza B lineages
(not shown). The start of H1N1 types of the 2019 pandemic and noisy semiannual and annual
cycles are indicated.
Panel (A) data from Soper, H.E. (1929). The interpretation of periodicity in disease prevalence. Journal
of the Royal Statistical Society, 92(1), 34–73. Panel (B) data from Zhou, L., Yang, H., Kuang, Y., Li, T.,
Xu, J., Li, S., et al. (2019). Temporal patterns of influenza A subtypes and B lineages across age in a subtropical
city, during pre-pandemic, pandemic, and postpandemic seasons. BMC Infectious Diseases, 19, 89.
two classical acute respiratory diseases caused by RNA viruses with significantly
different initial R reproduction metrics (12–18 and 1–2, respectively). While season-
ality appears not significantly constrained by infection spread potential (number of
infections caused by an infected person), the recurrence and stochastic behaviours
showcased in Fig. 1 are suggestive of the many research challenges that face the
study of seasonal behaviour.
A number of seasonal cycles of viral and bacterial diseases have been recently
documented in concert with their likely drivers (Martinez, 2018). Their ubiquity sug-
gests seasonality may be a unifying feature of epidemics in general. In some cases
there are clear cycles that impose temporal restrictions to infection despite vaccina-
tions or other mitigation strategies. For example, measles has been long associated to
school attendance, which fosters aggregation of school children and virus transmis-
sion (Fine & Clarkson, 1982; Soper, 1929). However, in some countries, measles
has been also associated to agricultural cycles (Duncan, Duncan, & Scott, 1997)
and the likely culprits of measles seasonality appear much more complex than
anticipated (Conlan & Grenfell, 2007). In fact, human physiology may be also an
important player.
Seasonal variations play a vital role in determining the time at which an infection
might occur, its transmission, and its potential to become an epidemic (Rohani et al.,
1999). Important elements affecting seasonal cyclicity include biotic and abiotic
mechanisms. Seasonal cycles are sometimes associated with pathogen life cycles
that involve viral spread via insect vectors or maintenance in animal or environ-
mental reservoirs. To illustrate, MERS-CoV is recurrently introduced into the
Middle Eastern population during the camel calving season (Dudas, Carvalho,
Rambaut, & Bedford, 2018). Seasonal peaks of the Marburg virus disease coincide
with the birthing season of bats, which occurs twice a year (Amman et al., 2012).
Similarly, cases of rabies coincide with seasonal infection cycles in bats (George
et al., 2011). In zoonotic diseases such as these, seasonality may result from contact
with wildlife or livestock. In the case of Ebola, for example, the pathogen presence in
wildlife peaks in the dry season showing also an environmental effect (Groseth,
Feldmann, & Strong, 2007). Complex environmental and life cycle interactions also
occur in African sleeping sickness. The distribution of the tsetse fly vector, which
expands during the rainy season, affects the seasonal behaviour of the disease
(Knight, 1971). Seasonal changes in the incidence of vector-borne diseases such
as yellow fever, Zika and Lyme disease are also expected to be driven by seasonal
fluctuations in the population of the tick and mosquito (Aedes aegyptii) vectors (e.g.
Ferguson et al., 2016; Soper, 1967). This abiotic modulation of vector population
dynamics adds complexity to biotic mechanisms of seasonality. Abiotic mechanisms
are also central for some seasonal cycles. Factors include geographic location and
environmental conditions. For example, latitude influences the time of emergence
and the magnitude of disease outbreaks, such as in poliomyelitis (Paccaud, 1979)
and influenza (Cox & Fukuda, 1998). At worldwide level, early suggestions that in-
fluenza outbreaks move across the Earth every year along a sinuous curve parallel
with the ‘midsummer’ curve of vertical solar radiation (Hope-Simpson, 1981) have
been recently supported by an exhaustive modelling study (Deyle, Maher,
Hernandez, Basu, & Sugihara, 2016). Primarily, the seasons arise from Earth’s tilted
axis relative to the plane of its orbit, which changes the amount of sunlight reaching
its surface at various latitudes over the course of a year. Worldwide analysis and
modelling of the effects of meteorological factors of humidity and temperature sug-
gest periodicity of influenza follows seasonal periodicities of the planet but also
show a U-shaped nonlinear effect of absolute humidity on influenza, which is me-
diated by temperature (Deyle et al., 2016). This global effect produces a trade-off
of wetter air and low temperature that likely promotes viral spread by protecting
the proteins and lipids of the viral envelope. This trade-off appears optimal at
24 °C. Results align with previous experiments that used guinea pig models of
transmission to demonstrate the coordinated effects of temperature and humidity
on the incidence of influenza disease (Lowen, Mubareka, Steel, & Palese, 2007).
A number of environmental factors imposed by climate conditions are also expected
to play critical roles in epidemics as they influence pathogen survival during transi-
tion periods spanning hosts. These factors directly impact the survival of the virus
pathogen. These effects are particularly significant for respiratory viral diseases
(Moriyama, Hugentobler, & Iwasaki, 2020). For example, short exposure of viruses
to temperature or UV light exposure in droplets or other forms of fomite airborne
transmission can have significant effects on viral load and emergence of epidemics
(e.g. for influenza; Weber & Stilianakis, 2008). Alternatively, the environment can
also affect host susceptibility to infection via physiology or behaviour. Seasonal
variations are expected to be impacted by phenological effects of life history, includ-
ing cycles of migration or hibernation, and endogenous rhythm responsible for
seasonal changes in immunity, reproduction and metabolism, all of which are im-
pacted by the environment (Dowell, 2001; Martinez, 2018). Environmental factors
also affect antiviral defenses including intrinsic barriers such as mucus production
and epithelial integrity, inducible innate immune defense mechanisms, and adaptive
immunity (Moriyama et al., 2020).
2.2 Drivers of seasonality in trade-off performance spaces

When exploring epidemic calendars, ‘seasonal drivers’ (see Glossary) have been cat-
egorized into those that involve the environment, host behaviour, host phenology,
and exogenous biotic factors (Martinez, 2018). A more fine-tuned categorization
of drivers was used in a survey of infectious diseases that included: (a) vector sea-
sonality; (b) seasonality in livestock, domestic animals and wildlife; (c) seasonal
climate (e.g. temperature, humidity); (d) seasonal non-climatic abiotic environment
(e.g. water salinity); (e) seasonal co-infection; (f ) seasonal exposure-behaviour-
contact; (g) seasonal biotic environment (e.g., algal density in waterbodies); and
(h) seasonal flareups-symptoms-remission-latency (see tables 1–4 in Martinez,
2018). Other categorizations stressed within-host and anthropogenic factors
(Kronfeld-Schor et al., 2021).
Here we propose that many of these multiple driving forces are in ‘trade-off’
relationships and can be better described within a framework of a ‘triangle of viral
persistence’ modulated by environment, physiology and behaviour (Fig. 2), with
environment impinging on both the life cycle of the virus (including ‘virion’ and
‘virocell’; defined in Glossary) and efficient viral transmission (e.g. enteric, respira-
tory), and physiology and behaviour embodying functional beneficial characteristics
of the hosts, vectors, and reservoirs involved. A ‘trade-off’ exists when one trait
cannot increase without a decrease in another (Garland, 2014). These trade-offs
are usually caused by limitations in matter-energy and information unfolding in
time and space. The triangle is based on a ‘persistence’ framework describing the
impact of the environment on biological systems (Yafremava et al., 2013). Its main
premise is that the environment constrains evolution of physiologies over the
system’s initial and boundary conditions. We here extend this framework, which
is based on trade-offs between ‘economy’, ‘flexibility’ and ‘robustness’ in perfor-
mance spaces (defined in Glossary), to the calendar of viral life cycles. Similar
triangles have been proposed for the persistence of networks that model biological
systems, the persistence of molecular communication and molecular systems, and
the persistence of viruses (Table 1). In particular, the triangle of viral persistence
FIG. 2
A triangle diagram of viral persistence explains main drivers of seasonality as a landscape of
trade-offs between factors related to environment, physiology and behaviour. The sphere
in the middle represents viral quasispecies clouds in Pareto fronts within a three-dimensional
fitness landscape. Viral interaction with environment, physiology and behaviour result in
approaches that achieve solution goals to increase persistence of viral life cycles.
Table 1 Triangles describing persistent systems.

Persistent
system Trade-off strategiesa Reference
General Economy Flexibility Robustness Yafremava et al.,

2013
Network Heterogeneity Modularity Randomness Caetano-Anolles
et al., 2021
Communication Persuasion Attraction Relevance Caetano-Anolles,
(Quantity) (Quality) (Relation) 2021
Molecular Catalyst Machine Gatekeeper Caetano-Anolles &
Caetano-Anolles,
2015
Virus life cycle Dependency Propagation Dormancy Nasir, Kim, &
Caetano-Anolles,
2017
Epidemic Behaviour Physiology Environment Present proposal
calendar
a
Definitions of Economy, Flexibility and Robustness strategies of the general framework can be found in
the Glossary.
(Nasir et al., 2017) explains how the three viral strategies of dependency (via
symbiotic-like associations of dissimilar entities tending towards mutualism, com-
mensalism, amensalism and parasitism), propagation (through lysis, budding and
transport), and dormancy (covert existence through latency via episomes or endo-
genized genetic material) take advantage of the engineering strategies of economy,
flexibility and robustness, respectively. Symbiotic-like co-dependencies impose altru-
istic, cooperative or antagonistic relationships that involve the budgeting of resources
(economy). Efficient propagation through lytic interactions requires establishing life
cycles and evolutionary arm races that foster co-evolutionary flexibility. Dormancy
inside cells shields against environmental variations and is a form of robustness.
The sphere in Fig. 2 represents a cloud of points in the trade-off space (morpho-
space) of a ‘viral quasispecies’, a dynamical virus collective defining a multiplicity
of virions and virocells (see Glossary). These points locate in Pareto fronts, which are
boundaries in multidimensional performance spaces that provide optimal fitness
solutions. Performance spaces are here defined as worlds of traits, which in our case
associate with strategies of economy, flexibility and robustness. Traits are the results
of processes such as number of cases in an epidemic, a geographical distribution of
vectors, or a direct measurement of seasonal behaviour (e.g. amplitudes of physio-
logical rhythms). These processes are sometimes drivers (e.g. schooling in measles
epidemics). The geometries of fitness solutions, which have been mathematically
elaborated (Sheftel, Shoval, Mayo, & Alon, 2013), correspond to planes in three-
dimensional performance spaces as described in Table 1. However, geometries
can be simpler, such as line segments arising from trade-offs between only two
drivers of strategy, or more complex, such as polygons describing trade-offs between
a multiplicity of drivers. Mathematical solutions to the analysis of performance
spaces is well developed and can provide new tools for the exploration of seasonality.
To explain drivers of seasonality, the triangle of viral persistence links environ-
ment to dormancy and robustness, physiology to propagation and flexibility, and
behaviour to dependency and economy (Table 1). These epidemic calendar associ-
ations become clear when seasonal drivers are assigned to strategies:
(i) Environment: Robustness embodies mechanisms that use information to

maintain structure and function in the face of environment-induced damage and
change. A clear example is the survival of respiratory viruses exposed to
temperature, absolute humidity or UV radiation. During a pandemic, the
evolving viral quasispecies will develop protein ‘variants’ with sets of
co-occurring amino acid changes that will strive to survive the environmental
challenges imposed by weather or geographic location. One proposed
mechanism is protection of integrity of the viral envelope (Minhaz Ud-Dean,
2010), which could be accomplished by favouring mutations in protein regions
of intrinsic disorder (Tomaszewski et al., 2020). Following a selective sweep,
mutations take over the quasispecies population in search for new cycles of
better variant proteins. While these processes of diversification occur during
replication, the actual driver results from a ‘passive’ interaction between the
environmental factors (e.g. temperature and absolute humidity) and the viral
envelope (e.g. influenza proteins). This passive interaction is dormant, in that
the virus is in a state where its ability to change is inactive or inoperative (akin
to a seed entering a dormant state to accomplish efficient plant propagation).
This example serves the purpose of illustration. However, the environment
affects other forms of viral transmission, such as the spread of enteroviruses
through sewage water or the spread of a number of RNA viruses through
vectors. Here, environmental effects are indirect. Diseases transmitted by
mosquitoes and tick require that vectors avoid being dormant in

‘overwintering’ states (e.g. for Culex mosquitoes and West Nile encephalitis
disease; Nasci et al., 2001). In tropical and subtropical regions, vector
number and generation time depend on warm weather and rainy seasons,
but also on the more stochastic effects of snow melts and floods (see examples
in Fisman, 2012). Viral zoonoses are also dependent on environmental
factors such as rainfall (e.g. hantaviruses and rodents in the American
Southwest; Jonsson, Moraes Figuereido, & Vapalahti, 2010). In these cases, the
passive element is the vector or reservoir but the effects are ultimately
on the virocells and the opportunities to fulfill life cycles through
different hosts.
(ii) Physiology: Flexibility reflects structural and functional mechanisms requiring
processing of information needed to respond and adapt to internal and external
challenges. Indeed, it is within the physiology of the host where the viral life
cycle fully achieves the goal of viral propagation. However, physiological
drivers of seasonal behaviour can be multiple and involve not only the host but
vectors and reservoirs. Early focus on these drivers (Dowell, 2001) and later
elaborations (Kronfeld-Schor et al., 2021; Martinez, 2018) highlight the effects
of host susceptibility to pathogen infection. Seasonal changes of immunity and
inflammation, among a multitude of ‘omic’ analytes, are now being studied at
multiomic profiling levels and with unprecedented depth (Sailani et al., 2020;
Wyse, O’Malley, Coogan, McConkey, & Smith, 2021). New data confirm
previous results, which suggested the possible role of cellular time-keeping
processes, including circadian clocks, circannual rhythms, metabolic cycles,
photoperiod effects, and other chronobiological processes. For example, there
is evidence of widespread seasonal transcriptome regulation in white human
blood cells and adipose tissue with endogenous patterns of immune function
that reverse in Northern and Southern Hemispheres (Dopico et al., 2015).
Similarly, the physiologies of a central circadian clock that supports daily
oscillations of cellular processes and behaviours synchronizes with clocks in
peripheral tissues that regulate immunity and other important cellular responses
(Borrmann, McKeating, & Zhuang, 2021). Circadian molecular pathways
shape viral infection, and vice versa, infections perturb circadian rhythms. This
tight integration of cell physiology and viral life cycles impacts the
environment and behaviour strategies. For example, integration will fine tune
the viral replication, assembly, maturation and release phases of the cellular
infection process that ultimately produces the infective virion particles. This
outcome then impinges on viral protein interaction with the environment and
the behaviour of host, vectors and reservoirs. It is here where fine tuning at
physiology level gets tested at physiological, ecological and evolutionary
time scales.
(iii) Behaviour: Economy reflects the budget of matter–energy costs of a system. In
human endeavours, economy plays a central role in decision-making. For
example, the opening-closing of schools is intimately linked to economic
drivers, as has been made evident in the current socioeconomical and political
landscape of COVID-19. The fact that school cycles are linked to the seasonal
incidence of measles (Fine & Clarkson, 1982; Soper, 1929) comes as no
surprise. The same goes for other respiratory illnesses (e.g. varicella,
influenza). Many cultural, socioeconomic, and lifestyle factors affect seasonal
patterns of infection. Some of these factors change the frequency of interactions
between/within hosts, vectors and reservoirs and finally the host-virus
interface. Because human activity has been a dominant influence on climate
and the environment during the past centuries, anthropogenic influences are
expected to impact epidemic calendars. These include changing climate, land
and freshwater use, food availability and consumption, demographics, travel,
settlement and urbanization, technology developments, war and famine,
antimicrobial drug use, and even breakdown of public health measures (e.g.
Jones et al., 2008; Kronfeld-Schor et al., 2021). They also include effects
on geography, such as river fragmentations and dewatering (Farah-Perez,
Umaña-Villalobos, Picado-Barboza, & Anderson, 2020). All these effects can
be seen as dependency relationships that change behaviour at the level of the
organism and in doing so can impact epidemic cycles.
While some seasonal drivers may be significant contributors to the epidemic

calendar, there may be multiple trade-off relationships that may be relevant. These
can be dissected with Pareto fronts in multidimensional performance spaces. For
example, cold weather leads to indoor crowding and higher levels of person-to-
person contact (Moriyama et al., 2020). This pushes the persistence of the seasonal
patterns of respiratory virus transmission towards the economy-driven ‘behav-
iour’ vertex of the triangle. However, indoor heating systems favour low relative
humidity (Moriyama et al., 2020), which pushes the seasonal response towards
the robustness-driven ‘environment’ vertex. In addition, vitamin D serum levels,
which are influenced by sunlight exposure and decrease during winter (Kasahara,
Singh, & Noymer, 2013; Klingberg, Olerod, Konar, Petzold, & Hammarsten,
2015), help the immune system fight the viral infections (Cannell et al., 2006).
This pushes the seasonal response towards the flexibility-driven ‘physiology’
vertex. In all cases, a number of physiological mechanisms are expected to be
relevant, some defining human ‘crowding’ responses, others defining the effects
of absolute humidity in viral makeup, and yet others impacting immunological
rhythms.
We end by noting that despite the increasing acceptance of seasonal patterns of
disease, only a few diseases have been systematically characterized. Mechanisms of
seasonal forcing have only been investigated for diseases of significant public inter-
est, including measles and influenza (e.g. Mantilla-Beniers, Bjørnstad, Grenfell, &
Rohani, 2010; Shaman, Pitzer, Viboud, Grenfell, & Lipsitch, 2010). There is still
much to learn about the causal factors of seasonal periodicities. This necessitates
both the application and development of statistical and data mining methodologies
that can dissect causative from aleatory effects.
2.3 Finding significant correlations

The effects of history and geography on viral diseases requires identification of
culprits. Generally, this starts by first identifying variables and then correlations
between variables that are statistically significant. Prior to the introduction of the
mathematical concepts of ‘regression’ and ‘correlation’ by Galton and Pearson at
the end of the 1800s, the only way to establish a relationship between variables
was to infer a causative connection (Rodgers & Nicewander, 1988). This occurred
without measurements of associations between variables that would test cause-effect
relationships. Today, Pearson’s product-moment correlation coefficient r and the
regression equation are the most widely used statistical measures of relationship
for studying observations. Alternative correlation indices such as Spearman’s rho,
the point-biserial correlation (rpb), and the phi coefficient are simply computations
of r for special types of data. Indices measure the strength and direction of an asso-
ciation between two variables (bivariate association) with no assumption of causal-
ity. They all assume dimensionless values ranging from –1 to +1, with values of 1
describing a perfect positive linear correlation, values of –1 describing a perfect neg-
ative correlation, and values of 0 describing the absence of a correlation. For
Pearson’s r, variables should be measured on a continuous scale (e.g. interval or
ratio), variables should be both paired and independent from other observations,
the association should be linear, variables should be approximately normally distrib-
uted, variances and co-variances should be finite, variances along the line of best fit
should remain homogeneous (fulfilling homoscedasticity), and there should be no
outliers in the data. Some of these requirements can be lifted, such as normality either
in the marginal distribution or in the bivariate surface when the number of data points
N exceeds 20. Generally, r values above [0.1], [0.3], and [0.5] indicate small (weak),
medium (moderate), and large (strong) associations, respectively. However, cut-offs
are arbitrary and any association above [0.1] with significant P-values should be
interpreted within the context of the scientific questions posed.
Of the 13 different ways to conceptualize correlation (Rodgers & Nicewander,
1988), we highlight correlation as ‘bivariate ellipses of isoconcentration’ because
they have become new tools of statistical inquiry (Friendly, Monette, & Fox,
2013). When Galton made one of the first uses of a scatter plot in his famous descrip-
tion of the relationship between the height of children and the average height of their
parents (Galton, 1886) he realized that an ellipse was associated with regression.
Since then, ‘data’, ‘concentration’ or ‘density’ ellipses that capture for example
95% of observations in a scatterplot have been used to effectively describe bivariate
marginal relationships in multivariate data. The geometrical approach detects un-
usual patterns such as curvilinear relationships or extreme outliers, which disrupt
correlation measurements. Modern analysis methods now use Kernel density estima-
tions of smoothed bivariate surfaces to explore skewness and multimodality in the
data. The goal is to make inferences about the underlying probability density func-
tion everywhere in the scatter plot by smoothing out contributions from each data
point to spaces surrounding them. Aggregation of the smoothed contributions
describe the structure of the data and its density function. For example, the scatter
plots of Fig. 3 show the relationship between the number of COVID-19 cases and
temperature, latitude or altitude of countries with reported cases. It is part of a larger
ongoing study (Hernandez and Caetano-Anolles, ms. in preparation) jumpstarted by
an initial exploration during the first wave of the pandemic (Burra et al., 2021). The
strong association of COVID-19 cases with temperature and latitude and its absence
with elevation suggests the geographical coordinate is associated with the onset
of the disease. Remarkably, the bimodal density patterns reveal countries located
at latitudes spanning 30–60°N or S and with average temperatures of 10–20 °C have
been most impacted. Bimodality was also present in Kernel density plots describing
the strong negative correlations between latitude and temperature (r ¼ –0.749;
rho ¼ –0.709), suggesting bimodality is at least partially driven by planetary environ-
mental factors. As we will describe below, these observations are relevant.
We note that correlations must first be confirmed as real, then every possible
causative relationship must be systematically explored. Five criteria must be fulfilled
to validate a causal relationship in scientific inquiry (Chambliss & Schutt, 2012):
(i) Empirical association: Typically this involves finding a correlation between
dependent and independent variables to determine if they vary together (covaria-
tion); without an empirical association of the variables there cannot be a causal
effect; (ii) Temporal priority: This criterion requires that there should be variation
in the independent variable before variation in the dependent variable, i.e. cause must
come before its effect; (iii) Non-spuriousness: Here the goal is to eliminate falsehood
in explanation of empirical associations by identifying other variables that could
explain empirical associations and subjecting them to a process of falsification;
(iv) Mechanism: Understanding a mechanism that connects independent and
dependent variables adds further support to the cause-and effect phenomenon; and
finally (v) Context: Establishing the external environment in which the cause-
and-effect occurs, for example, with networks of cause-effect relationships, the
causal-effect relationships are strengthened.
A number of tools help explore causal relationships, such as using hypothesis
testing methods that compare null and auxiliary hypotheses to a primary hypothesis,
or using simple controlled experiments (e.g. split-run testing in randomized exper-
iments) that compare ad minimum two versions of a single variable. Here, Fisher’s
statistical principles of experimental design—comparison, replication, randomiza-
tion, blocking, orthogonality, and factorials—are helpful. They seeded advances
in algebra and combinatorics and development of impactful methods such as the
Taguchi methods for robust engineering design that for example transformed the
automotive industry (Montgomery, 2013).
2.4 Distinguishing error from chaos in time series

The epidemiological periodicities that are evident in the examples of Fig. 1 suggest
the calendar of epidemics can be quite erratic. Measles for example peaks some-
where between November and December for the Northern Hemisphere and the flu
FIG. 3
Bivariate kernel density plots describing the relationship between the number of confirmed
COVID-19 cases (per million people) and temperature (A), the geographical coordinate of
latitude (B), or the average elevation (in metres) (C) of 191 countries as of May 23, 2021.
Kernel bandwidths were 5497.2, 2.1, 4.5 and 105.6 for cases, temperature, latitude and
elevation, respectively. Pearson product-moment correlation r values and Spearman’s rank
correlation rho values are given with their corresponding P-values, together with regression
lines. Correlations show strong associations in (A) and (B), and negligible association in (C).
Scatterplots of ranks from the Spearman’s rank correlation show how rank transformations
diminish homoscedasticity effects. Calculations used the University of Basel online statistical
server (Wessa, 2021). Note that countries located at latitudes spanning 30–60°N or S and
with average temperatures of 10–20 °C have been relatively most impacted. They include
Montenegro, Czechia, Slovenia, Luxembourg, Serbia, US, Israel, Netherlands, Belgium,
France, Croatia, Georgia, Hungary, Portugal, Cyprus, Lebanon, Lichtenstein, Argentina,
Spain, Uruguay, Armenia, North Macedonia, Slovakia, Jordan, Chile, Italy, Malta, United
Kingdom, Monaco, Moldova, Bosnia and Herzegovina, Turkey, Bulgaria, Palestine, and
Ukraine (in decreasing order of cases per million).
season peaks somewhere between November and March. Besides stochastic behav-
iour, there appears to be higher-level recurrent events imposed on the typical cycles
in measles and the flu that must be explained, such as semiannual or biennial behav-
iour. The existence of pandemic or major epidemic events complicate the recurrent
patterns, as showcased by the incidence of influenza A and B in a major metropolis
of Northwestern China following the 2009 H1N1 pandemic (Zhou et al., 2019;
Fig. 1B). Similar complications have been also highlighted for the city of Mexico
(Bjørnstad & Viboud, 2016).
Statistical predictive and modelling methodologies must be developed when
principles driving a dynamical system are poorly understood. Such is the case of
the seasonal behaviour of viruses. Time series analysis is a methodology readily used
in public health and biomedicine applications (Zeger, Irizarry, & Peng, 2006). It
addresses experimental situations where a sequence of observations is made over
time to monitor equally spaced temporal changes of a phenomenon, such as the
number of cases of viral disease in a population. The goal of the methodology is
to generate simple descriptions, explanations, predictions or control of the underly-
ing process. The plots of Fig. 1 for example are simple descriptions of a temporal
recurrence. Data displays and summary statistics are created to better understand re-
sponse variations over time. In some cases, the time series can be decomposed into
components to reveal autocorrelations that can help us better describe the process
(e.g. dissecting trends, seasonality, and residual effects). Sometimes a time series
can be decomposed into a numerous series of components, using the Fourier trans-
form or the discrete wavelet transform, for example. The time series is often
re-expressed as cosine waves of arbitrary amplitude and phase. Amplitudes can
be plotted against frequency to produce ‘periodograms’, and a ‘spectrum’ of the sto-
chastic process can be estimated as the expected squared amplitude. When the goal of
statistical analysis is explanation, the dependence of the process is modelled against
one or more predictor time series using regression analysis. These predictor series are
assumed non-random. Because neighbouring values of the process tend to be corre-
lated, we can make predictions from past process responses or from predictor covar-
iate time series with autoregressive models or distributed lag models. Time series
regression models conditioned on past observations can take the form of marginal
or conditional models, which often dissect a regression model for the mean and a
model for the autocorrelation function. In the presence of Gaussian processes, auto-
regressive moving-average models display autocorrelation functions that decay or
oscillate to zero with increasing lag. In some cases, the autoregressive process ex-
hibits error and the models used to describe it are stationary and do not exhibit
long-term trends and are therefore only appropriate in the absence of trends. Simi-
larly, in cases where past responses influence the present through non-linear func-
tions, we must apply nonlinear time series modelling approaches that for example
can take into consideration response interactions. Finally, one popular approach
to dissect the noisy time-series data that embody seasonal disease cyclicity, is the
use of nonparametric autoregression methods (Hardle, 1990), including nearest-
neighbours, splines, local polynomials and neural nets. These methods recursively
dissect error from chaotic behaviour that may govern cyclic disease patterns in
biology (Sugihara, Grenfell, & May, 1990). For processes underlying periodic
behaviour, a general form of spectral density may be assumed with increasing sample
size that can dissect the autocorrelation structure of the stationary process (Hardle,
L€utkenpohl, & Cheng, 1997). A recent analysis of global environmental drivers of
influenza showcases the power of using nonparametric autoregression in the form
of a smoothing spline to determine seasonal cycles (Deyle et al., 2016). The spline
works on time series variables with and without sinusoidal waveforms.
3 The seasonal behaviour of COVID-19

Human coronaviruses are part of a group colloquially known as ‘winter viruses’,
viruses that show peak incidences in the winter months. These viruses include
influenza virus (Tamerius et al., 2011), human respiratory syncytial virus (Midgley
et al., 2017), and rhinovirus pathogens (Morikawa et al., 2015). The incidence of en-
demic human coronaviruses increases during winter (Killerby et al., 2018; Li, Wang, &
Nair, 2020; Monto et al., 2020; Nickbakhsh et al., 2020). Consequently, coronavirus
seasonality as a group already suggests SARS-CoV-2 will likely exhibit a similarly
marked seasonal behaviour once it becomes endemic.
The 2003 outbreak of SARS-CoV-1 and the 2012 outbreak of MERS-CoV did not
advance enough to showcase seasonal behaviour. In contrast, the worldwide spread
of the COVID-19 pathogen was already rampant during the first wave of the pan-
demic, which peaked in April 2020 some few months after its emergence in Wuhan
(Fig. 4A). However, this same fact throws a monkey wrench onto detecting seasonal
periodicities, as has been evident with the mismatched periodicities of influenza (e.g.
Fig. 1B). As previously discussed, seasonal epidemics may arise because of the com-
bination of environmental effects, the high transmissibility of the virus, the initial
susceptibility of the human population, and the nature and degree of the immune
response to infection. Seasonal patterns embody stable oscillations that can be
dissected with epidemiological models. Under these circumstances, some degree
of immunity occurs at the initial stage of an epidemic when the transmission rate
is high and the immune response is weak (Grenfell & Bjørnstad, 2005; Hethcote,
Stech, & Van Den Driessche, 1981). In such a case, even robust and substantial
environmental drivers cannot stop transmission, as has been observed with previous
influenza outbreaks. Researchers assume the same patterns of a seasonal epidemic
are valid for COVID-19 and that the virus could produce seasonal oscillations if
it becomes endemic (Kissler, Tedijanto, Goldstein, Grad, & Lipsitch, 2020). How-
ever, the pandemic continues to be rampant worldwide and new amino acid variants
are arising that complicate vaccine mitigation strategies introduced massively at the
beginning of year 2021. We anticipate robust oscillating patterns will be difficult to
detect under these conditions.
Seasonality can be uncovered by focusing on correlations arising in a wide diver-
sity of geographical areas or locations, preferably at worldwide distribution level, or
FIG. 4
See figure legend on next page.
by studying time series describing seasonal recurrences on one or more particular

geographical area or location. We will refer to these two distribution approaches
‘spatial’ and ‘temporal’, respectively, though spacetime is involved in both,
discussing evidence supporting the seasonal behaviour of COVID-19.
3.1 Spatial distribution approaches

The amount of solar radiation (electromagnetic energy) received by any region of the
world varies with geographic coordinates (especially latitude), time of day, the sea-
sons, local weather and landscape. About half of incoming radiation in the form of
photons (89 out of 174 petawatts) is absorbed by clouds, oceans and landmasses and
converted into heat, but also electricity and chemicals that link to energy chains of
FIG. 4 The seasonal behaviour of COVID-19. (A) The plot shows the numbers of confirmed
cases (black) and weekly deaths (red) since the start of the recorded COVID-19 pandemic.
Three waves are clearly evident for worldwide weekly deaths recorded at the time of data
collection from CSSE at John Hopkins University, September 1, 2021. Data gathered in April
15, 2020 (Burra et al., 2021) (a) and May 23, 2021 (Hernandez and Caetano-Anolles, ms. in
preparation) (b) are highlighted in the timeline and its analysis summarized in panel (D).
(B) Contour plot of temperatures taken 2 metres above Earth’s surface for the entire world
during the first wave of the pandemic (November 2019 to March 2020). Data was
extracted from the NCEP/NCAR reanalysis (v. 1) project and rendered online (Climate
Change Institute, University of Maine; climatereanalyzer.org). White circles represent
countries with substantial outbreaks (>10 cumulative confirmed deaths per million people)
as of April 15, 2020. With exception of Peru, Ecuador and the Dominican Republic, all country
outbreaks occurred in yellow or green-shaded contours with temperatures ranging 5–11 °C.
(C) A timeline of countries with substantial outbreaks (>10 cumulative confirmed deaths per
million people) showing COVID-19 spread massively in a 30°N to 60°N corridor of latitudes
during the first wave of the pandemic and then spread through a 30°S to 50°S corridor of
latitudes during the onset of the winter season of the Southern Hemisphere. Red circles are
countries exhibiting >300 confirmed deaths per million people as of November 15, 2020.
(D) Effect of temperature (Temp.) and geographical coordinates of Latitude (Lat.) and
Longitude (Long.) on number of cases and deaths worldwide normalized to account for
population differences of the 211 and 191 countries analysed in 2020 and 2021, respectively.
Correlations were considered significant when P-values were less than 0.05 and association
strengths had Pearson’s correlation coefficients r were higher than 0.1. (E) Seasonal
oscillations detected in 5 countries of the Northern Hemisphere (NH), USA, India, Russia,
France and the United Kingdom, and 5 countries of the Southern Hemisphere (SH), Brazil,
Argentina, South Africa, Peru and Chile. Average seasonal signals and 95% confidence
intervals are given in red and black shades for the two hemispheres, respectively.
Seasonal signals were detected in the time series of cases and deaths using an adaptive
one-dimensional time series analysis, the Ensemble Empirical Mode Decomposition
(EEMD) method.
Panel (E) data from Liu, X., Huang, J., Li, C., Zhao, Y., Wang, D., Huang, Z., et al. (2021). The role of
seasonality in the spread of COVID-19 pandemic. Environmental Research, 195, 110874.
3 The seasonal behaviour of COVID-19 43
convection, circulation and biomass. The Earth’s 23.5° tilted axis and its elliptical
orbit around the sun make radiation strike the surface at different angles following
the ecliptic of the celestial sphere. This causes differences in solar energy that create
cyclic variations in temperature at daily and yearly levels. We note that temperature
also varies with differences in altitude and topographical surface. For example, con-
tinents are generally warmer than oceanic regions in the Northern Hemisphere, while
this reverses in the Southern Hemisphere tempered by the scarcity of land masses. If
temperature variation impacts the triangle of viral persistence, a viral pandemic of
COVID-19 proportions is expected to leave increasingly stronger worldwide sea-
sonal signatures as the disease progresses. In addition, since distance from the Equa-
tor measured as latitude is a strong predictor of temperature, any temperature effects
on seasonal behaviour detected by studying correlations of geographic coordinates
with epidemiological data should be strengthened. The same can be said with other
variables, such as elevation, which is correlated with UV radiation.
Indeed, initial studies during the first wave of the pandemic (Fig. 4A) suggested
temperature and humidity levels of geographical areas (countries, regions, cities)
were inversely related to epidemiological variables such as confirmed cases or
deaths, while latitude showed a positive relationship. In many instances however re-
sults were inconclusive. A GRADE tool analysis of 17 initial explorations (mostly
non-peer reviewed at that time) of data downloaded prior to March 1, 2020 (generally
much earlier) revealed that only 4 were low risk (Mecenas, Bastos, Vallinoto, &
Normando, 2020). Of these four, the only formally published study concluded that
weather factors alone could not explain variability of the viral reproductive number
in Chinese provinces or cities (Poirier et al., 2020). The meta-analysis suggested
warm and wet climates reduced COVID-19 spread but also highlighted the impor-
tance of controlling confounding variables. Other initial studies of epidemiological
variables were of significance. Demongeot, Flet-Berliac, and Seligmann (2020)
showed that higher temperatures decreased infection rates in both French adminis-
trative regions and in 21 countries spread throughout continents. An association anal-
ysis of temperatures of countries or regions with epidemiological variables collected
at the beginning of March 2020 and a time series predictive analysis with the Auto-
regressive Integrated Moving Average (ARIMA) model showed COVID-19 speed of
contagion decreased with increasing temperatures. In addition, a focused study of
how weather parameters of temperature, humidity and rainfall affected disease inci-
dence ending March 2020 in Jakarta, Indonesia, revealed only average temperature
exhibited statistically significant associations (Tosepu et al., 2020). The use of a log-
linear generalized additive model to study cases and deaths in 166 countries with
March 27, 2020 data showed that a temperature increase of only 1 °C reduced the
number of daily reported cases by 3.08%, while a 1% increase in relative humidity
reduced the number of daily reported cases by 0.85% (Wu, Jing, et al., 2020). The
analysis concluded high temperature and humidity significantly affected COVID-19
epidemiological variables. Similarly, data from 429 cities also showed a negative
correlation between viral transmission and temperature, reporting that a 1 °C temper-
ature increase reduced the reported cases by 0.86% (Wang, Jiang, et al., 2020).
Temperature, population age, and tourism were the most important factors affecting
COVID-19 risk measured with cases and deaths in 154 countries at the end of March
2020 (Yang & Lee, 2021). The study used a Pearson’s correlation matrix but also
modelled nonlinear associations of temperature and risk with random forest statisti-
cal methods. In contrast, Kassem (2020) reported the impact of temperature on cases
per million in 43 countries divided into three groups according to first time disease
introduction. There was only a slightly significant (P < 0.1) inverse relationship in
only one of the groups.
While temperature and humidity were the initial focus, an analysis of 50 cities
worldwide with and without community spread as of March 10, 2020 showed com-
munity transmission was restricted to a 30°N to 50°N latitude corridor with consis-
tent weather patterns of 5–11 °C average temperatures combined with low absolute
humidity (Sajadi et al., 2020). Poole (2020) also observed a similar corridor spanning
25°N to 55°N latitudes. Indeed, a world temperature map showed countries with sig-
nificant COVID-19 outbreaks during the first wave of the pandemic (exhibiting
>10 cumulative deaths per million people as of April 15, 2020) were located within
a 30°N to 60°N latitude corridor in regions with 5–11 °C average surface tempera-
tures (Fig. 4B). Moreover, a timeline of countries with significant outbreaks
(>10 cumulative deaths per million people) describing how COVID-19 was advanc-
ing from China to the rest of the world for the most part of year 2020 shows that the
disease began spreading through a latitude corridor in the Northern Hemisphere
followed by one in the Southern Hemisphere (Fig. 4C). Almost half of outbreak
countries were in the Northern corridor, 40% of which showed >300 cumulative
deaths per million people as of November 15, 2020. A transition from the Northern
corridor to Southern latitudes began to occur at the beginning of April with outbreaks
in Peru and Ecuador (when temperatures started to lower in the Andean mountain
range), then Brazil (beginning with the elevated Sao Paulo) but reached the Southern
corridor in May and fully in June (when winter formally started in the Southern
hemisphere). We also explored the worldwide role of temperature and geographical
coordinates of latitude and longitude on epidemiological parameters for 211 coun-
tries at the peak of the first wave, April 15, 2020 (Burra et al., 2021). Both temper-
ature and latitude were significantly correlated to COVID-19 cases and deaths
with weak to moderate association values (Fig. 4D). Repeating the analysis during
the third wave, a year later, showed these associations were becoming stronger
(Figs 3 and 4D). This corroborates the impact of the geographical temperature-
latitude correlate on COVID-19 seasonal behaviour, which is likely associated with
the planetary effect of solar radiation. Thus, latitude, temperature and humidity
appeared important factors during the first wave of the pandemic, consistent with
the behaviour of a seasonal respiratory virus.
Given the strong temperature-latitude association we detected, COVID-19 sea-
sonality is likely related to planetary-level environmental effects of solar radiation
on viral transmission, directly through germicidal effects or indirectly through ‘phys-
iology’ effects (vitamin D-related or through other immune regulatory activities).
The low-energy infrared (IR) wavelengths transmit heat and could be responsible
3 The seasonal behaviour of COVID-19 45
for germicidal effects of temperature. Laboratory studies have shown that high tem-
peratures and humidity levels shorten SARS-CoV-2 half-life in aerosols and other
media, with virus persistence dramatically decreasing with small temperature in-
creases (Chin et al., 2020; Matson et al., 2020; van Doremalen et al., 2020). The
high-energy ultraviolet (UV) wavelengths (especially the UV-C spectrum) could
have direct germicidal action on viral survival, as shown in laboratory experiments
(Heilingloh et al., 2020; Seyer & Sanlidag, 2020). The expectation that UV radiation
levels could be correlated with COVID-19 cases and deaths was recently fulfilled
(Karapiperis et al., 2021). A machine learning-based analysis of data from 12 coun-
tries distributed across latitudes with comparable economic and demographic indices
and epidemic surveillance statistics showed year-round UV radiation levels strongly
associated with incidence rates, more so than with other variables. Remarkably, time
series showed high UV levels depressed the number of cases in a hemisphere-related
manner. These types of studies link geographical to temporal effects of seasonality
and may lift some misconceptions about weather and seasonality (Carlson, Gomez,
Bansal, & Ryan, 2020) by providing new methods of hypothesis testing.
3.2 Temporal distribution approaches

While studies have shown that COVID-19 affects some geographical regions more
than others, a seasonal behaviour must also unfold with time in one location, with
cases waxing and waning with the seasons (e.g. measles and influenza in individual
cities; Fig. 1). This is particularly important because correlations often fail to portray
cause-and-effect relationships, especially in nonlinear dynamic systems where per-
sistent trends can often reverse with time or when drivers enslave specific responses
(Sugihara et al., 2012). Time series analysis provides the tools to dissect seasonal
cycles such as those of influenza (Deyle et al., 2016). Novel implementations of these
methodologies have been applied to modelling and forecasting of COVID-19 cases,
deaths and recoveries (e.g., Abotaleb & Makarovskikh, 2021; Barrı́a-Sandoval,
Ferreira, Benz-Parra, & López-Flores, 2021; Gecili, Ziady, & Szczesniak, 2021).
However, seasonal oscillation signatures derived from time series are expected to
be weak at the start of a pandemic but stronger as infections reach a seasonal endemic
equilibrium. While such transition has been recently modelled across a range of
immunity durations and demographic and social-mixing structures (Li, Metcalf,
Stenseth, & Bjørnstad, 2021), there is no clear understanding of important season-
ality factors (Smit et al., 2020). Liu et al. (2021) however recently extracted weak
seasonal signals embedded in confirmed COVID-19 cases and deaths (as of
December 31, 2020) in sets of five countries of the Northern and Southern
Hemispheres. Using the Ensemble Empirical Mode Decomposition (EEMD), a
method widely used in image processing and geophysical, financial and biomedical
applications (Colominas, Schlotthauer, & Torres, 2014), the spectral analysis-based
Hilbert-Huang transform decomposed (partitioned) multidimensional signal in the
time series into different intrinsic ‘mode’ functions along with a trend. Systematic
introduction of ‘white’ noise series to the original data followed by decomposition
in iterative steps allowed to obtain ensemble means of the mode functions for signal
extraction. Remarkably, the signal curves showed COVID-19 cases and deaths were
higher in colder climates and seasonality more pronounced at higher latitudes in an
hemisphere-related sinusoidal pattern (Fig. 4E). This provides further confirmation
of the seasonal behaviour of COVID-19.
4 Viral genomic make up and seasonality

RNA viruses are considered the most common aetiological agents of human disease.
They represent 25–44% of all human pathogens, rivalling noxious bacteria (Jones
et al., 2008). They trigger important pandemics such as those caused by the
interspecies-transmitted Chikungunya and Zika viruses, while also embodying
highly communicative zoonotic pathogens such as Ebola and Influenza A. RNA vi-
ruses exhibit exceptionally short generation times, high infection rates, and high
levels of mutation and recombination, all leading to high genetic variability, rapid
genome evolution, wide host range, enhanced virulence, evasion of host immunity,
and increased resistance to antivirals.
RNA viruses have genome sizes ranging 2–32 kb, with sizes inversely propor-
tional to mutation rates (Sanjuán & Domingo-Calap, 2016). RNA viruses make
up 4 out of the 7 groups of the ‘Baltimore classification’ (see Glossary), which or-
ganizes viral genomes according to pathways used for mRNA synthesis (Baltimore,
1971). These groups include double-stranded RNA (dsRNA), positive sense
single-stranded RNA (plus-ssRNA), and negative sense single-stranded RNA
(minus-ssRNA) viruses and one of the two groups of RNA transcribing viruses,
the single-stranded RNA viruses with DNA intermediate (ssRNA-RT). RNA viruses
can be enveloped or nonenveloped with icosahedral, icosahedral nucleocapsid,
helical nucleocapsid, or multilayered capsid virion morphologies. Genomes can
be unsegmented, segmented, bi-segmented or tri-segmented. Such structural and
functional diversity also translates into a wide diversity of life cycle strategies.
Coronaviruses belong to the order Nidovirales, a group or enveloped viruses with
plus-ssRNA genomes that are capped and polyadenylated (Coronaviridae Study
Group, 2020). Their genomes serve as mRNAs, which are directly translated into
a functional proteome in the cytoplasm upon viral entry. Genomes also serve as
templates for replication, folding into complex assemblies with modified cell
membranes to construct scaffolds for replication, transcription and translation.
The Nidovirales group expresses structural proteins coded in the 50 region of the ge-
nome separately from the rest through sub-genomic mRNA.
Coronaviruses harbour the largest known non-segmented RNA genomes reported to
date (26–32kb in length), a property that arises from evolutionary expansive trends
that are unfolding in the Nidovirales (Lauber et al., 2013). Large genomes result in large
proteome repertoires of 30 proteins of large size, many with published atomic struc-
tures. The genome and proteome of SARS-CoV-2 is a clear example (Fig. 5A). Note
however that the SARS-CoV-2 genome coding capacity has been established with
FIG. 5
The coronavirus proteome and protein intrinsic disorder (PID). (A). A diagram describing the
SARS-CoV-2 genome and the corresponding proteome illustrated with models of molecular
structure for its typical 29 non-structural, structural and accessory proteins. (B) Mapping
PID with the IUPred2 algorithmic tool along the ORF1 and ORF2 predicted amino acid
sequences, which encode overlapping polyproteins (pp1a and pp1ab) that cleave into
16 non-structural proteins (NSPs) of the SARS-CoV-2 reference (Wuhan) genome. Disorder
scores above 0.5 indicate significant PID levels. Only the hypervariable region (HVR) of the
large NSP3 papain-like protease scaffold shows significant PID. (C) Scatterplots showing
the relationship between mean disorder and average abundance of structural domains defined
at SCOP family level identified using HMMER in 6044 viral proteomes. Nidovirales, especially
the Coronaviridae family, showed proteomes with significantly low levels of PID.
ribosome-profiling techniques and that a complement of 23 unannotated viral ORFs

were identified that add to proteome complexity (Finkel et al., 2020). Coronaviruses
adapt to host environments by relying on the low fidelity of a replication complex,
which assembles around the NSP12 RNA dependent RNA polymerase with its extra
N-terminal β-hairpin domain in interaction with an hexadecameric complex of disor-
dered NSP7 and NSP8 primase cofactors (Gao et al., 2020; Kirchdoerfer & Ward,
2019). Coronaviruses also adapt to external environments by modulating flexibility
of regular protein structure, such as the case of the structural transmembrane spike
(S) protein, and by minimizing protein intrinsic disorder (PID) of the unstructured
regions of their proteins (see definition in Glossary), especially modulating PID of
the structural nucleocapsid (N), membrane (M) and envelope (E) proteins (Goh,
Dunker, Foster, & Uversky, 2020a, 2020b, 2021; Tomaszewski et al., 2020). The
flexibility of proteins is an intrinsic molecular property of regular structure present
in helices and strands or in irregular motifs such as loops. This flexibility is necessary
for the proper establishment of molecular functions. Protein flexibility of the spike
(S) protein has been shown to have been enhanced by the widely distributed D614G
mutation that unfolded early during the first wave of the pandemic. The coronavirus
spike is a trimer of highly glycosylated S-protein protomers, each harbouring an
N-terminal S1 subunit sequence with an N-terminal domain (NTD) and a receptor-
binding domain (RBD) and a C-terminal S2 subunit holding a ‘fusion’ region with
fusion peptide (FP) and internal fusion peptide (IFP) sequences, 2 heptad repeat
(HR) sequences, and a transmembrane (TM) domain (see Glossary). The subunits
are processed by host proteases upon viral entry. In silico modelling of the S-protein
suggests the D614G mutant variant breaks a D614-T859 side chain hydrogen bond
between the neighbouring S1 and S2 subunits of pairs of the three protomers of the
spike, thereby enhancing flexibility and modifying their interactions (Korber et al.,
2020). A more recent conformational dynamics study of the spike glycoprotein using
cryo-EM showed D614G is heavily involved in the interaction with residues K854,
K354 and Y837 of the fusion peptide (FP) region through side-chain atoms, contribut-
ing to linkage and/or allostery between the S1 and S2 subunits of neighbouring
protomers (Xu et al., 2021). Flexibility and its associated molecular functionalities
are also endowed by PID in regions lacking significant constraints on internal degrees
of freedom of the polypeptide chain typical of fixed three-dimensional (3D) structure
under native cellular conditions (Dunker, Brown, Lawson, Iakoucheva, & Obradovic,
2002). These regions are highly dynamic and exhibit conformations that resemble either
random-coils, molten globules or flexible linkers. Low PID is responsible for the
rigidity of the coronavirus shell and the tropism-delimited transmission (respiratory
or orofecal) mode of the virus (Goh et al., 2020b). PID has been proposed as a player
in a pangolin-mediated spread of an attenuated human SARS-CoV-2 precursor that pre-
ceded the COVID-19 pandemic (Goh et al., 2021). Remarkably, SARS-CoV-2 retains
the flexibility of the respiratory mode while enhancing the environmental resilience of
the virion for efficient dispersion (Goh et al., 2020b). Fig. 5B illustrates the very low
PID levels that we recently detected in the proteome of SARS-CoV-2 (Tomaszewski
et al., 2020) with an analysis of ORFs encoding non-structural proteins (NSPs).
4 Viral genomic make up and seasonality 49
Remarkably, these low PID levels are not only a rigidity property of coronaviruses
alone but of the entire Nidovirales group. A global analysis of 6044 viral proteomes
showed levels of mean intrinsic disorder were less than 0.2 for the proteomes of the
Nidovirales (Fig. 5C).
In Section 4, we focus on possible molecular culprits of seasonal behaviour. We
study the variants of the SARS-CoV-2 proteome encoded in thousands of genomes
sampled during the first wave of the pandemic. Analysis reveals that a number of
molecular regions associated with clades and the highly infectious ‘variants of con-
cern’ (VOCs; see Glossary) that arose in later waves are located in PID regions we
initially identified that are necessary to sustain the structural integrity of virion struc-
ture. We also show that the N-terminal domain of the S-protein, which decorates the
outer shell of the virion particle (crowning its ‘corona’ appearance), contains a
galectin-like structure. Tracking the prevalence of mutations in this structure follows
a seasonal pattern. We propose the galectin-like structure is a frequent target of
mutations because it helps the virus evade or modulate physiological responses of
the host to further its spread and survival. We end by suggesting that these regions
are good molecular candidates for sensors of environment and physiology.
4.1 Mutational change in rapidly expanding viral populations

Viruses in general and RNA viruses in particular are considered an ideal system to
study evolution because of their high error rates of replication, large populations, and
short multiplication times (Manrubia & Lázaro, 2006).
RNA viruses have mutation rates of about 103 to 106 misincorporations per
nucleotide in each replication round, orders of magnitude higher than the typical
106 to 108 observed for DNA viruses (Batschelet, Domingo, & Weissmann,
1976; Sanjuán & Domingo-Calap, 2016). This means that each newly synthesized
viral genome will carry an average of one to two mutations when aligned with
the parental sequence, matching known error rates of 1.1 nucleotide deletion/substi-
tution per genome per round of replication (Drake, Charlesworth, Charlesworth, &
Crow, 1998). We note that substitution rates are not only raw measurements of
genetic changes (point mutations, insertions, deletions, rearrangements) occurring
in a genome but also depend on the generation time and viral population sizes,
not to mention consideration of fitness. There are three main reasons for high mu-
tation levels: (1) copying errors during the viral replication process, (2) recombina-
tion in the viral genome, and (3) host-induced RNA editing systems. In RNA viruses,
high mutation rates largely arise from their RNA-dependent RNA polymerases lack-
ing proofreading activity, which allows them to adapt to environmental changes
(Domingo, 2002). In addition, single-strand RNA viruses such as coronaviruses
are more prone to mutations than double-strand genome viruses as single nucleic acid
strands are more susceptible to chemical damage and oxidative deamination
(Seronello et al., 2011). Higher mutation rates enable viral adaptation to be faster
over time (Berngruber, Froissart, Choisy, & Gandon, 2013). However, not all muta-
tions are adaptive and helpful; most of the mutations reported in RNA viruses are
deleterious and hinder their viability (Johnson & Barton, 2002). This puts RNA vi-
ruses close to an ‘error threshold’ of too many deleterious mutations for successful
persistence (Domingo, Sheldon, & Perales, 2012). Remarkably, coronavirus proof-
reading abilities are crucially enhanced by the 30 -to-50 exonuclease domain of the
NSP14 protein (Minskaia et al., 2006), which increases 12- to 15-fold template copy-
ing fidelity (Eckerle et al., 2010) and enables both genome expansion and mutation
robustness (Smith & Denison, 2013). Genetic recombination and genomic reassort-
ment also contribute to viral diversity and emergence of new phenotypes. In recom-
bination, two or more segments from two different parental genomic molecules
combine and produce a new mutant or recombinant phenotype that may be more
pathogenic and virulent than the parental molecules (Posada, Crandall, & Holmes,
2002). Recombination may accelerate viral evolution, but more research is needed
to evaluate the exact role it plays (Rhodes, Wargo, & Hu, 2003). Genomic reassort-
ment occurs in tripartite genomic RNA viruses like influenza in which new variants
arise after the simultaneous entry of two or more different viruses into a host cell
(Vijaykrishna, Mujerki, & Smith, 2015). Recombinants produced by genetic recom-
bination exhibit new properties that can significantly enhance viral diversity (Earn,
Dushoff, & Levin, 2002). In fact, the high recombination rates of RNA viruses are
directly associated with their virulence (Khatchikian, Orlich, & Rott, 1989), the host
range (Gibbs & Weiller, 1999), host immunity (Malim & Emerman, 2001), and
resistance to antivirals (Nora et al., 2007).
While mutation frequency determines genetic variations in a viral population and
speeds up viral evolution (Sanjuán & Domingo-Calap, 2016), mutational robustness
is dependent on population size and how viruses manage the detrimental effects of
mutations. While most random mutations (approximately 40%) are lethal, deleteri-
ous mutations that are non-lethal (approximately 30%) lead to a reduced effective-
ness of the virus (Sanjuán, Moya, & Elena, 2004) or can have positive effects, as has
been reported in bacteriophage φ6 (Burch & Chao, 2004), vesicular stomatitis virus
(Sanjuán et al., 2004), and HIV-1 (Bonhoeffer, Chappey, Parkin, Whitcomb, &
Petropoulos, 2004). However, beneficial mutations may occur if the environment
changes rapidly, if a multiplicity of ecological niches are present, or if other factors
adding to the viral mutational landscape enhances novelty generation, including rear-
rangement/recombination, changes in genome size, host-encoded modifiers, and rep-
lication mode (Sanjuán & Domingo-Calap, 2016). Regardless of how viruses
manage mutations, changes in population size can influence the frequency of a given
mutation and the identity of the viral population as a whole. For example, small
populations let genetic drift cause stochastic fixation of mutations in sequences that
are conserved and are present in the parental genome. Because most of the progeny
will acquire these mutations, the identity of the population is maintained, very much
as it occurs in higher organisms. In other words, a small population size guarantees
‘survival of the fittest’ by competition and natural selection of the best-adapted var-
iants among a limited number of genomes (Earn et al., 2002). When populations are
large, a swarm of genetic variants revolving around a consensus sequence is formed
in a phenomenon known as ‘the survival of the flattest’ (Lauring & Andino, 2010).
Here, viruses with larger numbers of variants are retained, limited only by the ‘error
threshold’ and the catastrophic possibility of viral extinction. Viral identity is lost
and replaced by a ‘quasispecies’, a group of different variants that show genetic
linkage through mutation, have shared functions, and collectively contribute to
the characteristics of the population.
4.2 A structuring quasispecies as paradigm of viral mutational

change
For the last 30 years, the quasispecies concept provided a population-based frame-
work to elaborate viral evolution, especially that of RNA viruses (Lauring & Andino,
2010). Although this framework is based on classical population genetics, its main
objective is to explain the results of error-prone replication, describe viral evolution-
ary dynamics, and test predictions in model organisms (Domingo et al., 2006). As it
is clearly evident from tracking the expanding COVID-19 pandemic with millions of
viral sequences (all publicly available in the GISAID viral data repository), the single
reference sequence (accession NC_045512.2, version March 30, 2020; previously
‘Wuhan seafood market pneumonia virus’) rapidly transformed into a cloud of
diverse amino acid variants in each and every host, which can be described using
accepted nomenclature from the Human Genome Variation Society—for example,
the first major and now universal variant D614G of the spike makes explicit that
a glycine (G) has substituted an aspartic acid (D) in site 614 of the reference sequence.
These variants are organized around that ‘master sequence’, which in our case repre-
sented the original viral infection that jumpstarted the pandemic. Indeed, initial
SARS-CoV-2 mutations recurrently resulted in genetically related variants that as-
sembled into phylogenetic groups with common origin, i.e., clades, all unified by a
single origin (root) in a phylogenetic tree (see Glossary) meticulously tracked by for
example the GISAID repository (Elbe & Buckland-Merrett, 2017). Fig. 6 shows an
example maximum likelihood tree reconstructed from 3615 sampled genomes using
the Nextstrain online system (Hadfield et al., 2018) with groups labelled as either
GISAID clades or emerging VOCs. So far, variants have been clustered into ten
clades: L, S, O, V, G, GH, GR, GV, GRY (Mercatelli & Giorgi, 2020) and GK. Clade
L arose in Wuhan and dominated SARS-CoV-2 spread prior to January 2020, a time
when clades S and O appeared. Clades V and G appeared at the middle of January
2020, followed by clades GH, GR appearing at the end of February, clades GV and
GRY appearing in June and September 2020, respectively, and clade GK appearing
in October 2020. While clades L, V and S are becoming extinct, clades G, GH, GR,
GV, GRY and GK embody the current genomic makeup of the virus (Singh, Pandit,
McArthur, Banerjee, & Mossman, 2021). This makeup is now producing VOCs that
are structuring in more complex ways the viral quasispecies. To illustrate, note how
the subtree defining the GK clade that embodies VOC delta embeds viruses from
other clades (mostly GRY and GV), suggesting an important role of horizontal
processes of genetic exchange such as recombination (Fig. 6). This questions the
suitability of using phylogenetic trees without reticulations to describe this new
FIG. 6
The mutational landscape of the SARS-CoV-2 virus. A maximum likelihood phylogenetic tree of 3615 genomes sampled from more than a million GISAID worldwide
sequences between December 2019 and September 2021 obtained from Nextstrain (https://nextstrain.org) shows groups of taxa (leaves of the tree indicated with
circles) labelled as either GISAID clades or emerging variants of concern (VOCs) and their origins along branches of the trees. Proportions (given as smoothed
percentages) of genomes holding major emerging VOCs along the evolutionary timeline is shown above the trees. The timeline of clades and VOCs and their
signature mutations (listed on the right) show three successive phases driven by proteome flexibility and rigidity, environmental sensing, and vaccine-driven
immune escape. Variants coloured in grey, blue and purple are linked to the three successive drivers, respectively. Variant lists of VOCs do not include the 4-variant
D614G haplotype nor the N-protein R203K and G204R mutations, which are widespread in all VOCs. See Bernasconi, Mari, Casagrandi, and Ceri (2021) for a
‘lineage directory’ of markers with changes in more than 75% of sequences.
diversification process. In fact, a recent analysis of mutations in SARS-CoV-2 ge-

nome sequences in the United States appear to suggest that mutations are being ac-
cumulated and sequences convert to VOCs through serial ‘super spreader’ founder
events in a sea of mutational bursts (Tasakis et al., 2021). Similarly, the rise of VOCs
appears to coincide with a major global shift in the selective landscape that involves
convergence between lineages (Martin et al., 2021).
An increasing body of molecular evidence suggests we are witnessing major ep-
isodes of structuring of the evolving SARS-CoV-2 quasispecies. These episodes can
be identified by studying the accumulation of sets of highly prevalent variants, which
we here call ‘markers’. These markers recurrently combine with a highly diverse set
of other variants of the master sequence. This marker-linked ‘cloud’ of variant com-
binations define a mutational landscape that the virocell explores to optimize. Fig. 6
dissects possible diversification mechanisms by showing a timeline of clades and
VOCs together with their most characteristic marker mutations. Based on these
markers, we elaborate a sequence of structuring episodes triggered during different
phases of the pandemic by: (i) enhancing viral survival through a careful balance of
protein flexibility and rigidity, (ii) facilitating viral sensing of the environment as
winter approached the Northern Hemisphere, and (iii) evading vaccines and thera-
peutics that were massively introduced at the beginning of year 2021. This last phase
involves strategies of ‘immune escape’ (see Glossary), i.e., the search of mutants that
override the innate and adaptive immunity mechanisms of the host. The next subsec-
tions will provide genomic evidence to support our contentions.
4.3 The mutational landscape of evolving SARS-CoV-2 viruses

A vast body of literature has been amassed describing the millions of SARS-CoV-2
genomes that have been sequenced so far. These efforts have been abundantly
reviewed (e.g. Harvey et al., 2021; Huang, Yang, Xu, Xu, & Liu, 2020;
Majumdar & Niyogi, 2021; Singh et al., 2021). Many mutations have been studied
in different viral proteins that might affect viral replication, transmissibility, and vir-
ulence. One clear example has been the mutations of the S-protein of the spike (Harvey
et al., 2021; Huang et al., 2020), but also of the nucleocapsid protein, the N-protein.
Prompted by the initial arrival of COVID-19 to the United States, we developed
an entropy-based algorithm to explore the mutational landscape of the SARS-CoV-2
virus (Tomaszewski et al., 2020), which detected 27 high-entropy mutations at the
amino acid level in an initial set of 25,000 genomic sequences retrieved on May 7,
2020 from the GISAID worldwide repository (Table 2). Our method uses Shannon
informational entropy to describe the amount of variation existing in discrete per-
location nucleotide or amino acid composition data. We used it to quantify popula-
tion diversity and selection with two independent state variables, as suggested and
tested with H3N2 influenza by Pan and Deem (2011). The first variable uses muta-
tional entropy as a measure of molecular biodiversity, being maximal for example
when all amino acids in an amino acid site of the sampled viral proteomes are equally
represented. Entropy is zero when only one amino acid overtakes that site
Table 2 The SARS-CoV-2 mutational landscape at the peak of the first wave of the pandemic.a
Protein Site Entropy Δb Str Location Region IUPred2 Anchor2
M 175 –0.136 loop surface ordered 0.2167 0.2647

N 13 0.050 loop surface disordered 0.8781 0.9749
193 –0.073 loop surface disordered 0.7912 0.4214
203 0.157 loop buried disordered 0.7573 0.5969
204 0.143 loop buried disordered 0.7605 0.621
S 614 –0.220 loop surface ordered 0.1266 0.3609
NSP1 75 –0.016 loop surface ordered 0.3184 0.4256
NSP2 85 0.055 loop surface ordered 0.0771 0.261
212 –0.120 loop surface ordered 0.2748 0.2408
NSP3 58 –0.101 helix surface ordered 0.0414 0.2217
NSP4 308 –0.071 loop surface TM 0.0004 0.0003
NSP5 15 0.114 helix surface ordered 0.0813 0.0843
NSP6 37 –0.121 loop surface ordered 0.0003 0
NSP12 323 –0.222 helix surface ordered 0.0137 0.0299
NSP13 504 –0.226 loop surface ordered 0.115 0.4329
3a 13 0.082 loop surface ordered 0.0587 0.029
57 0.066 helix pore TM 0.001 0.0014
8 24 0.105 helix surface ordered 0.0395 0.004
a
An examination of relative entropy delta values and the structure (Str: loop, helix, strand), location (surface, buried, pore) and region [ordered, disordered,
transmembrane (TM)] involving mutation sites are provided together with IUPred2 scores of intrinsic disorder and Anchor2 estimates of binding propensity. IUPred2
and Anchor2 scores above 0.5 support significant intrinsic disorder and binding energy of that amino acid site, respectively. Data from Tomaszewski et al. (2020).
b
Negative values of relative entropic delta imply entropy reversals that result in increased fitness and trends towards fixation. Positive values imply entropy expansion
fostering trends towards site diversification. Rows in bold are sites that have been confirmed as positively selected and exhibiting population level expansions as of
March 2021 (from table 2, Singh et al., 2021).
(suggesting fixation) and its value increases when mutations are diluted in the viral
cloud. The second variable is a relative measure of entropy, ‘relative entropy delta’,
which measures selection pressure by comparing viral diversity at two different time
points of a time series. Entropy reversal trends suggest mutations are positively
selected to enhance fitness while entropy expansions suggest other evolutionary
forces are at play. We note entropy expansions are expected to precede reversals
since they generate novelties which are then culled in a reversal phase.
Out of the 27 high-entropy mutations identified, 19 were entropy reversals
(Table 2). Five of these have been confirmed as positively selected and exhibiting
population level expansions (as of March 2021; Singh et al., 2021). Another 4 pos-
itively selected mutations were associated with the PID-rich serine/arginine-rich
linker of the N-protein, R203K and G204R, and the viroporin protein encoded by
ORF3a, Q57H and G251V. They were in either entropic expansion or reversal
modes, respectively. Most of 27 high-entropy mutations were located on the surface
of the molecules once mutations were traced onto three-dimensional atomic models
(Tomaszewski et al., 2020). The only exceptions were the R203K and G204R mu-
tations of the N-protein, which were buried, and the G57H mutation of the ORF3a
viroporin, which was located on an internal transmembrane domain. Remarkably,
seven of the high-entropy mutations were located on PID regions of significant dis-
order of the N-protein, the NSP3 papain-like protease, and the ORF3a viroporin
(Table 2). Three of these were positively selected.
Our analysis identified the well-known D614G mutation of the S-protein had co-
ordinated entropic trends with the P323L mutation of the NSP12 polymerase that
mediates viral replication. The D614G mutation, which is already fixed worldwide
in the current viral population, was part of a haplotype of four mutations altering the
S and NSP12 proteins, 50 UTR, and silently the NSP3 papain-like protein (F106F)
during the first wave. This haplotype defined the G-clade that originated in China
and was established in Europe in the middle of January 2020 following its first report
in Germany (Korber et al., 2020; Phan, 2020). A time series of variant appearance
revealed that the D614G and P323L haplotype marker of the G-clade had spread
through continents during the January-April period of the first wave visualized
through genomic analysis of the thousands of sequences we had available at the time.
The haplotype is believed to have increased infectivity (Becerra-Flores & Cardozo,
2020; Korber et al., 2020), and as previously discussed, to have enhanced protein
flexibility (Korber et al., 2020).
We also revealed accumulation of high-entropy variants enhancing flexibility in
PID regions and other regions that were of interest. The N-protein plays critical roles
in maintaining viral structure and viability once the virus enters the cell, helping viral
replication, transcription and packaging (e.g. Woo, Lee, Lee, Kim, & Cho, 2019).
The N-proteins holds two major RNA-binding domains, an N-terminal domain
(NTD) and a C-terminal domain (CTD) connected by a central serine/arginine-rich
linker and flanked by terminal sequences. We found these linker and terminal
sequences were PID regions and their contribution to the entire molecule made
the N-protein a ‘highly disordered’ molecule. All identified high-entropy mutations

(Table 2) occurred in loop regions of the N-terminal and linker PID regions. Two
particularly important mutations were in the linker, R203K and G204R, which were
already present in January but later defined the GR-clade that appeared late February
and the GRY-clade of September. Their high Shannon entropy values of 0.8 sug-
gested a coordinated active exploration of these two mutation sites for novel geno-
types, which was later reflected by its worldwide spread through clades GR and GRY
later in year 2020 and in VOC delta in 2021 (Fig. 6). In fact, the terminal and linker
PID regions flanking the high-entropy mutations we detected were particularly
targeted by major VOCs alpha and delta. This strongly suggests PID flexibility is
providing an important functionality to the SARS-CoV-2 molecules. Three more
focused studies revealed a coordinated mutational push associated with the
N-protein that followed that of the S-protein. Ye, West, Silletti, and Corbett
(2020) identified 10,983 amino acid substitutions in 38,318 genome sequences of
SARS-CoV-2 N-protein retrieved June 3, 2020, prior to the appearance of the
GRY clade. Remarkably, 94% of mutations localized to the linker and terminal
regions, with 9567 of them located in the central serine/arginine-rich linker. Simi-
larly, Rahman et al. (2021) analysed 61,485 sequences of the N-protein retrieved
on July 17, 2020 (prior to the appearance of clade GRY) to study the functional roles
and structural importance of amino acid sites in diagnosis and vaccine development.
They detected 1,034 unique mutations, a third of which occupied primer binding
sites used in PCR diagnostic reactions. A group of 684 amino acid substitutions
in 317 positions revealed that only 165 targeted the NTD and CTD RNA bind-
ing domains while the rest were located in the disordered linkers and terminal
sequences. Troyano-Hernáez, Reinosa, and Holguı́n (2021) retrieved 105,276 geno-
mic sequences available in September 2020 and studied mutations in all structural
proteins of SARS-CoV-2. Despite extremely high conservation of structural proteins
(>99%), they found 291, 142, 2,671 and 890 mutational changes in the M, E, S and
N proteins, all of which were targeting 74–89% of available amino acid sites. Rates
of 1.76, 2.18, 2.35 and 2.5 mutations/site for the M, E, S and N proteins, respectively,
showed significant mutational targeting of the nucleocapsid components of the
virion. The study also displayed the centrality of the D614G mutation of the
S-protein, with a prevalence of 81.5%, and of the linked R203K and G204R muta-
tions of the N-protein, with a prevalence of 37%. This showed these central
flexibility-driven mutations were widely circulating before the emergence of VOCs
in October 2020 (Fig. 6). These protein flexibility-driven heterogeneities that are
becoming established with time are expected. They embody diverse ‘quasispecies’
dynamic behaviours unfolding in the presence of extreme genetic variation
(Domingo et al., 2002) that followed the first wave of the pandemic. However,
further studies are required to explore the precise mechanism and functional role
of nucleocapsid PID regions that are selectively targeted by mutation/deletions
in replication and viral pathogenesis. These deletions may influence the tertiary
structure and function of the protein and subsequently affect virus-host interaction,
immune modulation, and the pathogenic nature of the virus (Phan, 2020).
The N-protein and other high-entropy mutations established likely pathways of

significant mutational change associated with protein flexibility and disorder
(Tomaszewski et al., 2020), some of which are currently being used over a year later
by widely distributed VOCs (Fig. 6). VOC alpha markers D3L and S235F and VOC
delta markers D63G, R203M and D377Y are all located in PID regions highlighted
by our initial high-entropy mutants. The large NSP3 papain-like protease that initi-
ates cleavage of the non-structural ORFs exhibited a high-entropy mutation (P153L,
listed in Table 2) that targeted the N-terminal PID-rich hypervariable region (HVR)
of the molecule (Fig. 5B). This PID region now holds marker T183I for VOC alpha.
Similarly, the flexible ORF3a and ORF8 accessory viroporin proteins showed
high-entropy mutations in regions that embody markers for VOC alpha, gamma
and delta, including the S26L mutation in a 50 -terminal disordered tail of the ORF3a
viroporin and mutations Q27STOP, Y73C, and R52I of the 50 terminal region of the
ORF8 viroporin we previously identified as significant.
While the search for variants that would modulate protein flexibility and rigidity
continued over time, the remarkable appearance in the middle of 2020 of a number of
markers in clades GV and GRY (labelled in blue) that were located in the N-terminal
NTD region of the S-protein suggested a different mutational landscape was also
unfolding (Fig. 6). These markers included A222V and three deletions, H69del,
V70del, and Y144del. Later on, VOC alpha expressed two additional related
deletions (H69-V70del and Y145del) and VOC delta added the terminal T19R
marker. These and many other NTD-associated markers appeared as the pandemic
was again approaching winter in the Northern Hemisphere. The S-protein has a sol-
vent exposed region that mainly holds the NTD and RBD domains of the S1 subunit,
and a buried region comprising the transmembrane region of the S2 subunit, which
associates predominantly with the lipid bilayer of the capsid (Fig. 7D). In proteins
there is a continuum between rigidity, flexibility and disorder, which has been only
recently characterized (Akhila et al., 2020). A simple exploration of PID levels how-
ever already shows the S-protein is a significantly rigid structure (Fig. 7B). The
N-terminal S1 subunit was less ordered than the transmembrane S2 region, with
scores ranging from 0 to 0.3. The Anchor2 algorithm of IUPred2 predicted binding
regions based on sequence, identifying segments that had the capacity to gain energy
by interacting with a globular partner protein. Two segments of the NTD had such
binding properties, flanking the central domain structure. Some significant muta-
tions occurred in the more flexible subtending region, such as L18F, T19R and
H69_V70del. We also traced the location of some significant variants onto a crys-
tallographic atomic model of one of the three S-protein monomers of the spike
(Fig. 7D). Most mutations were located on the surface of the molecule, including
those in the NTD region, which localized to loops of its 13-stranded 3-layered
β-sandwich galectin fold structure with two antiparallel β-sheets stacked against each
other through hydrophobic interactions (Peng et al., 2012). While RDB carries the
central role of binding to Angiotensin Converting Enzyme 2 (ACE2) on the host
cells, NTD appears to have a binding role related to immune responses that is
uncertain but likely associated to temperature and environment. While RBD is
FIG. 7
The rigid yet flexible structure of the viral spike. (A) A diagram describing the different regions of the
S-protein molecule, including their lengths in amino acids. SP, signal peptide; NTD, N-terminal
domain; RDB, receptor-binding domain; RBM, receptor-binding motif; CS, cleavage site; FP,
fusion peptide; IFP, internal fusion peptide; HR1, heptad repeat 1; HR2, heptad repeat 2; TM,
transmembrane domain; CT, cytoplasmic tail. (B) The S-protein is a significantly rigid structure.
Mapping PID (red line) and gain-loss of binding energy (blue line) with IUPred2 along the S-protein
sequence shows the protein is highly ordered with scores <0.3–0.4 in the N-terminal S
subunit that holds the NTD and RBD domains. Disorder scores above 0.5 indicate significant PID
levels and proteins with 0–10% of PID residues are considered ‘highly ordered’ (the S-protein has
none). Significant variant markers are indicated, which usually coincide with more flexible regions.
(C) The S-protein is given in the context of the spike homotrimer described with an atomic model
(PDB entry 6vxx). Chain A is highlighted with its differently coloured NTD and RBD domains.
Top views of the spike complex are shown in the bottom in closed (resting state; PDB entry; 7df3)
and open (ACE2 triggered; PDB entry 7dk3) states. Note that only one of the three S-proteins has
the RBD upward conformation exposing the S2 subunit of a different protomer. The T478K
mutation of the RBM is shown to highlight its external loop location. (D) Representative mutations
are mapped onto a crystallographic atomic model of one of the three protomers of the spike
(PDB entry 6vxx). The model is displayed in cartoon (ribbon) format with the polypeptide visualized
from the top of the coronavirus crown (slightly tilted when compared to the top views in panel C) and
showing the tripartite structure of the spike monomer. The NTP, RDB and membrane bound
domains coloured in light sea green, light green and blue are clearly evident. Note that the signal
peptide (SP) and some small segments are missing in the model. The inset shows a complete NTD
model obtained with I-Tasser by the Zhang lab (GenBank: QHD43418.1) displaying the SP and
N-terminal region of the domain, with locations of most important mutations highlighted.
immunodominant (i.e. is the preferred epitope), changes in the NTD region alter
antigenicity (reviewed by Harvey et al., 2021). In fact, an ‘NTD supersite’ consisting
of NTD residues 14–20, 140–158 and 245–264 is involved in antibody neutralization
by inhibiting conformational changes or interactions with auxiliary receptors of its
structurally plastic structure. NTD is also central from an evolutionary perspective.
An analysis of ‘evolutionarily important’ residues of the S-protein detected by
sequence conservation showed they were concentrated in two domains, the NTD
and the RBD, both of which had a role of host cell binding in a number of related
viruses (Saputri et al., 2020). While many evolutionarily important residues were
detected in NTD, suggesting an involvement in host receptor binding, the study
showed ‘importance’ correlated with structural flexibility. Remarkably, all atom
molecular dynamics simulations of the SARS-CoV-2 S-protein revealed protein
flexibility was dependent on external temperature (Rath & Kumar, 2020). In the sim-
ulations, the RBD was less mobile than the NTD, with flexibility limited mostly to
the receptor binding motif. Increasing temperature made a number of charged polar
amino acid residues on the top layer of the more flexible NTD less solvent exposed.
These residues involved loops delimited by the N-terminal β-strand, β8-β9, β9-β10
and β14-β15, which harbour most mutations highlighted in Fig. 7D (including the
inset). Similarly, increases in temperature closed the flexible binding motifs of
the RBD in the trimer, which are usually in an open conformation. This conformation
sealed the visibility of the trimeric pore when visualized from the top of the spike,
burying the receptor binding residues necessary for contacting the ACE2 receptor.
Thus, temperatures above 40 °C resulted in the inactivation of the spike, possibly
in a reversible manner and without loss of secondary structure. The combination
of mobile rigid elements encompassed by deformable regions that act as hinges
may be the mechanism behind this environmental modulation. Given these results,
the putative binding properties of NTD are likely to have a regulatory role related to
environmental responses, which we here sought to confirm.
Finally, the significant appearance in clade GRY of the N501Y mutation (Fig. 6)
revealed the early accumulation of a marker in one of the six key contact residues of
RBD shown to increase both ACE2 receptor affinity and infectivity and virulence
(Starr et al., 2020). A cryo-EM analysis of receptor-triggered dynamic transforma-
tion from the closed prefusion state of the spike to the fusion-prone open state
(Fig. 7C) exhibited enhanced sensitivity of ACE2 through the T470-478 loop and
Y505 site of RDB viral determinants (Xu et al., 2021). Remarkably, T478K has
become a significant marker of VOC delta. The appearance of VOC alpha at the
end of 2020 brought also the P681H marker of the S-protein, one of four residues
comprising the insertion that creates a S1/S2 furin cleavage site between S1 and
S2 in spike, which is known to promote viral entry and transmission in animal
models. Harvey et al. (2021) carefully reviewed how mutations associated with
the main binding function of the S-protein and other functional regions that appeared
in this later phase of the pandemic contributed to ‘immune escape’ by changing an-
tigenicity and transmissibility but also reducing the efficiency of vaccines, convales-
cent plasma, and post vaccination serum. None of these markers were significant in
our initial exploration of high-entropy mutations during the first wave of the
pandemic, showing they represented novel targets of dynamic change in the viral
population.
Thus, the three structuring phases proposed in Fig. 6, ‘flexibility/rigidity’, ‘envi-
ronmental sensing’, and ‘immune escape’, are compatible with the gradual appear-
ance of markers over time associated with multiple PID regions, a putative molecular
sensor located in evolutionarily important sites of the N-terminal NTD region of the
S-protein, and the central receptor-binding function of the RBD region, respectively.
4.4 Viral genomic change and seasonal behaviour

Because COVID-19 transmission was initially restricted to a 30°N to 50°N latitude
corridor of the Northern Hemisphere, seasonal behaviour had to unfold in countries
of those regions during the first wave of the pandemic. We reasoned NTD mutations
in the S-protein that were emerging in the middle of 2020 were likely associated with
a molecular region that was already acting as environmental sensor at a much earlier
time. To test this hypothesis, we used recently published genomic data (Showers,
Leach, Kechris, & Strong, 2021) to track spike mutations as they emerged during
almost the entire span of year 2020. In that study, variants were identified in
139,835 filtered SARS-CoV-2 genomic sequences retrieved worldwide on November
14, 2020. Their weekly prevalence was then used to construct heat maps with cells
ordered in time from the first week of January to the last of October of 2020. To dissect
a possible environmental sensing role of the NTD region of the spike, we dissected the
time series of S-protein variants in search of seasonal patterns.
A focus on year 2020 provided the best opportunity to find a seasonal pattern in
the data, especially because vaccine introduction in 2021 was expected to foster viral
immune evasion strategies and offset any possible signal. If SARS-CoV-2 acted as a
‘winter virus’, it would push prevalence of mutations in molecular ‘sensor’ regions in
a seasonal manner in search for better modulation of sensing functions. That should
translate into mutational exploration through bursts of weekly prevalence of variants
occurring first during the winter. Most of these would not be retained or would be
revisited at low levels in the timeline. Our expectation was that this prevalence effect
should disappear during the summer but should be recovered later in the year with
new bursts and variants. To study bursts, we reordered the time series by time of
significant appearance of variants in the time series and by grouping variants accord-
ing to their location in regions of the S-protein. Using different filtering criteria, the
most relevant variants could be followed in time, making evident any detectable
seasonal pattern present in the data.
Our expectations were fulfilled. The rearranged heat map of widely abundant
variants worldwide made explicit a chronology of major mutational spreads and
bursts within a ‘sea’ of amino acid changes expressed at low level in the sampled
viral population. For example, Fig. 8A shows a time series describing the weekly
abundance of individual variants present in more than 2% of sequenced genomes
worldwide ordered by time of significant appearance in the ‘N-terminal’ region
FIG. 8
A timeline of S-protein variants of the spike during the emergence of the COVID-19 pandemic. (A) Heatmap describing the gradual weekly
accumulation of variants grouped by their appearance in either the N-terminal domain (NTD), the receptor-binding domain (RBD), or other
locations of the protein molecule (see diagram of domain locations in the S1 and S2 subunits above). Only variants that were present in at least 2%
in sequenced genomes for at least a week were included and ordered by time of significant appearance. Major domains holding the mutations are
given in parentheses following the name of the variant; SP, signal peptide; NTD and RDB, N-terminal and receptor-binding domains; FP, fusion
peptide; HR1, heptad repeat 1; HR2, heptad repeat 2; CD, cytoplasmic domain; ID, intracellular domain; and O, other. Prevalence levels in the
heatmap at given in a log scale. (B) and (C) Stacked bar plots constructed with names of variants associated with bursts of weakly variant
prevalence initiated during 2-month periods. Only variants appearing in at least 2% of sequences in any given continent are considered and
coloured according to regions. Bursts were defined as variants appearing with prevalence higher than 0.3% in one or multiple weeks, which then
withered throughout the timeline. (D) A network of co-occurrence of variants in sequences describes the most abundant variant combinations
appearing in the timeline. Nodes are variants and links represent their co-occurrence in at least 500 sequences out of the 137,605 analysed. All data
was retrieved from supplementary tables in Showers et al. (2021).
[NTD plus signal peptide (SP)], the RBD region, and in ‘Other’ regions, including
the S2 subdomain of the S-protein. The time series showed the early and growing
prevalence of the D614G variant (90% during the week of June 19) but also of
the NTD L18F and A222V substitutions, which spread in July and early August,
respectively. Most RBD substitutions peaked later. For example, S477N peaked
in July (with 44% prevalence worldwide and massively present in Oceania) but
quickly decreased in incidence. RBD substitution N439K and NTD deletion
H69_V70del were significant but were clearly late introductions.
More importantly, the timeline revealed a cyclic pattern of prevalence for the
N-terminal region, but not so much for RDB or ‘Other’ regions. With the exception
of D614G and SP variant L5F, which progressed towards fixation, all mutants intro-
duced during the January and February winter months of the Northern Hemisphere
showed significant bursts of genomic abundance lasting one or a few weeks, which
then declined significantly in later months with some resurfacing by the end of 2020.
These included the first 6 mutations in the N-terminal SP and NTD regions (H49Y,
S98F, Y28H, L8V and L5F), two mutations in the intracellular domain (ID)
(T1273extQ and P1263L), one in the cytoplasmic domain (CD) (W1214X) and
one in the RDB region (V367F). ID and RDB mutations later vanished as the year
progressed. With only one exception (D253G of the NTD), mutations appearing be-
tween the months of March and July had low prevalence and accumulated without
significant bursts in the timeline. No significant late mutation entries appeared after
July as the Northern Hemisphere was entering summer, again suggesting a seasonal
component.
Remarkably, dissecting the timeline along geography uncovered bursts occurring
preferably in the N-terminal SP and NTD regions that increased during the winter
seasons of the Northern Hemisphere for Europe, North America and Asia (Fig.
8B), and the winter season of the Southern Hemisphere for Oceania, South America
and in part Africa (Fig. 8C). This expected seasonal pattern, which matches patterns
shown in Fig. 4E, provides strong support to assumptions and hypotheses. The
hemisphere-related sinusoidal pattern was particularly evident in Asia and South
America. In Asia, a significant number of bursts in January-March driven by the start
of the pandemic in China and involving either the NTD or ‘Other’ regions of the
S-protein was followed by marked decreases and then significant increases in activ-
ity towards the end of the year with massive numbers of bursts involving the NTD
region. In South America, the pattern reverses with most bursts occurring during the
months of May and June, fewer bursts observed in July and August, and no burst
observed in September and October, with patterns mostly driven by variants in
the ‘N-terminal’ and ‘Other’ categories. A similar behaviour was observed for Africa
and Oceania but with one difference for the number of bursts during September and
October for Oceania, which was maximal for that set. We note that the absence of
entries during the months of January and February for South America and Africa may
be related to the low numbers of sequenced genomes available for those regions dur-
ing that time. We also note that all of North America and Europe and most of Asia
(with exception of East Timor, Indonesia, and Maldives) is located on the Northern
Hemisphere and that most of South America (90%), all of Oceania and only 30% of
Africa is located in the Southern Hemisphere, which holds only 15% of the world
population. For Africa, only the Mediterranean countries and South Africa are
within the seasonal corridor of the disease. Despite possible geographical uncer-
tainties, the hemisphere-related patterns appear consistent.
How would bursts exert their influence on seasonality? Quantifying variants pre-
sent in a sequence provides insight into the kind of changes occurring in an individual
burst, which depend on the functional needs of proteins at that time. We therefore ex-
plored the combinatorial landscape of variants arising during the 2020 timeline. Out of
137,605 variant sequences analysed (Showers et al., 2021), 9.8% contained only one
variant (D614G), while 44.7% contained 2, 30.8% contained 3, and 14.4% contained
4–9. The average of 2.53 0.94 (SE) variants per sequence shows the poor mutational
saturation of the sampled viral population as a whole. A network of variants with links
describing their co-occurrence in sequences revealed that the vast majority of
sequences had variants that co-occurred with D614G. Thus, D614G represents the
central hub of the network. In fact, only 43 variant combinations representing 128
sequences lacked D614G variants (3 of which however co-occurred with other variants
of the 614 site). This is surprising and suggests D614G plays a very central functional
role, possibly of flexibility, that is complemented by each new variant. A network of
co-occurrence of variants in sequences with variant combinations present in at least
500 sequences is shown in Fig. 8D. Remarkably, the network reveals that variants
located in the NTD region, especially A222V and L18F, were driving network
co-occurrence in 2020. This again supports the central role of NTD as environmental
sensor. Note that 7,088 sequences contained all three D614G, A222V and L18F var-
iants, the top most common 3-variant combination. As expected, many of the central
network players we mapped earlier onto the atomic model of the S-protein (Fig. 7)
were also central hubs in this highly represented network.
4.5 Genomic change levels appear unlinked to temperature

or latitude
When analysing the effects of temperature and latitude on epidemiological param-
eters we also explored if genomic change levels for individual countries correlated
with temperature and latitude (Burra et al., 2021). We filtered genomic sequences
and collected 55,455 sequences from 211 countries on August 5, 2020. Variant ac-
cumulation and mutation rates were calculated for the entire genome and for specific
regions known for significant pathways of change, including the S1 subunit, the S2
subunit and the RBD region of the S-protein, ORF pp1a, and the NSP2 protease reg-
ulator. Pearson correlation analysis showed no significant associations. The only
weak borderline correlations were observed when comparing total genomic change
with temperature (r ¼ 0.09) and latitude (r ¼ 0.09), both of which had highly
significant P values of 4e 100. There were several possible reasons for lack of
significant association. Perhaps cyclic patterns observed in Fig. 4 were not fully man-
ifested at the time of data collection or the confounding hemisphere-related temporal
effects were not appropriately dissected in the genomic set. Alternatively, and given
the results of Fig. 8, variant bursts rather than variant levels could harbour better
signatures of seasonal behaviour. It is unclear whether the evolution of the SARS-
CoV-2 quasispecies is driven by mutational load and not specific molecular sensors,
as we here propose. Further exploration is therefore warranted.
4.6 Galectin homologues appear likely molecular culprits

While adaptive immunity is the central line of defense of vertebrates, the evolution-
ary older innate immunity response is the first step taken against an invading path-
ogen (Janeway, Travers, Walport, & Shlomchik, 2001). This strategy recruits
immune cells to sites of infection through production of chemical factors (e.g. cyto-
kine cascades), activates proinflammatory reactions and clearance of antibody
complexes, removes foreign structures through specialized white cells, triggers
the adaptive immune system through the process of antigen presentation, and
acts as a physical and/or chemical barrier to the infectious agent. Innate immunity
does not respond to antigens. Instead, it recognizes pathogen-associated and
damage-associated molecular patterns (PAMPs and DAMPs). PAMPs are small
evolutionarily-conserved molecular motifs of microbes (e.g. LPSs, endotoxins) that
activate innate immune responses when recognized by toll-like or other pattern rec-
ognition receptors. DAMPs include heat shock proteins, interleukin-1α, defensins
and anexins. Lectins are one important class of pattern recognition receptors that
bind to carbohydrate moieties of glycoproteins or glycolipids. They often have dual
roles as PAMPs and DAMPs (Sato, St-Pierre, Bhaumik, & Nieminen, 2009). In par-
ticular, the galectin family of lectins are highly evolutionarily-conserved effectors
that mediate a multiplicity of biological processes, making them molecular targets
for therapeutic intervention (Dings, Miller, Griffin, & Mayo, 2018). Central roles
include control of cell-cell and cell-matrix interactions, adhesion, proliferation, ap-
optosis, pre-mRNA splicing, immunity and inflammation. They are also involved in
multiple processes of cancer initiation and development, including apoptosis, adhe-
sion and migration, cell transformation, invasion and metastasis, immune escape and
angiogenesis (Dings et al., 2018). Galectin functions are multifaceted but generally
involve binding to carbohydrate moieties of glycoconjugates on the surfaces of cells.
Galectins are defined by conserved peptide sequence elements in one or more
well-defined carbohydrate recognition domain (CRD) and are grouped into proto-
type, chimera, and tandem repeat groups depending on having a single CRD core,
a CRD core with collagen-like N-terminal tail (galectin-3), or a tandem repeat of
two CRDs, respectively. Note that galectins can be monomeric or dimeric. Structur-
ally, CRDs are about 130 amino acids long and have β-sandwich structures
composed of 11 β-strands in antiparallel arrangement. Six of these β-strands (β1,
β3, β4, β5, β6, and β10), define the sugar-binding face of the fold structure.
Remarkably, a DALI analysis of the structural neighbourhood of the SARS-CoV-
2 S-protein of the viral spike using a representative crystallographic structural
entry as query revealed a significant structural match of the N-terminal NTD domain
to the relatively small galectin CRD structures (Fig. 9). The DALI server is an
FIG. 9
See figure legend on next page.
established fully automated nonhierarchical alignment tool for structure comparison

that uses a distance matrix alignment to construct lists of structural neighbours
(Holm, 2020). DALI provides structural alignments as either three-dimensional or
two-dimensional comparisons by explicitly rotating and translating one domain
structure over another or by mapping molecular structure into a matrix of intramo-
lecular distances, respectively. Since structure is far more conserved than sequence,
structural similarities [as root-mean square deviation (RMSD) scores] can better dis-
sect deeper homology relationships than sequences, especially when these are estab-
lished between domain regions of different sizes (using Z-scores) (see Glossary for
technical definitions). Note that better structural matches get lower RMSD values
and larger structural alignments get larger Z-scores. As expected, the RMSD vs
FIG. 9 Galectins, likely culprits of COVID-19 seasonal behaviour. (A) The DALI structural
neighbourhood of the spike protein of SARS-CoV-2 (PDB entry 6vxxA) contains 2310
structures (downloaded June 3, 2020) spread through a scatter plot describing their RMSD
and Z-score values (see Glossary for definitions). RMSD describes rigid-body structural
superposition while the Z-score describes a length-rescaled distance matrix alignment that
maximizes one-to-one atomic correspondences between two structures with a weighted sum
of similarities of intramolecular distances. The plot reveals galectins (red circles) exhibit a
good structural match (RMSD 2.5–5 Å) to a small segment (Z-score 8–10) of the spike
protein query (which self-aligns with RMSD ¼ 0 and Z-score ¼ 50). The inset shows the
match correlation matrix, which describes the correlation of matched structures along amino
acid residue positions of the query structure (proceeding from N-terminus to the C-terminus
in the x axis). The matrix can be used to evaluate modular segments in the alignment of the
entire neighbourhood. Structural modular domains are expected to show strong positive
correlation (red hues) within domains and negative correlations (blue hues) between
domains. The highlighted white square at the N-terminus of the molecule in the left-bottom
part of the correlation matrix reveals that the region of the N-terminal domain (NTD) of domain
S1 of the spike, which is homologous to the galectin fold (see panel B) is indeed modular.
The matrix also shows significant structural modularity of the receptor binding domain (RDB)
and the S2 subunit of the spike molecule. (B) Structural alignment of the monomer of
galectin-4 (brown; PDB entry 3ap5A) to the N-terminal domain of the coronavirus protein
(green; PDB entry 6vxxA) shows there is a good structural match in their three-dimensional
atomic models (rendered in ribbon format), confirming structural similarities (putative
homologies) between the NTD and the galectin fold. Alignments with other galectins show
similar structural matches (not shown). (C) A protein sequence and secondary structure
alignment details the structural match at the N-terminal region of the spike molecule.
Symbols of amino acids in the pairwise sequence alignment between the query SARS-CoV-2
spike protein and galectin-4 at the top are given in the one-letter amino acid notation of the
IUPAC-IUB Commission of Biochemical Nomenclature. Symbols in the pairwise
alignment of secondary structures at the bottom follow DSSP nomenclature: H/h, helix; E/e,
strand; L/l, coil. Uppercase means structurally equivalent positions with the query sequence.
Z-score scatter plot detected a multiplicity of structural clusters (blue circles in the
plot), most of them related to spike proteins of other RNA viruses (Fig. 9A). While
these spike structures showed good structural matches (RMSD 2–5 Å), alignments
of protein segments of decreasing length (Z 10–50) showcased the remarkable
structural diversity that exist in the world of spike proteins. The novelty is the exis-
tence of a cluster of small structures with RMSD 2.5–5 Å and Z 8–10 (red cir-
cles) showing a small segment located on the N-terminal region of the SARS-CoV-2
spike protein (see correlation matrix in Fig. 9A) matched known crystallographic
structures of galectin proteins. Fig. 9B and C show structural and secondary structure
alignments between galectin-4 and the spike protein we used as query. Note align-
ment of the extended strands (E) that make the sequential loops of β-strands.
But why are galectin-like structures relevant to the seasonal behaviour of
COVID-19? The answer can be found in the coral reefs of the Pacific and Indian
Oceans and the devastating phenomenon of coral bleaching that threatens marine
resources and the well-being of the millions that live in coastal communities.
Scleractinian corals establish an endosymbiosis with dinoflagellates of the genus
Symbiodinium that allows them to grow and persist in warm, well-illuminated and
oligotrophic waters. Coral bleaching has been attributed to symbiosis disruption un-
der environmental stress resulting from rising ocean water temperatures and other
factors of global change (e.g. Kleypas, Castruccio, Curchitser, & McLeod, 2015).
A number of lectins have been identified in corals as part of the innate immune
response system of coral communities (Kvennefors et al., 2010), some implicated
in thermal and disease stress responses (Ricci et al., 2019; Vidal-Dupiol et al.,
2014). In particular, galectin proteins with antimicrobial immunity functions were
found in greater abundance in healthy coral symbioses (Ricci et al., 2019). Remark-
ably, a recent study showed galectin functions of the scleractinian coral Pocillopora
damicornis were dependent on temperature effects, establishing galectins as possible
environmental sensors (Wu et al., 2019). A cloned galectin that encoded a 293 amino
acid-long protein harbouring a CRD and collagen-like N-terminal tail with signal
peptide was able to recognize and agglutinate or stabilize coral pathogens and sym-
bionts. Binding activities were only optimal between 25–30 °C. Results suggested
galectins may be involved in heat bleaching of scleractinian corals through
temperature-regulated recognition of pathogens and symbionts.
We end by noting that lectins are a diverse family of proteins with the capacity to
selectively recognize carbohydrate moieties associated for example with receptor
proteins. It appears that the SARS-CoV-2 S-protein, besides binding ACE2, also
interacts with the CRD of C-type lectin receptors, which facilitate viral entry by
dysregulating host immune responses and acting as entry receptors (Rahimi,
2021). A number of studies have recently surfaced that point into the centrality of
lectin-mediated recognition (Gao et al., 2021; Soh et al., 2021; Thepaut et al.,
2021). Curiously, these lectins interact with both ACE2 and with the NTD domain
of the S-protein (Soh et al., 2021), perhaps facilitating the process of receptor
presentation by trans-infection (Thepaut et al., 2021).
5 Conclusions and prospects

The relationship between weather and diseases has been a major concern for centu-
ries. Understanding the reasons and conditions under which pathogens evolve to
spread and achieve higher infection rates is considered a major challenge in epide-
miology. This understanding is necessary for prediction, mitigation and informed
public health decision making. Here we propose a triangle of viral persistence will
help identify seasonal and other drivers of the wax and waning of viral diseases.
Timing of winter-peaking diseases, but not their amplitude, scales with latitude when
analysing weather and health insurance claim databases across U.S. counties
(Schober, Rzhetsky, & Rust, 2021). This latitude scaling suggests seasonality across
many respiratory pathogens in temperate zones responds to annual changes in irra-
diance and possibly a human circannual clock. Our discussions have shown this pre-
diction applies to the SARS-CoV-2 disease and is corroborated by a growing number
of studies. The survival of the COVID-19 virus depends on the environment. The
capsid is surrounded by a lipid bilayer, which supports structural proteins that are
expected to be sensitive to environmental factors such as temperature, humidity
and solar radiation (Moriyama et al., 2020). These environmental factors affect
the ability of the virus to survive in droplets and surfaces and may thereby reduce
its transmission rate.
We also propose that molecular components of the virus can act as sensors of
environment and physiology, and could represent molecular culprits of seasonality.
Through analysis of variants of the SARS-CoV-2 proteome encoded in thousands of
genomes, we searched for possible structures capable of being modulated by the en-
vironment. The search resulted in the identification of a galectin-like structure within
the N-terminal domain of the S-protein. This galectin-like structure may be a fre-
quent target of mutations because it helps the virus evade or modulate physiological
responses of the host to further its spread and survival. Regions such as these appear
to be good molecular candidates for sensors of environment and physiology.
They are rigid enough to sustain environmental damage and flexible enough to en-
able recognition and signaling. Tracking mutations in these molecular regions may
provide key insights into predictable changes that occur in seasonal viral transmis-
sion patterns as well as viral mutations throughout the course of an epidemic.
In short, while it has been observed that seasonal changes have a significant impact
on the transmissibility and infectivity of SARS-CoV-2, the exact mechanisms through
which this phenomenon occurs have not yet been elucidated until now. The study of
SARS-CoV-2 virus seasonal behaviour and host responses that are associated with in-
fection is crucial, since this knowledge can help mitigation efforts. Results of our an-
alyses show that the SARS-CoV-2 virus pushes prevalence of mutations in molecular
‘sensor’ regions in a seasonal manner in search for better modulation of sensing
functions. Although the data analysed and presented here show clear seasonality of
SARS-CoV-2, there is still much to learn about the causal factors of seasonal period-
icities. This necessitates both the application and development of statistical and data
mining methodologies that can dissect causative from aleatory effects. Systematic
References 69
characterization of the seasonal patterns of infectious disease and transmission patterns

in general can help inform us on cultural, socioeconomic, and life style factors that
affect our susceptibility to disease, as well as public policy decisions on things such
as school openings and closings during periods of peak virus transmission.
Acknowledgements
We dedicate this work to the frontline medical professionals who have been saving the life of
others with limited protective equipment, selflessly, and at their own peril during an age of
misinformation. COVID-19 research in the laboratory of G.C.-A. is supported by the Office
of Research and Office of International Programs in the College of Agricultural, Consumer
and Environmental Sciences at the University of Illinois at Urbana-Champaign.
Financial disclosures and conflicts of interest

The authors have no financial disclosures or conflicts of interests to disclose.
References
Abotaleb, M., & Makarovskikh, T. (2021). System for forecasting COVID-19 cases using
time-series and neural networks models. Engineering Proceedings, 5, 46.
Akhila, M. V., Narwani, T. J., Floch, A., Maljkovic, M., Bisoo, S., Shinada, N. K., et al. (2020).
A structural entropy index to analyze conformations in intrinsically disordered proteins.
Journal of Structural Biology, 210, 107464.
Amman, B. R., Carroll, S. A., Reed, Z. D., Sealy, T. K., Balinandi, S., Swanepoel, R., et al.
(2012). Seasonal pulses of Marburg virus circulation in juvenile Rousettus aegyptiacus
bats coincide with periods of increased risk of human infection. PLoS Pathogens,
8(10), e1002877.
Ashour, H. M., Elkhatib, W. F., Rahman, M., & Elshabrawy, H. A. (2020). Insights into the
recent 2019 novel coronavirus (SARS-CoV-2) in light of past human coronavirus out-
breaks. Pathogens, 35(3), 235–241.
Baltimore, D. (1971). Expression of animal virus genomes. Bacteriological Reviews, 35(3),
235–241.
Barrı́a-Sandoval, C., Ferreira, G., Benz-Parra, K., & López-Flores, P. (2021). Prediction of
confirmed cases of and deaths caused by COVID-19 in Chile through time series tech-
niques: A comparative study. PLoS One, 16(4), e0245414.
Batschelet, E., Domingo, E., & Weissmann, C. (1976). The proportion of revertant and mutant
phage in a growing population, as a function of mutation and growth rate. Gene, 1(1),
27–32.
Becerra-Flores, M., & Cardozo, T. (2020). SARS-CoV-2 viral spike G614 mutation exhibits
higher case fatality rate. International Journal of Clinical Practice, 74, e13525.
Bernasconi, A., Mari, L., Casagrandi, R., & Ceri, S. (2021). Data-driven analysis of amino acid
change dynamics reveals SARS-CoV-2 variant emergence. Scientific Reports, 11, 21068.
Berngruber, T. W., Froissart, R., Choisy, M., & Gandon, S. (2013). Evolution of virulence in
emerging epidemics. PLoS Pathogens, 9(3), e1003209.
Bjørnstad, O. N., & Viboud, C. (2016). Timing and periodicity of influenza epidemics. Pro-
ceedings of the National Academy of Sciences of the United States of America, 113(46),
12899–12901.
Bonhoeffer, S., Chappey, C., Parkin, N. T., Whitcomb, J. M., & Petropoulos, C. J. (2004). Ev-
idence for positive epistasis in HIV-1. Science, 306(5701), 1547–1550.
Borrmann, H., McKeating, J. A., & Zhuang, X. (2021). The circadian clock and viral infec-
tions. Journal of Biological Rhythms, 36, 9–22.
Brownlee, J. (1918). An investigation into the periodicity of measles epidemics in London
from 1703 to the present day by the method of the periodogram. Philosophical Transac-
tions of the Royal Society London B, 208, 225–250.
Burch, C. L., & Chao, L. (2004). Epistasis and its relationship to canalization in the RNA virus
φ6. Genetics, 167(2), 559–567.
Burra, P., Soto-Dı́az, K., Chalen, I., Gonzalez-Ricon, R. J., Istanto, D., & Caetano-Anolles, G.
(2021). Temperature and latitude correlate with SARS-CoV-2 epidemiological variables
but not with genomic change worldwide. Evolutionary Bioinformatics, 19,
1176934321989695.
Caetano-Anolles, G. (2021). The language of biomolecular communication. In G. Caetano-
Anolles (Ed.), Untangling molecular biodiversity (pp. 283–345). Singapore: World Scien-
tific Publishing.
Caetano-Anolles, D., & Caetano-Anolles, G. (2015). Computing the origin and evolution of
the ribosome from its structure—Uncovering processes of macromolecular accretion
benefitting synthetic biology. Computational and Structural Biotechnology Journal, 13,
427–447.
Caetano-Anolles, G., Mughal, F., Aziz, M. F., Koç, I., Caetano-Anolles, K., Caetano-Anolles,
D., et al. (2021). A ’double tale’ of module creation in evolving networks. In G. Caetano-
Anolles (Ed.), Untangling molecular biodiversity (pp. 91–168). Singapore: World Scien-
tific Publishing.
Cannell, J. J., Vieth, R., Umhau, J. C., Holick, M. F., Gran, W. B., Madronich, S., et al. (2006).
Epidemic influenza and vitamin D. Epidemiology and Infection, 134, 1129–1140.
Carlson, C. J., Gomez, A. C., Bansal, S., & Ryan, S. J. (2020). Misconceptions about weather
and seasonality must not misguide COVID-19 response. Nature Communications, 11(1),
1–4.
Chambliss, D. F., & Schutt, R. K. (2012). Making sense of the social world (4th ed.). London:
SAGE Publications.
Chin, A. W. H., Chu, J. T. S., Perera, M. R. A., Hui, K. P. Y., Yen, H.-L., Chan, M. C. W., et al.
(2020). Stability of SARS-CoV-2 in different environmental conditions. The Lancet Mi-
crobe, 1, e10.
Colominas, M. A., Schlotthauer, G., & Torres, M. E. (2014). Improved complete ensemble
EMD: A suitable tool for biomedical signal processing. Biomedical Signal Process and
Control, 14, 19–29.
Conlan, A. J. K., & Grenfell, B. T. (2007). Seasonality and the persistence and invasion of
measles. Proceedings of the Royal Society B: Biological Science, 274, 1133–1141.
Coronaviridae Study Group of the International Committee on Taxonomy of Viruses. (2020).
The species severe acute respiratory syndrome-related coronavirus: Classifying 2019-
nCoV and naming it SARS-CoV-2. Nature Microbiology, 5, 536–544.
Cox, N. J., & Fukuda, K. (1998). Influenza. Infectious Disease Clinics of North America, 12,
27–38.
References 71
Demongeot, J., Flet-Berliac, Y., & Seligmann, H. (2020). Temperature decreases spread pa-
rameters of the new Covid-19 case dynamics. Biology (Basel), 9, 94.
Deyle, E. R., Maher, M. C., Hernandez, R. D., Basu, S., & Sugihara, G. (2016). Global envi-
ronmental drivers of influenza. Proceedings of the National Academy of Science of the
United States of America, 113, 13081–13086.
Dings, R. P. M., Miller, M. C., Griffin, R. J., & Mayo, K. H. (2018). Galectins as
molecular targets for therapeutic intervention. International Journal of Molecular
Sciences, 19, 905.
Domingo, E. (2002). Quasispecies theory in virology. Journal of Virology, 76(1), 463–465.
Domingo, E., Martin, V., Perales, C., Grande-Perez, A., Garcia-Arriaza, J., & Arias, A. (2006).
Viruses as quasispecies: Biological implications. Current Topics in Microbiology and
Immunology, 299, 51–82.
Domingo, E., Sheldon, J., & Perales, C. (2012). Viral quasispecies evolution. Microbiology
and Molecular Biology Reviews, 76, 159–216.
Domingo, E., Ruiz-Jarabo, C. M., Sierra, S., Arias, A., Pariente, N., Baranowski, E., et al.
(2002). Emergence and selection of RNA virus variants: Memory and extinction. Virus
Research, 82(1–2), 39–44.
Dopico, X. C., Evangelou, M., Ferreira, R. C., Guo, H., Pekalski, M. L., Smyth, D. J., et al.
(2015). Widespread seasonal gene expression reveals annual differences in human immu-
nity and physiology. Nature Communications, 6, 7000.
Dowell, J. (2001). Seasonal variation in host susceptibility and cycles of certain infectious dis-
eases. Emerging Infectious Diseases, 7(3), 369–374.
Drake, J. W., Charlesworth, B., Charlesworth, D., & Crow, J. F. (1998). Rates of spontaneous
mutation. Genetics, 148(4), 1667–1686.
Dudas, G., Carvalho, L. M., Rambaut, A., & Bedford, T. (2018). MERS-CoV spillover at the
camel-human interface. eLife, 7(e31257), 1–37.
Duncan, C. J., Duncan, S. R., & Scott, S. (1997). The dynamics of measles epidemics.
Theoretical Population Biology, 2, 155–163.
Dunker, A. K., Brown, C. J., Lawson, J. D., Iakoucheva, L. M., & Obradovic, Z. (2002).
Intrinsic disorder and protein function. Biochemistry, 41, 6573–6582.
Earn, D. J., Dushoff, J., & Levin, S. A. (2002). Ecology and evolution of the flu. Trends in
Ecology and Evolution, 17(7), 334–340.
Eckerle, L. D., Becker, M. M., Halpin, R. A., Li, K., Venter, E., Lu, X., et al. (2010). Infidelity
of SARS-CoV Nsp14-exonuclease mutant virus replication is revealed by complete
genome sequencing. PLoS Pathogens, 6(5), e1000896.
Elbe, S., & Buckland-Merrett, G. (2017). Data, disease and diplomacy: GISAID’s innovative
contribution to global health. Global Challenges, 1, 33–46.
Farah-Perez, A., Umaña-Villalobos, G., Picado-Barboza, J., & Anderson, E. P. (2020). An
analysis of river fragmentation by dams and river dewatering in Costa Rica. River Re-
search and Applications, 36, 1442–1448.
Ferguson, N. M., Cucunubá, Z. M., Dorigatti, I., Nedjati-Gilani, G. L., Donnelly, C. A., Basá-
ñez, M. G., et al. (2016). Countering the Zika epidemic in Latin America. Science,
353(6297), 353–354.
Fine, P. E. M., & Clarkson, J. A. (1982). Measles in Engand and Wales—I: An analysis of
factors underlying seasonal patterns. International Journal of Epidemiology, 11, 5–14.
Finke, L. L. (1792-1795). Versuch einer allgemeinen medicinisch -praktischen Geographie. 3
Vols. Leipzig: Weidmannschen Buchhandlung.
Finkel, Y., Mizrahi, O., Nachshon, A., Weingarten-Gabbay, S., Morgenstern, D., Yahalom-
Ronen, Y., et al. (2020). The coding capacity of SARS-CoV-2. Nature, 589, 125–130.
Fisman, D. (2012). Seasonality of viral infections: Mechanisms and unknowns. Clinical

Microbiology and Infection, 18, 946–954.
Friendly, M., Monette, G., & Fox, J. (2013). Elliptical insights: Understanding statistical
methods through elliptical geometry. Statistical Science, 28(1), 1–39.
Galton, F. (1886). Regression towards mediocrity in hereditary stature. Journal of the Anthro-
pological Institute, 15, 246–263.
Gao, Y., Yan, L., Huang, Y., Liu, F., Zhao, Y., Cao, L., et al. (2020). Structure of the
RNA-dependent RNA polymerase from COVID-19 virus. Science, 368, 779–782.
Gao, C., Zeng, J., Jia, N., Stavenhagen, K., Matsumoto, Y., Zhang, H., et al. (2021). SARS-
CoV-2 spike protein interacts with multiple innate immune receptors. bioRxiv. https://doi.
org/10.1101/2020.07.29.227462.
Garland, T., Jr. (2014). Trade-offs. Current Biology, 24(2), PR60–PR61.
Gecili, E., Ziady, A., & Szczesniak, R. D. (2021). Forecasting COVID-19 confirmed cases,
deaths and recoveries: Revisiting established time series modeling through novel applica-
tions for the USA and Italy. PLoS One, 16(1), e0244173.
George, D. B., Webb, C. T., Farnsworth, M. L., O’Shea, T. J., Bowen, R. A., Smith, D. L., et al.
(2011). Host and viral ecology determine bat rabies seasonality and maintenance. Pro-
ceedings of the National Academy of Sciences of the United States of America,
108(25), 10208–10213.
Gibbs, M. J., & Weiller, G. F. (1999). Evidence that a plant virus switched hosts to infect a
vertebrate and then recombined with a vertebrate-infecting virus. Proceedings of the
National Academy of Sciences of the United States of America, 96(14), 8022–8027.
Goh, G. K.-M., Dunker, A. K., Foster, J. A., & Uversky, V. N. (2020a). Rigidity of the outer
shell predicted by a protein intrinsic disorder model sheds light on the COVID-19 (Wuhan-
2019-nCoV) infectivity. Biomolecules, 10, 331.
Goh, G. K.-M., Dunker, A. K., Foster, J. A., & Uversky, V. N. (2020b). Shell disorder analysis
predicts greater resilience of the SARS-CoV-2 (COVID-19) outside the body and in body
fluids. Microbial Pathogenesis, 144, 104177.
Goh, G. K.-M., Dunker, A. K., Foster, J. A., & Uversky, V. N. (2021). Shell disorder analysis
suggests that pangolins offered a window for a silent spread of an attenuated SARS-CoV-2
precursor among humans. Journal of Proteome Research, 19, 4543–4552.
Grenfell, B., & Bjørnstad, O. (2005). Epidemic cycling and immunity. Nature, 433(7024),
366–367.
Groseth, A., Feldmann, H., & Strong, J. E. (2007). The ecology of Ebola virus. Trends in
Microbiology, 15(9), 408–416.
Hadfield, J., Megill, C., Bell, S. M., Huddleston, J., Potter, B., Callender, C., et al. (2018).
Nextrain: Real-time tracking of pathogen evolution. Bioinformatics, 34(23), 4121–4123.
Hardle, W. (1990). Applied nonparametric regression. Cambridge: Cambridge University
Press.
Hardle, W., L€utkenpohl, H., & Cheng, R. (1997). A review of nonparametric time series anal-
ysis. International Statistical Review, 65(1), 49–72.
Harvey, W. T., Carabelli, A. M., Jackson, B., Gupta, R. K., Thomson, E. C., Harrison, E. M.,
et al. (2021). SARS-CoV-2 variants, spike mutations and immune escape. Nature Reviews.
Microbiology, 19, 409–424.
Heilingloh, S. S., Aufderhorst, U. W., Schipper, L., Dittmer, U., Witzke, O., Yang, D., et al.
(2020). Susceptibility of SARS-CoV-2 to UV radiation. American Journal of Infection
Control, 48(10), 1273–1275.
References 73
Hethcote, H. W., Stech, H. W., & Van Den Driessche, P. (1981). Nonlinear oscillations in
epidemic models. SIAM Journal on Applied Mathematics, 40(1), 1–9.
Hirsch, A. (1883). Handbook of geographical and historical pathology. Acute infective
diseases: Vol. I. London: The New Sydenham Society.
Holm, L. (2020). DALI and the persistence of protein shape. Protein Science, 29, 128–140.
Hope-Simpson, R. E. (1981). The role of season in the epidemiology of influenza. Journal of
Hygiene (London), 86(1), 35–47.
Huang, Y., Yang, C., Xu, X.-F., Xu, W., & Liu, S.-W. (2020). Structural and functional prop-
erties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19.
Acta Pharmacologica Sinica, 41, 1141–1149.
Janeway, C., Travers, P., Walport, M., & Shlomchik, M. (2001). Immunobiology (5th ed.).
New York: Garland Science.
Johnson, T., & Barton, N. H. (2002). The effect of deleterious alleles on adaptation in asexual
populations. Genetics, 162(1), 395–411.
Jones, K. E., Patel, N. G., Levy, M. A., Storeygard, A., Balk, D., Gittleman, J. L., et al. (2008).
Global trends in emerging infectious diseases. Nature, 451, 990–993.
Jonsson, C. B., Moraes Figuereido, L. T., & Vapalahti, O. (2010). A global perspective on
Hantavirus ecology, epidemiology, and disease. Clinical Microbiology Reviews, 23(2),
412–441.
Karapiperis, C., Kouklis, P., Papastratos, S., Chasapi, A., Danchin, A., Angelis, L., et al.
(2021). A strong seasonality pattern for COVID-19 incidence rates modulated by UV
radiation levels. Viruses, 13, 574.
Kasahara, A. K., Singh, R. J., & Noymer, A. (2013). Vitamin D (25OHD) serum seasonality in
the United States. PloS One, 8, e65785.
Kassem, A. Z. E. (2020). Does temperature affect COVID-19 transmission? Frontiers in
Public Health, 8, 554964.
Khatchikian, D., Orlich, M., & Rott, R. (1989). Increased viral pathogenicity after insertion of
a 28S ribosomal RNA sequence into the haemagglutinin gene of an influenza virus.
Nature, 340(6229), 156–157.
Killerby, M. E., Biggs, H. M., Haynes, A., Dahl, R. M., Mustaquim, D., Gerber, S. I., et al.
(2018). Human coronavirus circulation in the United States 2014-2017. Journal of Clinical
Virology, 101, 52–56.
Kirchdoerfer, R. N., & Ward, A. B. (2019). Structure of the SARS-CoV NSP12 polymerase
bound to NSP7 and NSP8 co-factors. Nature Communications, 10, 2342.
Kissler, S. M., Tedijanto, C., Goldstein, E., Grad, Y. H., & Lipsitch, M. (2020). Projecting the
transmission dynamics of SARS-CoV-2 through the postpandemic period. Science,
368(6493), 860–868.
Kleypas, J. A., Castruccio, F. S., Curchitser, E. N., & McLeod, E. (2015). The impact of ENSO
on coral heat stress in the western equatorial Pacific. Global Change Biology, 21,
2525–2539.
Klingberg, E., Olerod, G., Konar, J., Petzold, M., & Hammarsten, O. (2015). Seasonal vari-
ations in serum 25-hydroxy vitamin D levels in a Swedish cohort. Endocrine, 49, 800–808.
Knight, G. (1971). The ecology of African sleeping sickness. Annals of the Association of
American Geographers, 61(1), 23–44.
Korber, B., Fischer, W. M., Gnanakaran, S., Yoon, H., Theiler, J., Abfalterer, W., et al. (2020).
Tracking changes in SARS-CoV-2 spike: Evidence that D614G increases infectivity of the
COVID-19 virus. Cell, 182, 812–827.
Kronfeld-Schor, N., Stevenson, T. J., Nickbakhsh, S., Schernhammer, E. S., Dopico, X. C.,
Dayan, T., et al. (2021). Driversof infectious disease seasonality: Potential implications
for COVID-19. Journal of Biological Rythms, 36(1), 35–54.
Kvennefors, E. C., Leggat, W., Kerr, C. C., Ainsworth, T. D., Hoegh-Guldberg, O., &
Barnes, A. C. (2010). Analysis of evolutionarily conserved innate immune components
in coral links immunity and symbiosis. Developmental and Comparative Immunology,
34, 1219–1229.
Lauber, C., Goeman, J. J., Parquet, M. C., Thi Nga, P., Snijder, E. J., Morita, K., et al. (2013).
The footprint of genome architecture in the largest genome expansion in RNA viruses.
PLoS Pathogens, 9(7), e1003500.
Lauring, A. S., & Andino, R. (2010). Quasispecies theory and the behavior of RNA viruses.
Li, R., Metcalf, J. E., Stenseth, N. C., & Bjørnstad, O. N. (2021). A general model for the de-
mographic signatures of the transition from pandemic emergence to endemicity. Science
Advances, 7, eabf9040.
Li, Y., Wang, X., & Nair, H. (2020). Global seasonality of human seasonal coronaviruses:
A clue for postpandemic circulating season of severe acute respiratory syndrome corona-
virus 2? Journal of Infectious Diseases, 222, 1090–1097.
Liu, X., Huang, J., Li, C., Zhao, Y., Wang, D., Huang, Z., et al. (2021). The role of seasonality
in the spread of COVID-19 pandemic. Environmental Research, 195, 110874.
Lowen, A. C., Mubareka, S., Steel, J., & Palese, P. (2007). Influenza virus transmission is
dependent on relative humidity and temperature. PLoS Pathogens, 3(10), 1470–1476.
Majumdar, P., & Niyogi, S. (2021). SARS-CoV-2 mutations: The biological trackway towards
viral fitness. Epidemiology and Infection, 149, e110.
Malim, M. H., & Emerman, M. (2001). HIV-1 sequence variation: Drift, shift, and attenuation.
Cell, 104(4), 469–472.
Manrubia, S. C., & Lázaro, E. (2006). Viral evolution. Physics of Life Reviews, 3(2), 65–92.
Mantilla-Beniers, N. B., Bjørnstad, O. N., Grenfell, B. T., & Rohani, P. (2010). Decreasing
stochasticity through enhanced seasonality in measles epidemics. Journal of the Royal
Society Interface, 7(46), 727–739.
Martin, D. P., Weaver, S., Tegally, H., San, E. J., Shank, S. D., Wilkinson, E., et al. (2021). The
emergence and ongoing convergent evolution of the N501Y lineages coincides with a
major global shift in the SARS-CoV-2 selective landscape. medRxiv. https://doi.org/
10.1101/2021.02.23.21252268.
Martinez, M. E. (2018). The calendar of epidemics: Seasonal cycles of infectious diseases.
Matson, M. J., Yinda, C. K., Seifert, S. N., Bushmaker, T., Fischer, R. J., van Doremalen, N.,
et al. (2020). Effect of environmental conditions on SARS- CoV-2 stability in human nasal
mucus and sputum. Emergent Infectious Diseases, 26, 2276–2278.
Mecenas, P., Bastos, R. T. R. M., Vallinoto, A. C. R., & Normando, D. (2020). Effects of tem-
perature and humidity on the spread of COVID-19: A systematic review. PLoS One, 15(9),
e0238339.
Mercatelli, D., & Giorgi, F. M. (2020). Geographic and genomic distribution of SARS-CoV-2
mutations. Frontiers in Microbiology, 11, 1800.
Midgley, C. M., Haynes, A. K., Baumgardner, J. L., Chommanard, C., Demas, S. W.,
Prill, M. M., et al. (2017). Determining the seasonality of respiratory syncytial virus in
the United States: The impact of increased molecular testing. Journal of Infectious
Diseases, 216, 345–355.
References 75
Minhaz Ud-Dean, S. M. (2010). Structural explanation for the effect of humidity on persis-
tence of airborne virus: Seasonality of influenza. Journal of Theoretical Biology,
263(3), 822–829.
Minskaia, E., Hertzig, T., Gorbalenya, A. E., Campanacci, V., Cambillau, C., Canard, B., et al.
(2006). Discovery of an RNA virus 30 !50 exoribonuclease that is critically involved in
coronavirus RNA synthesis. Proceedings of the National Academy of Sciences of the
Montgomery, D. (2013). Design and analysis of experiments. Hoboken, NJ: John Wiley &
Sons, Inc.
Monto, A. S., DeJonge, P., Callear, A. P., Bazzi, L. A., Capriola, S., Malosh, R. E., et al.
(2020). Coronavirus occurrence and transmission over 8 years in the HIVE cohort of
households in Michigan. Journal of Infectious Diseases, 222, 9–16.
Morikawa, S., Kohdera, U., Hosaka, T., Ishii, K., Akagawa, S., Hiroi, S., et al. (2015). Seasonal
variations of respiratory viruses and etiology of human rhinovirus infection in children.
Journal of Clinical Virology, 73, 14–19.
Moriyama, M., Hugentobler, W. J., & Iwasaki, A. (2020). Seasonality of respiratory viral
infections. Annual Review of Virology, 7, 83–101.
Nasci, R. S., Savage, H. M., White, D. J., Niller, J. R., Cropp, B. C., Godsey, M. S., et al.
(2001). West Nile virus in overwintering Culex mosquitoes, New York City, 2000.
Emerging Infectious Diseases, 7, 742–744.
Nasir, A., Kim, K. M., & Caetano-Anolles, G. (2017). Long-term evolution of viruses:
A Janus-faced balance. BioEssays, 39, 1700026.
Nickbakhsh, S., Ho, A., Marques, D. F., McMenamin, J., Gunson, R. N., & Murcia, P. R.
(2020). Epidemiology of seasonal coronaviruses: Establishing the context for the
emergence of coronavirus disease 2019. Journal of Infectious Diseases, 222, 17–25.
Nora, T., Charpentier, C., Tenaillon, O., Hoede, C., Clavel, F., & Hance, A. J. (2007).
Contribution of recombination to the evolution of human immunodeficiency viruses
expressing resistance to antiretroviral treatment. Journal of Virology, 81(14), 7620–7628.
Paccaud, M. (1979). World trends in poliomyelitis morbidity and mortality, 1951-1975. World
Health Statistics Quarterly, 32, 198–224.
Pan, K., & Deem, M. W. (2011). Quantifying selection and diversity in viruses by entropy
methods, with application to the haemagglutinin of H3N2 influenza. Journal of the Royal
Society Interface, 8, 1644–1653.
Peng, G., Xu, L., Lin, Y. L., Chen, L., Pasquarella, J. R., Holmes, K. V., et al. (2012). Crystal
structure of bovine coronavirus spike protein lectin domain. Journal of Biological Chem-
istry, 287, 41931–41938.
Phan, T. (2020). Genetic diversity and evolution of SARS-CoV-2. Infection, Genetics and
Evolution, 81, 104260.
Poirier, C., Luo, W., Majumder, M. S., Liu, D., Mandl, K. D., Mooring, T. A., et al. (2020). The
role of environmental factors on transmission rates of the COVID-19 outbreak: An initial
assessment in two spatial scales. Scientific Reports, 10(1), 1–11.
Poole, L. (2020). Seasonal influences on the spread of SARS-CoV-2 (COVID19), causality,
and forecastabililty (3-15-2020). SSRN Electronic Journal. https://doi.org/10.2139/ssrn.
3554746.
Posada, D., Crandall, K. A., & Holmes, E. C. (2002). Recombination in evolutionary geno-
mics. Annual Review of Genetics, 36(1), 75–97.
Rahimi, N. (2021). C-type Lectin CD209L/L-SIGN and CD209/DC-SIGN: Cell adhesion
molecules turned to pathogen recognition receptors. Biology, 10, 1.
Rahman, M. S., Islam, M. R., Rubayet Ul Alam, A. S. M., Islam, I., Hoque, M. N., Akter, S.,
et al. (2021). Evolutionary dynamics of SARS-CoV-2 nucleocapsid protein and its conse-
quences. Journal of Medical Virology, 93(4), 2177–2195.
Rath, S. L., & Kumar, K. (2020). Investigation of the effect of temperature on the structure of
SARS-CoV-2 Spike protein by molecular dynamics simulations. Frontiers in Molecular
Biosciences, 7, 583523.
Rhodes, T., Wargo, H., & Hu, W.-S. (2003). High rates of human immunodeficiency virus type
1 recombination: Near-random segregation of markers one kilobase apart in one round of
viral replication. Journal of Virology, 77(20), 11193–11200.
Ricci, C. A., Kamal, A. H. M., Chakrabarty, J. K., Fuess, L. E., Mann, W. T., Jinks, L. R., et al.
(2019). Proteomic investigation of a diseased Gorgonian coral indicates disruption of
essential cell function and investment in inflammatory and other immune processes. Inte-
grative and Comparative Biology, 59(4), 830–844.
Rodgers, J. L., & Nicewander, W. A. (1988). Thirteen ways to look at the correlation coeffi-
cient. The American Statistician, 43(1), 59–66.
Rohani, P., Earn, D. J., & Grenfell, B. T. (1999). Opposite patterns of synchrony in sympatric
disease metapopulations. Science, 286(5441), 968–971.
Sailani, M. R., Metwally, A. A., Zhou, W., Rose, S. M. S.-F., Ahadi, S., Contrepois, K., et al.
(2020). Deep longitudinal multiomics profiling reveals two biological seasonal patterns in
California. Nature Communications, 11, 4933.
Sajadi, M. M., Habibzadeh, P., Vintzileos, A., Shokouhi, S., Miralles-Wilhelm, F., &
Amoroso, A. (2020). Temperature, humidity, and latitude analysis to estimate potential
spread and seasonality of coronavirus disease 2019 (COVID-19). JAMA Network Open,
3, e2011834.
Sanjuán, R., & Domingo-Calap, P. (2016). Mechanisms of viral mutation. Cellular and Mo-
lecular Life Sciences, 73(23), 4433–4448.
Sanjuán, R., Moya, A., & Elena, S. F. (2004). The distribution of fitness effects caused by
single-nucleotide substitutions in an RNA virus. Proceedings of the National Academy
of Sciences of the United States of America, 101(22), 8396–8401.
Saputri, D. S., Li, S., van Eerden, F. J., Rozewicki, J., Xu, Z., Ismanto, H. S., et al. (2020).
Flexible, functional, and familiar: Characteristics of SARS-CoV-2 spike protein evolution.
Frontiers in Microbiology, 11, 2112.
Sato, S., St-Pierre, C., Bhaumik, P., & Nieminen, J. (2009). Galectins in innate immunity: Dual
functions of host soluble β-galactosidase-binding lectins as damage-associated molecular
patterns (DAMPs) and as receptors for pathogen-associated molecular patterns (PAMPs).
Immunological Reviews, 230, 172–187.
Schober, A. F., Rzhetsky, A., & Rust, M. J. (2021). Seasonal disease in the United States has
the hallmarks of an entrained circannual clock. medRxiv. https://doi.org/10.1101/2021.05.
26.21257655.
Seronello, S., Montanez, J., Presleigh, K., Barlow, M., Park, S. B., & Choi, J. (2011). Ethanol
and reactive species increase basal sequence heterogeneity of hepatitis C virus and produce
variants with reduced susceptibility to antivirals. PLoS One, 6(11), e27436.
Seyer, A., & Sanlidag, T. (2020). Solar ultraviolet radiation sensitivity of SARS-CoV-2. The
Lancet Microbe, 1(1), e8–e9.
Shaman, J., Pitzer, V. E., Viboud, C., Grenfell, B. T., & Lipsitch, M. (2010). Absolute humid-
ity and the seasonal onset of influenza in the continental United States. PLoS Biology, 8(2),
e1000316.
Sheftel, H., Shoval, O., Mayo, A., & Alon, U. (2013). The geometry of the Pareto front in
biological phenotype space. Ecology and Evolution, 3, 1471–1483.
References 77
Showers, W. M., Leach, S. M., Kechris, K., & Strong, M. (2021). Analysis of SARS-CoV-2
mutations over time reveals increasing prevalence of variants in the spike protein and
RNA-dependent RNA polymerase. bioRxiv. https://doi.org/10.1101/2021.03.05.433666.
Singh, J., Pandit, P., McArthur, A. G., Banerjee, A., & Mossman, K. (2021). Evolutionary tra-
jectory of SARS -CoV-2 and emerging variants. Virology Journal, 18, 166.
Smit, A. J., Fitchett, J. M., Engelbrecht, F. A., Scholes, R. J., Dzhivhuho, G., & Sweijd, N. A.
(2020). Winter is coming: A southern hemisphere perspective of the environmental drivers
of SARS-CoV-2 and the potential seasonality of COVID-19. International Journal of
Environmental Research and Public Health, 17(16), 5634.
Smith, E. C., & Denison, M. R. (2013). Coronaviruses as DNA wannabes: A new model for the
regulation of RNA virus replication fidelity. PLoS Pathogens, 9, e1003760.
Soh, W. T., Liu, Y., Nakayama, E. E., Ono, C., Torii, S., Nakagami, H., et al. (2021).
The N-terminal domain of spike glycoprotein mediates SARS-CoV-2 infection by
associating with L-SIGN and DC-SIGN. bioRxiv. https://doi.org/10.1101/2020.11.05.
369264.
Soper, H. E. (1929). The interpretation of periodicity in disease prevalence. Journal of the
Royal Statistical Society, 92(1), 34–73.
Soper, F. L. (1967). Dynamics of Aedes aegyptii distribution and density. Bulletin of the World
Health Organization, 36, 536–538.
Starr, T. N., Greaney, A. J., Hilton, S. K., Ellis, D., Crawford, K. H. D., Dingens, A. S., et al.
(2020). Deep mutational scanning of SARS-CoV-2 receptor binding domain reveals
constraints on folding and ACE2 binding. Cell, 5, 1295–1310.
Sugihara, G., Grenfell, B., & May, R. M. (1990). Distinguishing error from chaos in ecological
time series. Philosophical Transactions of the Royal Society, London B, 330(1257),
235–251.
Sugihara, G., Nay, R., Ye, H., Hsieh, C.-H., Deyle, E., Fogarty, M., et al. (2012). Detecting
causality in complex ecosystems. Science, 338(6106), 496–500.
Tamerius, J., Nelson, M. I., Zhou, S. Z., Viboud, C., Miller, M. A., & Alonso, W. J. (2011).
Global influenza seasonality: Reconciling patterns across temperate and tropical regions.
Environmental Health Perspectives, 119, 439–445.
Tasakis, R. N., Samaras, G., Jamison, A., Lee, M., Paulus, A., Whitehouse, G., et al. (2021).
SARS-CoV-2 variant evolution in the United States: High accumulation of viral mutations
over time likely through serial founder events and mutation bursts. PLoS One, 16(7),
e0255169.
Thepaut, M., Luczkowiak, J., Vivès, C., Labiod, N., Bally, I., Lasala, F., et al. (2021).
DC/L-SIGN recognition of spike glycoprotein promotes SARS- CoV-2 trans-
infection and can be inhibited by a glycomimetic antagonist. PLoS Pathogens, 17(5),
e1009576.
Tomaszewski, T., DeVriers, R. S., Dong, M., Bhatia, G., Norsworthy, M. D., Zheng, X., et al.
(2020). New pathways of mutational change in SARS-CoV-2 proteomes involve regions
of intrinsic disorder important for virus replication and release. Evolutionary Bioinformat-
ics, 16, 1176934320965149.
Tosepu, R., Gunawan, J., Effendy, D. S., Ahmad, L. O. I. E., Lestari, H., Bahar, H., et al.
(2020). Correlation between weather and Covid-19 pandemic in Jakarta, Indonesia.
Science of the Total Environment, 725, 138436.
Troyano-Hernáez, P., Reinosa, R., & Holguı́n, Á. (2021). Evolution of SARS-CoV-2 enve-
lope, membrane, nucleocapsid, and spike structural proteins from the beginning of the pan-
demic to September 2020: A global and regional approach by epidemiological week.
Viruses, 13, 243.
van Doremalen, N., Bushmaker, T., Morris, D. H., Holbrook, M. G., Gamble, A.,
Williamson, B. N., et al. (2020). Aerosol and surface stability of SARS- CoV-2 as com-
pared with SARS-CoV-1. New England Journal of Medicine, 382, 1564–1567.
Vidal-Dupiol, J., Dheilly, N. M., Rondon, R., Grunau, C., Cosseau, C., Smith, K. M., et al.
(2014). Thermal stress triggers broad Pocillopora damicornis transcriptomic remodeling,
while Vibrio coralliilyticus infection induces a more targeted immuno-suppression
response. PLoS One, 9, e107672.
Vijaykrishna, D., Mujerki, R., & Smith, G. J. D. (2015). RNA virus reassortment: An evolu-
tionary mechanism for host jumps and immune evasion. PLoS Pathogens, 11(7),
e1004902.
Wang, C., Horby, P. W., Hayden, F. G., & Gao, G. F. (2020). A novel coronavirus outbreak of
global health concern. The Lancet, 395, 470–473.
Wang, M., Jiang, A., Gong, L., Lu, L., Guo, W., Li, C., et al. (2020). Temperature significant
change COVID-19 transmission in 429 cities. medRxiv. https://doi.org/10.1101/2020.02.
22.20025791.
Weber, T. P., & Stilianakis, N. I. (2008). Inactivation of influenza A viruses in the environment
and modes of transmission: A critical review. Journal of Infection, 57, 361–373.
Wessa, P. (2021). Free statistics software (v1.2.1), Office for Research Development and
Education. http://www.wessa.net.
Woo, J., Lee, E. Y., Lee, M., Kim, T., & Cho, Y.-E. (2019). An in vivo cell-based assay for
investigating the specific interaction between the SARS-CoV N-protein and its viral RNA
packaging sequence. Biochemistry and Biophysics Research Communications, 520,
499–506.
Wu, Y., Jing, W., Liu, J., Ma, Q., Yuan, J., Wang, Y., et al. (2020). Effects of temperature and
humidity on the daily new cases and new deaths of COVID-19 in 166 countries. Science of
the Total Environment, 729, 139051.
Wu, F., Zhao, S., Yu, B., Chen, Y. M., Wang, W., Song, Z. G., et al. (2020). A new coronavirus
associated with human respiratory disease in China. Nature, 579, 265–269.
Wu, Y., Zhou, Z., Wang, J., Luo, J., Wang, L., & Zhang, Y. (2019). Temperature regulates
the recognition activities of galectin to pathogen and symbiont in the sclerotinian coral
Pocillopora damicornis. Developmental and Comparative Immunology, 96, 103–110.
Wyse, C., O’Malley, G., Coogan, A., McConkey, S., & Smith, D. (2021). Seasonal and day-
time variation in multiple immune parameters in humans: Evidence from 329,261 partic-
ipants of the UK Biobank cohort. iScience, 24, 102255.
Xu, C., Wang, Y., Liu, C., Zhang, C., Han, W., Hong, X., et al. (2021). Conformational
dynamics of SARS-CoV-2 trimeric spike glycoprotein in complex with receptor ACE2
revealed by cryo-EM. Science Advances, 7(1), eabe5575.
Yafremava, L. S., Wielgos, M., Thomas, S., Nasir, A., Wang, M., Mittenthal, J. E., et al.
(2013). A general framework of persistence strategies for biological systems helps explain
domains of life. Frontiers in Genetics, 4, 16.
Yang, H.-Y., & Lee, J. K. W. (2021). The impact of temperature on the risk of COVID-19:
A multinational study. International Journal of Environmental Research and Public
Health, 18, 4052.
Ye, Q., West, A. M., Silletti, S., & Corbett, K. D. (2020). Architecture and self-assembly of the
SARS-CoV-2 nucleocapsid protein. Protein Science, 29(9), 1890–1901.
Zeger, S. L., Irizarry, R., & Peng, R. D. (2006). On time series analysis of public health and
biomedical data. Annual Reviews of Public Health, 27, 57–79.
Glossary 79
Zhou, L., Yang, H., Kuang, Y., Li, T., Xu, J., Li, S., et al. (2019). Temporal patterns of influ-
enza A subtypes and B lineages across age in a subtropical city, during pre-pandemic, pan-
demic, and postpandemic seasons. BMC Infectious Diseases, 19, 89.
Further reading
Callaway, E. (2020). The coronavirus is mutating-does it matter? Nature, 585(7824), 174–177.
Johannes, L., Jacob, R., & Leffler, H. (2019). Galectins at a glance. Journal of Cell Science,
131(9), jcs208884.
Li, F. (2016). Structure, function, and evolution of coronavirus spike proteins. Annual Review
of Virology, 3, 237–261.
Modenutti, C. P., Capurro, J. I. B., Di Lella, S., & Martı́, M. A. (2019). The structural biology
of galectin-ligand recognition: Current advances in modeling tools, protein engineering,
and inhibitor design. Frontiers in Chemistry, 7, 823.
Glossary
Amino acid variant A mutant protein with an amino acid replaced by another in a particular
site of its polypeptide sequence.
Baltimore classification of viruses A classification system of viruses that groups viruses
according to seven types of pathways used for mRNA synthesis: Group I: double-stranded
DNA viruses (dsDNA); Group II: single-stranded DNA viruses (ssDNA);Group III:
double-stranded RNA viruses (dsRNA); Group IV: positive sense single-stranded RNA
viruses (plus-ssRNA); Group V: negative sense single-stranded RNA viruses (minus-
ssRNA); Group VI: single-stranded reverse transcribing RNA viruses with a DNA inter-
mediate (ssRNA-RT); and Group VII: double-stranded reverse transcribing DNA viruses
with an RNA intermediate (dsRNA-RT).
Clade A group of taxa with a common evolutionary origin.
Coronavirus spike protein The spike (S) protein is the largest structural protein of corona-
viruses. The S-protein assemble into trimers to form spike structures that project outward
from the surface of the virion and give the typical ‘solar corona’ appearance of the virion
under negative stained transmission electron microscopy. The highly glycosylated
1200–1400 amino acid long protein is typically composed of two regions known as the
S1 and S2 subunits. The N-terminal S1 subunit interacts with receptor molecules on
the surface of cells and contains an N-terminal domain (NTD) and a C-terminal domain
(CTD). While both domains can interact with receptors, the CTD of the SARS-CoV-2
virus is known as the receptor-binding domain (RBD). The C-terminal S2 subunit embeds
the spike in the viral envelope and mediates viral entry by fusion of viral and host cell
membranes. It holds a ‘fusion’ region with hydrophobic fusion peptide (FP) and internal
fusion peptide (IFP) sequences, a ‘fusion core’ region composed of two heptad repeat (HR)
sequences that undergo major fusion-triggered conformational changes, and a C-terminal
transmembrane (TM) domain that acts as anchor.
Economy The budget of a system in terms of matter-energy costs to maintain its functioning
mechanisms.
Epidemic calendar A calendar of seasonality of viral and bacterial diseases.
Flexibility The structural and functional mechanisms responding to ‘internal’ and ‘external’
changes imposed on the system; these mechanisms require processing of information and
delimit the potential of the system to adapt to environmental change.
Galectins A class of proteins known to bind specifically to β-galactoside sugars with broad
specificity and harbour a disulphide bond-dependency for carbohydrate binding and
stability, making them S-type lectins.
Human coronaviruses (HCoVs) A group of coronaviruses that can cause infections of the
respiratory system and mild-to-severe illnesses, including common cold, pneumonia, se-
vere acute respiratory syndrome, kidney failure and even death.
Immune escape The ability of a virus to evade innate or adaptive immunity mechanisms.
Morphospace Spaces describing worlds of phenotypes, including observable molecular, cel-
lular, and organismal characteristics resulting from the interaction of genotypes with the
environment.
Persistence Maintenance of identity through time, including the continuance of a feature or
lineage of an organism or virus.
Phylogenetic tree A specific hypothesis of history (a phylogeny) in the form of a network
without reticulations.
Phylogeny A hypothesis of history and genealogical relationship among a group of entities
(taxa) in the form of a tree or network with specific connotations of ancestry and an implied
time axis.
Protein Intrinsic Disorder (PID) The lack or fixed or ordered three-dimensional molecular
structure that endows a molecule with flexibility, typically in the absence of macromolec-
ular interacting partners. PID can be a property of the entire protein in intrinsically disor-
dered proteins (IDPs) or of particular regions within protein domains or in linker or
terminal sequences. PID can be predicted with high confidence at per-residue level directly
from amino acid sequence with a number of algorithmic implementations, such as the
IUPred energy-based prediction method.
Robustness The mechanisms that use information to passively maintain structure and func-
tion despite external influence; these mechanisms protect the system from malfunction by
resisting damage and change.
Root-mean-square deviation (RMSD) When referring to atomic positions, RMSD measures
the average distance (in Å) between the atoms of superimposed proteins. Typically,
RMSDs of the Cα atomic coordinates of the protein backbone are used to measure simi-
larities of three-dimensional structures after optimal rigid body superposition. RMSD is
used as quantitatively measure of structural similarity between one or more proteins, with
lower values implying better structural match.
SARS-CoVs Strains of coronaviruses that cause severe acute respiratory syndrome (SARS), a
respiratory illness that materialized in two major outbreaks, the 2002–2004 SARS-CoV-1
outbreak and the ongoing 2019 SARS-CoV-2 pandemic outbreak.
Seasonal driver Causative agent of the seasonal behaviour of infectious diseases.
Seasonal forcing Seasonal variations in the onset and spread of infectious diseases.
Spike protein A round, flattened or button-shaped glycoprotein (previously known as a peplo-
mer protein; from Greek, peplos ‘robe’, meros ‘part’) that projects outward from the lipid
bilayer of the surface of an enveloped virus. Spike proteins play important roles, including
attachment of the virion to receptor sites on cell surfaces, mediating release of the nucle-
ocapsid with its genetic material, and harbouring hemagglutinating or enzymatic activities.
Glossary 81
Variant of concern (VOC) A variant of a virus exhibiting a set of mutations (amino acid var-
iants) that increase virus transmissibility, morbidity, mortality, risk, immune escape, diag-
nostic test evasion, or other criteria of significance.
Viral quasispecies A dynamical virus collective that is structured at a population level by
exhibiting a large number of variants that arise continually via mutation and are subjected
to natural selection.
Virion The infective submicroscopic particle form of a virus, complete with a capsid protein
coat structure encasing an infectious nucleic acid.
Virocell A cell with physiologies transformed by viral infection geared towards production of
virions rather than cellular multiplication.
Z-score In bioinformatics, the Z-score is simply the comparison of an actual alignment score
with the scores obtained on a set of random sequences by a Monte-Carlo process. In the
case of DALI, the Z-score is an optimized similarity score defined as the sum of equivalent
Cα-Cα atomic distances among two proteins. The maximum of the total score defines a
common structural core where every atom in the alignment makes a net positive contri-
bution. Scores are rescaled according to length because large structural alignments get
higher scores than smaller alignments. Significant similarities have Z-scores > 2, which
usually correspond to similar folds.
CHAPTER
Current molecular
diagnostics assays for
SARS-CoV-2 and
emerging variants
3
Jonathan M. Banksa, Kristelle Capistranoa, Pari Thakkara, Hemangi Ranadeb,
Vaidik Sonia, Manali Dattab, and Afsar R. Naqvia,*
a
Department of Periodontics, College of Dentistry, University of Illinois Chicago, Chicago, IL,
United States
b
Amity Institute of Biotechnology, Amity University Rajasthan, Jaipur, Rajasthan, India
Abbreviations
SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
WHO World Health Organization
VOC variant of concern
B.1.1.7 SARS-CoV-2 alpha variant
B.1.351 SARS-CoV-2 beta variant
P.1 SARS-CoV-2 gamma variant
B.1.617.2 SARS-CoV-2 delta variant
E protein envelope protein
S protein spike protein
M protein membrane protein
N protein nucleocapsid protein
RBD receptor-binding domain
ACE2 angiotensin-converting enzyme 2
NTD N-terminal domain
RT-PCR real-time reverse transcription polymerase chain reaction
cDNA complementary DNA
USFDA United States Food & Drug Administration
EUA emergency use authorization
CDC United States Centers for Disease Control and Prevention
LOD limit of detection
SGTF spike-gene target failure
LFIA lateral flow immunoassay

83
84 CHAPTER 3 Diagnostics for SARS-CoV-2 and emerging variants
ELISA enzyme-linked immunosorbent assay

CLIA chemiluminescent immunoassay
ECLIA electrochemiluminescence immunoassay
ECL electrochemiluminescence
CV2T dimension EXL SARS-CoV-2 total antibody assay
CRISPR clustered regularly interspaced short palindromic repeats
crRNA CRISPR-RNA
dsDNA double-stranded DNA
ssDNA single-stranded DNA
SHERLOCK specific high-sensitivity enzymatic reporter unlocking
DETECTR SARS-CoV-2 DNA endonuclease-targeted CRISPR Trans reporter
RT-LAMP loop-mediated amplification
qRT-PCR real-time quantitative reverse transcription polymerase chain reaction
SPR surface plasmon resonance
BAL bronchoalveolar lavage
IVD in vitro diagnostic
NAAT nucleic acid amplification test
UTR untranslated region
1 Introduction
In December 2019, the Severe Acute Respiratory Syndrome Coronavirus 2, better
known as SARS-CoV-2, underwent zoonotic transmission to infect a human and
cause a viral outbreak (Peñarrubia et al., 2020). On March 11, 2020, the World
Health Organization (WHO) declared COVID-19 a pandemic (van Dorp et al.,
2020). SARS-CoV-2 is genetically similar to a few other beta coronaviruses that in-
fect animals, including bats (RaTG13) and pangolins (Salian et al., 2021). Believed
to have originated due to mutation, SARS-CoV-2 spread from human to human and
continued mutating as it rapidly divided in each host (van Dorp et al., 2020). With the
world unable to contain SARS-CoV-2 or the surfacing mutants, the COVID-19 out-
break escalated to an epidemic and ultimately a pandemic, with high infection and
death rates globally (Salian et al., 2021).
On November 12, 2021, the World Health Organization COVID-19 Dashboard
reported 251,788,329 confirmed cases of COVID-19 as well as 5,077,907 deaths
from the disease (WHO COVID-19 Dashboard, 2020). The virus spreads through
air droplets, resulting in unique transmission patterns (Datta, Singh, & Naqvi,
2021). Countries worldwide experienced wave after wave of new cases, often fol-
lowed by a chaotic spike in deaths (Dyer, 2021). To manage and prevent new
COVID-19 waves, researchers must continue to study SARS-CoV-2 and develop
COVID-19 diagnostic methods to contain the viral spread (Vandenberg, Martiny,
Rochas, van Belkum, & Kozlakidis, 2020).
SARS-CoV-2 possesses a spherical shape of approximately 150 nm, and its
genome is 30 kb long single-stranded RNA (Datta et al., 2021). The viral genome
was sequenced in its entirety and shared with the NCBI Genbank on January 5, 2020.
2 SARS-CoV-2 variants of concern 85
In the following months, scientists identified thousands of additional sequences in

countries around the world (Sallam & Mahafzah, 2021; van Dorp et al., 2020).
Since the onset of the pandemic, diagnostic assays have served as valuable tools
in the fight against COVID-19. Many were developed as the first wave of viral cases
surfaced. Most diagnostic assays helped detect viral infection in human samples or
identify particular strains of SARS-CoV-2 through individual or community testing
(Vandenberg et al., 2020). The need for both individual and community testing is
clear: to monitor viral infection and prevent the spread of disease by isolating
infected individuals. Further, identifying different viral mutants is necessary to mon-
itor emerging dominant variants throughout the world and develop policies to coun-
ter their spread (Sallam & Mahafzah, 2021; Vandenberg et al., 2020). With that
understanding, researchers continue to investigate key variants to better understand
their differences in transmission and disease manifestation.
In a pandemic that has resulted in mask mandates, physical distancing, and ram-
pant death and disease, diagnostic assays are a necessary component of global recov-
ery efforts. To enter a post-pandemic world, the spread of COVID-19 must be
sustainably contained. The end of the pandemic is only possible with the information
that diagnostic assays provide. For people to return to their jobs, families, and lives
safely, without the threat of undetected variants and uncontrollable infections, the
development of effective and accessible diagnostics must be a worldwide priority.
With an ever-changing viral genome, diagnostic assays must continue to develop
to keep up with new variants. Presently, diagnostics are used to identify viral infec-
tions in individuals and extrapolate viral prevalence information in broader popula-
tions with a more epidemiological approach (Uddin et al., 2020). Diagnostic assays
have been used to survey sewage contents for viral prevalence, revealing trends in
viral load throughout communities (Martin et al., 2020). These diagnostic strategies,
coupled with individual testing and variant detection, provides a robust framework
for the global diagnostic arsenal needed to combat the viral spread.
Regarding individual testing techniques, there are many. They range in specific-
ity, sensitivity, and accuracy, and they each have their benefits and drawbacks. In this
chapter, we focus on the following diagnostic methods: real-time polymerase chain
reaction, serology, CRISPR, and electronic biosensors. We will discuss the strengths
and limitations of viral detection techniques, and their role in diagnosing SARS-
CoV-2 variants.
2 SARS-CoV-2 variants of concern

The rapid spread of SARS-CoV-2 around the globe and its consequential high viral
replication rates have increased the chance of mutation events. As a result, numerous
genetic variants have emerged since the discovery of the original strain (Wuhan-Hu-1)
in December 2019 (Shahhosseini, Babuadze, Wong, & Kobinger, 2021). As of
October 2021, there were four COVID-19 strains classified as “variants of concern”
(VOCs): (1) B.1.1.7 (Alpha) (2) B.1.351 (Beta) (3) P.1 (Gamma) and (4) B.1.617.2
(Delta) (Table 1). These variants display key mutations, which mounting evidence
Table 1 Notable variations of the variants of concern (VOCs). Important
mutations are notated in bold.
Variant Mutation Gene
B.1.1.7 (Alpha) TI001I ORF1a/b

A1708D
I2230T
SGF 3675–3677 del
L18F (some isolates) S
HV 69–70
Y144 del
E484K
N501Y
A570D
D614G
P681H
T716I
S982A
D1118H
Q27 stop ORF8a/b
R52I
Y73C
D3L N
S235F
B.1.351 (Beta) K1655N ORF1a/b
SGF 3675–3677 del
L18F (some isolates) S
D80A
D215G
241–243 del
R246I
K417N
E484K (some isolates)
N501Y
D614G
A701V
P71L E
T205I N
P.1 (Gamma) S1188L ORF1a/b
K1795Q
SGF 3675–3677 del
E5665D
L18F S
T20N
P26S
R190S
K417T
E484K
N501Y
D614G
H655Y
T1027I
E92K ORF8a/b
P80R N
2 SARS-CoV-2 variants of concern 87
Table 1 Notable variations of the variants of concern (VOCs). Important

mutations are notated in bold.—cont’d
Variant Mutation Gene
B.1.617.2 (Delta) P323L ORF1a/b
G671S
P77L
T19R S
157–158 del
L452R
T478K
D614G
P681R
D950N
S26L ORF3a
I82T M
V82A ORF7a
T120I
119–120 del ORF8a/b
R203M N
377Y
has shown to confer one or more of the following viral attributes: increased transmis-
sibility, increased disease severity, decreased neutralizing antibody response acquired
through natural infection or vaccination, decreased treatment/vaccine efficacy, and
diagnostic detection failures.
Although mutations have accumulated throughout SARS-CoV-2 genes encoding
the ORF1ab, ORF3, ORF8, and N (nucleocapsid) proteins, mutations in the S (spike)-
protein are particularly significant. The S-protein is a type I transmembrane protein
that initially exists as an inactive precursor. During the early stages of infection,
SARS-CoV-2 uses its S-protein’s receptor-binding domain (RBD) to engage the
angiotensin-converting enzyme 2 (ACE2) host receptor, which is primarily expressed
in lung and intestinal cells. Following the RBD-ACE2 binding, proteolysis occurs at
the S1/S2 junction by furin or other proteases (i.e. TMPRSS2 or cathepsin proteases),
exposing a second cleavage site within the S2, subsequently liberating the S2 fusion
peptide to initiate the viral-host membrane fusion and leading to S1 shedding (Peacock
et al., 2021). Specific mutations such as D614G result in less S1 shedding and
increased incorporation of the S protein into the virion, thereby enhancing viral
infectivity.
Because the S-protein plays a crucial role in viral invasion and host cell attach-
ment, it is a major target for antibody therapy, specifically neutralizing antibodies
that target SARS-CoV-2. Within the S protein, the RBD and the NTD (N-terminal
domain) are primary targets. NTD-targeting and RBD-targeting antibodies form
complexes with the NTD and RBD, respectively, preventing viral entry and host
cell-virus membrane fusion. However, some variants such as B.1.351 (Beta) and
P.1 (Gamma) have developed mutations that prevent or weaken the binding of
particular antibodies to the S-protein (Yang & Du, 2021). This section highlights
changes in the viral genome, spread, and detection of each VOC.
2.1 B.1.1.7 (Alpha) variant

In September 202, the two earliest documented genomic samples of lineage B.1.1.7
(also known as Alpha variant, 20I/501YV1, or VOC 2020 12/01) were collected in
Kent and Greater London. The variant became notable for its unusually large number
of genomic changes, accruing 14 lineage-specific amino acid substitutions before its
detection, and it quickly became predominant worldwide (Morris et al., 2021). By
February 2021, 90 countries/territories reported cases of B.1.1.7 (Alpha)
(Shahhosseini et al., 2021).
In total, the B.1.1.7 (Alpha) variant has 23 mutations (17 amino acid changes)
from the Wuhan-Hu-1 strain (Fig. 1) (Abdool Karim & de Oliveira, 2021). Notable
mutations of B.1.1.7 (Alpha) include the spike D614G mutation, spike N501Y mu-
tation, spike HV 69–70 deletion, and other mutations that are not addressed in this
text. B.1.1.7 (Alpha) features a significant number of non-synonymous amino acid
substitutions, which multiple sources implicate for its increased transmissibility and
infectivity; experts estimate that B.1.1.7 (Alpha) is up to 70% more transmissible
than the Wuhan-Hu-1 strain (Cheng et al., 2021; Jackson, Zhang, Farzan, &
Choe, 2021; Meng et al., 2021). Additionally, B.1.1.7 (Alpha) appears to be resistant
to neutralization by most NTD-directed and a few RBD-directed monoclonal anti-
bodies (but not convalescent plasma or vaccine sera) due to the N501Y mutation
(Wang et al., 2021).
2.2 B.1.351 (Beta) variant

In October 2020, the second wave of COVID-19 infections swarmed through Nelson
Mandela Bay in South Africa and spread through the Western Cape, Eastern Cape,
and KwaZulu-Natal provinces within weeks. At the peak of the second wave,
daily confirmed cases of COVID-19 in the area rose as high as >20% of PCR tests
at the local municipality level. Most of these cases were later attributed to a new
variant, B.1.351 (Beta). The B.1.351 (Beta) variant emerged independently of B.1.1.7
(Alpha), likely after the first wave of SARS-CoV-2 cases in the Eastern Cape province
(Tegally et al., 2021). B.1.351 (Beta) contains multiple mutations in the S-protein,
three of which are in the RBD (N501Y, E484K, and K417N) and alter the binding
affinity for ACE2 receptors (Fig. 1).
Like the B.1.1.7 (Alpha) variant, B.1.351 (Beta) also increases the risk of trans-
mission. To a greater degree compared to B.1.1.7 (Alpha), however, there are
multiple reports that the B.1.351 (Beta) reduces neutralization by monoclonal anti-
bodies (against the N-terminal and RBD domains), convalescent plasma (9.4-fold),
and post-vaccination sera (10.3- to 12.4-fold) compared to wild type SARS-CoV-2
(Wang et al., 2021). The increased transmissibility of B.1.351 (Beta) is likely due to
FIG. 1
SARS-CoV-2 genome and the notable mutations of the Variants of Concern (VOC). Crucial mutations notated in red (BioRender.com, 2021).
mutations D614G and N501Y, which also contributed to increased transmissibility in

the B.1.1.7 (Alpha) variant. In B.1.351 (Beta), the spike E484K and K417N muta-
tions also contribute to immune escape by enabling the evasion of antibody and
plasma neutralization (Greaney et al., 2021; Harvey et al., 2021; Laffeber, de
Koning, Kanaar, & Lebbink, 2021; Wang et al., 2021).
2.3 P.1 (Gamma) variant

The P.1 (Gamma) variant (alias of B.1.1.28.1) was first reported in January 2021
when four travellers arrived at a Japanese airport from Brazil. Molecular clock anal-
ysis shows that P.1 (Gamma) emerged around November 2020 and was responsible
for a resurgence of cases in Manaus, the capital of the Amazonas. In late December
2020, a reported 42% of specimens from Manaus tested positive for the P.1 (Gamma)
variant. The spike of cases was alarming because approximately 75% of Manaus
residents have previously tested positive for SARS-CoV-2 and were expected to
have a degree of immunity (Faria et al., 2021). Today, there are approximately
62 countries with the P.1 (Gamma) sequence. In total, P.1 (Gamma) has 17 mutations
(11 amino acid changes).
Although distinct, P.1 (Gamma) and B.1.351 (Beta) share several characteristics.
First, P.1 (Gamma) and B.1.351 (Beta) feature the same key spike mutations N501Y
and E484K in the RBD of the S-protein. While P.1 (Gamma) and B.1.351 (Beta) have
acquired K417T and K417N, respectively, both mutations are highly similar in effect
and are often grouped. Similar to B.1.351 (Beta), N501Y is likely responsible for P.1
(Gamma)’s increased binding to the ACE2 receptor and consequential increased
transmissibility. Moreover, E484K and K417T also reportedly result in a dampened
neutralizing humoral immunity response. Despite these similar RBD mutations,
Dejnirattisai et al. suggest that natural and vaccine-induced antibody neutralization
are significantly more effective against P.1 (Gamma) than B.1.351 (Beta); the mech-
anism behind this difference in antibody neutralization of P.1 (Gamma) and B.1.351
(Beta) is unclear. Nonetheless, the fact that P.1 (Gamma) and B.1.351 (Beta)
independently evolved similar RBD mutations indicates convergent evolution
(Dejnirattisai et al., 2021).
2.4 B.1.617.2 (Delta) variant

B.1.617.2 (Delta) is a subtype of the SARS-CoV-2 B.1.617 lineage, which
first emerged in October 2020 in India. Compared to the other B.1.617
subtypes, B.1.617.1 (Kappa) and B.1.617.3, B.1.617.2 (Delta) is considered the most
transmissible. As of August 2021, B.1.617.2 (Delta) spread to at least 124 countries
and serves as a significant cause of concern due to its increased transmissibility
relative to all other SARS-CoV-2 strains. Current estimates show that B.1.617.2
(Delta) is 60% more contagious than B.1.1.7 (Alpha). Interestingly, some data
indicate that the B.1.617.2 (Delta) variant results in a shorter incubation period than
the original strain (B.1.617.2 (Delta): mean of 4 days; Wuhan-Hu-1: mean of 6 days).
Moreover, the high viral load in people infected with the variant (up to 1260 times
3 COVID-19 diagnostics 91
higher than those infected with the original strain) further heightens the transmissi-
bility of B.1.617.2 (Delta) and could play a part in breakthrough infections (Li et al.,
2021; Reardon, 2021). Finally, one study found that B.1.617.2 (Delta) remains
infectious for longer (B.1.617.2 (Delta): 18 days; Wuhan-Hu-1: 13 days) (Ong
et al., 2021). Altogether, these data indicate that B.1.617.2 (Delta) replicates faster
and at higher rates compared to other mutants.
There are 12 mutations in the B.1.617.2 (Delta) genome, 10 of which are in the
S-protein: T19R, G142D (in some strains), 156del, 157del, R158G, L452R, T478K,
D614G, P681R, and D950N (Fig. 1). L452R and T478K both confer a significant
increase in immune evasion and infectivity to the B.1.617.2 (Delta) variant, and
they interfere with the host antibody response (monoclonal antibodies and sera from
convalescent and vaccinated individuals) by weakening the binding between anti-
bodies and the S-protein (Di Giacomo, Mercatelli, Rakhimov, & Giorgi, 2021;
Motozono et al., 2021; Planas et al., 2021). P681R is located in the S-protein
S1/S2 (furin) cleavage site, and it is another mutation that confers better transmis-
sibility (Cherian et al., 2021).
The VOCs share key mutations, mainly in the RBD and NBD-containing S1 sub-
unit. Consequently, a significant portion of these major spike mutations increases the
ACE2 binding affinity, altering viral pathogenicity and virulence. Not to mention,
specific mutations appear to have compensatory effects when combined. One exam-
ple is the K417N: N501Y combination seen in B.1.351 (Beta). K417N reportedly
reduces ACE2 binding affinity by disrupting the formation of two salt bridges in
the RBD-ACE2 complex. Despite K417N, B.1.351 (Beta) is still estimated to be
2.5 times more transmissible than Wuhan-Hu-1 due to the N501Y mutation
(Harvey et al., 2021).
The effect of these mutations on vaccine efficacy sensitivity is of great concern.
While SARS-CoV-2 vaccines mRNA-1273 (Moderna) and BNT162b2/Comirnaty
(Pfizer/BioNTech) reportedly elicit a robust antibody response against B.1.1.7
(Alpha) and P.1 (Gamma), the neutralization effect is significantly weaker against
B.1.351 (Beta). Data regarding the effect of B.1.617.2 (Delta) on the vaccines is
limited. However, early reports suggest that while protection against infection is
dampened, mRNA-1273 and BNT162b2 still vigorously protect against hospitaliza-
tion and death (Khateeb, Li, & Zhang, 2021).
3 COVID-19 diagnostics
A prevalent concern is the effect of mutations on diagnostic sensitivity. With the
background provided regarding the SARS-CoV-2 virus and its variants, the diagnos-
tic field is rapidly evolving. In this text, we discuss the various widely used diag-
nostic strategies that researchers developed to test for the virus and its effects on
the body (as manifested through antibody response). The sections below describe
four SARS-CoV-2 diagnostics approaches: RT-PCR, Serology, CRISPR and Bio-
sensor/electric/smart sensors (Fig. 2). Additionally, we discuss how diagnostic tech-
niques have been designed and redesigned for the detection of SARS-CoV-2.
FIG. 2
COVID-19 Diagnostic Techniques and their Targets (BioRender.com, 2021).
3.1 Real-time PCR diagnostics

Real-time reverse transcription polymerase chain reaction (RT-PCR) is a widely
known technique involving a series of chemical reactions with several significant
applications related to genetics. For decades, polymerase chain reactions have been
used to selectively amplify target genetic molecules, and PCR protocols have since
been adapted to utilize a multitude of sample types (Nolan, Hands, & Bustin, 2006).
The integration of a fluorescent indicator allowed for relative molecular quantities to
be observed and compared in real time (Heid, Stevens, Livak, & Williams, 1996;
Morley, 2014). Since then, RT-PCR methods have allowed researchers to quantify
and amplify expressed RNA (Green & Sambrook, 2018), study genetic expression on
the microscale in microdissected cells (Paweletz, Charboneau, & Liotta, 2001), and,
in conjunction with electrospray ionization mass spectrometry (ESI/MS), perform
viral assays and diagnose pathogens (Deyde, Sampath, & Gubareva, 2011; Wolk,
Kaleta, & Wysocki, 2012). As with other pathogen diagnostics, RT-PCR tests play
a significant role in providing public health experts and government officials with
valuable information regarding viral presence and spread (Farasani, 2021).
At its core, RT-PCR involves the following processes: RNA is reverse tran-
scribed into complementary DNA (cDNA), then the cDNA is replicated exponen-
tially with each experimental cycle, and finally the expression levels of the cDNA
are observed in real time by fluorescent indicators as a proxy, and the expression
levels are used to extrapolate information regarding the genetic expression and
activity within a sample (Nolan et al., 2006). These samples can come from a variety
of sources, as previously mentioned, and PCR tests can probe for the presence of
several known pathogens (Fig. 3).
3.1.1 RT-PCR and COVID-19 detection

With potential applications ranging from forensics to genomics and microbiology,
RT-PCR has also emerged as a valuable viral diagnostic assay, especially during
the COVID-19 pandemic (Bustin, Benes, Nolan, & Pfaffl, 2005). Perhaps the most
esteemed method of PCR diagnostics, and SARS-CoV-2 diagnostics at large,
involves the isolation and purification of nucleic acids before the PCR and reverse
transcription occurs. This method is praised for its accuracy, specificity, and
FIG. 3
RT-PCR Diagnostic Process. Schematic showing the description of obtaining a sample,
isolating RNA and RT-qPCR using instrument to detect viral genome (BioRender.com, 2021).
sensitivity, all of which make it a popular choice for diagnosing SARS-CoV-2 world-
wide (Fomsgaard & Rosenstierne, 2020). The accuracy of commercial RT-PCR tests
for COVID-19 were experimentally validated, and the tests were found to meet in-
ternational standards for accuracy (Wu, Xu, Zhu, & Xia, 2020). In addition to detect-
ing viral presence in samples, RT-PCR tests have yielded valuable information about
viral load and the infectivity of different COVID-19 variants (Korber et al., 2020).
Though they are not considered true rapid tests, in comparison to other methods used
for measuring RNA expression, PCR reactions are faster and safer, requiring fewer
dangerous materials for the tests (Farasani, 2021; Green & Sambrook, 2018).
There are several RT-PCR assays that governing bodies have approved for use in
testing for COVID-19. To rapidly respond to the developing COVID-19 pandemic,
the United States Food & Drug Administration (USFDA) issued Emergency Use
Authorizations (EUA) to quickly authorize the use of RT-PCR diagnostics. Accord-
ing to the USFDA, 210 RT-PCR diagnostic assays have been granted such approval
at the time of writing (https://www.fda.gov/medical-devices/coronavirus-disease-
2019-covid-19-emergency-use-authorizations-medical-devices/in-vitro-diagnos
tics-euas-molecular-diagnostic-tests-sars-cov-2). Two such tests were developed by
the United States Centers for Disease Control and Prevention (CDC), and the tests
fall into two separate categories of RT-PCR diagnostic assays: simplex and multiplex
assays (CDC, 2021). As detailed in Table 2, both tests target the nucleocapsid
(N) protein-coding gene in SARS-CoV-2. However, the multiplex assay also tests
for genes in the Influenza A and B viruses, allowing it to test for co-infection of
the viruses that manifest themselves similarly to COVID-19 (Shu et al., 2021).
Table 2 depicts their sensitivities as both >95%. The TaqPath COVID-19 Combo
Kit by Thermo Fisher tests for open reading frames 1a and 1b, the spike protein-
coding region, and the N protein-coding region of the SARS-CoV-2 genome
(www.thermofisher.com/us/en/home/clinical/clinical-genomics/pathogen-detection-
solutions/covid-19-sars-cov-2/multiplex.html; https://www.fda.gov/media/136112/
download). With a 100% detection rate at the limit of detection (LOD), this highly
sensitive test can detect various viral mutants because of its multi-site screening ca-
pabilities. Similarly, Labcorp’s COVID-19 RT-PCR Test is able to screen for mul-
tiple parts of the viral genome, resulting in a high sensitivity of >95% at the LOD
(https://www.fda.gov/media/136151/download). However, the invasive nature of
the nasal or bronchial swab required for these assays can cause subject discomfort.
Lastly, the most recent assay to be granted EUA approval at the time of writing
came out of the Yale School of Public Health, the SalivaDirect dualplex RT-PCR
assay. This assay yields comparable sensitivity of 94% agreement when compared
to the TaqPath assay, and its less invasive salivary sample requirement provides a
significant advantage without completely sacrificing sensitivity (https://ysph.yale.
edu/salivadirect/publications/; Vogels et al., 2021). These assays are described in
more detail in Table 2. Alternative RT-PCR techniques with fewer required reagents
were developed in response to a shortage in key RT-PCR reagents, and articles by
Fomsgaard and Rosenstierne (2020) and Smyrlaki et al. (2020) provide a more com-
prehensive description of these alternate approaches.
Table 2 RT-PCR diagnostic assays and their gene targets, sensitivities, limits of detection, and other key details.
Approval Sensitivity and limit of
Type of test, company, source and date Targets detection (LOD) Pros and cons
Influenza SARS-CoV-2 Multiplex Assay USFDA SARS-CoV-2 N gene, greater than 95% detection rate Pros: Tests
(Multiplex), CDC (CDC, 2021; https://www.fda. EUA, Influenza A Matrix (M1) gene, at LOD multiple viruses,
gov/medical-devices/coronavirus-disease-2019- 07/02/ Influenza B nonstructural 2 LOD ¼ Influenza A 102.0TCID50. high sensitivity
covid-19-emergency-use-authorizations- 2020 (NS2) gene Influenza B 10–0.1 EID50, and Cons: Limited to
medical-devices/in-vitro-diagnostics-euas- SARS-CoV-2 10–2.0 TCID50 genetic
molecular-diagnostic-tests-sars-cov-2; Shu et al., screening, time
2021) consuming
2019-nCoV RT-PCR Diagnostic Panel – QIAGEN USFDA SARS-CoV-2 N gene greater than 95% detection with Pros: High
EZ1 Advanced XL (Singleplex), CDC (CDC, 2021; EUA, LOD 100.5 RNA copies/μL sensitivity and
https://www.fda.gov/medical-devices/ 02/04/ accuracy
coronavirus-disease-2019- 2020 Cons: Tests only
covid-19-emergency-use-authorizations- one gene
medical-devices/in-vitro-diagnostics-euas-
molecular-diagnostic-tests-sars-cov-2)
TaqPath COVID-19 Combo Kit (Singleplex), USFDA SARS-CoV-2 ORF 1a, ORF 100% detection rate at LOD Pros: Tests
Thermo Fisher Scientific, (https://www.fda.gov/ EUA, 1b, S, and N genes LOD ¼ 10 Genomic Copy multiple genes,
medical-devices/coronavirus-disease-2019- 03/13/ Equivalents (GCE) per reaction, or differentiates
covid-19-emergency-use-authorizations- 2020 50 GCE/mL in 17.5 and 14.0 μL variants
medical-devices/in-vitro-diagnostics-euas- samples Cons: Tests for
molecular-diagnostic-tests-sars-cov-2; www. one virus, time
thermofisher.com/us/en/home/clinical/clinical- consuming
genomics/pathogen-detection-solutions/covid-
19-sars-cov-2/multiplex.html; https://www.fda.
gov/media/136112/download)
COVID-19 RT-PCR Test (Singleplex or Multiplex), USFDA SARS-CoV-2 nucleocapsid greater than 95% detection rate Pros: Targets
Laboratory Corporation of America (Labcorp) EUA, (N) gene at LOD multiple genes,
(https://www.fda.gov/medical-devices/ 03/16/ LOD ¼ 6.25 genome copies per versatile
coronavirus-disease-2019- 2020 microliter (cp/μL) for singleplex Cons: Only tests
covid-19-emergency-use-authorizations- and multiplex format one gene,
medical-devices/in-vitro-diagnostics-euas- invasive swab
molecular-diagnostic-tests-sars-cov-2; https://
www.fda.gov/media/136151/download)
SalivaDirect (Dualplex), Yale School of Public USFDA SARS-CoV-2 nucleocapsid 94% positive agreement when Pros: Efficient,
Health (https://www.fda.gov/medical-devices/ EUA, (N) gene compared to TaqPath COVID-19 noninvasive
coronavirus-disease-2019- 08/27/ combo kit, no LOD specified swab sample
covid-19-emergency-use-authorizations- 2021 Cons: Slightly
medical-devices/in-vitro-diagnostics-euas- lower sensitivity
molecular-diagnostic-tests-sars-cov-2; https://
ysph.yale.edu/salivadirect/publications/Vogels
et al., 2021)
3.1.2 RT-PCR and COVID-19 variants

Despite the many benefits of RT-PCR in diagnostics, the testing method is not with-
out its flaws, especially when it comes to the variants of COVID-19 and false neg-
ative test results. If a PCR test fails to detect a significant amount of viral RNA in a
sample, resulting in a negative test result, and another test later reveals a positive test
result for the virus, the original test is deemed a “false negative” (Arevalo-Rodriguez
et al., 2020). These inaccuracies in testing have significant consequences, allowing
unknowing individuals to potentially spread a virus while believing they are unin-
fected. A review article discovered a high propensity for false negative PCR results
in patients with COVID-19 symptoms, and authors advocated for multiple tests if a
patient is suspected of having a false negative (Arevalo-Rodriguez et al., 2020).
Even when multiple tests are administered, false negatives still impact PCR test-
ing results. A case study featured a 63-year old female with symptoms of COVID-19
who repeatedly tested negative for the virus via a nasopharyngeal swab (Shukha,
Makhoul, Abu-Elhija, Hayek, & Hamoud, 2021). Upon testing her for COVID-19
using a sample acquired during a bronchoscopy, the results came back positive
for COVID-19, and those results were followed by even more negative results from
the nasopharyngeal RT-PCR diagnostic. Thus, due to different viral manifestation
patterns, as evidenced by the RT-PCR test results, the standard nasopharyngeal swab
was an inaccurate testing diagnostic for the patient already displaying COVID-19
symptoms.
Differences in viral manifestation and behaviour are often attributed to viral mu-
tations, forming variants of COVID-19 with different genome sequence, transmissi-
bility and clinical manifestations. Some variants can evade RT-PCR detection
because of mutations in the target areas of RNA reverse transcription that prevent
gene amplification. Other variants feature mutants that cause conformational
changes in proteins that influence gene accessibility, rendering RT-PCR assays in-
effective. For example, the H69-V70 deletion of the B.1.1.7 (Alpha) variant impacts
the accuracy of diagnostic tests that target the S-gene, as is the case for the Thermo-
Fisher TaqPath real-time PCR diagnostic kit. Specifically, the mutation likely in-
duces a conformational change in the S protein, which interferes with the binding
of the primers of Taqpath and other similar PCR tests to the S-gene target, resulting
in “S-gene target failure” (SGTF) (Borges et al., 2021). SGTF is a phenomenon in
which RT-PCR testing fails to amplify and thereby detect the S gene in an otherwise
positive PCR test.
These challenges and others require innovative solutions to monitor the ever-
changing variants of COVID-19. In the case of variant-induced spike-gene target
failure, areas with high B.1.1.7 (Alpha) prevalence, such as England and Portugal,
have used SGTF as a proxy to monitor the geographical dispersion and frequency
of the variant (Borges et al., 2021). One study found a high correlation between
B.1.1.7 (Alpha) frequency and SGTF in community-based diagnostic PCR testing
in the UK, allowing the researchers to distinguish between VOC and non-VOC in-
cidence by region over time (Volz et al., 2021). Due to the multiple gene targets of
the ThermoFisher TaqPath assay, including ORF1 and N genes, the test remains a
functionally reliable detector of SARS-CoV-2 overall, as noted in Table 2. It is worth

noting that many commercially available SARS-CoV-2 diagnostic tests have multi-
ple genetic targets and do not use the S-gene as the primary target, including multi-
target RT-PCR tests in Table 2. Currently, there is no evidence of S-gene mutations
in other variants of concern and mutations in other genes affecting the accuracy of
diagnostic tests (Babb de Villiers, Blackburn, Cook, & Janus, 2021). All-in-all, di-
agnostic tests are expected to remain accurate despite further viral mutations.
Similar improvements in other diagnostic assays have led to continued effective-
ness in RT-PCR testing. In one study, RT-PCR tests that targeted multiple genetic
sites were able to maintain a high sensitivity level despite the mutations that would
typically decrease sensitivity in a RT-PCR test with only one target region
(Peñarrubia et al., 2020). A similar technique was used in England to monitor com-
munity viral presence through analysing sewage contents. By taking samples from
the sewers and testing them with multi-target RT-PCR diagnostics, researchers were
able to discover the presence and prevalence of different COVID-19 variants based
on the target gene amplification and the expression levels (Martin et al., 2020). The
results from this study verified the efficacy of lockdown measures in England, as the
community viral load decreased during the enforced physical distance, and the find-
ings also showcased the ability of RT-PCR diagnostics to test and influence health
guidelines on an environmental scale.
Though there remain limitations to its efficacy, the benefits of RT-PCR presently
outweigh the drawbacks as a diagnostic tool for COVID-19. It is used worldwide
because it provides a sensitive, low cost, and safe option for viral diagnostics
(Farasani, 2021). Additionally, despite the shortage of reagents involved in the
RNA isolation process, techniques like heat treatment and lysis buffers provide al-
ternatives that remain scalable, affordable, and safe (Fomsgaard & Rosenstierne,
2020; Smyrlaki et al., 2020). While variants have coincided with notable false neg-
ative results, developments in multi-target RT-PCR testing have produced high sen-
sitivity tests that can distinguish between different variants (Martin et al., 2020).
Although RT-PCR is not the rapid diagnostic tool, its effectiveness and timeliness
makes it a useful technique for diagnosing en masse.
3.2 Serology based COVID-19 diagnostics

Serologic (antibody) tests are blood tests that measure the extent to which an indi-
vidual has developed antibodies against different parts of a certain virus (https://
www.healthline.com/health/serology; https://publichealth.jhu.edu/2021/variants-
vaccines-and-what-they-mean-for-covid-19-testing). Antigens (e.g. bacteria, fungi,
viruses, parasites) are substances that cause an immune response in the host, and spe-
cific antibodies are produced by the immune system to defend against these antigens
(https://www.healthline.com/health/serology). Thus, the measurement of antibodies
will provide further insight on the host’s potential to fight viral infection and may
even provide some insight into the virus pathobiology (Datta et al., 2021). Addition-
ally, serology assays are more important in cases that do not allow for RNA isolation,
either due to difficulty or no longer being present at the target site, as well as for
epidemiological and post-vaccination monitoring studies (Zhang et al., 2020). Sero-
logical tests can also aid with autoimmune disorder diagnosis, in the case of the body
mistaking its own healthy tissues for foreign invaders thus resulting in unnecessary
antibody production.
There are several types of serological tests, including: rapid diagnostic tests,
enzyme-linked immunosorbent assays, chemiluminescent immunoassays, electro-
chemiluminescence immunoassays, lateral flow chromatographic immunoassays
and neutralization assays (Datta et al., 2021). Rapid serology diagnostic tests (e.g.
lateral flow immunoassay [LFIA]) are convenient to implement at point-of-care,
rapid and inexpensive, thus allowing for commercial kit production (Yamamoto
et al., 2021). However, there is still a considerable amount of uncertainty with accu-
racy of rapid serologic tests.
Enzyme-linked immunosorbent assays (ELISA) rely on antigen binding to anti-
bodies in a laboratory (https://www.healthline.com/health/elisa). Chemiluminescent
immunoassays (CLIA) are also laboratory-based and rely on enzyme labelled
antibodies and antigens (https://www.lornelabs.com/news-events/blog/what-is-
chemiluminescent-immunoassay). One advantage of this assay technique is that
its sensitivity levels are very high. Electrochemiluminescence immunoassays
(ECLIA) rely on quantifying antigen or antibody, based on the change in electro-
chemiluminescence (ECL) signal, both before and after immunoreaction. ECLIA
has increased sensitivity and can be more selective than other methods (Wu & Ju,
2012). Lateral flow chromatographic immunoassays rely on the collected specimen’s
IgM or IgG antibodies binding to labelled SARS-CoV-2 antigens to form a complex,
which will later be accounted for (https://www.fda.gov/media/144071/download).
Neutralization assays measure the levels of neutralizing antibodies from either recent
or prior infection, which help inform the reasoning behind existing antibodies (https://
www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-
authorizes-first-test-detects-neutralizing-antibodies-recent-or). Due to lower sensi-
tivity of serological tests compared to molecular methods, serology tests are primarily
used for retrospective diagnosis (Datta et al., 2021).
SARS-CoV-2 has four structural surface proteins: E, S, M and N proteins (enve-
lope, spike, membrane, and nucleocapsid, respectively) (Datta et al., 2021). Serology
tests against SARS-CoV-2 have been created by several companies and have been
given emergency-use approval (EUA) via the U.S. Food and Drug Administration
(FDA) (Zhang et al., 2020). Other countries that have also similarly approved sero-
logical tests include Germany, Singapore, China, Japan and Spain. Most serological
tests have been developed to detect the presence of IgM/IgG antibodies against N,
S and Receptor-Binding Domain (RBD) proteins in human plasma and serum
(Ishikawa et al., 2009). Therefore, each serological test may be used for a single
or a few variants, until a new variant emerges with mutations in the protein targeted
by the serology test (https://publichealth.jhu.edu/2021/variants-vaccines-and-what-
they-mean-for-covid-19-testing). As a result, serology diagnostics should not be
used for vaccine efficacy testing, due to different vaccine targets. However, with
further testing, serological diagnostic tests for COVID-19 may be used to inform a
level of immunity that could perhaps decrease the severity of re-infection and the
time during which the infection remains.
There are several serology diagnostic assays that are currently being studied for
use against COVID-19 and its several variants (Table 3). FDA authorizes each for
use under the Emergency Use Authorization (EUA). The Elecsys AntiSARS-
CoV-2 S test uses an electrochemiluminescence quantitative immunoassay, and its
overall sensitivity is 99.5%, post 14 days of PCR confirmation (https://www.
centerforhealthsecurity.org/covid-19TestingToolkit/testing-basics/types-of-COVID-19-
tests/serology-tests.html). SARS-CoV-2 antibodies against the spike RBD (Receptor
Binding Domain) of the spike (S) protein (https://diagnostics.roche.com/us/en/
products/params/elecsys-anti-sars-cov-2.html; https://publichealth.jhu.edu/2021/
variants-vaccines-and-what-they-mean-for-covid-19-testing).
The Innovita 219-nCoV Ab Test (Colloidal Gold) employs a rapid lateral flow
qualitative chromatographic immunoassay, and its sensitivity is about 100%, with
its confidence interval of (88.7%, 100%) (https://www.centerforhealthsecurity.
org/covid-19TestingToolkit/testing-basics/types-of-COVID-19-tests/serology-tests.
html). This test uses antibodies against both the S1 and nucleocapsid (N) proteins of
SARS-CoV-2 (https://www.fda.gov/media/144071/download), as the antigens from
these regions are colloidal gold-labelled. Although mutations are possible in both
regions, testing for antibodies that match two different proteins results in a higher
efficacy.
The Dimension EXL SARS-CoV-2 Total antibody assay (CV2T) is an
example of a quantitative chemiluminescent immunoassay, and its sensitivity
after early SARS-CoV-2 infection in the host is unknown (https://www.cen
terforhealthsecurity.org/covid-19TestingToolkit/testing-basics/types-of-COVID-
19-tests/serology-tests.html). The target antigen of this assay is the S1 protein, which
has been associated with several possible mutations that could potentially lead to
several COVID-19 variants (Fig. 1) (https://www.fda.gov/media/138757/down
load). Access SARS-CoV-2 IgM test also relies on a chemiluminescent immunoas-
say and its sensitivity after early infection is unknown and requires further study.
This test can also yield false negative results if the quantity of antibodies against
the SARS-CoV-2 virus is too low or if the virus has acquired one or more amino acid
mutations in the RBD of the viral S1 protein recognized by the antibodies employed
in this test. These challenges result in decreased assay efficacy (https://www.
beckmancoulter.com/products/immunoassay/access-sars-cov-2-igm-antibody-test).
The OmniPATH COVID-19 Total Antibody Test is a quantitative enzyme-linked
immunosorbent assay (ELISA), and its overall sensitivity is 100%, post 15 days since
symptom onset (https://www.centerforhealthsecurity.org/covid-19TestingToolkit/
testing-basics/types-of-COVID-19-tests/serology-tests.html). Similar to other serol-
ogy tests, this test can also result in false negative results. Since this assay employs
SARS-CoV-2 antibodies against the RBD of the S1 protein, its accuracy is also
dependent on the possible mutations of this region in COVID-19 disease variants
(https://www.thermofisher.com/covid-19-antibody-testing/us/en/solutions/Omni
PATH-COVID19-Total-Antibody-ELISA-Test.html). The Platelia SARS-CoV-2
Table 3 Serology diagnostic assays and their sensitivity ranges, their target proteins, and several other key information.
Quantitative
Kits available, or
Type of test, source Company, Approval Targets Sensitivity qualitative Pros and cons
Total Ab-ECLIA (Datta et al., 2021; https:// Elecsys AntiSARS-CoV- SARS-CoV-2 Ag 14 days post PCR confirmation (95% Cl): Quantitative Pros: Takes very
diagnostics.roche.com/us/en/products/ 2 S, Roche Diagnostics, against spike 99.5% (97.0–100%) little time (18 min),
params/elecsys-anti-sars-cov-2.html; USFDA EUA (S) protein RBD epidemiological
https://diagnostics.roche.com/global/en/ application
news-listing/2020/roche-develops-new- Cons: Only used
serology-test-to-detect-covid- in vitro to date,
19-antibodies.html) prone to false
positives due to
pre-existing
antibodies
Lateral flow IgM/G (Datta et al., 2021; https:// Innovita 219-nCoV Ab Test SARS-CoV-2 Ag 100% (30/30) with confidence interval of Qualitative Pros: Aids with
www.fda.gov/media/144071/download) (Colloidal Gold), Innovita against S1 and (88.7%, 100%). Possible lower sensitivity to variant detection
(Tangshan) Biological nucleocapsid IgG antibodies in symptomatic individuals less Cons: Limited to
Technology Co., Ltd., (N) proteins than 15 days since symptom onset. Sensitivity IgM, IgG antibodies,
USFDA EUA of this test after early infection is unknown prescription only
Total antibody, CLIA (Datta et al., 2021; Dimension EXL SARS- SARS-CoV-2 Ag Sensitivity of this test after early infection is Quantitative Pros: Low
https://www.fda.gov/media/138757/ CoV-2 Total antibody against S1 unknown probability of false
download) assay (CV2T), Siemens protein RBD positives, detects
Healthcare Diagnostics total antibody levels
Inc., USFDA EUA Cons: Prescription
use only, complex
assay
IgM-CLIA (https://www.fda.gov/media/ Access SARS-CoV-2 IgM, SARS-CoV-2 Ag Sensitivity of this test after early infection is Quantitative Pros: Low
142911/download; https://www. Beckman Coulter, Inc., against S1 unknown maintenance, easy
beckmancoulter.com/products/ USFDA EUA protein RBD workflow integration
immunoassay/access-sars-cov-2- Cons: Limited to
igm-antibody-test; Datta et al., 2021) IgM antibodies,
prone to false
positives
Total Ab-ELISA (Datta et al., 2021; https:// OmniPATH COVID-19 SARS-CoV-2 Ag 15 days post symptom onset (95% Cl): Quantitative Pros: Detects IgM,
www.thermofisher.com/covid-19- Total Antibody ELISA Test, against S1 100% (89.2, 100.0). Sensitivity of this test after IgA, IgG bound
antibody-testing/us/en/solutions/ Thermo Fisher Scientific, protein RBD early infection is unknown antibodies
OmniPATH-COVID19-Total-Antibody- USFDA EUA Cons: Only used
ELISA-Test.html; https://www.fda.gov/ in vitro to date,
media/142700/download) prone to false
positives
Total Ab-ELISA (Datta et al., 2021; https:// Platelia SARS-CoV-2 Total SARS-CoV-2 Ag Overall: 49/50 (98%); 95% CI: 89.51–99.65% Quantitative Pros: One-step
www.fda.gov/media/137493/download; Ab assay, Bio-Rad, against the antigen capture
https://publichealth.jhu.edu/2021/variants- USFDA EUA nucleocapsid (90 min incubation),
vaccines-and-what-they-mean-for-covid- (N) protein visual control
19-testing) Cons: Limited use
by EUA
IgM-CLIA (Datta et al., 2021; https://www. Diazyme DZ-Lite SARS- SARS-CoV-2 Ag Overall: 94.4% Quantitative Pros: High
diazyme.com/covid-19-antibody-tests/dz- CoV-2 IgM CLIA Kit, against the 15–30 days from symptom onset (95% CI): specificity, no
lite-sars-cov-2-igm-clia-kit; https://www. Diazyme Laboratories, nucleocapsid 88.4–97.4 cross-reactivity
fda.gov/media/141255/download) Inc., USFDA EUA (N) and spike Sensitivity of this test after early infection is Cons: Only detects
(S) proteins unknown IgM antibodies
Total Ab assay is also an example of an enzyme-linked immunosorbent assay,

and its overall sensitivity is 98%. This assay relies on SARS-CoV-2 antibodies
against the nucleocapsid (N) protein (https://publichealth.jhu.edu/2021/variants-
vaccines-and-what-they-mean-for-covid-19-testing).
Finally, the Diazyme DZ-Lite SARS-CoV-2 IgM CLIA Kit is a quantitative
chemiluminescent immunoassay, like the Dimension EXL and Access SARS-
CoV-2 IgM tests (https://www.centerforhealthsecurity.org/covid-19TestingToolkit/
testing-basics/types-of-COVID-19-tests/serology-tests.html). Its overall sensitivity
is approximately 94.4%. This assay uses antibodies targeted against nucleocapsid
(N) and spike (S) proteins (https://www.diazyme.com/covid-19-antibody-tests/dz-lite-
sars-cov-2-igm-clia-kit). By screening antibodies with two different target sites, as the
Innovita 219-nCoV Ab Test does, the Diazyme DZ-Lite assay minimizes false nega-
tives, and increases efficacy.
Within the larger realm of serology tests, there are two types: qualitative
and quantitative antibody tests (https://www.centerforhealthsecurity.org/covid-
19TestingToolkit/testing-basics/types-of-COVID-19-tests/serology-tests.html).
Lateral flow assays (LFAs) are typically qualitative, rapid serology tests, which
are used to provide a patient’s “serostatus,” a common term denoting whether a
patient has antibodies of interest. This test can be performed very rapidly at a
single point in time, which is a major advantage. In contrast, quantitative tests
include enzyme-linked immunosorbent assays (ELISAs) and chemiluminescent
immunoassays (CLIAs), and similar tests provide additional detailed informa-
tion beyond a binomial (detected or not detected) answer. Instead, these tests
provide the levels of antibodies in a patient sample and are thus biologically
quantitative, but are more heavily used for research purposes rather than inform-
ing patients.
Because these serology-based diagnostic tests rely on highly specific antibodies,
serology assays can potentially result in false negatives in the presence of COVID-19
variants. Changes in the viral genome can result in downstream changes in the pro-
tein sequence and conformation. These changes can cause changes in the epitope
region of the viral antigen, and these altered epitopes would specifically bind to an-
tibodies with matching paratopes. The resulting antibody-antigen incompatibility
due to mutation can result in false negatives and viral variants that spread while going
undetected. Therefore, further development of serology-based diagnostic testing is
needed to ensure accurate COVID-19 diagnoses in the face of COVID-19 variants.
3.3 CRISPR diagnostics

Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is a
genetic engineering technique that allows targeted modification of genomes. It is
based on a simplified version of the bacterial CRISPR-Cas9 antiviral defence system
(Palaz, Kalkan, Tozluyurt, & Ozsoz, 2021). Cas is an enzyme that can recognize and
cleave specific target strands of DNA using a guide CRISPR sequence in prokar-
yotic organisms like bacteria and archaea (Ganbaatar & Liu, 2021). The CRISPR
sequences are derived from DNA fragments of bacteriophages that had previously
infected the prokaryote (Ganbaatar & Liu, 2021). The sequences allow the prokary-
ote to detect and destroy DNA from similar bacteriophages during subsequent infec-
tions, protecting the bacterial cell from invasion. Hence, these CRISPR sequences
play a vital role in the antiviral defence of prokaryotes and provide a form of acquired
immunity.
In general, there are two major parts in the CRISPR-Cas system: guide RNA (to
identify and direct Cas endonuclease to the target region) and Cas endonuclease (to
break the target genomic site) (Ding et al., 2020). By delivering the Cas9 nuclease
complexed with a synthetic guide RNA into a cell, the genome can be cleaved at the
desired location, allowing existing genes to be removed and new ones introduced
in vitro or in vivo (in living organisms) (Ganbaatar & Liu, 2021).
3.3.1 CRISPR and COVID-19 detection

CRISPR-based detection methods have recently received substantial attention for
nucleic acid-based molecular testing due to their simplicity, high sensitivity, and
specificity. There are various CRISPR-based COVID-19 detection methods and re-
lated diagnostic devices. As of August 2021, over 217 million people worldwide
have been infected, with over four million deaths due to this virus. Thus, there is
a critical need for simple, rapid, and affordable testing facilities in every country,
from developing to first-world nations. With the help of CRISPR, proteins can pre-
cisely cut the target region that matches the complementary crRNA sequence
(Ganbaatar & Liu, 2021). There are two components in CRISPR detection: first,
the CRISPR-RNA complex cuts the target region. This step initiates the next one,
collateral cleavage of the surrounding nucleic acids. Generally, the CRISPR system
is divided into two main classes and six types (Broughton et al., 2020a). Class
I contains Cas proteins that cut DNA and RNA in vivo. Class II CRISPR systems
are used widely for genomic manipulation and infectious disease diagnosis, and
these systems feature three main effector proteins: Cas12, Cas13, and Cas14
(Broughton et al., 2020a).
Concerning cleavage activity, Cas12 recognizes double-stranded DNA (dsDNA)
more efficiently than single-stranded DNA (ssDNA), but it still exhibits collateral
activity for ssDNA (Broughton et al., 2020a). Cas14 recognizes ssDNA more effec-
tively than dsDNA as well, and Cas14 also exhibits similar collateral activity in
ssDNA. Cas13 possesses the intriguing ability to both recognize ssRNA and exhibit
collateral activity. Since CRISPR can create collateral cleavage activity, it can be
combined with isothermal nucleic acid amplification to simplify the detection
method by visualizing the result of positive or negative samples with the naked
eye, LED or UV lamps (Broughton et al., 2020a).
There is another test to diagnose COVID-19; however, it is not as popular
(Rahimi et al., 2021). A multiplex diagnostic system developed recently incorpo-
rated nucleic acid preamplification with CRISPR/Cas enzymology to identify the tar-
geted nucleic acid sequences with high sensitivity (Kellner, Koob, Gootenberg,
Abudayyeh, & Zhang, 2019). The developed system, called specific high-sensitivity
enzymatic reporter unlocking (SHERLOCK) can detect clinical sample nucleic acid
sequences in a portable and ultrasensitive manner.
In recent months, Cas12 has been used in several assays. One commonly used
CRISPR test is the DETECTR (SARS-CoV-2 DNA Endonuclease-Targeted
CRISPR Trans Reporter) (Kaminski, Abudayyeh, Gootenberg, Zhang, & Collins,
2021). This assay uses loop-mediated amplification (RT-LAMP) to reverse-
transcribe and amplify viral RNA obtained from a nasal or oral swab. The Cas12
protein then identifies target SARS-CoV-2 sequences, leading to genetic cleavage
that signals a positive test result (Rahimi et al., 2021). The entire test takes only
30–40 min to complete, and the results can be seen using a lateral flow strip. If both
the E and N protein-encoding genes are detected, the DETECTR assay signals a pos-
itive result. However, the result changes to presumptive positive if only one of the
two protein-encoding genes is detected (Rahimi et al., 2021).
The FAM-biotin reporter molecule and lateral flow strips provide a visual result
for the Cas12 detection. Flow strips capture and separate the cleaved strands from the
uncleaved reporter molecules (Rahimi et al., 2021). The RT–LAMP DETECTR
assay’s ability to amplify SARS-CoV-2 nucleic acid directly from the swab sample
is a valuable and critical component of the diagnostic’s efficacy and usability.
Broughton et al. performed a study where they discovered diminishing accuracy
from the diagnostic with higher reaction concentrations of 10% UTM and 10%
phosphate-buffered saline by volume, with estimated LODs decreasing to 15,000
and 500 copies per μL, respectively (Broughton et al., 2020a; Rahimi et al., 2021).
CRISPR-based diagnostic systems have reshaped molecular diagnosis. The
benefits of the CRISPR system, such as speed, precision, specificity, strength, effi-
ciency, and versatility, have inspired researchers to develop CRISPR-based diagnos-
tic and therapeutic methods (Rahimi et al., 2021). For instance, eliminating the need
for thermocycling and isothermal signal amplification offers significant benefits
compared to qRT-PCR, such as fast turnaround time, target specificity for single
nucleotides, integration with usable and user-friendly reporting formats like lateral
flow strips, and no requirement for sophisticated laboratory systems (Rahimi et al.,
2021). During the global COVID-19 outbreak, different groups have begun
designing and developing diagnostic and therapeutic programs based on the
efficient CRISPR system. Thanks to these developments, scientists will be able to
accurately run cost-effective tests and apply these methods to other groundbreaking
molecular work.
3.4 Biosensor diagnostics

A biosensor is a device that is assembled by utilizing two major components: the
biorecognition element and the transducer within. The former enables the detection
of an analyte, and the latter translates this specific interaction into a quantifiable sig-
nal. The whole process of recognition is referred to as “signalization.” Transducers
have been classified according to the type of signal generated upon analyte-
bioreceptor interaction. Biosensors are considered one of the most sensitive, specific
and efficient diagnostics for disease detection, and consequently, they have been
harnessed to monitor COVID-19 spread. Sensors for SARS-CoV-2 were designed
based on viral surface nucleoproteins, receptors, and genetic material. Biosensors
can be broadly classified into four categories: (1) optical, (2) thermal, (3) electro-
chemical, and (4) piezoelectric. In the following sections, we discuss the types of
biosensors that are prevalent and their conceptual operation in SARS-CoV-2
diagnostics.
3.4.1 Optical biosensors

Optical biosensors mainly work by converting light signals into electrical signals.
The activity is based on the interaction of the optical field with a bio-recognition
element. These sensors have been categorized as “label-free” and “label-based.”
The first approach generates signals directly upon the interaction of the analyte ma-
terial with the transducer. On the other hand, signals produced in label-based sensing
are amplified by colorimetric, fluorescent or luminescent methods. Optical sensors
have specialized into different categories such as surface plasmon resonance (SPR),
evanescent wave fluorescence, and optical waveguide interferometry (Table 4).
SPR is a type of label-free optical detection whereby the transducer consists of a
probe attached to a thin metallic film, which remains in close contact with a dielectric
medium of lower refractive index. Subsequent binding of the analyte changes the
angle of extinction of light, which is reflected after transverse waves impinge on
the metal dielectric interface. This fluctuation may be perceived as a signal and
is directly proportional to the concentration of analyte present on the surface
(Shrivastav, Cvelbar, & Abdulhalim, 2021; Unser, Bruzas, He, & Sagle, 2015).
Djaileb et al. developed a SPR based sensor for the detection of antibodies against
the N protein from serum (Djaileb et al., 2020). Similarly, Qiu et al. achieved detec-
tion of various genes specific to COVID-19 with the introduction of dual functional
plasmonic sensors (Qiu et al., 2020). Table 4 exhaustively lists the methods that have
applied this technology.
3.4.2 Electrochemical biosensors

Electrochemical sensors use electrochemical transducers to detect the inherent elec-
trical properties of interacting biomolecules. Electrochemical mechanisms generally
require sensing or redox electrodes which include a reference electrode, a counter
electrode, and a working electrode in combination. The working electrode provides
the interface where the probe is immobilized. It further acts as a transduction element
for the elicitation of electrical fluctuations. The counter electrode functions to main-
tain a continuum with the electrolyte solution, thus maintaining the circuit.
Electrochemical sensors have been mainly classified into three types: ampero-
metric, potentiometric, and conductometric devices. Amperometric devices measure
the current, caused by oxido-reduction reactions of an electroactive molecule, at a
constant potential. In contrast, voltammetry is the term used for the current measured
with controlled variation in the potential. Not all analytes are intrinsically capable of
inducing redox reactions; in such cases external mediators, also known as indicators,
Table 4 COVID-19 biosensors designed for rapid detection of disease.
Type of sensor Detection LOD or sensitivity Reference
FET Sensor detects SARS-CoV2 antigen protein. Graphene base functionalized 1 fg/mL Seo et al. (2020)
with SARS-CoV2 spike antibody used
Electrochemical SARS-CoV-2 antigen is detected with the potentiostat by measuring the 90 fM within 10–30 s Mahari, Roberts,
change in electrical conductivity. The SARS-CoV2 monoclonal antibody was Shahdeo, and Gandhi
immobilized onto a screen printed carbon electrode (SPCE) (2020)
Electrochemical N and S genes of SARS-CoV2 detected in less than 2 h. RCA is used to 1 copy/ μL Chaibun et al. (2021)
generate amplicons which are hybridized with probes functionalized with
redox active labels
Electrical SARS-CoV2 S1 spike protein detected with the help of Bioelectric Recognition 1 fg/mL Mavrikou,
Assay. The antigen specific antibody is bound to membrane-engineered Moschopoulou,
mammalian cells. As the protein attaches to the antibody considerable change Tsekouras, and Kintzios
is observed in the cellular bioelectric properties (2020)
Electrochemical SARS-CoV2 antibodies are detected by the sensor. Here, the presence of Ab IgG ¼ 0.96 ng/mL Yakoh et al. (2021)
stops a redox conversion which leads to a decrease in current that is IgM ¼ 0.14 ng/mL
measured
Electrochemical RNA of SARS-CoV-2 is detected using calixarene functionalized graphene 200 copies/mL Zhao et al. (2021)
oxide which targets the RNA without any requirement of nucleic acid
amplification and reverse-transcription. Only portable electrochemical
smartphones are a necessity
LFIA (optical) SARS-CoV2 nucleocapsid protein was detected using this platform. Specific 2 ng of antigen Kim et al. (2021)
single chain variable fragment- crystallizable fragment (scfc-fc) fusion protein;
antibodies were developed using phage display technique. Cellulose nano 2.5*104pfu cultured
beads were used for visual display of attached SARS antigen virus
Raman scattering Simultaneous detection of anti SARS-CoV2 IgM/IgG is performed. Dual-layer 1 pg/mL Liu et al. (2021)
based LFIA Raman molecules loaded silver-coated SiO2 nanoparticles as SERS tags in
clinical samples. The Raman molecule used was DTNB; system surface was
modified with CoV2 spike protein which specifically binds antibodies
SPR Dual functional plasmonic biosensor which combines the 0.22 pM Qiu et al. (2020)
plasmonicphotothermal effect and localized surface plasmon resonance
detects the CoV2 specific genes. 2D Au-Nanoislands were functionalized with
complementary DNA receptors which specifically bind to Cov2 sequences
and generate thermoplasmonic heat
SPR SPR sensor developed for the detection of nucleocapsid protein antibodies nM range within Djaileb et al. (2020)
from serum samples. The sensor is coated with the recombinant nucleocapsid 15 min
protein which specifically binds to the antibody from the serum.
Optical Split luciferase mechanism used for antibody detection specific to S protein 89% for S protein; Elledge et al. (2021)
and N protein of SARS-CoV2. NanoLuc was split into two and both arms fused 98% for N protein
with viral antigens. The antibodies bind with both the arms and reconstruct the
NanoLuc, hence generating the luminescence
Continued
Table 4 COVID-19 biosensors designed for rapid detection of disease.—cont’d
Type of sensor Detection LOD or sensitivity Reference
Colorimetric and Detection of N gene of SARS-CoV2 by the use of gold nanoparticles capped 0.18 ng/mL Moitra, Alafeef, Dighe,
SPR with thiol-modified antisense oligonucleotides that are N gene specific. The Frieman, and Pan (2020)
binding of the target demonstrates a change in surface plasmon resonance.
The cleavage of RNA-DNA hybrid gives a detectable precipitate because of
addition of RNase H
Optical (LFIA, Single stranded Recombinase Polymerase Amplification method used for 4 copies/50 μL Kim et al. (2020)
Fluorescence) detection of SARS-CoV2 RNA. Isothermal amplification of RPA is done and sample
then dsDNA converted to a single strand which can be detected using the
hybridization process within 10 min
Optomagnetic Conserved region of SARS-CoV2 RNA dependent RNA polymerase (RdRp) 0.4 fM Tian, Gao, Fock, Dufva,
gene detected by making synthetic cDNA and applying the circle to circle and Hansen (2020)
amplification; a rolling circle amplification based cascade
Fluorescence and E gene and N gene of the SARS-CoV2 are targeted in this assay. Simultaneous 10 copies/μL Broughton et al. (2020b)
LFA reverse transcription and isothermal amplification is done using LAMP. Later
CRISPR technique is used for the detection wherein Cas12 g RNA are utilized
targeting the N and E gene
Fluorescence and CASdetec is a developed nucleic acid detection platform based on CRISPR 1 104 copies/mL Guo et al. (2020)
LFA technique for the detection of RdRp of SARS-CoV2 using sgRNA-3.
Recombinase aided amplification is used to amplify the substrates
Fluorescence and Multiplex reverse transcription loop-mediated isothermal amplification (mRT- 12 copies per reaction Zhu et al. (2020)
LFA LAMP) is designed for the detection of SARS-CoV2 combined with with 100% sensitivity
nanoparticle-based lateral flow biosensor. The opening reading frame 1a/b
and N gene of the virus were detected
Fluorescence, Immunoassay with fluorescence-colorimetry dual mode LFIA for detection of 1:106 dilution by Wang et al. (2020)
colorimetric and IgM and IgG specific to SARS-CoV2 from serum. Spike protein is used for the fluorescence values
LFA detection which is conjugated with SiO2@Au@QD nanobeads
Optical and LFIA Biolayer interferometry technique is used for the detection of spike protein 5 μg/mL Baker et al. (2020)
wherein α,N-acetyl neuraminic acid was immobilized onto sensor platform and
signal was generated upon binding of spike protein to glycan
Optical and LFIA SARS-CoV2 IgG and IgM were detected from serum, plasma and whole 92% sensitivity for Black et al. (2021)
blood. Colloidal-gold labelled SARS-CoV-2 antigen was used for detection venous blood;
93% sensitivity for
capillary blood
Fluorescence and Detection of anti SARS-CoV2 IgG antibody in human serum. The capture – Chen et al. (2020)
LFIA molecule was the recombinant SARS-CoV2 nucleocapsid phosphoprotein.
The detection was done using Lanthanide-doped polystyrene nanoparticles
which served as a fluorescence reporter functionalized with IgG mouse/rabbit
anti-human IgG antibody
LFIA The method developed for simultaneous detection of IgM and IgG specific to Sensitivity ¼ 88.63% Li et al. (2020)
SARS-CoV2. The surface antigen conjugated with gold nanoparticles is used
here as a capture
Optical The sensor is developed based on an interferometric bimodal waveguide Sensitivity ¼ greater Ruiz-Vega, Soler, and
(Interferometry) whose surface is modified with specific receptors targeting antigens of SARS- than 95% Lechuga (2021)
CoV2 such a spike protein. When virus particles are captured by receptors,
interferometric signals are recorded
Plasmonic Sensor Optical detection of SARS-CoV2 virus done using the specific monoclonal 370 virus particles/mL Huang et al. (2021)
antibody and ACE2 protein
LFA Evaluation of four lateral flow assay kits for detection of SARS-CoV2 IgG Sensitivities: McAulay et al. (2020)
BTNX kit 1 ¼ 95%
BTNX kit 2 ¼ 91%
ACON ¼ 95%
SD Biosensor ¼ 92%
LFIA Detection method for SARS-CoV2 spike 1 protein using a combination of 1.86 105 copies/mL Lee et al. (2021)
capture and detector molecule being SARS-CoV2 receptor ACE2 and
commercially available antibodies for S1 respectively
Quartz Crystal S1 spike protein of SARS-CoV2 is detected with the help of anti-spike 40 nM Pandey (2020)
Microbalance glycoprotein (engineered surface with mixed SAM of CH3 and COOH
(Piezo) + antibody)
Amplification and SARS-CoV2 N gene and SARS-CoV2 S gene are being detected using S Xing et al. (2020)
Microfluidic isothermal amplification analyser (RTisochip). The chip is able to detect gene ¼ 10 copies/μL;
device 19 common respiratory viruses as well N
gene ¼ 25 copies/μL
Chromatographic Standard Q COVID-19 antigen (SD Biosensor) for detection of SARS-CoV2 Sensitivity ¼ 70.6% Cerutti et al. (2020)
immunoassay nucleoprotein in nasopharyngeal swabs
facilitate the electrochemistry of the analyte at the working electrode surface. Poten-
tiometric devices mainly indicate the concentration of ions related to electrochemical
reactions by measuring the charge potential that is accumulated on the working
electrode. Hence, the electromotive force defines the relationship between the con-
centration and the potential at the working electrode, which is also given by the
Nernst equation. Conductometric devices work by measuring the ability of an ana-
lyte to conduct an electrical current between electrodes. They are contemplated as a
subset of impedimetric devices. These devices are widely used for electrochemical
reactions using enzymes, wherein the ionic strength of the conductive solution may
change due to the reaction in situ.
Huge preference for electrochemical transducers is attributed to ease of synthesis,
quick response time, and low power consumption (Table 4) (Desai, Kumar, Bose, &
Datta, 2018; Grieshaber, MacKenzie, V€or€os, & Reimhult, 2008). Seo and his asso-
ciates have developed an electrochemical sensor capable of detecting the S protein
with a sensitivity of 1 fg/mL, whereas Mahari et al. developed a similar sensor with a
sensitivity up to 90 fM (Seo et al., 2020). Later in 2021, Zhao et al. fabricated a tech-
nique for the electrochemical detection of SARS-CoV2 RNA that did not require
nucleic acid amplification (Zhao et al., 2021). Variants and modified electrochemical
sensors have been actively used for COVID19 detection (Table 4).
3.4.3 Piezoelectric biosensors

Piezoelectric biosensors are mainly designed for the detection of affinity interac-
tions. These biosensors elicit a voltage when they are induced due to mechanical
or oscillatory stress. Alternatively, voltage applied to piezoelectric material causes
oscillation or mechanical stress on the crystal, whose frequency may be detected by
putting the crystal into an oscillation circuit. The detection module of the sensors are
located on the surface of the crystal, and binding of the analyte causes fluctuations in
the oscillation frequency. This frequency observed is directly proportional to the an-
alyte concentration (Hussain, Rupp, Wendel, & Gehring, 2018). Among the many
sensors created, the quartz crystal microbalance developed by Pandey specifically
detects the S1 spike protein of SARS-CoV2 at protein levels as low as 40 nM
(Pandey, 2020).
3.4.4 Next generation sensors

Wearable sensors are considered as a class of next gen sensor, having application in
both diagnostics and regular monitoring. The magnitude of wearable sensors is vast
and varies from physiological sensing and biochemical sensing to motion sensing.
The ability to miniaturize the electronic circuits and hence miniaturize the sensor
plays a major role in the development of wearable sensors. The applicability of
accelerometers has been shown to help monitor the activity of daily living, especially
for old people. Wearable sensors can help track for years the recovery of patients who
have undergone abdominal surgery. These types of sensors are now preferred even
more due to the advantages they offer, especially since no sampling or processing is
required. Thus, these next gen sensors can be easily used by the general population.
4 Diagnostics in the era of COVID-19 vaccination 109
With face masks becoming a necessity and a preventive safety measure, scientists
have delved into the plausibility of sensor-based face masks as a strategy for iden-
tifying infected individuals. Researchers from Harvard and MIT designed a SARS-
CoV-2 sensing mask capable of detecting a patient within 90 min. Embedded with
miniature sensors, the technology encompasses freeze-dried cellular machinery ca-
pable of detecting viral particles in the exhaled aerosol of the person wearing the
mask. This sensor-based mask has a sensitivity equivalent to that of gold-standard
WHO-approved RT-PCR tests, and it can detect the presence of the viral genome.
This particular novel prototype has begun another path for the next generation sen-
sors. As of now, the prototype biosensor costs approximately $5, and it is anticipated
to become cheaper with mass manufacturing (Nguyen et al., 2021).
Another upcoming and explorative field in next generation sensors are CRISPR-
based sensors. The ability to target several genomic loci simultaneously is achieved
with the help of CRISPR and its associated proteins known as Cas proteins, as men-
tioned previously. With CRISPR being one of the most promising potential fields of
research, the detection of many pathogens are being targeted with the help of
CRISPR, including the detection of coronaviridae. As described before, CRISPR-
based SHERLOCK assays are being utilized specifically for the detection of
SARS-CoV-2. This detection can be achieved by using samples from nasal swabs,
nasopharyngeal swabs, oropharyngeal swabs or bronchoalveolar lavage (BAL). As
the viral signature sequence is detected, the CRISPR enzyme is released to generate
fluorescent signals (Azhar et al., 2020). A CRISPR-based in vitro diagnostic (IVD)
detector is used for the detection of E and N2 genes of SARS-CoV-2 by using
Cas12a. The Cas12a-sgRNA complex binds to the target, leading to ssDNA cleavage
and concurrent increase in fluorescence (Kellner et al., 2019). CRISPR-based detec-
tion offers the user the sensitivity and specificity they require in detection of viruses
belonging to the same family, and it is robust enough to distinguish between genet-
ically similar viruses. This advantage is attributed to the fact that detection is based
on specific signature sequences that are conserved (Datta et al., 2021).
4 Diagnostics in the era of COVID-19 vaccination

While vaccines are indispensable in the fight against COVID-19, it is essential to
consider how vaccination alters viral diagnostics, specifically whether SARS-
CoV-2 vaccination results in a false-positive diagnosis. There are two broad catego-
ries of testing: viral tests and serology (antibody) tests. There are two broad
categories of testing: viral tests and serology (antibody) tests. Viral tests include
antigen tests (often referred to as rapid tests) and nucleic acid amplification tests
(NAAT). Briefly, NAATs (e.g. RT-PCR) detect viral RNA, whereas rapid antigen
tests detect specific viral proteins (i.e. antigens) on the virus’ surface. In contrast,
serology tests, described interchangeably as antibody tests, measure specific viral
antibody levels. These serology tests can also be performed rapidly, though they only
provide information on antibody presence, not viral infection.
Both viral tests are highly unlikely to result in a false-positive test because of vac-
cination for two primary reasons. First, mRNA COVID-19 vaccines (mRNA-1273
by Moderna and BNT162b2/Comirnaty by Pfizer-BioNTech) and adenovirus-based
COVID-19 vaccines (ChAdOx1-S by AstraZeneca-Oxford and Janssen COVID-19
Vaccine by Johnson & Johnson) do not consist of the entire SARS-CoV-2 genome.
Instead, these four vaccines contain a virus fragment that carries instructions on syn-
thesizing S-proteins. Therefore, these vaccines use the S-protein as a major target.
Fortunately, the majority of widely used molecular tests do not target the S gene.
Moreover, S gene-targeting molecular tests (e.g. Thermofisher Taqpath) have other
gene targets, thereby remaining functionally reliable. Thus, vaccination does not
significantly affect the accuracy of viral tests (Borges et al., 2021).
Second, mRNA-1273 (Moderna) and BNT162b2/Comirnaty (Pfizer-BioNTech)
contain non-replicating mRNA. Specifically, these two vaccines contain the target
antigen sequence, 30 untranslated region (UTR), and 50 UTR but lack protein se-
quences necessary for self-amplification. Consequently, these non-replicating viral
vector vaccines are unable to create new viral particles upon host entry. In other
words, the small amount of mRNA in these non-replicating mRNA vaccines is
too low to be detected by either RT-PCR or antigen testing (Guglielmi, 2020).
On the other hand, vaccination can result in false positive results for serology
(antibody) tests. A false positive can occur if the serology test specifically detects
spike protein-specific antibodies. All four vaccines mentioned in the previous
paragraph (i.e. mRNA-1273, BNT162b2/Comirnaty, ChAdOx1-S, and Janssen
COVID-19 vaccine) aim to elicit antibody production against the spike protein.
Hence, a positive result from serology tests that target the spike protein (Table 3)
could indicate either vaccination or prior infection. In contrast, serology tests that
target antibodies to the nucleocapsid protein (Table 3) provide more conclusive
results; a positive test result could only occur from natural infection, allowing for
differentiation between natural infection and immunization (West, Gronvall, &
Kobokovich, 2021).
Another question is whether serology tests are appropriate diagnostic tools to mea-
sure vaccine-induced immunity against SARS-CoV-2. Unfortunately, there is a lack of
research that evaluates the level of protection provided by an immune response to
COVID-19 vaccination. As of October 2021, the FDA has not recommended any cur-
rently available serology tests as a reliable method to measure vaccination efficacy.
Serology testing remains an unreliable predictor of COVID-19 immunity for two
main reasons. First, scientists and clinicians have yet to determine the exact concen-
tration of antibodies needed to prevent SARS-CoV-2 infection or illness (correlates
of protection). Due to this gap of knowledge, a positive serology test obtained via
qualitative or quantitative COVID-19 serology testing, including those listed in
Table 3, does not guarantee protection against COVID-19. Second, as listed in
Table 3, numerous serology tests target antibodies to the N protein rather than the
S protein. Since currently approved COVID-19 vaccines elicit S protein-specific
neutralizing antibodies, people who have had the COVID-19 vaccine (but not a nat-
ural infection) would test negative with serology tests that do not detect anti-S pro-
tein antibodies. Therefore, serology tests are not an accurate measure of COVID-19
5 Conclusion 111
vaccine efficacy. Importantly, misinterpretation of serology tests can provide a false

sense of security, misleading people away from clinically proven security measures
such as mask wearing and social distancing (Bausch, Hampton, Perkins, &
Saville, 2021).
5 Conclusion
At the time of writing, the COVID-19 pandemic continues, causing widespread in-
fection and death. Diagnostic techniques involving RT-PCR, serology, CRISPR, and
biosensors have all played roles in informing best health practices and slowing the
spread of SARS-CoV-2. However, the disease has become more transmissible,
dangerous, and challenging to detect with the increasing number of emerging vari-
ants. Developments in diagnostic methods have helped, but the spread of the virus
continues to rage. People continue to lose their lives daily, despite the world’s best
diagnostic capabilities. Many countries cannot afford the best diagnostic assays,
resulting in health inequities on a global scale.
It must be mentioned that diagnostics alone are incapable of bringing an end to
the COVID-19 pandemic. While testing helps mitigate the spread, the best way to
stop the spread of COVID-19 is global vaccination, augmenting acquired immunity
against the virus and limiting viral transmission (and severe infection). Vaccination
is crucial to curb variant emergence and transmission frequency while preventing
further viral replication and mutation (Salian et al., 2021). Effective vaccine distri-
bution reduces the need for diagnostic testing since fewer individuals will transmit
and develop viral infections, reducing the population’s viral load. This reduction in
testing demand is vital, given the immense strain that diagnostic efforts have put on
the global scientific and clinical supply chains. Therefore, vaccines are necessary to
stop the spread of COVID-19, mitigate the need for testing, and save lives. Coupled
with implemented public safety measures such as physical distancing, vaccinations
provide hope for a safer and healthier post-pandemic future (Ramos, Vela-Perez,
Ferrández, Kubik, & Ivorra, 2021).
Unfortunately, just as the distribution of testing was not always equal, neither has
the worldwide distribution of vaccines. Many countries have been left out of the ben-
efits of vaccination because they lacked resources and global support (Salian et al.,
2021). Thus, people in these countries must face the dangerous COVID-19 variants
without protection from vaccines. This predictable and sad reality is worsened by
vaccine hesitancy and mistrust within countries with greater vaccine access
(Forni & Mantovani, 2021). These factors contribute to the massive health disparities
related to vaccination worldwide. According to the New York Times, over 5 billion
vaccine doses have been administered worldwide. Yet, billions of people remain
unvaccinated while health disparities worsen. Countries like the United States,
France, China, and Canada have over 100 vaccine doses administered per 100
people. In contrast, countries like Venezuela, Nicaragua, Kenya, and South Africa
average fewer than 20 doses per 100 people (Holder, 2021). These statistics point
to a worldwide issue of access to healthcare that has existed throughout the
COVID-19 pandemic.
With continued massive testing efforts, valuable resources remain in short sup-
ply, slowing down research and science while infections and deaths persist. The bat-
tle against COVID-19 continues, and a global solution is needed to end it.
A worldwide collaborative effort to continue developing diagnostic assays is crucial
to keeping up with the ever-changing virus and its variants. Researchers and scien-
tists must cooperate and refine diagnostics that are accurate and sensitive to emerg-
ing SARS-CoV-2 variants so new variants can be identified and contained quickly.
Further, these improved diagnostics should be made available to all people: ensuring
the distribution of diagnostic tests to developing countries is a global responsibility.
A globally run task force devoted to monitoring SARS-CoV-2 spread worldwide in
real-time would provide a much-needed solution to the underreported COVID-19
cases around the world. To reiterate an earlier point, equitable vaccine distribution
to people in every nation is also a global responsibility. With a worldwide cooper-
ative effort, future waves of cases caused by new variants can be quickly contained
and ultimately prevented with the proper investment in global accessibility for
COVID-19 testing and vaccination.
References
Abdool Karim, S. S., & de Oliveira, T. (2021). New SARS-CoV-2 Variants—Clinical, public
health, and vaccine implications. The New England Journal of Medicine, 384(19),
1866–1868. https://doi.org/10.1056/NEJMc2100362.
Arevalo-Rodriguez, I., Buitrago-Garcia, D., Simancas-Racines, D., Zambrano-Achig, P.,
Campo, R. D., Ciapponi, A., et al. (2020). False-negative results of initial RT-PCR assays
for COVID-19: A systematic review. PLoS One, 15(12). https://doi.org/10.1371/journal.
pone.0242958, e0242958.
Azhar, M., Phutela, R., Ansari, A. H., Sinha, D., Sharma, N., Kumar, M., et al. (2020). Rapid,
field-deployable nucleobase detection and identification using FnCas9. https://doi.org/
10.1101/2020.04.07.028167.
Babb de Villiers, Chantal, Blackburn, Laura, Cook, Sarah, Janus, Joanna, & PHG Founda-
tion. (2021). SARS-CoV-2 variants. Foundation for Innovative New Diagnostics.
https://www.finddx.org/wp-content/uploads/2021/03/COVID-variants-report-FINAL-
12MAR2021.pdf.
Baker, A. N., Richards, S.-J., Guy, C. S., Congdon, T. R., Hasan, M., Zwetsloot, A. J., et al.
(2020). The SARS-COV-2 spike protein binds sialic acids and enables rapid detection in a
lateral flow point of care diagnostic device. ACS Central Science, 6(11), 2046–2052.
https://doi.org/10.1021/acscentsci.0c00855.
Bausch, D., Hampton, L., Perkins, M., & Saville, M. (2021). COVID-19: Why we can’t use
antibody tests to show that vaccines are working. https://www.gavi.org/vaccineswork/
covid-19-why-we-cant-use-antibody-tests-show-vaccines-are-working.
BioRender.com (2021). https://biorender.com.
Black, M. A., Shen, G., Feng, X., Garcia Beltran, W. F., Feng, Y., Vasudevaraja, V., et al.
(2021). Analytical performance of lateral flow immunoassay for SARS-CoV-2 exposure
screening on venous and capillary blood samples. Journal of Immunological Methods,
489(112909). https://doi.org/10.1016/j.jim.2020.112909.33166549.
References 113
Borges, V., Sousa, C., Menezes, L., Gonçalves, A. M., Picão, M., Almeida, J. P., et al. (2021).
Tracking SARS-CoV-2 lineage B.1.1.7 dissemination: Insights from nationwide spike
gene target failure (SGTF) and spike gene late detection (SGTL) data, Portugal, week
49 2020 to week 3 2021. Eurosurveillance, 26(10). https://doi.org/10.2807/1560-7917.
ES.2021.26.10.2100130.
Broughton, J. P., Deng, X., Yu, G., Fasching, C. L., Servellita, V., Singh, J., et al. (2020a).
CRISPR-Cas12-based detection of SARS-CoV-2. Nature Biotechnology, 38, 870–874.
https://doi.org/10.1038/s41587-020-0513-4.32300245.
Broughton, J. P., Deng, X., Yu, G., Fasching, C. L., Singh, J., Streithorst, J., et al. (2020b).
Rapid detection of 2019 novel coronavirus SARS-CoV-2 using a CRISPR-based
DETECTR lateral flow assay. medRxiv: the preprint server for health sciences. https://
doi.org/10.1101/2020.03.06.20032334. Submitted for publication.
Bustin, S. A., Benes, V., Nolan, T., & Pfaffl, M. W. (2005). Quantitative real-time RT-PCR –
A perspective. Journal of Molecular Endocrinology, 34(3), 597–601. https://doi.org/
10.1677/jme.1.01755.
CDC. (2021, August 7). CDC diagnostic tests for COVID-19. Centers for Disease Control and
Prevention. https://www.cdc.gov/coronavirus/2019-ncov/lab/testing.html.
Cerutti, F., Burdino, E., Milia, M. G., Allice, T., Gregori, G., Bruzzone, B., et al. (2020). Ur-
gent need of rapid tests for SARS CoV-2 antigen detection: Evaluation of the
SD-biosensor antigen test for SARS-CoV-2. Journal of Clinical Virology: The Official
Publication of the Pan American Society for Clinical Virology, 132. https://doi.org/
10.1016/j.jcv.2020.104654, 104654.
Chaibun, T., Puenpa, J., Ngamdee, T., Boonapatcharoen, N., Athamanolap, P., O’Mullane, A.
P., et al. (2021). Rapid electrochemical detection of coronavirus SARS-CoV-2. Nature
Communications, 12(1), 802. https://doi.org/10.1038/s41467-021-21121-7.
Chen, Z., Zhang, Z., Zhai, X., Li, Y., Lin, L., Zhao, H., et al. (2020). Rapid and sensitive de-
tection of anti-SARS-CoV-2 IgG, using lanthanide-doped nanoparticles-based lateral flow
immunoassay. Analytical Chemistry, 92(10), 7226–7231. https://doi.org/10.1021/acs.
analchem.0c00784.
Cheng, L., Song, S., Zhou, B., Ge, X., Yu, J., Zhang, M., et al. (2021). Impact of the N501Y
substitution of SARS-CoV-2 spike on neutralizing monoclonal antibodies targeting di-
verse epitopes. Virology Journal, 18(1), 87. https://doi.org/10.1186/s12985-021-01554-8.
Cherian, S., Potdar, V., Jadhav, S., Yadav, P., Gupta, N., Das, M., et al. (2021). SARS-
CoV-2 spike mutations, L452R, T478K, E484Q and P681R, in the second wave of
COVID-19 in Maharashtra, India. Microorganisms, 9(7), 1542. https://doi.org/10.3390/
microorganisms9071542.
Datta, M., Singh, D. D., & Naqvi, A. R. (2021). Molecular diagnostic tools for the detection of
SARS-CoV-2. International Reviews of Immunology, 40(1–2), 143–156. https://doi.org/
10.1080/08830185.2020.1871477.
Dejnirattisai, W., Zhou, D., Supasa, P., Liu, C., Mentzer, A. J., Ginn, H. M., et al. (2021). An-
tibody evasion by the P.1 strain of SARS-CoV-2. Cell, 184(11). https://doi.org/10.1016/j.
cell.2021.03.055. 2939–2954.e9.
Desai, D., Kumar, A., Bose, D., & Datta, M. (2018). Ultrasensitive sensor for detection of early
stage chronic kidney disease in human. Biosensors & Bioelectronics, 105, 90–94. https://
doi.org/10.1016/j.bios.2018.01.031.
Deyde, V. M., Sampath, R., & Gubareva, L. V. (2011). RT-PCR/electrospray ionization mass
spectrometry approach in detection and characterization of influenza viruses. Expert Re-
view of Molecular Diagnostics, 11(1), 41–52. https://doi.org/10.1586/erm.10.107.
Di Giacomo, S., Mercatelli, D., Rakhimov, A., & Giorgi, F. M. (2021). Preliminary report on
severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike mutation T478K.
Journal of Medical Virology, 93(9), 5638–5643. https://doi.org/10.1002/jmv.27062.
Ding, X., Yin, K., Li, Z., Lalla, R. V., Ballesteros, E., Sfeir, M. M., et al. (2020). Ultrasensitive
and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay. Nature
Djaileb, A., Charron, B., Jodaylami, M. H., Thibault, V., Coutu, J., Stevenson, K., et al. (2020).
A rapid and quantitative serum test for SARS-CoV-2 antibodies with portable surface plas-
mon resonance sensing. ChemRxiv. Submitted for publication.
Dyer, O. (2021). Covid-19: Indonesia becomes Asia’s new pandemic epicentre as delta variant
spreads. BMJ, n1815. https://doi.org/10.1136/bmj.n1815.
Elledge, S. K., Zhou, X. X., Byrnes, J. R., Martinko, A. J., Lui, I., Pance, K., et al.
(2021). Engineering luminescent biosensors for point-of-care SARS-CoV-2 antibody
detection. Nature Biotechnology, 39(8), 928–935. https://doi.org/10.1038/s41587-021-
00878-8.
Farasani, A. (2021). Biochemical role of serum ferratin and d-dimer parameters in COVID
19 diagnosis. Saudi Journal of Biological Sciences. https://doi.org/10.1016/j.
sjbs.2021.08.040.
Faria, N. R., Mellan, T. A., Whittaker, C., Claro, I. M., da Candido, D. S., Mishra, S., et al.
(2021). Genomics and epidemiology of the P.1 SARS-CoV-2 lineage in Manaus, Brazil.
Science, 372(6544), 815–821. https://doi.org/10.1126/science.abh2644.
Fomsgaard, A. S., & Rosenstierne, M. W. (2020). An alternative workflow for molecular de-
tection of SARS-CoV-2—Escape from the NA extraction kit-shortage, Copenhagen, Den-
mark, march 2020. Eurosurveillance, 25(14), 2000398. https://doi.org/10.2807/1560-
7917.ES.2020.25.14.2000398.
Forni, G., & Mantovani, A. (2021). COVID-19 vaccines: Where we stand and challenges
ahead. Cell Death and Differentiation, 28(2), 626–639. https://doi.org/10.1038/s41418-
020-00720-9.
Ganbaatar, U., & Liu, C. (2021). CRISPR-based COVID-19 testing: Toward next-generation
point-of-care diagnostics. Frontiers in Cellular and Infection Microbiology, 11, 663949.
https://doi.org/10.3389/fcimb.2021.663949.
Greaney, A. J., Starr, T. N., Barnes, C. O., Weisblum, Y., Schmidt, F., Caskey, M., et al.
(2021). Mutational escape from the polyclonal antibody response to SARS-CoV-2 infec-
tion is largely shaped by a single class of antibodies [preprint]. Microbiology. https://doi.
org/10.1101/2021.03.17.435863.
Green, M. R., & Sambrook, J. (2018). Quantification of RNA by real-time reverse
transcription-polymerase chain reaction (RT-PCR). Cold Spring Harbor Protocols,
2018(10). pdb.prot095042. https://doi.org/10.1101/pdb.prot095042.
Grieshaber, D., MacKenzie, R., V€ or€
os, J., & Reimhult, E. (2008). Electrochemical
biosensors—Sensor principles and architectures. Sensors (Basel, Switzerland), 8(3),
1400–1458. https://doi.org/10.3390/s80314000.
Guglielmi, G. (2020). Fast coronavirus tests: What they can and can’t do. Nature, 585(7826),
496–498. https://doi.org/10.1038/d41586-020-02661-2.
Guo, L., Sun, X., Wang, X., Liang, C., Jiang, H., Gao, Q., et al. (2020). SARS-CoV-2 detection
with CRISPR diagnostics. Cell Discovery, 6(1), 34. https://doi.org/10.1038/s41421-020-
0174-y.
Harvey, W. T., Carabelli, A. M., Jackson, B., Gupta, R. K., Thomson, E. C., Harrison, E. M.,
et al. (2021). SARS-CoV-2 variants, spike mutations and immune escape. Nature Reviews.
Microbiology, 19(7), 409–424. https://doi.org/10.1038/s41579-021-00573-0.
References 115
Heid, C. A., Stevens, J., Livak, K. J., & Williams, P. M. (1996). Real time quantitative PCR.
Genome Research, 6(10), 986–994. https://doi.org/10.1101/gr.6.10.986.
Holder, J. (2021). Covid world vaccination tracker. The New York times. https://www.nytimes.
com/interactive/2021/world/covid-vaccinations-tracker.html.
Huang, L., Ding, L., Zhou, J., Chen, S., Chen, F., Zhao, C., et al. (2021). One-step rapid quan-
tification of SARS-CoV-2 virus particles via low-cost nanoplasmonic sensors in generic
microplate reader and point-of-care device. Biosensors & Bioelectronics, 171, 112685.
https://doi.org/10.1016/j.bios.2020.112685.
Hussain, M., Rupp, F., Wendel, H. P., & Gehring, F. K. (2018). Bioapplications of acoustic
crystals—A review. TrAC Trends in Analytical Chemistry, 102, 194–209. https://doi.org/
10.1016/j.trac.2018.02.009.
Ishikawa, F. N., Chang, H.-K., Curreli, M., Liao, H.-I., Olson, C. A., Chen, P.-C., et al. (2009).
Label-free, electrical detection of the SARS virus N-protein with nanowire biosensors uti-
lizing antibody mimics as capture probes. ACS Nano, 3(5), 1219–1224. https://doi.org/
10.1021/nn900086c.
Jackson, C. B., Zhang, L., Farzan, M., & Choe, H. (2021). Functional importance of the D614G
mutation in the SARS-CoV-2 spike protein. Biochemical and Biophysical Research Com-
munications, 538, 108–115. https://doi.org/10.1016/j.bbrc.2020.11.026.
Kaminski, M. M., Abudayyeh, O. O., Gootenberg, J. S., Zhang, F., & Collins, J. J. (2021).
CRISPR-based diagnostics. Nature Biomedical Engineering, 5(7), 643–656. https://doi.
org/10.1038/s41551-021-00760-7.
Kellner, M. J., Koob, J. G., Gootenberg, J. S., Abudayyeh, O. O., & Zhang, F. (2019). SHER-
LOCK: Nucleic acid detection with CRISPR nucleases. Nature Protocols, 14(10),
2986–3012. https://doi.org/10.1038/s41596-019-0210-2.
Khateeb, J., Li, Y., & Zhang, H. (2021). Emerging SARS-CoV-2 variants of concern and po-
tential intervention approaches. Critical Care, 25(1), 244. https://doi.org/10.1186/s13054-
021-03662-x.
Kim, Y., Yaseen, A. B., Kishi, J. Y., Hong, F., Saka, S. K., Sheng, K., et al. (2020). Single-
strand RPA for rapid and sensitive detection of SARS-CoV-2 RNA. https://doi.org/
10.1101/2020.08.17.20177006.
Kim, H.-Y., Lee, J.-H., Kim, M. J., Park, S. C., Choi, M., Lee, W., et al. (2021). Development
of a SARS-CoV-2-specific biosensor for antigen detection using scFv-fc fusion proteins.
Biosensors & Bioelectronics, 175. https://doi.org/10.1016/j.bios.2020.112868, 112868.
Korber, B., Fischer, W. M., Gnanakaran, S., Yoon, H., Theiler, J., Abfalterer, W., et al. (2020).
Tracking changes in SARS-CoV-2 spike: Evidence that D614G increases infectivity of the
COVID-19 virus. Cell, 182(4). https://doi.org/10.1016/j.cell.2020.06.043. 812–827.e19.
Laffeber, C., de Koning, K., Kanaar, R., & Lebbink, J. H. G. (2021). Experimental evidence for
enhanced receptor binding by rapidly spreading SARS-CoV-2 Variants. Journal of Molec-
ular Biology, 433(15). https://doi.org/10.1016/j.jmb.2021.167058, 167058.
Lee, J.-H., Choi, M., Jung, Y., Lee, S. K., Lee, C.-S., Kim, J., et al. (2021). A novel rapid de-
tection for SARS-CoV-2 spike 1 antigens using human angiotensin converting enzyme 2
(ACE2). Biosensors & Bioelectronics, 171. https://doi.org/10.1016/j.bios.2020.112715,
112715.
Li, Z., Yi, Y., Luo, X., Xiong, N., Liu, Y., Li, S., et al. (2020). Development and clinical ap-
plication of a rapid IgM-IgG combined antibody test for SARS-CoV-2 infection diagnosis.
Journal of Medical Virology, 92(9), 1518–1524. https://doi.org/10.1002/jmv.25727.
Li, B., Deng, A., Li, K., Hu, Y., Li, Z., Xiong, Q., et al. (2021). Viral infection and transmission
in a large, well-traced outbreak caused by the SARS-CoV-2 Delta variant [preprint].
Epidemiology. https://doi.org/10.1101/2021.07.07.21260122.
Liu, H., Dai, E., Xiao, R., Zhou, Z., Zhang, M., Bai, Z., et al. (2021). Development of a SERS-
based lateral flow immunoassay for rapid and ultra-sensitive detection of anti-SARS-
CoV-2 IgM/IgG in clinical samples. Sensors and Actuators B: Chemical, 329, 129196.
https://doi.org/10.1016/j.snb.2020.129196.
Mahari, S., Roberts, A., Shahdeo, D., & Gandhi, S. (2020). ECovSens-ultrasensitive novel
in-house built printed circuit board based electrochemical device for rapid detection of
nCovid-19 antigen, a spike protein domain 1 of SARS-CoV-2. https://doi.org/
10.1101/2020.04.24.059204.
Martin, J., Klapsa, D., Wilton, T., Zambon, M., Bentley, E., Bujaki, E., et al. (2020). Tracking
SARS-CoV-2 in sewage: Evidence of changes in virus variant predominance during
COVID-19 pandemic. Viruses, 12(10), 1144. https://doi.org/10.3390/v12101144.
Mavrikou, S., Moschopoulou, G., Tsekouras, V., & Kintzios, S. (2020). Development of a por-
table, ultra-rapid and ultra-sensitive cell-based biosensor for the direct detection of the
SARS-COV-2 S1 spike protein antigen. Sensors (Switzerland), 20(11). https://doi.org/
10.3390/s20113121.
McAulay, K., Bryan, A., Greninger, A. L., Grill, F., Lake, D., Kaleta, E. J., et al. (2020).
Retrospective clinical evaluation of 4 lateral flow assays for the detection of SARS-
CoV-2 IgG. Diagnostic Microbiology and Infectious Disease, 98(3), 115161. https://
doi.org/10.1016/j.diagmicrobio.2020.115161.
Meng, B., Kemp, S. A., Papa, G., Datir, R., Ferreira, I. A. T. M., Marelli, S., et al.
(2021). Recurrent emergence of SARS-CoV-2 spike deletion H69/V70 and its role in
the Alpha variant B.1.1.7. Cell Reports, 35(13), 109292. https://doi.org/10.1016/j.
celrep.2021.109292.
Moitra, P., Alafeef, M., Dighe, K., Frieman, M. B., & Pan, D. (2020). Selective naked-eye
detection of SARS-CoV-2 mediated by N gene targeted antisense oligonucleotide
capped Plasmonic nanoparticles. ACS Nano, 14(6), 7617–7627. https://doi.org/10.1021/
acsnano.0c03822.
Morley, A. A. (2014). Digital PCR: A brief history. Biomolecular Detection and Quantifica-
tion, 1(1), 1–2. https://doi.org/10.1016/j.bdq.2014.06.001.
Morris, C. P., Luo, C. H., Amadi, A., Schwartz, M., Gallagher, N., Ray, S. C., et al. (2021). An
update on SARS-CoV-2 diversity in the United States National Capital Region: Evolution
of novel and Variants of concern. Clinical Infectious Diseases: An Official Publication of
the Infectious Diseases Society of America, ciab636. https://doi.org/10.1093/cid/ciab636.
Motozono, C., Toyoda, M., Zahradnik, J., Ikeda, T., Saito, A., Tan, T. S., et al. (2021). An
emerging SARS-CoV-2 mutant evading cellular immunity and increasing viral infectivity
[preprint]. Microbiology. https://doi.org/10.1101/2021.04.02.438288.
Nguyen, P. Q., Soenksen, L. R., Donghia, N. M., Angenent-Mari, N. M., de Puig, H.,
Huang, A., et al. (2021). Wearable materials with embedded synthetic biology sensors
for biomolecule detection. Nature Biotechnology, 1–9. https://doi.org/10.1038/s41587-
021-00950-3.
Nolan, T., Hands, R. E., & Bustin, S. A. (2006). Quantification of mRNA using real-time
RT-PCR. Nature Protocols, 1(3), 1559–1582. https://doi.org/10.1038/nprot.2006.236.
Ong, S. W. X., Chiew, C. J., Ang, L. W., Mak, T.-M., Cui, L., Toh, M. P. H. S., et al. (2021).
Clinical and virological features of SARS-CoV-2 variants of concern: A retrospective co-
hort study comparing B.1.1.7 (Alpha), B.1.315 (Beta), and B.1.617.2 (Delta). Clinical In-
fectious Diseases: An Official Publication of the Infectious Diseases Society of America,
ciab721. https://doi.org/10.1093/cid/ciab721.
References 117
Palaz, F., Kalkan, A. K., Tozluyurt, A., & Ozsoz, M. (2021). CRISPR-based tools: Alternative
methods for the diagnosis of COVID-19. Clinical Biochemistry, 89, 1–13. https://doi.org/
10.1016/j.clinbiochem.2020.12.011.
Pandey, L. M. (2020). Design of engineered surfaces for prospective detection of SARS-CoV-
2 using quartz crystal microbalance-based techniques. Expert Review of Proteomics,
17(6), 425–432. https://doi.org/10.1080/14789450.2020.1794831.
Paweletz, C. P., Charboneau, L., & Liotta, L. A. (2001). Micro RT-PCR. Current Protocols in
Cell Biology, 10(1), A.3G.1–A.3G.6. https://doi.org/10.1002/0471143030.cba03gs10.
Peacock, T. P., Goldhill, D. H., Zhou, J., Baillon, L., Frise, R., Swann, O. C., et al. (2021). The
furin cleavage site in the SARS-CoV-2 spike protein is required for transmission in ferrets.
Nature Microbiology, 6(7), 899–909. https://doi.org/10.1038/s41564-021-00908-w.
Peñarrubia, L., Ruiz, M., Porco, R., Rao, S. N., Juanola-Falgarona, M., Manissero, D.,
et al. (2020). Multiple assays in a real-time RT-PCR SARS-CoV-2 panel can mitigate
the risk of loss of sensitivity by new genomic variants during the COVID-19 outbreak.
International Journal of Infectious Diseases, 97, 225–229. https://doi.org/10.1016/
j.ijid.2020.06.027.
Planas, D., Veyer, D., Baidaliuk, A., Staropoli, I., Guivel-Benhassine, F., Rajah, M. M., et al.
(2021). Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization. Na-
ture, 596(7871), 276–280. https://doi.org/10.1038/s41586-021-03777-9.
Qiu, G., Gai, Z., Tao, Y., Schmitt, J., Kullak-Ublick, G. A., & Wang, J. (2020). Dual-functional
plasmonic photothermal biosensors for highly accurate severe acute respiratory
syndrome coronavirus 2 detection. ACS Nano, 14(5), 5268–5277. https://doi.org/
10.1021/acsnano.0c02439.
Rahimi, H., Salehiabar, M., Barsbay, M., Ghaffarlou, M., Kavetskyy, T., Sharafi, A., et al.
(2021). CRISPR systems for COVID-19 diagnosis. ACS Sensors, 6(4), 1430–1445.
https://doi.org/10.1021/acssensors.0c02312.
Ramos, A. M., Vela-Perez, M., Ferrández, M. R., Kubik, A. B., & Ivorra, B. (2021). Modeling
the impact of SARS-CoV-2 variants and vaccines on the spread of COVID-19. Commu-
nications in Nonlinear Science and Numerical Simulation, 102, 105937. https://doi.org/
10.1016/j.cnsns.2021.105937.
Reardon, S. (2021). How the Delta variant achieves its ultrafast spread. Nature. https://doi.org/
10.1038/d41586-021-01986-w.
Ruiz-Vega, G., Soler, M., & Lechuga, L. M. (2021). Nanophotonic biosensors for point-of-
care COVID-19 diagnostics and coronavirus surveillance. Journal of Physics: Photonics,
3(1), 011002. https://doi.org/10.1088/2515-7647/abd4ee.
Salian, V. S., Wright, J. A., Vedell, P. T., Nair, S., Li, C., Kandimalla, M., et al. (2021).
COVID-19 transmission, current treatment, and future therapeutic strategies. Molecular
Pharmaceutics, 18(3), 754–771. https://doi.org/10.1021/acs.molpharmaceut.0c00608.
Sallam, M., & Mahafzah, A. (2021). Molecular analysis of SARS-CoV-2 genetic lineages in
Jordan: Tracking the introduction and spread of COVID-19 UK variant of concern at a
country level. Pathogens, 10(3), 302. https://doi.org/10.3390/pathogens10030302.
SARS-CoV-2 Total ab assay. (n.d.). Bio-Rad Laboratories. Retrieved August 25, 2021e, from
https://www.bio-rad.com/en-us/product/sars-cov-2-total-ab-assay?ID¼QADMT6E08O1Y.
Seo, G., Lee, G., Kim, M. J., Baek, S.-H., Choi, M., Ku, K. B., et al. (2020). Rapid detection of
COVID-19 causative virus (SARS-CoV-2) in human nasopharyngeal swab specimens
using Field-effect transistor-based biosensor. ACS Nano, 14(4), 5135–5142. https://doi.
org/10.1021/acsnano.0c02823.
Shahhosseini, N., Babuadze, G. G., Wong, G., & Kobinger, G. P. (2021). Mutation signatures
and in silico docking of novel SARS-CoV-2 variants of concern. Microorganisms, 9(5),
926. https://doi.org/10.3390/microorganisms9050926.
Shrivastav, A. M., Cvelbar, U., & Abdulhalim, I. (2021). A comprehensive review on
plasmonic-based biosensors used in viral diagnostics. Communications Biology, 4(1),
70. https://doi.org/10.1038/s42003-020-01615-8.
Shu, B., Kirby, M. K., Davis, W. G., Warnes, C., Liddell, J., Liu, J., et al. (2021). Multiplex
real-time reverse transcription PCR for influenza A virus, influenza B virus, and severe
acute respiratory syndrome coronavirus 2. Emerging Infectious Diseases Journal—
CDC, 27(7). https://doi.org/10.3201/eid2707.210462.
Shukha, Y., Makhoul, K., Abu-Elhija, J., Hayek, T., & Hamoud, S. (2021). A case of severe
COVID-19 pneumonia diagnosed in bronchoscopy with negative repeated nasopharyngeal
swabs. Journal of Medical Cases, 12(6), 217–219.
Smyrlaki, I., Ekman, M., Lentini, A., Rufino de Sousa, N., Papanicolaou, N., Vondracek, M.,
et al. (2020). Massive and rapid COVID-19 testing is feasible by extraction-free SARS-
CoV-2 RT-PCR. Nature Communications, 11(1), 4812. https://doi.org/10.1038/s41467-
020-18611-5.
Tegally, H., Wilkinson, E., Giovanetti, M., Iranzadeh, A., Fonseca, V., Giandhari, J., et al.
(2021). Detection of a SARS-CoV-2 variant of concern in South Africa. Nature,
592(7854), 438–443. https://doi.org/10.1038/s41586-021-03402-9.
Tian, B., Gao, F., Fock, J., Dufva, M., & Hansen, M. F. (2020). Homogeneous circle-to-circle
amplification for real-time optomagnetic detection of SARS-CoV-2 RdRp coding se-
quence. Biosensors & Bioelectronics, 165, 112356. https://doi.org/10.1016/j.bios.2020.
112356.
Uddin, M., Mustafa, F., Rizvi, T. A., Loney, T., Al Suwaidi, H., Al-Marzouqi, A. H. H., et al.
(2020). SARS-CoV-2/COVID-19: Viral genomics, epidemiology, vaccines, and therapeu-
tic interventions. Viruses, 12(5), 526. https://doi.org/10.3390/v12050526.
Unser, S., Bruzas, I., He, J., & Sagle, L. (2015). Localized surface plasmon resonance
biosensing: Current challenges and approaches. Sensors (Basel, Switzerland), 15(7),
15684–15716. https://doi.org/10.3390/s150715684.
van Dorp, L., Acman, M., Richard, D., Shaw, L. P., Ford, C. E., Ormond, L., et al. (2020).
Emergence of genomic diversity and recurrent mutations in SARS-CoV-2. Infection, Ge-
netics and Evolution, 83. https://doi.org/10.1016/j.meegid.2020.104351, 104351.
Vandenberg, O., Martiny, D., Rochas, O., van Belkum, A., & Kozlakidis, Z. (2020). Consid-
erations for diagnostic COVID-19 tests. Nature Reviews. Microbiology, 1–13. https://doi.
org/10.1038/s41579-020-00461-z.
Vogels, C., Watkins, A. E., Harden, C. A., Brackney, D. E., Shafer, J., Wang, J., et al. (2021).
SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity.
Med (New York, N.Y.), 2(3), 263–280.e6. https://doi.org/10.1016/j.medj.2020.12.010.
Volz, E., Mishra, S., Chand, M., Barrett, J. C., Johnson, R., Geidelberg, L., et al. (2021). Asses-
sing transmissibility of SARS-CoV-2 lineage B.1.1.7 in England. Nature, 593(7858),
266–269. https://doi.org/10.1038/s41586-021-03470-x.
Wang, C., Yang, X., Gu, B., Liu, H., Zhou, Z., Shi, L., et al. (2020). Sensitive and simultaneous
detection of SARS-CoV-2-specific IgM/IgG using lateral flow immunoassay based on
dual-mode quantum dot nanobeads. Analytical Chemistry, 92(23), 15542–15549.
https://doi.org/10.1021/acs.analchem.0c03484.
References 119
Wang, P., Nair, M. S., Liu, L., Iketani, S., Luo, Y., Guo, Y., et al. (2021). Antibody resistance
of SARS-CoV-2 variants B.1.351 and B.1.1.7. Nature, 593(7857), 130–135. https://doi.
org/10.1038/s41586-021-03398-2.
West, R., Gronvall, G., & Kobokovich, A. (2021). Variants, vaccines and what they mean for
COVID-19 testing. Johns Hopkins Bloomberg School of Public Health. https://www.
jhsph.edu/covid-19/articles/variants-vaccines-and-what-they-mean-for-covid19-testing.
html.
WHO COVID-19 Dashboard. (2020). WHO COVID-19 dashboard. Geneva: World Health
Organization. Available online: Https://covid19.who.int/ (last cited: [Date]). https://
covid19.who.int.
Wolk, D. M., Kaleta, E. J., & Wysocki, V. H. (2012). PCR–electrospray ionization mass
spectrometry. The Journal of Molecular Diagnostics: JMD, 14(4), 295–304. https://doi.
org/10.1016/j.jmoldx.2012.02.005.
Wu, J., & Ju, H. X. (2012). 3.07—Clinical immunoassays and immunosensing. In J. Pawliszyn
(Ed.), Comprehensive sampling and sample preparation (pp. 143–167). Academic Press.
https://doi.org/10.1016/B978-0-12-381373-2.00071-5.
Wu, Y., Xu, W., Zhu, Z., & Xia, X. (2020). Laboratory verification of an RT-PCR assay for
SARS-CoV-2. Journal of Clinical Laboratory Analysis, 34(10), e23507. https://doi.org/
10.1002/jcla.23507.
Xing, W., Liu, Y., Wang, H., Li, S., Lin, Y., Chen, L., et al. (2020). A high-throughput, multi-
index isothermal amplification platform for rapid detection of 19 types of common respi-
ratory viruses including SARS-CoV-2. Engineering (Beijing, China), 6(10), 1130–1140.
https://doi.org/10.1016/j.eng.2020.07.015.
Yakoh, A., Pimpitak, U., Rengpipat, S., Hirankarn, N., Chailapakul, O., & Chaiyo, S. (2021).
Paper-based electrochemical biosensor for diagnosing COVID-19: Detection of
SARS-CoV-2 antibodies and antigen. Biosensors & Bioelectronics, 176, 112912. https://
doi.org/10.1016/j.bios.2020.112912.
Yamamoto, S., Tanaka, A., Kobayashi, S., Oshiro, Y., Ozeki, M., Maeda, K., et al. (2021).
Consistency of the results of rapid serological tests for SARS-CoV-2 among healthcare
workers in a large national hospital in Tokyo, Japan. Global Health & Medicine, 3(2),
90–94. https://doi.org/10.35772/ghm.2021.01022.
Yang, Y., & Du, L. (2021). SARS-CoV-2 spike protein: A key target for eliciting persistent
neutralizing antibodies. Signal Transduction and Targeted Therapy, 6(1), 95. https://doi.
org/10.1038/s41392-021-00523-5.
Zhang, W., Du, R.-H., Li, B., Zheng, X.-S., Yang, X.-L., Hu, B., et al. (2020). Molecular
and serological investigation of 2019-nCoV infected patients: Implication of multiple
shedding routes. Emerging Microbes & Infections, 9(1), 386–389. https://doi.org/
10.1080/22221751.2020.1729071.
Zhao, H., Liu, F., Xie, W., Zhou, T.-C., OuYang, J., Jin, L., et al. (2021). Ultrasensitive
supersandwich-type electrochemical sensor for SARS-CoV-2 from the infected
COVID-19 patients using a smartphone. Sensors and Actuators. B, Chemical, 327,
128899. https://doi.org/10.1016/j.snb.2020.128899.
Zhu, X., Wang, X., Han, L., Chen, T., Wang, L., Li, H., et al. (2020). Multiplex reverse
transcription loop-mediated isothermal amplification combined with nanoparticle-based
lateral flow biosensor for the diagnosis of COVID-19. Biosensors & Bioelectronics,
166, 112437. https://doi.org/10.1016/j.bios.2020.112437.
Further reading
Access SARS-CoV-2 IgM Antibody Test. (n.d.). Beckman Coulter. Retrieved August 25, 2021,
from https://www.beckmancoulter.com/products/immunoassay/access-sars-cov-2-igm-an
tibody-test.
ACCESS SARS-CoV-2 IgM. (2020). Beckman Coulter. https://www.fda.gov/media/142911/
download.
Coronavirus (COVID-19) Update: FDA Authorizes First Test that Detects Neutralizing
Antibodies from Recent or Prior SARS-CoV-2 Infection. FDA; FDA. (2020, November 6).
https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-
authorizes-first-test-detects-neutralizing-antibodies-recent-or.
Diazyme DZ-Lite SARS-CoV-2 IgM CLIA Kit. (n.d.). Diazyme Laboratories, Inc. Retrieved
August 25, 2021, from https://www.diazyme.com/covid-19-antibody-tests/dz-lite-sars-
cov-2-igm-clia-kit.
Diazyme Laboratories, Inc. (2020 August 14). DIAZYME DZ-LITE SARS-CoV-2 IgM CLIA
KIT. Diazyme, 1–4. https://www.fda.gov/media/141255/download.
Elecsys® anti-SARS-CoV-2. (n.d.). Diagnostics. Retrieved August 24, 2021b, from https://di
agnostics.roche.com/us/en/products/params/elecsys-anti-sars-cov-2.html.
ELISA: Purpose, Procedure, and Results. (2012, July 19). Healthline. https://www.healthline.
com/health/elisa.
In Vitro Diagnostics EUAs—Molecular Diagnostic Tests for SARS-CoV-2. (2021, August
30). U.S. Food & Drug Administration; FDA. https://www.fda.gov/medical-devices/coro
navirus-disease-2019-covid-19-emergency-use-authorizations-medical-devices/in-vitro-
diagnostics-euas-molecular-diagnostic-tests-sars-cov-2.
Innovita 2019-nCoV Ab Test (Colloidal Gold)—Instructions for Use. (n.d.). https://www.fda.
gov/media/144071/download.
Labcorp’s COVID-19 RT-PCR Test EUA Summary. (2021). 30. https://www.fda.gov/media/
136151/download.
OmniPATH COVID-19 Total Antibody ELISA Test j COVID-19 Antibody Testing. (n.d.).
Thermo Fisher Scientific. Retrieved August 25, 2021, from https://www.thermofisher.
com/covid-19-antibody-testing/us/en/solutions/OmniPATH-COVID19-Total-Antibody-
ELISA-Test.html.
OmniPATH™ COVID-19 Total Antibody ELISA Test. (n.d.). https://www.fda.gov/media/
142700/download.
Platelia SARS-CoV-2 Total Ab. (n.d.). https://www.fda.gov/media/137493/download.
Roche develops new serology test to detect COVID-19 antibodies. (n.d.). Diagnostics. Re-
trieved August 24, 2021d, from shttps://diagnostics.roche.com/global/en/news-listing/
2020/roche-develops-new-serology-test-to-detect-covid-19-antibodies.html.
SalivaDirect Papers & Protocols. (n.d.). Retrieved August 31, 2021, from https://ysph.yale.
edu/salivadirect/publications/.
SARS-CoV-2 Total Antibody assay (CV2T). (n.d.). https://www.fda.gov/media/138757/
download.
Serology: Purpose, Results, and Aftercare. (2012, June 8). Healthline. https://www.healthline.
com/health/serology.
TaqPath COVID-19 multiplex diagnostic solution—US. (n.d.). Retrieved August 31, 2021,
from //www.thermofisher.com/us/en/home/clinical/clinical-genomics/pathogen-detection-
solutions/covid-19-sars-cov-2/multiplex.html.
Further reading 121
TaqPath™ COVID-19 Combo Kit and TaqPath™ COVID-19 Combo Kit Advanced
INSTRUCTIONS FOR USE. (n.d.). https://www.fda.gov/media/136112/download.
Testing Tool Kit, 2021. https://www.centerforhealthsecurity.org/covid-19TestingToolkit/test
ing-basics/types-of-COVID-19-tests/serology-tests.html.
Variants, Vaccines and What They Mean For COVID-19 Testing j Johns Hopkins
Bloomberg School of Public Health. (2021, February 2). Johns Hopkins Bloomberg
School of Public Health. https://publichealth.jhu.edu/2021/variants-vaccines-and-what-
they-mean-for-covid-19-testing.
What is Chemiluminescent immunoassay? j Lorne Laboratories UK. (n.d.). Lorne Laboratories
Ltd. Retrieved August 30, 2021, from https://www.lornelabs.com/news-events/blog/what-
is-chemiluminescent-immunoassay.
CHAPTER
CRISPR use in diagnosis

and therapy for COVID-19
Pallavi Deola, Aashwina Madhwalb, Gaurav Sharmaa, Rahul Kaushikc,

4
and Yashpal Singh Malikd,*
a
Virology Lab, Centre for Animal Disease Research and Diagnosis, ICAR-Indian Veterinary
Research Institute, Bareilly, India
b
Division of Pathology, ICAR-Indian Veterinary Research Institute, Bareilly, India
c
Laboratory for Structural Bioinformatics, Center for Biosystems Dynamics Research, RIKEN,
Yokohama, Japan
d
College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University,
Ludhiana, India
Abbreviations
AAV adeno-associated vectors
ACE-2 angiotensin converting enzyme-2
AIOD-CRISPR All-In-One Dual CRISPR-Cas12a
CARVER Cas13-assisted restriction of viral expression and readout
Cas CRISPR associated
CASdetect CRISPR-assisted detection
CONAN Cas3-operated nucleic acid detection
COVID-19 Coronavirus Disease 2019
CREST Cas13-based, Rugged, Equitable, Scalable Testing
CRISPR Clustered Regularly Interspaced Short Palindromic Repeat
crRNAs CRISPR RNAs
DETECTR DNA Endonuclease-Targeted CRISPR Trans Reporter
DR direct repeats
EUA emergency use authorization
FELUDA FnCas9 Editor Linked Uniform Detection Assay
GFP green fluorescent protein
gRNA guide RNA
HEDGES High-level Extended Duration Gene Expression System
HEPN higher eukaryotes and prokaryotes nucleotide binding domains
HPV human papilloma virus
IAV influenza A virus

123
124 CHAPTER 4 CRISPR use in diagnosis and therapy for COVID-19
ICTV International Committee on taxonomy of viruses

iSCAN in vitro Specific CRISPR-based Assay for Nucleic acids detection
LAMP loop-mediated isothermal amplification
LCMV lymphocytic choriomeningitis virus
LFA lateral flow assay
LoD limit of detection
LSPCF Localized Surface Plasmon Coupled Fluorescence
LSPR localized surface plasmon resonance
NER naked eye readout
NP nasopharyngeal
ORF open reading frame
PAC-MAN prophylactic antiviral CRISPR in human cells
PAM protospacer adjacent motif
PFS protospacer flanking sequence
POC point-of-care
PRRSV porcine reproductive and respiratory syndrome virus
RBD receptor binding domain
RdRP RNA-dependent RNA polymerase
RNP ribonucleoproteins
RPA recombinase polymerase amplification
SARS-CoV-2 Severe Acute Respiratory Syndrome Coronavirus- 2
SHERLOCK Specific High-Sensitivity Enzymatic Reporter Unlocking
SHINE SHERLOCK and HUDSON Integration to Navigate Epidemics
SNP single nucleotide polymorphism
STOP SHERLOCK Testing in One Pot
tracrRNA trans-activating CRISPR RNA
UTM Universal Transport Media
VaNGuard Variant Nucleotide Guard
VSV vesicular stomatitis virus
1 Introduction
An outbreak of a new human respiratory disease was noticed in late December 2019
at Wuhan city, Hubei province, China, caused by Severe Acute Respiratory Syn-
drome Coronavirus-2 (SARS-CoV-2), a new emerging corona virus (Jiang et al.,
2020). It has now infected over 211 million people worldwide with over 4.4 million
deaths since its onset (https://covid19.who.int/; accessed on August 24, 2021). The
Global Initiative on Sharing Avian Influenza Data (GISAID) website published the
first genome sequence of SARS-CoV-2 on January 10, 2020 and since then a plethora
of sequences have been released through the GISAID platform (Hu, Guo, Zhou, &
Shi, 2021). On January 9, 2020, the etiological agent was identified as a never seen
before betacoronavirus. Studies claimed that the 2019-nCoV (novel corona virus)
was found to be 96% identical at the whole-genome level to a bat coronavirus
(Zhou et al., 2020). On February 11, 2020, the International Committee on taxonomy
2 Diagnostics and therapeutics for SARS-CoV-2 125
of viruses (ICTV) named the virus 2019-nCoV SARS-CoV-2 and the World Health
Organization (WHO) named the disease coronavirus disease 2019 (COVID-19), then
declared it as a pandemic on March 11, 2020 (https://www.who.int/emergencies/dis
eases/novelcoronavirus2019). The whole of the globe was threatened causing high
morbidity and significant mortality. The SARS-CoV-2 virus belongs to the family
of enveloped positive-sense RNA genome viruses that infects both the upper and
lower respiratory tracts (Lu et al., 2020; Malik et al., 2021). The virus genome is
made up of 06 functional ORFs, arranged (50 to 30 ) as ORF1a/1b (replicase; covers
2/3rd of the 50 genome and encodes for polyprotein 1ab), spike surface glycoprotein
(S), small envelop protein (E), membrane protein (M), and nucleocapsid (N). It also
includes an RNA-dependent RNA polymerase (RdRP) which maintains genome
fidelity (Malik et al., 2021; Sexton et al., 2016).
Among structural proteins, the receptor binding spike surface glycoprotein,
which enables the virus to infect cells, is encoded by the “S gene.” In terms of nu-
cleotide sequence-based analysis, the “S-gene” of SARS-CoV-2 was observed to be
phylogenetically divergent from its previously known counterparts in other corona
viruses (Malik, Kumar, et al., 2020; Malik, Sircar, et al., 2020; Udugama et al.,
2020). However, the receptors used by SARS-CoV-2 are similar to the previously
known SARS-CoV, i.e., angiotensin converting enzyme-2 (ACE-2) (Zhou et al.,
2020). Some of the common symptoms of COVID-19 includes throat pain, fever,
body pain, cough and cold at initial stages of infection. In severe cases there may
be weakness, shortness of breath, skin rashes and congestion of conjunctiva. Certain
cases also revealed difficulty in breathing leading to severe hypoxia causing death
(Malik, Kumar, et al., 2020; Malik, Sircar, et al., 2020).
2 Diagnostics and therapeutics for SARS-CoV-2

Rationally, emergence of any pandemic accelerates researchers to develop rapid,
accurate, and ultrasensitive disease detection kits enabling the rapid implementation
of control measures. As COVID-19 shows both symptomatic and asymptomatic
traits, its early diagnosis remains vital for pandemic control and establishment of
an adequate therapeutic strategy for reducing the disease threat (Pizzol et al.,
2020). The basic approach of diagnosis starts from clinical symptoms ruling out
the aetiology leading to a cause confirmed by laboratory diagnosis. The designing
of a better technique completely relies on (Abbott et al., 2020) the proteomic and
genomic composition of the pathogen and/or (Abudayyeh et al., 2017) changes in
the expression of genes (proteins) in the host during and after infection (Udugama
et al., 2020). This is based on two approaches (1) Immunological (viz. RAPID,
ELISA, LFT) and 2) Molecular (viz. qPCR, LAMP). Between both, immunological
approaches involve serological tests to detect the antigens (structural protein of
virus) in lungs or antibodies in blood. It offers an enhanced understanding of the
ongoing mechanism and the dynamics of disease transmission (Mahase, 2020).
Whereas, the molecular approaches include mainly nucleic acid detection by
different methods which helps in early diagnosis of the disease. A list of other adjunct
diagnostic techniques are also exploited/developed to identify the disease including
non-invasive techniques like ultrasound as point-of-care ultrasound (POCUS), CT
scan, piezoelectric biosensing (surface of piezoelectric crystals are bounded by
SARS-CoV2 horse polyclonal antibodies from protein A), gold nanoparticles bio-
sensing (exploited largely for MERS CoV and HCoV viruses), LSPR (Localized sur-
face plasmon resonance approach), and optic immunosensors (LSPCF) (Layqah &
Eissa, 2019). The recorded consistent lung sonographic findings in a case series
of 20 patients in China with confirmed COVID-19 revealed pleural line irregularity
and thickening, focal B-lines, bilateral diffuse B-profile with spared areas, sub-
pleural consolidation and, rare pleural effusion (Peng, Wang, & Zhang, 2020;
Poggiali et al., 2020).
Among all the diagnostic techniques, PCR is one of the most adopted procedures
for detecting viral nucleic acids, and it has been declared as the gold standard
approach to diagnose the viral infections because of high sensitivity and accuracy.
Though, the quantitative PCR (qPCR) may be performed to diagnose COVID-19,
restricted availability to RT-qPCR equipment and materials may cause the diagnos-
tic procedure to take longer and to further complicate the situation because lower
viral loads may go undetected, resulting in false negative results (Broughton
et al., 2020; Wang, Doyle, & Mark, 1989). Hence, there is an immediate need to
adopt a diagnostic method with simplistic, time-efficient and highly accurate
throughput for diagnosing the emerging pathogen in the early stages of infection.
Most recent molecular diagnostics that can detect the presence of infection despite
lower viral titres can be beneficial to ensure timely diagnosis of all infected patients
(Xiang et al., 2020).
A quick detection of the virus serves half the game. However, successful thera-
peutic interventions are equally necessary to combat a viral disease. The develop-
ment of virus specific therapies is a daunting task owing to the involvement of
host factors in viral life cycle, due to which the number of approved antiviral ther-
apies are limited (De Clercq & Li, 2016). The mainstream therapeutic approaches for
the current pandemic of COVID-19 includes preventing the SARS-CoV-2 virus from
multiplication, which can be achieved by the use of the antiviral drugs (antic-
ipated benefits early in the course of disease) and/or with immune modulators,
which can modulate the immune response thereby helping the immune system fight
against the virus (more effective in the later stages of COVID-19) (https://www.
covid19treatmentguidelines.nih.gov/therapeutic-management/). Several hundred
antivirals, immunomodulators, neutralizing antibody therapies etc. are being ana-
lysed to discover effective treatments for the COVID-19 (https://www.raps.org/
news-and-articles/news-articles/2020/3/covid-19-therapeutics-tracker). Due to the
immediate needs, the repurposing of some of the existing antiviral drugs is also seen
as a feasible option. Along with the available options, it is equally important to in-
vestigate the diversified diagnostic and therapeutic approaches. Research is under-
way to develop novel rapid diagnostic techniques and to understand the effect of
distinct categories of potential treatments against SARS-CoV-2.
3 CRISPR/Cas systems 127
In the last few decades, genetic engineering techniques have immensely im-
proved the concept of disease diagnostics and therapeutics. CRISPR biotechnol-
ogies, where the Cas proteins act as effectors to recognize and degrade specific
genome targets, complimentary to a specific guide RNA (primarily a tool for genome
editing), is emerging as a potential tool for the development of new generation
diagnostics, prophylactics as well as therapeutics. In recent years, research has ex-
plored the potential of different CRISPR/Cas systems as a tool for the development
of novel diagnostics and therapeutics, due to specificity, design, feasibility etc. (Cox
et al., 2017).
3 CRISPR/Cas systems
Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR), refers to the
short repeating DNA sequences in the genome of prokaryotes. These sequences were
first identified in E. coli, by Dr. Ishino’s group in 1987, and since then these have
been discovered in different prokaryotes (Mojica, Diez-Villasenor, Soria, & Juez,
2000). When a prokaryote is infected by a virus the repeated sequences are
transcribed into CRISPR RNAs (crRNAs) that guide the CRISPR associated
(Cas) proteins to break the plasmid or viral RNA/DNA sequences. Therefore, the
CRISPR/Cas system is referred to as the adaptive immune system of prokaryotes
(Jinek et al., 2012). The CRISPR/Cas system is classified into class1 and class2,
and has six types (I-VI) with a continuously expanding list of at least 33 subtypes
(Makarova, Wolf, & Koonin, 2018). The hijacking of CRISPR/Cas9 system (class2;
type II) as molecular scissors for genome editing led the royal Swedish academy of
sciences to award the Nobel prize in chemistry (2020) to Emmanuelle Charpentier
and Jenifer A. Doudna (https://www.nobelprize.org/prizes/chemistry/2020/press-
release/). Mechanistically, the CRISPR/Cas systems primarily require two parts; a
nucleic acid binding domain, that recognizes the specific sequence and an effector
protein (Cas) that cleaves/regulates nucleic acids. The basic mechanistic steps in all
the CRISPR/Cas systems described till date are almost the same but the Cas proteins
involved in the processing exhibit substantial diversity. Since its discovery, this sys-
tem has been harnessed for a wide variety of applications, including the development
of novel diagnostic and therapeutic approaches against infectious diseases. In this
chapter, we present the use of different CRISPR/Cas systems for the potential devel-
opment of advanced diagnostic and therapeutic strategies for SARS-CoV-2 4
CRISPR-based diagnostics for SARS-Cov-2.
The CRISPR/Cas systems have an immense capability of transforming the
status of diagnostics and health care systems (Gootenberg et al., 2017) which are
presently ready to take advantage of this technology. The principles of “collateral
cleavage activity” have been exploited by recently developed CRISPR-based
diagnostics in which the developers have made fluorescently labelled ssDNA/
RNA reporter probes to detect the visible bands through the lateral flow assay in
a paper strip, for the development of a novel nucleic acid-based diagnostic tool
(Chen et al., 2018; Zhang, Abudayyeh, Gootenberg, Sciences, & Mathers, 2020). The
Cas effectors like Cas12a or Cas13 nuclease possessing collateral activity (described in
detail in the next section on therapeutics) are becoming the most popular. Amongst
these the Cas12 effectors are more effective in the detection of tumour associated viral
markers, such as HPV (Chen et al., 2018) and the Cas13 effectors are better at RNA
detection for viruses like Zika and Dengue (Gootenberg et al., 2017). Using this tech-
nology, different Cas proteins are exploited for the development of very efficient di-
agnostic kits for the diagnosis of COVID-19. The various types of Cas systems being
explored for COVID-19 diagnosis are discussed in the next sections of this chapter.
3.1 Cas12
The different approaches developed using various types and sub-types of the Cas12
system are discussed in this section.
3.1.1 Cas12a
Different methods developed using the Cas12a system are discussed in the following
sub-sections and summarized in Table 1.
Table 1 A summary of different approaches/methods developed using Cas12a

system.
Target gene in
Method SARS-CoV-2 Remarks
DETECTR (Broughton Envelop (E) and Uses RT-LAMP for reverse transcription
et al., 2020) Nucleoprotein (N) and isothermal amplification.
Given Emergency Use Authorization
(EUA) by FDA.
AIOD-CRISPR (Ding Nucleoprotein (N) Separate nucleic acid preamplification
et al., 2020; Zhang and multiple manual operations are
et al., 2020) required.
One-pot reaction system with visual
detection.
NER (Wang et al., Orf1a, Orf1b, SARS-CoV-2 nucleic acid detected as
2020) Nucleoprotein green fluorescence under 485 nm light.
(N) and Envelop (E) Portable with high sensitivity and
specificity.
iSCAN (Ali et al., 2020) Envelop (E) and RT-LAMP coupled with
Nucleoprotein (N) CRISPRCas12a.
Suitable for large-scale and early
detection of SARS-CoV-2 carriers.
VaNGuard (Ooi et al., N-gene Highly efficient for detecting viral
2021) mutations.
Robust, time and cost efficient,
sensitive, specific, convenient point-of-
care test for SARS-CoV-2.
3.1.1.1 DNA endonuclease-targeted CRISPR trans reporter (DETECTR)

The DETECTR system has been successfully used to differentiate between human
papillomavirus 18 (HPV18) and human papillomavirus 16 (HPV16) from clinical
samples as well as in the crude DNA isolated from cultured human cells within
an hour (Myhrvold et al., 2018). It simultaneously performs the reverse transcription
and isothermal amplification using the loop mediated amplification (RT-LAMP)
and specifically recognizes the viral sequence via Cas12, leading to the cleavage
of fluorescent and lateral flow reporter ssDNAs (Ramachandran et al., 2020). The
main steps of this procedure include, (a) RNA extraction from nasopharyngeal/oro-
pharyngeal swabs in the universal transport media (UTM), (b) Cas12 detection of
pre-established coronavirus sequences, and (c) Cleavage of the reporter molecule
(confirming virus) (Broughton et al., 2020). It has been demonstrated on predicted
SARS-CoV-2 sequences initially and further studied on many clinical samples. This
assay takes less than 40 min to complete and its limit of detection (LoD) is noted to be
10 copies/μL (Broughton et al., 2020). The primers for this test were designed to am-
plify the E (envelope) gene, having overlaps with the WHO assay (E gene region)
and N (nucleoprotein) with US CDC assay (N2 region in the N gene) of SARS-
CoV-2. The N1 and N3 regions lack the suitable PAM sites for the Cas12 gRNAs,
therefore these were not targeted for amplification (Safari et al., 2021). This test was
given EUA (emergency use authorization) by the FDA recently, provided it must
only be used at a single centre (https://www.fda.gov/media/139934/download). Fur-
ther studies on multi-centre comparison using clinical samples (Brandsma et al.,
2020) suggested that the DETECTR method was demonstrated to be an efficient
and rapid point-of-care (POC) test, with comparable sensitivity and specificity to
RT-qPCR. Some limitations of this technique include the carry over contamination,
need of nucleic acid extraction, kits and reagents, and requirement of personal
protective equipment (Rahimi et al., 2021).
3.1.1.2 All-in-one dual CRISPR-Cas12a (AIOD-CRISPR) assay

The CRISPR-Cas-based nucleic acid detection method usually needs individual
nucleic acid pre-amplification and multiple manual operations, that potentially
increases the risk of carry-over contaminations due to amplified products shifting.
In the AIOD-CRISPR assay, all the ingredients required for the nucleic acid ampli-
fication and CRISPR dependent detection are meticulously mixed in a one-pot
reaction system, and incubated at a fixed temperature, to eliminate the requirement
for individual pre-amplification and transfer of amplified product (Ding, Yin, Li,
Lalla, et al., 2020). The target sequence for SARS-CoV-2 in this method includes
a 121 bp N gene fragment (GenBank accession MT688716.1) and the initiation of
dual CRISPR-based nucleic acid detection with high efficiency done by dual
crRNAs without protospacer adjacent motif sites (PAM). The primers and crRNA
of the AIOD-CRISPR assay were designed by selecting four sites of the target
sequence, which were found to be highly conserved using the GISAID’s multiple
sequence alignment analysis (n ¼ 4663) of SARS-CoV-2 genomes (https://www.
gisaid.org/epifluapplications/next-hcov-19-app). The projected LOD of AIOD-
CRISPR is about 4.6 copies for RNA targets and 1.2 copies for DNA targets in a
40 min incubation. This assay has been implemented to identify the genomic RNA of
HIV and SARS-CoV-2 with high sensitivity within an hour (Ding, Yin, Li, Lalla,
et al., 2020; Zhang et al., 2020). It was corroborated by testing 28 COVID suspected
clinical swab samples where its ultra- specificity is demonstrated by detection of
HIV-1 with negligible background as compared to the reported real-time RPA
(Safari et al., 2021). The results were found to be consistent with that of the
RT-qPCR method and is developed for rapid, simple, specific, ultrasensitive, one-
pot, and visual detection of SARS-CoV-2. In addition, it replaced the need for a
big incubator with a low-cost hand warmer leading to an instrument-free point of
diagnostic method of COVID-19 (Ding, Yin, Li, Lalla, et al., 2020). A few limita-
tions of the AIOD-CRISPR assay are the need for nucleic acid extraction, and the
need for kits and reagents (Rahimi et al., 2021).
3.1.1.3 CRISPR/Cas12a-NER (naked eye readout)

Advances in diagnostic techniques has led to a more rapid and accurate method to
detect SARS-CoV-2 nucleic acid using the CRISPR/Cas12a-NER system, the
Cas12a protein, SARS-CoV-2 specific CRISPR RNAs (crRNAs) and a single-
stranded DNA (ssDNA) reporter labelled with a quenched green fluorescent mole-
cule. This reporter molecule is cleaved by Cas12a when there is SARS-CoV-2
nucleic acid in the detection system leading to green fluorescence clearly seen with
the naked eye under 485 nm light (Wang et al., 2020). There are 15 crRNAs designed
on four domains of the orf1a, orf1b, N and E genes over the Wuhan-Hu-1 strain
(GenBank accession number MN908947) that can distinguish other SARS-related
viruses on the basis of single nucleotide polymorphisms (SNPs). Results revealed
that 14 crRNAs, except the E-crRNA1, targeting SARS-CoV-2 were validated,
and were highly specific. Clinical validation of CRISPR/Cas12a-NER showed that
it has 100% agreement with the results of RT-qPCR assays confirming the high per-
formance of this platform (Wang et al., 2020). The portability, simplicity, sensitivity,
specificity, no need for special instruments, time-efficiency, and visibility of results
with the naked eye are some of the significant advantages of this method. However,
the need for nucleic acid extraction with availability of automated extraction equip-
ment, kits and reagents remain unaddressed drawbacks (Rahimi et al., 2021).
3.1.1.4 iSCAN (in vitro specific CRISPR-based assay for nucleic acids
detection)
The iSCAN system involves the RT-LAMP coupled with CRISPR/Cas12 for the
rapid, specific, accurate, sensitive detection of SARS-CoV2. Its development tar-
geted two regions in N (at the highly conserved 3’end) and E genes wherein the iden-
tified primer set efficiently amplify the synthetic virus fragments, but not the
controls. The LAMP primers were generated to ensure a robust amplification to suf-
fice the LAMP-based detection i.e., 200 bp amplification products. This approach
is specifically suitable for large-scale and early detection of SARS-CoV-2 carriers,
allowing the effective isolation of individuals to limit the spread of the virus.
Ali et al. validated the detection kit using extracted RNAs from clinical samples of
COVID-19 positive patients (Ali et al., 2020). A requirement of only rapid, field
deployable, simple equipment is highly advantageous in using iSCAN, as the spe-
cific and easy to use RTLAMP and CRISPR/Cas12 takes less than 1 h (colorimetric
reaction coupled to lateral flow immunochromatography makes easy interpretation
of the results). However, the need of kits and reagents remains unsolved (Rahimi
et al., 2021).
3.1.1.5 Variant nucleotide guard (VaNGuard) assay

This assay is highly efficient for viral mutations and can be utilized on purified RNA
or directly on nasopharyngeal (NP) swab samples (Ooi et al., 2021). It includes three
steps, viz. sample preparation, RT-LAMP reaction, and Cas12a based detection via
fluorescence or lateral flow assay. The sample preparation requires proteinase
K digestion of NP swabs and heat inactivation. The purified RNA or digested NP
swab samples are mixed as the templates into RT-LAMP reactions which is followed
by an incubation at 65 °C for 22 min. The enAsCas12a and ssDNA-probes are added
after the incubation to lead to a further incubation at 60 °C for another 5 min.
The end-point fluorescence in this assay may be spotted by a plate reader or a
RT-qPCR machine. Otherwise, a lateral flow strip may be implanted into each reaction
tube for an equipment-free read-out. (Ooi et al., 2021). This assay is a robust, rapid,
sensitive, affordable, specific, convenient point-of-care test for SARS-CoV-2.
However, the need for nucleic acid extraction, kits and reagents are among the
disadvantages (Rahimi et al., 2021).
3.1.2 Cas12b
Different methods developed using the Cas12b system are discussed in the following
Table 2 A summary of different approaches/methods developed using Cas12b

system.
Target gene in
STOP (Joung N-gene Appropriate for point-of-care applications.

et al., 2020) Detection of SARS-CoV-2 in about 1 h.
High sensitivity, cost efficiency, convenient
components, no need for RNA extraction.
CASdetect RdRp Cas12b-mediated DNA detection range of
(Guo et al., detection was 1 104 copies/mL with reduced
2020) false positive rate.
No cross-reactivity to other human endemic
coronaviruses.
3.1.2.1 STOP (SHERLOCK testing in one pot)

Recently, this assay was developed as a simple test for detection of SARS-CoV-2
in about 1 h, that is appropriate for point-of-care applications. As compared to
RT-qPCR-based SARS-CoV-2 tests, the sensitivity of STOP COVID has the
LOD of 100 copies of viral genome/μL. The test results are obtained in 70 min with
a dipstick, and in 40 min with a fluorescence readout. To make the test less complex
Zhang et al. developed a simple protocol that does not require the sample extraction
as it lyses the viral particles with QuickExtract at room temperature (22 °C) or in one-
pot at an incubation temperature of 60 °C for 10 min (Zhang et al., 2020). The Cas12b
is from Alicyclobacillus acidiphilus (AapCas12b) that sustains sufficient activity at
the same temperature range as LAMP (55–65 °C). It is utilized for the detection of the
N gene of SARS-CoV-2 in this defined assay. Since the AapCas12 locus lacks a
CRISPR array the AapCas12b was integrated with the scaffold of Alicyclobacillus
acidoterrestris Cas12b (AacCas12b) as tracrRNA (Trans-activating CRISPR
RNA). The validation test on the clinical samples showed this assay successfully di-
agnosed 12 positive and 5 negative COVID-19 patients, with a minimum 2 of 3 rep-
licates scoring positive in infected persons (Joung et al., 2020). The application of
this platform may considerably help “test-trace-isolate” approach, particularly in
the low-resource areas (Joung et al., 2020). Its simplicity, suitability for point-of-care
(POC) analysis, sensitivity, cost efficiency, handiness of its components, no need of
RNA extraction is among the main advantages of this assay whereas its disadvan-
tages are negligible (Rahimi et al., 2021).
3.1.2.2 CASdetect (CRISPR-assisted detection)

Another diagnostic assay based on CRISPR, called Cas12b-mediated DNA detection
(CDetection), was developed for the detection of SARS-CoV-2 (Guo et al., 2020).
The detection range of the CASdetect system for SARS-CoV-2 pseudovirus was
1 104 copies/mL, without cross-reactivity to other human endemic coronaviruses.
Incorporation of the sample treatment protocols and the nucleic acid amplification
strategies with CDetection, an integrated viral nucleic acid detection system CAS-
detect (CRISPR-assisted detection) was developed (Guo et al., 2020). Some of
the advantages of this tool are no cross-reactivity, reduced false positive rate, and
accuracy whereas disadvantages are the need for nucleic acid extraction, need of kits
and reagents (Rahimi et al., 2021).
3.1.3 Cas13
Different methods developed using Cas13 system are discussed in the following
3.1.3.1 Specific high-sensitivity enzymatic reporter unlocking

(SHERLOCK)
The SHERLOCK (Gootenberg et al., 2017) approach exploited Cas13a for the
detection of RNA molecules. Later, a diagnostic platform based on this method
was developed in 2018 (Gootenberg et al., 2018). This tool was employed for the
detection of COVID- 19 (Zhang et al., 2020), to develop an improved and specific
Table 3 A summary of different approaches/method developed using Cas13

system.
Target gene in
SHERLOCK S-gene and Specific High-Sensitivity Enzymatic Reporter

(Gootenberg et al., Orf1ab gene Unlocking.
2017) Exploited Cas13a for the detection of RNA
molecules.
Amenability to automation, the use of a
minimum volume of reagents, no need for
sophisticated equipment.
CREST (Rauch N-gene Cas13-based, Rugged, Equitable, Scalable
et al., 2021) Testing.
Cas13 detection is integrated with thermal
cycling amplification.
Potential to pick up positive cases at early
stages.
SHINE (Myhrvold ORF1a SHERLOCK and HUDSON Integration to
et al., 2018) Navigate Epidemics.
Need to prepare multiple reaction mixtures
and handling multiple samples.
Single-step reaction, no need for hospitals/
laboratories.
CARVER (Freije Putative genes N, Cas13-assisted restriction of viral expression
et al., 2019) E, RdRp or ORF and readout.
An end-to-end platform that uses Cas13 to
detect and destroy viral RNA.
Immense potential for diverse utility of rapid
diagnostic and antiviral drug development.
diagnostic kit for COVID-19 to two targets - one from the S-gene and the other from
the Orf1ab gene. The primers and gRNAs (LwaCas13a CRISPR) were developed
to detect COVID-19 RNA (not cross reacting with related viral genomes) (Hou
et al., 2020). This approach implements a non-targeted reporter RNA tagged to a
fluorescent dye for the identification of specific RNA molecules (Kellner, Koob,
Gootenberg, Abudayyeh, & Zhang, 2019). A web resource containing CRISPR-
Cas13 based assay designs has been developed to identify 67 viruses, including
SARS-CoV-2, Zika virus, and dengue virus, capable of selecting single or multiplex
panels (Chen et al., 2018). The sensitivity of COVID-19 target sequences using
SHERLOCK method is estimated in a range between 10 and 100 copies per micro-
liter of input (20 and 200 aM), i.e., LoD was 10–100 viral RNA copies/μL.
The SHERLOCK COVID-19 detection protocol can be completed in 1 h involv-
ing the following steps:
(1) An isothermal amplification of the sample (25 min incubation) with the help of
recombinase polymerase amplification (RPA) kit.
(2) Identification of pre-amplified viral RNA with Cas13 (30 min incubation)
(3) Read out of the outcome with paper dipstick (2 min incubation)
SHERLOCK was validated on 154 clinical samples, with 96% and 88% sensitivity
for the fluorescence and lateral flow readouts, respectively (Patchsung et al., 2020).
Additionally, both the assays had 100% specificity (Patchsung et al., 2020). The
advantages of SHERLOCK include amenability to automation and the use of a min-
imum volume of reagents, rapid, sensitive, and no need for sophisticated equipment
(Rahimi et al., 2021).
3.1.3.2 CREST (Cas13-based, rugged, equitable, scalable testing)

To minimize the blockade to COVID-19 diagnostics, a method called CREST
(Cas13-based, Rugged, Equitable, Scalable Testing) was devised (Rauch et al.,
2021). The CREST platform with Cas13 detection is integrated with a thermal
cycling amplification step (PCR), a linear amplification step (transcription), and
enzymatic signal amplification via fluorescence detection. It eliminates the 3 main
barriers, viz. reagent accessibility, equipment availability, and cost. Therefore, this
tool has been developed by harnessing the advantage of widely available enzymes,
low-cost thermocyclers (more cost effective than RT-qPCR), and easy-to-use fluores-
cent visualizers. Moreover, the CREST is equivalent in sensitivity (LOD-10 copies of a
target RNA molecule per microlitre) to the reverse transcription quantitative polymer-
ase chain reaction (RT-qPCR) method for COVID-19 testing. It therefore has the po-
tential to pick up positive cases earlier than regular tools (Rauch et al., 2021). The
advantages of CREST include that it can be executed from RNA sample to result with-
out any requirement of a dedicated facility, within 2 h, relieve some of the strain on
the global supply chain for testing reagents, does not need specialized instrumentation,
and requires very little specialized training. A few disadvantages are that, it requires
nucleic acid extraction, needs kits and reagents (Rahimi et al., 2021).
3.1.3.3 SHINE (SHERLOCK and HUDSON integration to navigate

epidemics)
To eliminate the need of nucleic acid extraction by using heat and chemical reduc-
tion, SHERLOCK can be combined with HUDSON (Heating Unextracted Diagnos-
tic Samples to Obliterate Nucleases), for both viral particle lysis and elimination of
RNA-degradation (Myhrvold et al., 2018). The combined SHERLOCK and HUD-
SON can be carried out with minimal infrastructure because only a heating element
is required. But, the need to prepare multiple reaction mixtures and handling multiple
samples in between are limitations. To address the current limitations of nucleic acid
diagnostics, a special tool has been developed, named SHINE (SHERLOCK and
HUDSON Integration to Navigate Epidemics) for extraction-free, rapid, and sensi-
tive detection of SARSCoV-2 RNA. It has been shown that SHINE can identify
SARS-CoV-2 RNA in HUDSON-treated samples (clinical) with either a paper-based
colorimetric readout, or an in-tube fluorescent readout that can be carried out with
portable equipment and reduced risk of sample contamination. Its advantages
include sensitivity, specificity, single-step reaction, no need for hospitals, laborato-

ries and nucleic acid extraction, whereas its disadvantages are negligible (Rahimi
et al., 2021).
3.1.3.4 CARVER (Cas13-assisted restriction of viral expression and

readout)
CARVER is an end-to-end platform that uses Cas13 to detect and destroy viral RNA.
Hundreds of crRNAs along with the LCMV (lymphocytic choriomeningitis virus)
genome were screened to assess how conservation and target RNA nucleotide con-
tent influences Cas13’s anti-viral activity (Freije et al., 2019). CARVER was also
used to detect RNA viruses such as, influenza A and vesicular stomatitis, providing
examples of its potential expanded application for the detection of a broad range of
viral nucleotides in disease diagnosis (Freije et al., 2019). Hence, it is quite clear that
Cas13 can be utilized to target a wide range of ssRNA viruses and CARVER has im-
mense potential for diverse utility of rapid diagnostic and antiviral drug development.
3.1.4 Cas3
3.1.4.1 Cas3-operated nucleic acid detection (CONAN)
A combination of RT-LAMP and Cas3-based nucleic acid detection, resulted in an
approach known as (CONAN) for COVID-19 diagnosis. Using post RNA isolation
from clinical samples, RT-LAMP was carried out for SARS-CoV-2, and the leading
amplicons were targeted using Cascade/Cas3 to achieve a fluorescence or lateral
flow readout. The lateral flow-based CONAN approach was implemented on 31 clin-
ical samples and showed 90% sensitivity and 95% specificity compared to the
RT-qPCR assay. Similar results were reported with the DETECTR method
(Broughton et al., 2020). Although, Cas3 was implemented for pathogen recognition
for the first time, efficiency was at a level comparable to that of the Cas12a-based
detection method, which has been in use for more than 2 years (Chen et al., 2018).
Therefore, an even more sensitive SARS-CoV-2 detection method can be created by
further optimization of the CONAN method. Advantages of this assay are time and
cost efficiency, highly sensitive, and efficient single-base-pair discrimination.
Whereas, disadvantages are nucleic acid extraction, and need of kits and reagents
(Rahimi et al., 2021).
3.1.5 Cas9
3.1.5.1 FnCas9 editor linked uniform detection assay (FELUDA)
This class of CRISPR/Cas approaches for nucleotide recognition is dependent on the
specific binding and cutting activity of CRISPR/Cas9. Previously, this method was
used for the detection of Zika virus. Explicitly, Cas9 from Francisella novicida
(FnCas9) was found to be highly specific for both target DNA binding and cleavage
(Acharya et al., 2019). Its high specificity helped in developing a FnCas9-based
nucleic acid detection method named (FELUDA) (Azhar et al., 2020), which was
quickly adapted by these authors for diagnosis of COVID-19. This method used
synthetic DNA fragments coding N gene of SARS-CoV-2, demonstrating that this
Table 4 List of diagnostic methods that can be used for diagnosis of COVID-19.
Method of Cas LODa (limit of
S. No. diagnosis enzyme detection) References
1 DETECTR Cas12a 10 copies/μL Broughton et al. (2020)

2 AIOD- Cas12a RNA Zhang et al. (2020) and Ding,
CRISPR 4.6 copies/μL Yin, Li, Lalla, et al. (2020)
DNA
1.2 copies/μL
in 40 min
3 CRISPR/ Cas12a 10 copies/μL Wang et al. (2020)
Cas12a-
NER
4 iSCAN Cas12a 10 copies/μL Ali et al. (2020)
5 VaNGuard Cas12a 20 copies/μL Ooi et al. (2021)
6 STOP Cas12b 100 copies Joung et al. (2020)
7 CASdetec Cas12b 1 104 copies/ Guo et al. (2020)
mL
8 SHERLOCK Cas13 10–100 viral RNA Gootenberg et al. (2018)
copies/μL
9 CREST Cas13 10 copies/μL Rauch et al. (2021)
10 SHINE Cas13 10 copies/μL Myhrvold et al. (2018)
11 CARVER Cas13 Yet to Freije et al. (2019)
comprehend
12 CONAN Cas3 1 copies/μL Chen et al. (2018)
13 FELUDA Cas9 10 copies/μL Azhar et al. (2020)
a
Each molecular method developed to detect COVID-19 is mentioned with its respective limit of
detection (LOD) and the Cas enzyme used.
assay can identify SARS-CoV-2 and is capable of distinguishing it from SARS-CoV

and H1N1 viral sequences. This method was validated by screening total RNA of
COVID-19 patient samples within 45 min. It is also claimed that FELUDA was com-
patible with fluorescence readout and with RT-RPA as a pre-amplification method
(Azhar et al., 2020). Thereafter, the FELUDA method was adapted for the lateral
flow readout by using the catalytically inactive form of FnCas9 (dFnCas9), FAM-
labelled trans-activating CRISPR RNA (tracrRNA), and biotinylated PCR primers
(Azhar et al., 2020). A summary of the limits of detection (LOD) and the Cas enzyme
used for all the diagnostic methods discussed above is provided in Table 4.
4 CRISPR-based therapeutics for SARS-Cov-2

The replication of viral nucleic acid inside the host cells is one of the key steps
required for completion of successful viral life cycle. Targeting viral genes and
rendering the virus non-replicative is considered as an ideal therapeutic strategy.
4 CRISPR-based therapeutics for SARS-Cov-2 137
For decades, the biggest hurdle for targeting the viral genome was the lack of precise
gene editing techniques. With the advent of the CRISPR/Cas systems, manipulation
of virus genes has been tested for therapeutic studies in many viruses (Freije et al.,
2019; Lee, 2019). Likewise, CRISPR/Cas systems can be utilized in different ways to
develop anti-SARS-CoV-2 strategies.
4.1 Disrupting the viral RNA genome

Most of the antiviral approaches target the proteinaceous structural or non-structural
components and inhibit the virus at one of the viral life cycle stages (attachment,
entry, uncoating, replication, assembly, release). Around the world, CRISPR/Cas
systems have been adopted by the scientific community to limit viral replication
by targeting the viral genome. The CRISPR/Cas9 has proven its potential as an anti-
viral strategy for many DNA viruses, in-vitro as well as in-vivo (reviewed by Lee,
2019). Likewise, the CRISPR/Cas12a system (from Lachnospiraceae bacterium) is
demonstrated as a promising tool to inactivate integrated HIV DNA genomes in cell
culture. Gao and co-workers also reported that Cas12a outperformed Cas9 for HIV
inhibition (Gao, Fan, Das, Herrera-Carrillo, & Berkhout, 2020). Moreover, unlike
Cas 9 and Cas12a CRISPR enzymes, which have the capability to manipulate
DNA, the CRISPR/Cas 13 system has been identified as a novel RNA guided RNA
targeting system (Abudayyeh et al., 2017). The Cas13 system can recognize and de-
grade the viral genome of SARS-CoV-2 by targeting positive sense single stranded
genomic RNA as well as viral mRNA formed by genomic and subgenomic RNA,
to limit virus replication. Identification of the RNA targeting activity of the
CRISPR/Cas13 system has immensely increased its potential applications in terms
of research and development of new anti-viral therapies and has the capability for
development of anti-SARS-CoV-2 therapies.
4.1.1 Overview of Crispr/Cas13 system

The CRISPR/Cas13 belongs to Class2; type VI CRISPR Cas family (the only known
CRISPR nuclease with a single-effector, exclusively targeting single stranded RNA)
with a minimum of four subtypes recognized; VI-A, Cas13a (Class2candidate2/
C2c2); VI-B, Cas13b (C2c6); VI-C, Cas13c (C2c7); and VI-D, Cas13d
(Abudayyeh et al., 2017; Cox et al., 2017; Lin et al., 2021). The Cas13a was used
as an RNA targeting enzyme (Abudayyeh et al., 2016) whereas Cas13b has been
adapted as a precise RNA editing enzyme (Cox et al., 2017). Like Cas9, Cas13a con-
sists of one crRNA recognition (REC) lobe and a nuclease (NUC) lobe which con-
tains various functional domains (O’Connell, 2019). The enzymes in the Cas13
family show two different catalytic activities: (a) RNA cleavage, mediated by two
RNase motifs (R-X4-H) which are conserved among all four subtypes that belong
to the superfamily of higher eukaryotes and prokaryotes nucleotide (HEPN) binding
domains (Zhang et al., 2018), (b) a guide RNA (gRNA) maturation activity (pre-
crRNA processing), probably due to activities in the Helical-1 and HEPN2 domains
(Abudayyeh et al., 2017).
4.1.2 Mechanism of action of CRISPR/Cas13 system

Mechanistically, the Cas13 enzymes require a 60–66 nucleotide long crRNA which
recognizes a 28–30 nucleotide long sequence on the target RNA. The crRNA is a
short hairpin structure and forms a complex with Cas13 enzyme like Cas9 enzyme.
Unlike Cas9, Cas13 does not require a protospacer adjacent motif (PAM) sequence at
the target locus. This property makes Cas13 system more flexible to use. Some mem-
bers of the Cas13 system require a protospacer flanking sequence (PFS) located near
the protospacer (not named PAM because it is used for a sequence used in self
and non-self-differentiation whereas PFS is not) which varies with the subtype
(Marraffini & Sontheimer, 2010). For example, subtype VI-D and a few members
of VI-A do not require PFS (Burmistrz, Krakowski, & Krawczyk-Balska, 2020). Un-
like Cas9 endonuclease that cleaves the dsDNA and reverts back to the inactive stage
once DNA is cleaved, Cas13-crRNA complex gets activated by binding to its target
RNA and cleaves the target ssRNA as well as the other RNAs non-specifically,
resulting in “collateral cleavage” activity (Abudayyeh et al., 2016). The property
of collateral damage is independent of the presence of PFS or homology to the
crRNA and was utilized for diagnostic purposes. For example, SHERLOCK
(Myhrvold et al., 2018) etc. that has been described above in the diagnostic section.
This bystander RNase activity is a general property of the class2 system which tar-
gets ssRNA. Some different subtypes of Cas13 have been studied for their antiviral
potential. A few of these studies are described under the heading, applications in next
section (Section 4.1.3).
4.1.3 Applications of Cas13 variants as potential antivirals

4.1.3.1 Cas13a
Cas13a was originally identified in 2015 by Shmakov and co-workers, as Leptotri-
chia shahii (LshCas13a) which utilizes a short 24 nt long crRNA. Unlike the most
widely used CRSIPR/Cas9 system which needs crRNA and trcrRNA (as a single
guide RNA (sgRNA)), Cas13a utilizes only a crRNA. The crRNA interacts with
the LshCas13a via a Uracil rich stem loop and requires a PFS consisting of A,
C or U base pair, located at the 30 end of the spacer sequence (Shmakov et al.,
2015). The Zhang lab at the Broad Institute of MIT and Harvard discovered that some
orthologues of Cas13 can be used in mammalian and plant cells (Abudayyeh et al.,
2017). Cas13a from Leptotrichia wadei (LwaCas13a) is well characterized and it
does not require a PFS at the target site, making it more flexible for therapeutic
applications. However, it requires stabilization by a monomeric superfolder green
fluorescent protein (GFP) for effective RNA knockdown in mammalian cells (Cox
et al., 2017). Moreover, the LwaCas13a does not display collateral cleavage activity
in eukaryotic cells. For Cas13a, the processing of pre-crRNA into mature crRNA is not
required, as pre-crRNAs themselves can acts as a guide for the cleavage of the ssRNA
target sequence (East-Seletsky, O’Connell, Burstein, Knott, & Doudna, 2017).
Blanchard and colleagues demonstrated that the specific activity of Cas13a to
knock down endogenous genes can be utilized for treatment of respiratory viral in-
fections including SARS-CoV-2 infections (Blanchard et al., 2021). They performed
a prophylactic as well as a therapeutic study in VeroE6 cells by targeting the con-

served regions (Nucleocapsid and replicase) of SARS-CoV-2, using synthetic
mRNA to express LbuCas13a (from Leptotrichia buccalis) and demonstrated that
SARS-CoV-2 was inhibited. They also demonstrated an in-vivo mitigation of the vi-
rus in a Syrian hamster model by using an inhalation-based apparatus to deliver
Cas13mRNA along with crRNA. In another study, with the help of bioinformatics
tools, crRNAs against the SARS-CoV-2 receptor binding domain (RBD) were iden-
tified and their editing efficiency was evaluated in human epithelial type II (AT2)
cells and human hepatocarcinoma cells (HepG2). They designed CRISPR/Cas13a
(LwaCas13a) based technology against SARS-CoV-2 for targeting and cleaving
its RNA and found that crRNA6 was a potential candidate (Wang et al., 2021). Apart
from the cleavage of SARS-CoV-2 RNA (a strategy considered useful in early
infection), they also used the same strategy for reducing viral proteins (more appro-
priate during late infections) using the dCas13a-crRNA6. DeadCas13a (dCas13a) is
a catalytically inactive version of Cas13a, generated by causing R474A and R1046A
mutations in the HEPN domains, which only binds with the target RNA sequence and
does not cleave it, thus regulating the transcription of SARS-CoV-2 genes
(Abudayyeh et al., 2017).
4.1.3.2 Cas13b
Like the Cas13a subtype, CRISPR loci encode a single effector protein, Cas13b
which contains two predicted HEPN domains at its N and C- termini. The
CRISPR/Cas13b system cleaves ssRNA using HEPN domains and also exhibits col-
lateral RNase activity. Apart from HEPN domains there is no sequence similarity
between 13a and 13b. Unlike Cas13a, Cas1 and Cas2 are absent in the Cas13b system
and it can process its own CRISPR array. The Cas13b system has two variants
denoted as VI-B1 and VI-B2 with their accessory proteins named as Csx27 and
Csx28 respectively. In the VI-B1 system, the Csx27 causes repression of Cas13b
whereas Csx28 enhances Cas13b activity. It has been shown that along with several
factors, the presence of secondary structure in the RNA target impacts the activity of
Cas13b enzymes (Smargon et al., 2017). A research group from Thailand showed
that CRISPR/Cas13b system effectively abrogated the porcine reproductive and
respiratory syndrome virus (PRRSV), by simultaneously targeting ORF5 and
ORF7 genes (Cui, Techakriengkrai, Nedumpun, & Suradhat, 2020).
The antiviral potential of Cas13 systems (both 13a and 13b) have been evaluated
in 3 different ssRNA viruses [lymphocytic choriomeningitis virus, (LCMV), Influ-
enza A virus (IAV) and vesicular stomatitis virus (VSV)] in cell culture by Freije
et al. (2019). They carried out a computational analysis followed by experimental
validation of viral genome sequences to create a repository of antiviral crRNAs.
They used Cas13a (LwaCas13a) and Cas13b (PspCas13b) from L. wadei and Pre-
votella sp. P5–125, respectively, to demonstrate the generalizability of the Cas13
system. Their study demonstrated that Cas13 can efficiently reduce the viral RNA
levels in mammalian cells, confirming the potent antiviral activity of Cas13 against
different ssRNA viruses (Freije et al., 2019). In comparison to the Cas13a system,
the CRISPR/Cas13b system was found to be more robust and its activity can be
upregulated or downregulated depending on the accessory proteins encoded by its
loci (Cox et al., 2017). Considering that SARS-CoV-2 also possess a ssRNA viral
genome, the same principles can be applied to generate anti SARS-CoV-2
therapeutics.
4.1.3.3 Cas13d
For working with this system, guide RNA is made up of a 30 nt direct repeat with a
22 nt spacer (Fig. 1). Spacer length of 22 nt is desirable as below this length the cleav-
age activity is significantly dropped. In mammalian cells, the collateral cleavage
activity of Cas13d is absent. Also, the target cleavage does not depend on the flank-
ing sequence requirements but the cleavage pattern varies with the target. For exam-
ple, Eubacterium siraeum/EsCas13d prefers uracil bases in the target region above
all other bases. The study was conducted to find out an active Cas13d orthologue in
eukaryotic cells and revealed that an engineered variant of Cas13d Ruminococcus
flavefaciens strain XPD3002 (Rfx) Cas13d (CasRx) can be developed into a flexible
tool for programmable ssRNA targeting in mammalian cells. They compared the
small hairpin RNA (shRNA) interference, CRISPR subtype VI-A/VI-B and Cas9
mediated transcriptional inhibition (CRISPRi) with CasRx and found that CasRx
outperformed with 96% knockdown as compared to 65% knockdown by shRNA, ap-
proximately 70% by CRISPRi and 53% by CRISPRi; suggesting CasRx was the most
efficient RNA regulating method. Another study by Yan and co-workers, character-
ized E. siraeum (EsCas13d) and Ruminococcus sp. (RspCas13d) orthologues of
Cas13d enzyme (Yan et al., 2018). They also showed that Cas13d associated acces-
sory proteins have a WYL domain, because the target activity of RspCas13d was
increased, indicating that this particular domain regulates the activity of Cas13d
(Yan et al., 2018). Recently, a research group from Stanford University developed
a potential CRISPR/Cas13d-based pan-coronavirus inhibition strategy. They named
it prophylactic antiviral CRISPR in human cells (PAC-MAN) and showed that it
could cleave the SARS-CoV-2 sequences that were effective as novel antiviral ther-
apy against COVID-19 (Abbott et al., 2020). Abbott and colleagues used CasRx and
synthesized 20 crRNAs targeting RNA-dependent RNA polymerase (RdRp) and Nu-
cleocapsid (N) genes, each. They chose a Cas13d expressing human lung epithelial
cell line (A549) to transduce the pool of crRNAs and found that the targeting RdRp
and N gene repressed a reporter by 86% and 71% respectively. It was also demon-
strated that the SARS-CoV-2 inhibition was quite sensitive to different crRNA con-
centrations and lowering the Cas13d expression has little effect on the inhibitory
activity of the Cas13d system (Abbott et al., 2020). They also suggested that
CRISPR/Cas13d can be used as an antiviral strategy, both prophylactically and ther-
apeutically (Fig. 2).
Consolidating the studies on antiviral capabilities of subtypes of CRISPR/Cas13
systems, Cox and co-workers detected that among the different orthologues of
Cas13a, b and c; Cas13b (PspCas13b) was the most specific and efficient for
RNA knockdown in mammalian cells (Cox et al., 2017). LwaCas13a had two major
FIG. 1
Schematics for SARS-Cov-2 detection using CRISPR/Cas platform. The RNA is extracted from the patient using conventional RNA extraction
method. For Cas12 based detection the RNA is amplified into dsDNA whereas for Cas13 based detection the amplified DNA is transcribed into
ssRNA. The collateral activity of both Cas12 and Cas13 is used for the detection of SARS-CoV-2.
FIG. 2
(A) CRISPR/Cas13d array showing HEPN domains. (B) Schematic of CRISPR/Cas13d
mechanism as an antiviral strategy. Cas13d shown as a green cloud and guide RNA (DR and
spacer) together forms a Cas13d:crRNA complex required for viral RNA degradation. DR:
Direct repeat.
issues; first it must be stabilized with monomeric super-folded GFP and secondly, the
average RNA knockdown efficiency was around 50% whereas PspCas13b provided
better efficiency as compared to LwaCas13a with 62.9% knockdown. Although
these systems can be reprogrammed to target ssRNA, it is difficult to pack them into
adeno-associated vectors (AAV) for in-vivo delivery due to their large size. In
comparison to Cas13a (1250 aa), Cas13b (1150 aa), and Cas13c (1120 aa), Cas13d
effector has an average length of 930 aa (the smallest class2 CRISPR effector) (Cox
et al., 2017; Shmakov et al., 2015; Smargon et al., 2017). Overall, the CRISPR/
Cas13d system seems to be the most practical system for a therapeutic approach
to target the SARS-CoV-2 genome. The small but robust CRISPR/Cas13d system
seems to be the latest technology for the RNA engineering toolbox.
This claim may be further supported by the following statements.
i. The size of Cas13d (approx. 930aa) is 17–26% smaller than other class2 type VI-
CRISPR/Cas subtypes (Cas13a-c); which makes it suitable for packaging in
low- capacity vectors, like AAV; making it particularly suitable for delivery
in primary cells and in-vivo applications.
ii. It lacks any sequence constraints for flanking sequences i.e., Cas13d does not
require the presence of PFS. This property makes it possible to target
theoretically any ssRNA sequence.
iii. Modular activity of WYL1 for CRSISPR/Cas13d system: CRISPR/Cas13d

locus consists of an accessory protein with the WYL domain (named for
three amino acids conserved in the original domain) (Yan et al., 2018).
Co-occurrence of Cas13d with accessory proteins having a WYL-domain
increases the targeted cleavage, implying such proteins act as regulators for
Cas13d activity.
iv. Comparison between Cas13a/b effectors and Cas13d effector (CasRx) as RNA
regulating systems, showed knockdown of approximately 70% by Cas13a/b
enzymes whereas 96% by CasRx.
Therefore, the strong catalytic activity, high specificity, and small size of the
Cas13d protein makes it the best choice for targeting the SARS-CoV-2 genome
(Abbott et al., 2020). Studies showed that the highly conserved regions of SARS-
CoV-2 [(Abbott et al., 2020) nucleocapsid (N) which protects the viral genome
and (Abudayyeh et al., 2017) RNA-dependent RNA polymerase (RdRp) which ca-
talyses the transcription of all viral mRNAs] can become potent targets of CRISPR/
Cas13d (Chan et al., 2020), thus disabling virus production and function (Abbott
et al., 2020).
4.2 Disrupting the host cell factors essential for SARS-CoV-2

infection
One of the key questions in virology has always been: how viruses that encode com-
paratively few genes, gain control over their host cells? The answer is partly because
some host factors are utilized by the viruses at some stage(s) during their life cycle.
Along with targeting SARS-CoV-2 genes, the identification of the host factors that
promote or restrict the replication of novel viruses can lead to the recognition of new
targets for antiviral therapeutics. For studying such interactions between virus and
host, different techniques including forward genetic screens are being used.
Although the CRISPR/Cas9 system is not the first technique to study genetic screens,
it has certainly emerged as the most robust tool to date. Basically, in forward genetic
screens, mutated genes are studied by changes in their phenotypes. Using genome
scale CRISPR/Cas screens, the host genes which promote or limit the viral replica-
tion, can be identified within the entire host genome. Genome wide CRISPR screens
are being carried out for SARS-CoV-2 by many researchers. For example, Wang and
co-workers found that apart from the well-known angiotensin converting enzyme
(ACE-2) entry receptors, other candidate host factors are TMEM106B, VAC14,
cholesterol regulators, and subunits of exocysts, that support the infection of
SARS-CoV-2 and thus can be targeted for development of potential antiviral strat-
egies (Wang, Simoneau, et al., 2021). Likewise, CRISPR based genetic screens have
found different candidate host genes (Daniloski et al., 2021; Wei et al., 2021; Zhu
et al., 2021) which can be targeted by the CRISPR/Cas9 system to generate potential
antiviral therapeutics for SARS-CoV-2.
5 Delivery of CRISPR/Cas components

Like the CRISPR/Cas9 system, the Cas13-crRNA also has different expression
modalities which includes, ribonucleoproteins (RNPs), mRNAs and plasmids.
Researchers are investigating different strategies to deliver the CRISPR components
successfully into the target host. Owing to the small size of the Cas13d enzyme, viral
delivery using adeno associated virus (AAV) can be considered as an in-vivo delivery
platform, which has shown promise in the mouse model (van Lieshout, Domm, &
Wootton, 2019). Also, a liposome- based gene delivery platform; high-level ex-
tended duration gene expression system (HEDGES) has been used to deliver the
CRISPR components in immunocompetent mice. Unlike viral delivery, this system
does not elicit any anti-vector immune response, host toxicity or DNA integration
into the host genome (Handumrongkul et al., 2019). HEDGES can be used to deliver
the crRNAs and the mRNA encoding the Cas13d. Krishnamurthy and co-workers
demonstrated that the amphiphilic shuttle peptides can also be used to deliver the
CRISPR components (as ribonucleoproteins/RNP) to cultured human epithelial cells
and to mouse airway epithelia (Krishnamurthy et al., 2019). Likewise, RNP based
delivery can also be performed using synthetic carriers like gold nanoparticles which
have been tested in a mice model (Amirkhanov & Stepanov, 2019; Shahbazi et al.,
2019). Guan and co-workers showed that the mRNA and plasmid DNA can be
delivered using poloxamine-based copolymer (peptide poloxamine nanoparticle) in-
vitro as well as in-vivo (mice lungs) genetic modifications (Guan et al., 2019). Despite
all these developments, in-vivo delivery of the CRISPR components to a particular cell
type of interest is still a matter of investigation. Delivery studies for the Cas13 system
are in its infancy especially because Cas13 systems are only beginning to be discovered
and characterized (East-Seletsky et al., 2016).
6 Limitations of CRISPR/Cas system

Although the Cas13d system holds the title of most promising tool for the develop-
ment of anti-viral strategies against RNA viruses including SARS-CoV-2, there are a
number of limitations which should be addressed before CRISPR/Cas13d technol-
ogy can be introduced to medical clinics;
i. First and foremost is the lack of a safe and effective in-vivo delivery method into
human respiratory tract cells: As the Cas13d enzyme has a small size, adeno-
associated virus (AAV) seems to be the most feasible option but the adaptive
immune response against AAV might be of a concern. Hopefully, one of the
methods mentioned in Section 6 could be used for the CRISPR based antiviral
delivery in humans using a nasal spray/nebulizer system, in the future.
ii. Off-target effects: An evaluation of the off-target activity of the crRNAs using
whole transcriptome RNA sequencing would be required.
7 Summary 145
iii. Validation of the above-mentioned studies in pre-clinical animal models

(macaques/ferrets) to test the specificity and efficacy of the CRISPR based
antiviral strategies.
iv. The most advanced study among the above-mentioned studies is PAC-MAN but
its major shortcoming is that it was done on synthetic constructs of the virus.
With knowledge of the exact effects of the CRISPR/Cas13 system, validation
could be done using live SARS-CoV-2.
7 Summary
Since the beginning of the COVID-19 pandemic, many diagnostic approaches
(RT-qPCR, RAPID, LFA) have been adopted, among which RT-qPCR turned out
to be the most popular/gold standard. But, one of the mystifying facets of
COVID-19 is its presentation of a wide range of symptoms which varies among dif-
ferent patients and needs early diagnosis for better management. Even though
RT-qPCR is a precise molecular technique false negative results may be obtained.
On the other hand, CRISPR-based SARS-CoV-2 detection approaches are cost
and time efficient, highly sensitive and specific, and do not require sophisticated
instruments. Moreover, they also have shown promise to increase scalability and
enable the diagnostic tests to be carried out at the point-of-care (POC). The CRISPR
can be customized to the target for any genomic region of interest within the desired
genome possessing a broad range of other applications and has been efficiently
implemented for diagnosis of SARS-CoV-2. Considering the therapeutics, we need
to understand that the traditional vaccines priming the immune system against the
exposure to the viral proteins shows a high rate of mutations, overcoming the host
immune response. In comparison, antiviral therapies targeting the highly conserved
gene sequences can limit the escape of SARS-CoV-2 by the immune system. The
CRISPR/Cas systems provide specific gene targeting with immense potential to
develop new generation diagnostics and therapeutics. Moreover, with the
CRISPR/Cas based therapeutics, multiplexing is possible, where different sgRNAs
or crRNAs can be guided to more than one target within the same gene thus decreas-
ing the possibility of viral escape mutants. As an exceptionally efficient tool the
CRISPR/Cas13 system, CARVER (Cas13-assisted restriction of viral expression
and readout) can be implemented to target a broad range of ssRNA viruses, and it
can be used for both, diagnosis and treatment for a variety of viral diseases including
SARS-CoV-2. However, the efficacy and safety of the CRISPR-based therapeutics
needs to be assessed in pre-clinical and clinical settings. Although the CRISPR bio-
technologies are not very helpful to control the present pandemic of COVID-19 there
is hope that the limitations of the CRISPR/Cas system can be overcome in the near
future. The CRISPR based strategies would lead to a new era in the field of disease
diagnosis and therapeutic development, that would make us better prepared for
future viral threats.
References
Abbott, T. R., Dhamdhere, G., Liu, Y., Lin, X., Goudy, L., Zeng, L., et al. (2020). Develop-
ment of CRISPR as an antiviral strategy to combat SARS-CoV-2 and influenza. Cell,
181(4), 865–876. e812. https://doi.org/10.1016/j.cell.2020.04.020.
Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., et al.
(2017). RNA targeting with CRISPR-Cas13. Nature, 550(7675), 280–284. https://doi.org/
10.1038/nature24049.
Abudayyeh, O. O., Gootenberg, J. S., Konermann, S., Joung, J., Slaymaker, I. M., Cox, D. B.,
et al. (2016). C2c2 is a single-component programmable RNA-guided RNA-targeting
CRISPR effector. Science, 353(6299), aaf5573. https://doi.org/10.1126/science.aaf5573.
Acharya, S., Mishra, A., Paul, D., Ansari, A. H., Azhar, M., Kumar, M., et al. (2019).
Francisella novicida Cas 9 interrogates genomic DNA with very high specificity and
can be used for mammalian genome editing. Proceedings of the National Academy of Sci-
ences of the United States of America, 116(42), 20959–20968. https://doi.org/10.1073/
pnas.1818461116.
Ali, Z., Aman, R., Mahas, A., Rao, G. S., Tehseen, M., Marsic, T., et al. (2020). iSCAN: An
RT-LAMP-coupled CRISPR-Cas12 module for rapid, sensitive detection of SARS-CoV-
2. Virus Research, 288, 198129. https://doi.org/10.1016/j.virusres.2020.198129.
Amirkhanov, R., & Stepanov, G. (2019). Systems of delivery of CRISPR/Cas9 ribonucleopro-
tein complexes for genome editing. Russian Journal of Bioorganic Chemistry, 45(6),
431–437.
Azhar, M., Phutela, R., Ansari, A. H., Sinha, D., Sharma, N., Kumar, M., et al. (2020). Rapid,
field-deployable nucleobase detection and identification using FnCas9. bioRxiv,
2020.2004.2007.028167. https://doi.org/10.1101/2020.04.07.028167.
Blanchard, E. L., Vanover, D., Bawage, S. S., Tiwari, P. M., Rotolo, L., Beyersdorf, J., et al.
(2021). Treatment of influenza and SARS-CoV-2 infections via mRNA-encoded Cas13a
in rodents. Nature Biotechnology, 39(6), 717–726. https://doi.org/10.1038/s41587-021-
00822-w.
Brandsma, E., Verhagen, H., van de Laar, T. J. W., Claas, E. C. J., Cornelissen, M., & van den
Akker, E. (2020). Rapid, sensitive and specific SARS coronavirus-2 detection: A multi-
center comparison between standard qRT-PCR and CRISPR based DETECTR. Journal
of Infectious Diseases. https://doi.org/10.1093/infdis/jiaa641.
Broughton, J. P., Deng, X., Yu, G., Fasching, C. L., Servellita, V., Singh, J., et al. (2020).
CRISPR-Cas12-based detection of SARS-CoV-2. Nature Biotechnology, 38(7), 870–874.
https://doi.org/10.1038/s41587-020-0513-4.
Burmistrz, M., Krakowski, K., & Krawczyk-Balska, A. (2020). RNA-targeting CRISPR-Cas
systems and their applications. International Journal of Molecular Sciences, 21(3). https://
doi.org/10.3390/ijms21031122.
Chan, J. F., Kok, K. H., Zhu, Z., Chu, H., To, K. K., Yuan, S., et al. (2020). Genomic char-
acterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with
atypical pneumonia after visiting Wuhan. Emerging Microbes & Infections, 9(1),
221–236. https://doi.org/10.1080/22221751.2020.1719902.
Chen, J. S., Ma, E., Harrington, L. B., Da Costa, M., Tian, X., Palefsky, J. M., et al. (2018).
CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.
Science, 360(6387), 436–439. https://doi.org/10.1126/science.aar6245.
References 147
Cox, D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B., Kellner, M. J., Joung, J., et al.
(2017). RNA editing with CRISPR-Cas13. Science, 358(6366), 1019–1027. https://doi.
org/10.1126/science.aaq0180.
Cui, J., Techakriengkrai, N., Nedumpun, T., & Suradhat, S. (2020). Abrogation of PRRSV
infectivity by CRISPR-Cas13b-mediated viral RNA cleavage in mammalian cells. Scien-
tific Reports, 10(1), 9617. https://doi.org/10.1038/s41598-020-66775-3.
Daniloski, Z., Jordan, T. X., Wessels, H. H., Hoagland, D. A., Kasela, S., Legut, M., et al.
(2021). Identification of required host factors for SARS-CoV-2 infection in human cells.
Cell, 184(1), 92–105. e116. https://doi.org/10.1016/j.cell.2020.10.030.
De Clercq, E., & Li, G. (2016). Approved antiviral drugs over the past 50 years. Clinical
Microbiology Reviews, 29(3), 695–747. https://doi.org/10.1128/cmr.00102-15.
Ding, X., Yin, K., Li, Z., Lalla, R. V., Ballesteros, E., Sfeir, M. M., et al. (2020). Ultrasensitive
and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay. Nature
East-Seletsky, A., O’Connell, M. R., Knight, S. C., Burstein, D., Cate, J. H., Tjian, R., et al.
(2016). Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and
RNA detection. Nature, 538(7624), 270–273. https://doi.org/10.1038/nature19802.
East-Seletsky, A., O’Connell, M. R., Burstein, D., Knott, G. J., & Doudna, J. A. (2017). RNA
targeting by functionally orthogonal type VI-A CRISPR-Cas enzymes. Molecular Cell,
66(3), 373–383. e373. https://doi.org/10.1016/j.molcel.2017.04.008.
Freije, C. A., Myhrvold, C., Boehm, C. K., Lin, A. E., Welch, N. L., Carter, A., et al. (2019).
Programmable inhibition and detection of RNA Viruses using Cas13. Molecular Cell,
76(5), 826–837. e811. https://doi.org/10.1016/j.molcel.2019.09.013.
Gao, Z., Fan, M., Das, A. T., Herrera-Carrillo, E., & Berkhout, B. (2020). Extinction of all
infectious HIV in cell culture by the CRISPR-Cas12a system with only a single crRNA.
Nucleic Acids Research, 48(10), 5527–5539. https://doi.org/10.1093/nar/gkaa226.
Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., et al.
(2017). Nucleic acid detection with CRISPR-Cas13a/C2c2. Science, 356(6336), 438–442.
https://doi.org/10.1126/science.aam9321.
Gootenberg, J. S., Abudayyeh, O. O., Kellner, M. J., Joung, J., Collins, J. J., & Zhang, F.
(2018). Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a,
and Csm6. Science, 360(6387), 439–444. https://doi.org/10.1126/science.aaq0179.
Guan, S., Munder, A., Hedtfeld, S., Braubach, P., Glage, S., Zhang, L., et al. (2019). Self-
assembled peptide-poloxamine nanoparticles enable in vitro and in vivo genome restora-
tion for cystic fibrosis. Nature Nanotechnology, 14(3), 287–297. https://doi.org/10.1038/
s41565-018-0358-x.
Guo, L., Sun, X., Wang, X., Liang, C., Jiang, H., Gao, Q., et al. (2020). SARS-CoV-2 detection with
CRISPR diagnostics. Cell Discovery, 6(1), 34. https://doi.org/10.1038/s41421-020-0174-y.
Handumrongkul, C., Ye, A. L., Chmura, S. A., Soroceanu, L., Mack, M., Ice, R. J., et al.
(2019). Durable multitransgene expression in vivo using systemic, nonviral DNA delivery.
Science Advances, 5(11), eaax0217. https://doi.org/10.1126/sciadv.aax0217.
Hou, T., Zeng, W., Yang, M., Chen, W., Ren, L., Ai, J., et al. (2020). Development and
evaluation of a rapid CRISPR-based diagnostic for COVID-19. PLoS Pathogens, 16(8),
e1008705. https://doi.org/10.1371/journal.ppat.1008705.
Hu, B., Guo, H., Zhou, P., & Shi, Z. L. (2021). Characteristics of SARS-CoV-2 and COVID-
19. Nature Reviews. Microbiology, 19(3), 141–154. https://doi.org/10.1038/s41579-020-
00459-7.
Jiang, S., Shi, Z., Shu, Y., Song, J., Gao, G. F., Tan, W., et al. (2020). A distinct name is needed
for the new coronavirus. Lancet, 395(10228), 949. https://doi.org/10.1016/s0140-6736
(20)30419-0.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012).
A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.
Science, 337(6096), 816–821. https://doi.org/10.1126/science.1225829.
Joung, J., Ladha, A., Saito, M., Segel, M., Bruneau, R., Huang, M. W., et al. (2020). Point-of-
care testing for COVID-19 using SHERLOCK diagnostics. medRxiv. https://doi.org/
10.1101/2020.05.04.20091231.
Kellner, M. J., Koob, J. G., Gootenberg, J. S., Abudayyeh, O. O., & Zhang, F. (2019). SHER-
LOCK: Nucleic acid detection with CRISPR nucleases. Nature Protocols, 14(10),
Krishnamurthy, S., Wohlford-Lenane, C., Kandimalla, S., Sartre, G., Meyerholz, D. K.,
Theberge, V., et al. (2019). Engineered amphiphilic peptides enable delivery of proteins
and CRISPR-associated nucleases to airway epithelia. Nature Communications, 10(1),
4906. https://doi.org/10.1038/s41467-019-12922-y.
Layqah, L. A., & Eissa, S. (2019). An electrochemical immunosensor for the corona virus as-
sociated with the Middle East respiratory syndrome using an array of gold nanoparticle-
modified carbon electrodes. Mikrochimica Acta, 186(4), 224. https://doi.org/10.1007/
s00604-019-3345-5.
Lee, C. (2019). CRISPR/Cas9-based antiviral strategy: Current status and the potential chal-
lenge. Molecules, 24(7). https://doi.org/10.3390/molecules24071349.
Lin, X., Liu, Y., Chemparathy, A., Pande, T., La Russa, M., & Qi, L. S. (2021).
A comprehensive analysis and resource to use CRISPR-Cas13 for broad-spectrum
targeting of RNA viruses. Cell Reports Medicine, 2(4), 100245. https://doi.org/10.1016/
j.xcrm.2021.100245.
Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., Wu, H., et al. (2020). Genomic characterisation and
epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor
binding. Lancet, 395(10224), 565–574. https://doi.org/10.1016/s0140-6736(20)30251-8.
Mahase, E. (2020). Covid-19: Coronavirus was first described in the BMJ in 1965. BMJ, 369,
m1547. https://doi.org/10.1136/bmj.m1547.
Makarova, K. S., Wolf, Y. I., & Koonin, E. V. (2018). Classification and nomenclature of
CRISPR-Cas systems: Where from here, The CRISPR Journal, 1(5), 325–336, Published
online 2018 Oct 17. https://doi.org10.1089/crispr.2018.0033.
Malik, Y. S., Sircar, S., Bhat, S., Ansari, M. I., Pande, T., Kumar, P., et al. (2020). How
artificial intelligence may help the Covid-19 pandemic: Pitfalls and lessons for the future.
Reviews in Medical Virology, e2205. https://doi.org/10.1002/rmv.2205.
Malik, Y. S., Kumar, N., Sircar, S., Kaushik, R., Bhat, S., Dhama, K., et al. (2020). Corona-
virus disease pandemic (COVID-19): Challenges and a global perspective. Pathogens,
9(7). https://doi.org/10.3390/pathogens9070519.
Malik, Y. S., Ansari, M. I., Kattoor, J. J., Kaushik, R., Sircar, S., Subbaiyan, A., et al. (2021).
Evolutionary and codon usage preference insights into spike glycoprotein of SARS-CoV-
2. Briefings in Bioinformatics, 22(2), 1006–1022. https://doi.org/10.1093/bib/bbaa383.
Marraffini, L. A., & Sontheimer, E. J. (2010). Self versus non-self discrimination during
CRISPR RNA-directed immunity. Nature, 463(7280), 568–571. https://doi.org/10.1038/
nature08703.
Mojica, F. J. M., Diez-Villasenor, C., Soria, E., & Juez, G. (2000). Biological significance of a
family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria.
Molecular Microbiology, 36, 244–246.
References 149
Myhrvold, C., Freije, C. A., Gootenberg, J. S., Abudayyeh, O. O., Metsky, H. C., Durbin, A. F.,
et al. (2018). Field-deployable viral diagnostics using CRISPR-Cas13. Science, 360(6387),
444–448. https://doi.org/10.1126/science.aas8836.
O’Connell, M. R. (2019). Molecular mechanisms of RNA targeting by Cas13-containing type
VI CRISPR-Cas systems. Journal of Molecular Biology, 431(1), 66–87. https://doi.org/
10.1016/j.jmb.2018.06.029.
Ooi, K. H., Liu, M. M., Tay, J. W. D., Teo, S. Y., Kaewsapsak, P., Jin, S., et al. (2021). An
engineered CRISPR-Cas12a variant and DNA-RNA hybrid guides enable robust and rapid
COVID-19 testing. Nature Communications, 12(1), 1739. https://doi.org/10.1038/s41467-
021-21996-6.
Patchsung, M., Jantarug, K., Pattama, A., Aphicho, K., Suraritdechachai, S., Meesawat, P.,
et al. (2020). Clinical validation of a Cas13-based assay for the detection of SARS-
CoV-2 RNA. Nature Biomedical Engineering, 4(12), 1140–1149. https://doi.org/
10.1038/s41551-020-00603-x.
Peng, Q. Y., Wang, X. T., & Zhang, L. N. (2020). Findings of lung ultrasonography of novel
corona virus pneumonia during the 2019-2020 epidemic. Intensive Care Medicine, 46(5),
Pizzol, J. L. D., Hora, V. P. D., Reis, A. J., Vianna, J., Ramis, I., Groll, A. V., et al. (2020).
Laboratory diagnosis for Covid-19: A mini-review. Revista da Sociedade Brasileira de
Medicina Tropical, 53, e20200451. https://doi.org/10.1590/0037-8682-0451-2020.
Poggiali, E., Dacrema, A., Bastoni, D., Tinelli, V., Demichele, E., Mateo Ramos, P.,
et al. (2020). Can lung US help critical care clinicians in the early diagnosis of novel
coronavirus (COVID-19) pneumonia? Radiology, 295(3), E6. https://doi.org/10.1148/radiol.
2020200847.
Rahimi, H., Salehiabar, M., Barsbay, M., Ghaffarlou, M., Kavetskyy, T., Sharafi, A., et al.
(2021). CRISPR systems for COVID-19 diagnosis. ACS Sensors, 6(4), 1430–1445.
https://doi.org/10.1021/acssensors.0c02312.
Ramachandran, A., Huyke, D. A., Sharma, E., Sahoo, M. K., Huang, C., Banaei, N., et al.
(2020). Electric field-driven microfluidics for rapid CRISPR-based diagnostics and its
application to detection of SARS-CoV-2. Proceedings of the National Academy of Sci-
ences of the United States of America, 117(47), 29518–29525. https://doi.org/10.1073/
pnas.2010254117.
Rauch, J. N., Valois, E., Solley, S. C., Braig, F., Lach, R. S., Audouard, M., et al. (2021).
A scalable, easy-to-deploy protocol for Cas13-based detection of SARS-CoV-2 genetic
material. Journal of Clinical Microbiology, 59(4). https://doi.org/10.1128/jcm.02402-20.
Safari, F., Afarid, M., Rastegari, B., Borhani-Haghighi, A., Barekati-Mowahed, M., &
Behzad-Behbahani, A. (2021). CRISPR systems: Novel approaches for detection and com-
bating COVID-19. Virus Research, 294, 198282. https://doi.org/10.1016/j.virusres.2020.
198282.
Sexton, N. R., Smith, E. C., Blanc, H., Vignuzzi, M., Peersen, O. B., & Denison, M. R. (2016).
Homology-based identification of a mutation in the coronavirus RNA-dependent RNA
polymerase that confers resistance to multiple mutagens. Journal of Virology, 90(16),
7415–7428. https://doi.org/10.1128/jvi.00080-16.
Shahbazi, R., Sghia-Hughes, G., Reid, J. L., Kubek, S., Haworth, K. G., Humbert, O., et al.
(2019). Targeted homology-directed repair in blood stem and progenitor cells with
CRISPR nanoformulations. Nature Materials, 18(10), 1124–1132. https://doi.org/
10.1038/s41563-019-0385-5.
Shmakov, S., Abudayyeh, O. O., Makarova, K. S., Wolf, Y. I., Gootenberg, J. S.,
Semenova, E., et al. (2015). Discovery and functional characterization of diverse class
2 CRISPR-Cas systems. Molecular Cell, 60(3), 385–397. https://doi.org/10.1016/j.

molcel.2015.10.008.
Smargon, A. A., Cox, D. B. T., Pyzocha, N. K., Zheng, K., Slaymaker, I. M., Gootenberg, J. S.,
et al. (2017). Cas13b is a type VI-B CRISPR-associated RNA-guided RNase differentially
regulated by accessory proteins Csx27 and Csx28. Molecular Cell, 65(4), 618–630. e617.
https://doi.org/10.1016/j.molcel.2016.12.023.
Udugama, B., Kadhiresan, P., Kozlowski, H. N., Malekjahani, A., Osborne, M., Li, V. Y. C.,
et al. (2020). Diagnosing COVID-19: The disease and tools for detection. ACS Nano,
14(4), 3822–3835. https://doi.org/10.1021/acsnano.0c02624.
van Lieshout, L. P., Domm, J. M., & Wootton, S. K. (2019). AAV-mediated gene delivery to
the lung. Methods in Molecular Biology, 1950, 361–372. https://doi.org/10.1007/978-1-
4939-9139-6_21.
Wang, X., Zhong, M., Liu, Y., Ma, P., Dang, L., Meng, Q., et al. (2020). Rapid and sensitive
detection of COVID-19 using CRISPR/Cas12a-based detection with naked eye readout,
CRISPR/Cas12a-NER. Science Bulletin (Beijing), 65(17), 1436–1439. https://doi.org/
10.1016/j.scib.2020.04.041.
Wang, R., Simoneau, C. R., Kulsuptrakul, J., Bouhaddou, M., Travisano, K. A., Hayashi, J. M.,
et al. (2021). Genetic screens identify host factors for SARS-CoV-2 and common cold
coronaviruses. Cell, 184(1), 106–119. e114. https://doi.org/10.1016/j.cell.2020.12.004.
Wang, A. M., Doyle, M. V., & Mark, D. F. (1989). Quantitation of mRNA by the polymerase
chain reaction. Proceedings of the National Academy of Sciences of the United States of
America, 86(24), 9717–9721. https://doi.org/10.1073/pnas.86.24.9717.
Wei, J., Alfajaro, M. M., DeWeirdt, P. C., Hanna, R. E., Lu-Culligan, W. J., Cai, W. L., et al.
(2021). Genome-wide CRISPR screens reveal host factors critical for SARS-CoV-2 infec-
tion. Cell, 184(1), 76–91. e13. https://doi.org/10.1016/j.cell.2020.10.028.
Xiang, X., Qian, K., Zhang, Z., Lin, F., Xie, Y., Liu, Y., et al. (2020). CRISPR-cas systems
based molecular diagnostic tool for infectious diseases and emerging 2019 novel corona-
virus (COVID-19) pneumonia. Journal of Drug Targeting, 28(7–8), 727–731. https://doi.
org/10.1080/1061186x.2020.1769637.
Yan, W. X., Chong, S., Zhang, H., Makarova, K. S., Koonin, E. V., Cheng, D. R., et al. (2018).
Cas13d is a compact RNA-targeting type VI CRISPR effector positively modulated by
a WYL-domain-containing accessory protein. Molecular Cell, 70(2), 327–339. e325.
https://doi.org/10.1016/j.molcel.2018.02.028.
Zhang, C., Konermann, S., Brideau, N. J., Lotfy, P., Wu, X., Novick, S. J., et al. (2018). Struc-
tural basis for the RNA-guided ribonuclease activity of CRISPR-Cas13d. Cell, 175(1),
212–223. e217. https://doi.org/10.1016/j.cell.2018.09.001.
Zhang, F., Abudayyeh, O. O., Gootenberg, J. S., Sciences, C., & Mathers, L. (2020).
A protocol for detection of COVID-19 using CRISPR diagnostics. Bioarchives, 8.
Zhou, P., Yang, X. L., Wang, X. G., Hu, B., Zhang, L., Zhang, W., et al. (2020). A pneumonia
outbreak associated with a new coronavirus of probable bat origin. Nature, 579(7798),
Zhu, Y., Feng, F., Hu, G., Wang, Y., Yu, Y., Zhu, Y., et al. (2021). A genome-wide CRISPR
screen identifies host factors that regulate SARS-CoV-2 entry. Nature Communications,
12(1), 961. https://doi.org/10.1038/s41467-021-21213-4.
CHAPTER
Recent and advanced

nano-technological
strategies for COVID-19
vaccine development
5
Chinekwu Sherridan Nwagwua,∗, Chinenye Nnenna Ugwub,
John Dike Nwabueze Ogbonnaa, Adaeze Linda Onugwua, Chinazom Precious Agboa,
Adaeze Chidiebere Echezonaa, Ezinwanne Nneoma Ezeibeb, Samuel Uzondua,
Frankline Chimaobi Kenechukwua, Paul Achile Akpaa, Mumuni Audu Momoha,
Petra Obioma Nnamania, Clemence Tariraic, Kenneth Chibuzor Ofokansia,
and Anthony Amaechi Attamaa
a
Drug Delivery & Nanomedicines Research Laboratory, Department of Pharmaceutics, University
of Nigeria, Nsukka, Enugu State, Nigeria
b
Department of Pharmaceutical Microbiology and Biotechnology, University of Nigeria, Nsukka,
Enugu state, Nigeria
c
Department of Pharmaceutical Sciences, Tshwane University of Technology, Pretoria,
South Africa
∗
Corresponding author: e-mail address: [email protected]
1 Introduction
The coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syn-
drome coronavirus 2 (SARS-CoV-2) and is one of the most difficult health crises that
humanity has faced in recent years. The pandemic has affected millions of people
across the globe causing harm to humans as well as the economies of nations. Several
public health strategies such as the use of masks, social distancing, regular washing
of hands as well as contact tracing, have been employed since the beginning of the
outbreak to curtail the spread of the virus. However, these practices have not been
able to completely prevent the widespread of the pandemic (Young, Thone, & Jik,
2021). Despite the tireless efforts of researchers and scientists all over the world,
there is as of now, still, no cure for COVID-19, although the United States Food
and Drugs Administration (FDA) recently approved the use of remdesivir for
treatment, especially in severe cases of viral infection (Campos et al., 2020). The
outbreak of the pandemic has stretched the limits of healthcare systems and chal-
lenged the management of the situation using conventional tools in the development
151
152 CHAPTER 5 Recent nano-technological strategies for COVID-19 vaccines
of treatment therapies, vaccines, and other preventive as well as diagnostic measures

(Campos et al., 2020). Vaccination over the years has proven to be the most effective
approach for the control and prevention of infectious diseases. Therefore, the control
and subsequent total eradication of the pandemic requires the development of effec-
tive and safe vaccine protocols (Chung, Beiss, Fiering, & Steinmetz, 2020). The ma-
jor focus in the development of COVID-19 vaccines is to limit and possibly totally
prevent severe illness as well as the widespread of the virus. Studies have suggested
that neutralizing antibodies confer protection as they inhibit viral entry by preventing
the interaction between the rapid binding domain (RBD) of the SARS-COV-2 spike
(S) protein with the angiotensin-converting enzyme (ACE) 2 receptors. Other
approaches have also explored the role of T-cells in clearing infected cells. Some
other approaches suggest the best approach for developing an efficient as well as
safe COVID-19 vaccine is to ensure a balance between antibody and T-cell res-
ponses (Chauhan et al., 2020). There are about 117 vaccine candidates in clinical
development and 194 candidates in pre-clinical development, with only about four
candidates approved for use in humans (World Health Organization, 2021). Nano-
technological interventions have provided immense benefits in the area of vaccine
development over the years, from providing sustainable nanomaterials for the deliv-
ery of antigens to being utilized as vaccine adjuvants to potentiate immune responses
to vaccines. This is particularly important for the development of COVID-19 vac-
cines as some studies suggest that the SARS-COV-2 is a functional nanomaterial,
possessing nano-metric dimensions with a nano-core-shell structure (Ruiz-Hitzky
et al., 2020). This study focuses on reviewing the contributions of nanotechnological
approaches in the development of COVID-19 vaccines.
2 The structure and infection mechanism of SARS-COV-2

SARS-CoV-2 is a beta-coronavirus and a single-stranded positive-sense RNA
(+ssRNA) which is bigger than any other RNA virus in the genome of CoVs
(27–32 kb) (Wang, Hu, et al., 2020; Wang, Peng, Xu, Cui, & Williams, 2020;
Wang, Zhao, et al., 2020). The capsid outside the genome is created by the nucleo-
capsid protein (N), and the genome is further packed by an envelope made up of three
structural proteins: membrane protein (M), spike protein (S), and envelope protein
(E) (Wan, Shang, Graham, Baric, & Li, 2020). SARS-CoV-2 is encoded by four
structural proteins (S, E, M, and N) and sixteen non-structural proteins (nsp1–16).
The M protein is the most abundant which shapes the virions (envelop) and is com-
prised of three transmembrane territories, that encourage membrane curving and
helps fix the nucleocapsid (Ahmed et al., 2021). On the other hand, protein E is
the smallest structural protein and performs important roles in the assembly and dis-
charge of viruses (DeDiego et al., 2007; Nieto-Torres et al., 2014). The N protein is
associated with RNA which forms an envelope containing the nucleocapsid. Addi-
tionally, N protein is largely involved in the viral genome processes and replication
cycle which involves the assembly, budding, and also stimulating the host cellular
response to viral infection (Chang et al., 2006; Hurst, Koetzner, & Masters, 2009).
3 Pathogenesis and clinical presentation of COVID-19 153
The S proteins have polymers that get embedded in the virion, obtaining the crown-like
appearance, which helps the virus connect to the host cell’s surface receptors and com-
bines the viral and host cell membranes, allowing the virus to enter the host cell
(Boopathi, Poma, & Kolandaivel, 2020). The spike protein (S-protein) facilitates
the coronavirus access into host cells (Wang, Hu, et al., 2020; Wang, Peng, et al.,
2020; Wang, Zhao, et al., 2020) by attaching to the ACE-2 receptor which has high
expression on some cell types, such as endothelial cells, alveolar cells, kidney cells,
intestinal epithelial cells, monocytes/macrophages, in addition to neuro-epithelial cells
and neurons (Wan et al., 2020; Zhou et al., 2020) and low-to-no expression, in most
cells and organs of the immune system (blood cells, spleen, bone marrow, and blood
vessels) (Garciá, Mancilla-Galindo, Paredes-Paredes, Tiburcio, & Ávila-Vanzzini,
2021). After the spike (S) protein binds to the ACE-2 receptor, cleavage by transmem-
brane proteases serine 2, cathepsin, or furin causes endocytosis and translocation of the
SARS-CoV-2 into endosomes (Reza-Zaldıvar, 2021), or direct viral envelope fusion
with host cell membrane for cell entrance (Sanclemente-Alaman et al., 2020). Since
the SARS-CoV-2 S protein is highly glycosylated and remains mostly in a closed pre-
fusion conformation (Turoňová et al., 2020), pre-activation of the S protein by furin
protease is thought to be an essential step to expose its receptor-binding domain
(Garciá et al., 2021).
3 Pathogenesis and clinical presentation of COVID-19

SARS-CoV-2 is the cause of COVID-19 disease. Three phases of SARS-CoV-2 in-
fection match different clinical stages of the COVID-19 disease, based on the cells
affected (Mason, 2020). The first phase is the asymptomatic state, at this point, the
inhaled SARS-CoV-2 virus binds to epithelial cells in the nasal cavity and starts rep-
licating as seen in Fig. 1. The presence of the virus can be confirmed by swabbing
the nasal cavity (Mason, 2020). The viral load at this stage although very low is very
infectious and presents a limited innate immune response. At this point, the virus can
be transmitted even before the symptoms appear (Yang, 2021). The second phase is
when the virus replicates and moves down the respiratory tract. This triggers an in-
crease in the innate immune response. The virus and early markers of the innate
immune system can be detected by nasal swabs or sputum. At this phase, there is
a mild clinical manifestation of the COVID-19. Individuals affected at this point
can be managed at home with conventional treatment of the patients’ symptoms.
(Wu & McGoogan, 2020). Only about 20% of the infected patients progresses to
the final stage of the disease which presents with massive pulmonary infiltration
(Wu & McGoogan, 2020). Here, the virus invades the gas exchange components
of the lungs and contaminates the alveolar type II cells (Mason, 2020). SARS-
CoV-2 reproduces within the T-cells, discharging a huge amount of viral particles
which instigates the cells to encounter caspase-mediated cell death and die (Qian
et al., 2012). This stage initiates severe flu-like symptoms that can progress to acute
respiratory distress (ARD), pneumonia, renal failure as well as death (Ksiazek et al.,
2003; Wang, Hu, et al., 2020; Wang, Peng, et al., 2020; Wang, Zhao, et al., 2020).
FIG. 1
Structure, transmission and common symptoms of SARS-CoV2 infection. Shown is the structure of SARS-CoV2, the common routes of
transmission, and the common symptoms of infection with the virus).
4 Vaccine development strategies and platforms 155
Initial studies about COVID-I9 reported the effect of the disease mainly on the re-
spiratory tract but also on the gastrointestinal tract (Fig. 1). However, more recent
reports strongly suggest that the disease can lead to several extra-pulmonary compli-
cations and even multiple organ injuries. There have been reports of myocardial in-
flammation and venous thromboembolism especially with patients with pre-existing
cardiovascular conditions (Sarkesh et al., 2020). Hematological complications such
as lymphopenia, increased level of interleukin 6 (IL-6) and some cytokines, throm-
bocytopenia, neutrophilia caused by hyper-inflammatory and cytokine storm result-
ing in severe organ malfunction and physiologic decompensation have been reported
in patients with severe symptoms of COVID-19 (Alexandrova, Beykov, Vassilev,
Jukic, & Podlipnik, 2021). Viral infections have over the years been known to cause
serious structural and functional damage to the nervous system (Rahman et al., 2020;
Sarkesh et al., 2020). Several studies have reported some central nervous system
(CNS) complications such as cerebral infarctions in patients with severe cases of
COVID-19 disease (Macera, De Angelis, Sagnelli, & Coppola, 2020). Also, older pa-
tients particularly those with underlying ailments, are at high risk of impaired con-
sciousness or delirium at the onset of acute infections. These patients also display
symptoms like encephalopathy and confusion. Rare, nonspecific neurological symp-
toms have been reported in COVID-19 patients, including dizziness, headache (Fig. 1),
muscle injury leading to myalgia, neuralgia, and ataxia (Harrison, Lin, & Wang, 2020).
Several SARS COV2 infected patients have been reported to present with several
muscular disorders, some of which include myopathy, acute quadriplegic myopathy,
thick filament myopathy, and necrotizing myopathy (Gálvez-Barrón et al., 2021; Mba,
Sharndama, Osondu-chuka, & Okeke, 2021). Although the aged population is partic-
ularly vulnerable to COVID-19, due to their weakened immune system, poor ability to
heal damaged epithelium, and a reduced mucociliary clearance, which permits the
virus to easily move to the lung’s gas exchange components, children and young adults
can also be infected by the virus (Chao et al., 2020; Ho et al., 2001) (Fig. 1).
4 Vaccine development strategies and platforms

The use of a whole virus or bacterium components which trigger the immune system,
or genetic materials that give instructions for the activation of the immune response
is the basic approach to vaccine formulation. The vaccine strategy must be both safe
and effective in producing strong and long-lasting protective immunity against the
infectious pathogen, ideally with only one dose. Traditional vaccine development
tactics are gradually giving way to newer and more advanced strategies such as viral
vectored and nucleic acid vaccines, which are expanding the options in vaccine de-
velopment. Vaccine platforms are divided into six main categories: live attenuated
virus, inactivated or killed virus vaccine, protein subunit vaccines, virus-like parti-
cles (VLPs), viral-vectored vaccines, and nucleic acid-based (DNA or mRNA)
vaccines. Fig. 2 provides a summary of the different vaccine strategies explored
in the development of COVID-19 vaccines. Each of these approaches has its own
set of benefits and drawbacks.
FIG. 2
Common vaccine strategies. This is a diagrammatic representation of the common vaccine
strategies been explored in the development of COVD-19 vaccines.
There are two major components of vaccines among others that should be given
great consideration during the production process. Firstly, protein or polysaccharide
antigens, which are supplied to or produced by the vaccine recipient. Another impor-
tant component is an infection signal that alerts and activates the host immune
system. Live attenuated vaccines can naturally provide both the antigen and the sig-
nal, while non-viral vaccine platforms can supply the antigens but frequently require
adjuvant that gives the danger signals to the immune system. Fig. 3 further illustrates
other basic components of a vaccine formulation.
4.1 Live attenuated viral vaccines

Human vaccines based on a live attenuated vaccine platform which have been used
successfully for decades include measles, mumps, rubella, poliomyelitis, and the
bacillus Calmette–Guerin (BCG) vaccines (Plotkin, Orenstein, Offit, & Edwards,
2017). They are live, reproducing, but avirulent viruses or bacteria. This vaccine
strategy is based on administering weakened but live strains of the actual pathogen
that mimics the natural infection without causing disease in healthy individuals.
Attenuation of the pathogenic strains is traditionally achieved through in vitro
passage that leads to mutation or loss of virulence genes. A new technique to design
live attenuated virus strains is genetic modification via mutation or deletion of
Basic consistuents of vaccines
Stabilizers
Active ingredients Stabilizers such as sugar or gelatin
Viral or bacterial antigens that are usually included to help
directly stimulate the immune maintain the efficacy of the vaccine
system with the primary aim of until ladministered.
preventing a full blown infection by
the causative organism.
Preservatives
Adjuvants Some vaccine formulations
These are diverse compounds contain preservatives (eg
added in very small quantities in thimerosal) which serves to
order to enhance the immune prevent contamination by
response to the vaccine dangerous microorganisms.
formulation.. VACCINE
Trace components
Residual inactivating ingredients
Antibiotics such as formaldehyde, and
Prevent contamination by bacteria residual cell culture materials
during the vaccine manufacturing (present in small quantities that
process. does not pose a safety concern).
Created in BioRender.com
FIG. 3
Basic constituents of vaccines.
virulence genes. The mutants lose their pathogenicity property in the host cells but
can replicate to a limited extent. Several genes possessed by coronaviruses are not
required for replication and these genes can be deleted, leading to attenuation in vivo.
Various non-structural proteins and structural E proteins can be deleted to yield vac-
cine strains of several coronaviruses. Deletion of the E protein leads to attenuation
and generation of an efficacious vaccine strain (Almazán et al., 2013; Netland et al.,
2010). There can be a problem of reversion of the attenuated strain to the virulent
strain (Jimenez-Guardeño et al., 2015). Therefore, the deletion of virulence genes
may provide a more effective mechanism of attenuation.
Codon deoptimization is another efficient approach to viral attenuation. The
nucleic acid sequence is modified to use suboptimal codon pairs to encode the
wild-type amino acid sequence, which considerably slows the translation of the viral
protein during infection. This approach can produce a replication-competent but
highly attenuated strain in vivo (Mueller et al., 2020). The recoded virus has an an-
tigenic property similar to that of its pathogenic parents. Consequently, the attenu-
ated viruses induce immune responses that are identical to those of virulent strains
(Mueller et al., 2020).
The inability of the attenuated strain to revert genetically to become pathogenic is
an important consideration in the generation of a live attenuated vaccine. Corona-
viruses are known to often recombine in nature and this makes the development
of an attenuated live vaccine against SARS-CoV-2 challenging. The attenuated
strain could recombine with other wild coronaviruses resulting in a fully virulent
strain. One of the drawbacks of live attenuated viruses is the use of exhaustively
long cell or animal cultures in their development. Also, pre-existing cross-reactive
immunity resulting from natural exposure with other human coronaviruses could
limit the efficacy of SARS-CoV-2 vaccines developed using this platform. Another
disadvantage of this technique is that attenuated vaccines cannot be given to
immune-compromised persons since the attenuated agent would find a niche to
multiply uncontrollably and, on rare occasions, revert to a wild-type phenotype,
resulting in severe disease. As a result of these drawbacks, only two live attenuated
SARS-CoV-2 vaccine candidates have reached clinical trials as seen in Table 1
(World Health Organization, 2021).
4.2 Inactivated pathogen vaccines

Viruses inactivated through physical and chemical means have been used success-
fully in human vaccines against hepatitis A, polio, and influenza (Murdin,
Barreto, & Plotkin, 1996; Vellozzi et al., 2009). In this platform, a dead form of
the pathogen is used, thus ensuring a better safety profile than live attenuated vac-
cines. During the inactivation process using chemicals, heat, or radiation, some of
these vaccine strains lose their immunogenicity making this platform less efficient
than live attenuated pathogen immunization. Moreover, inactivated pathogen vac-
cines are poor inducers of cytotoxic CD8 + T cells, which are necessary for an effec-
tive COVID-19 vaccine. Inactivated viral vaccines require an adjuvant which are
compounds that enhance and amplify the immune responses to the presence of an
Table 1 Some vaccine candidates in clinical trials.

Phase of
Vaccine clinical
S/N Name of Vaccine Platform Manufacturer trial
1. CoronaVac®:Inactivated Inactivated, Sinovac Research and Phase 4

SARSCoV-2 vaccine produced in Develop company Ltd
(Vero Cell) vero cells
2. Inactivated SARSCoV-2 Inactivated, Sinopharm/Beijing Phase 4
vaccine (Vero Cell). produced in Institute of Biological
BBIBP COVID-19 Vero cells Products Co., Ltd. (BIBP)
vaccine
3. Coviran-Barkat® Inactivated Shifa Pharmed Industrial Phase 2/3
Co
4. Inactivated SARS-CoV-2 Inactivated, Sinopharm/Wuhan Phase 4
Vaccine (Vero Cell) produced in Institute of Biological
Vero cells Products Co., Ltd.
(WIBP)
5. ChAdOx1- Viral vector AstraZeneca and Phase 4
S—(AZD1222) (Non- University of Oxford
“Covishield” replicating)
Vaxzevria
6. Ad5-nCoV Viral vector CanSino Biological Inc./ Phase 4
Recombinant Novel (Non- Beijing Institute of
Coronavirus Vaccine replicating) Biotechnology
(Adenovirus Type 5
Vector)
7. Gam-COVID-Vac Viral vector Gamaleya Research Phase 3
Adeno-based (rAd26-S (Non- Institute; Health Ministry
+ rAd5-S) replicating) of the Russian
Sputnik V COVID-19 Federation
vaccine
8. Ad26.COV2S Viral vector Janssen Pharmaceutical Phase 4
(Non- Johnson & Johnson
replicating)
9. SARS-CoV-2 rS/Matrix Protein Novavax Phase 3
M1-Adjuvant (Full length subunit
recombinant SARS
CoV-2
glycoprotein
nanoparticle vaccine
adjuvanted with Matrix
M) NVX-CoV2373
10. mRNA-1273 RNA based Moderna + National Phase 4
vaccine Institute of Allergy and
Spikevax Infectious Diseases
(NIAID)
Continued
Table 1 Some vaccine candidates in clinical trials.—cont’d

Phase of
Vaccine clinical
11. BNT162b2 (3 LNP- RNA based Pfizer/BioNTech + Fosun Phase 4
mRNAs), also known as vaccine Pharma
“Comirnaty”
12. Recombinant SARS- Protein Anhui Zhifei Longcom Phase 3
CoV-2 vaccine (CHO subunit Biopharmaceutical +
Cell) Institute of Microbiology,
Chinese Academy of
Sciences
Zhongyianke Biotech
Liaoning Maokangyuan
Biotech
Academy of Military
Medical Sciences
13. CVnCoV Vaccine RNA based CureVac AG Phase 3
vaccine
14. SARS-CoV-2 Vaccine, Whole- Bharat Biotech Phase 3
Inactivated (Vero Cell)/ Virion International Ltd
COVAXIN® Inactivated
15. SARS-CoV-2 Vaccine, Inactivated Institute of Medical Phase 3
Inactivated (Vero Cell) Biotechnology Chinese
Academy of Medical
Sciences (IMBCAMS),
China
16. INO-4800 DNA based Inovio Pharmaceuticals Phase 3
+ electroporation vaccine + International Vaccine
Institute + Advaccine
(Suzhou)
Biopharmaceutical Co.,
Ltd
17. AG0301-COVID19 DNA based AnGes + Takara Bio Phase 2/3
vaccine + Osaka University
18. nCov vaccine DNA based Zydus Cadila Phase 3
vaccine
19. GX-19 N DNA based Genexine Consortium Phase 2/3
vaccine
20. KBP-COVID-19 (RBD- Protein Kentucky Bioprocessing Phase 1/2
based) subunit Inc.
21. VAT00008: SARS-CoV- Protein Sanofi Pasteur + GSK Phase 3
2 S protein with adjuvant subunit Phase 3
(1) CoV2 preS dTM
monovalent D614 antigen
“(2) Bivalent (2-antigen)
vaccine comprising spike
protein of D614 and spike
protein of the
SARS-CoV-2 Beta
variant (B.1.351)”

Phase of
Vaccine clinical
22. ARCT-021 RNA based Arcturus Therapeutics Phase 2
vaccine
23. RBD SARS-CoV-2 Virus like Serum Institute of India Phase 1/2
HBsAg VLP vaccine particle + Accelagen Pty
+ SpyBiotech
24. GRAd-COV2 Viral vector ReiThera + Leukocare + Phase 2/3
(Replication defective (Non- Univercells
Simian Adenovirus replicating)
(GRAd) encoding S)
25. VXA-CoV2–1 Ad5 Viral vector Vaxart Phase 2
adjuvanted Oral Vaccine (Non-
platform replicating)
26. MVA-SARS-2-S Viral vector University of Munich Phase 1
(Non- (Ludwig-Maximilians)
replicating)
27. Coronavirus-Like Particle Virus like Medicago Inc. Phase 3
COVID-19 (CoVLP) particle
MT-2766
Other Name: CoVLP,
AS03 adjuvant
28. COVI-VAC Live Codagenix/Serum Phase 3
attenuated Institute of India
virus
29. Dendritic cell vaccine Viral vector "Aivita Biomedical, Inc.; Phase 2
AV-COVID-19. A vaccine (Replicating) "National Institute of
consisting of autologous + APC Health Research and
dendritic cells loaded Development;
with antigens from Ministry of Health
SARS-CoV-2, with or Republic of Indonesia
without GM-CSF
30. Inactivated COVID-19 Inactivated KM Biologic Co Ltd Phase 2/3
vaccine + alum
31. Osvid-19® Inactivated Osve Pharmaceutical Phase 1
Company
32. TURKOVAC® Inactivated Erciyes University and Phase 3
The Health Institute of
Turkey (TUSEB)
33. VB10.2210, DNA DNA based Vaccibody AS Phase 1/2
plasmid vaccine, vaccine
encodes multiple
immunogenic and
conserved T cell
epitopes spanning
multiple antigens across
the SARS-CoV-2
genome
Continued

Phase of
Vaccine clinical
®
34. CoviVax Inactivated National Research Phase 1
whole virus Centre, Egypt
Inactivated
35. Adjuvanted inactivated Inactivated The Scientific and Phase 1
vaccine against SARS- Technological Research
CoV 2 Council of Turkey
(TUBITAK)
36. Inactivated (NDV-based) Inactivated The Government Phase 1/2
Chimeric vaccine with or + CpG 1018 Pharmaceutical
without adjuvant CpG Organization (GPO):
1018 PATH, Dynavax
37. VLA2001® Inactivated Valneva, National Phase 3
Institution of Health
Research UK
38. QazCOVID-in® Inactivated Research Institute for Phase 3
Biological Safety
Problems, Rep of
Kazakhstan
39. Kocak inactivated inactivated Kocak Farma Phase 1
adjvant COVID-19
vaccine
40. CoviVac® inactivated Chumakov Federal Phase 1/2
Scientific Center for
Development of
Immune-and-Biological
products
41. MV-014-212, a live Live Meissa Vaccines, Inc. Phase 1
attenuated vaccine that attenuated
expresses the spike virus
(S) protein of SARS-
CoV-2
42. VBI-2902a. An Virus like VBI Vaccines Inc. Phase 1/2
enveloped virus-like particle
particle (eVLP) of SARS-
CoV-2 spike
(S) glycoprotein and
aluminum phosphate
adjuvant.
43. SARS-CoV-2 VLP Virus like The Scientific and Phase 2
Vaccine particle Technological Research
Vaccine-Wuhan; Council of Turkey
Vaccine-Alpha variant;
Vaccine-Wuhan + Alpha
variant
44. ABNCoV2 capsid virus- Virus like Radboud University Phase 1
like particle (cVLP) +/ particle
adjuvant MF59
antigen. Inactivated viral vaccine also requires the administration of more than one
dose to be effective. There are sixteen inactivated SARS-CoV-2 vaccines under clin-
ical trials as seen in Table 1 (World Health Organization, 2021).
4.3 Protein subunit vaccines

Protein subunit vaccines are made up of specific isolated proteins from pathogenic
bacteria or viruses. The advances in laboratory techniques that ushered in the era of
genetic engineering in the 1970s resulted in the first recombinant protein vaccine, the
hepatitis B vaccine (Vellozzi et al., 2009). Protein subunit vaccines are generated
through recombinant technology or protein isolation and purification methods after
cultivating large amounts of the pathogen. Instead of the whole pathogen, a subunit
of it that stimulates the immune system is used. Proteins or peptides alone do not
elicit a strong immunogenic response and thus require both adjuvant and booster
doses. Just like an inactivated viral vaccine, subunit vaccines are poor inducers of
CD8 + T cell responses. This platform eliminates the possibility of severe adverse
effects, but there is a need for repeated administration and incorporation of an adju-
vant to create robust and long-lasting immunity. Antigen-presenting cells (APCs),
activated by the adjuvant, take up the antigen when administered and present it to
adaptive immune cells (Vellozzi et al., 2009). There are thirty-six COVID-19 subunit
vaccines currently in clinical trials (Fig. 4), making this the most common platform
(World Health Organization, 2021).
PS Protein subunit
LAV Live Attenuated Virus
DNA DNA
2%
16%
34% VVr Viral Vector (replicating)
1%
15% IV Inactivated Virus
2%
5% VLP Virus Like Particle
9%
14% 2%
VVnr Viral Vector (non-replicating)
VVnr + APC VVnr + Antigen

Presenting Cell
RNA RNA
FIG. 4
Percentage representation of vaccine candidates in clinical development. Given is a statistical
representation of the different vaccine candidates currently under clinical development.
4.4 Virus-like particle vaccines

Hepatitis B and human papillomavirus vaccines are based on this platform. Virus-
like vaccines are subunit vaccines that are designed to closely resemble the structure
of a virus and can induce robust immune responses to the antigen(s) expressed on
their surface; they have good safety profiles since they do not contain the pathogen’s
genetic material. Virus-like particle (VLP) vaccines make use of the immunogenic
and safety property of empty virus particles with multiple copies of the same antigen
on their surface. The presence of multiple copies of antigen induces a stronger
immune response than a single copy. Virus-like particles are formed when proteins
S, M, and E of enveloped coronaviruses, with or without N, are co-expressed in eu-
karyotic cells (Lokugamage et al., 2008). The viral particle detaches from the eukary-
otic producer cells through budding. The VLPs produced are identical in structure to
the pathogenic virus but lack a viral genome and are thus non-infectious. When VLPs
are administered, they bind to ACE2 + cells through their surface S protein in the
same manner as the parent virus (Naskalska et al., 2018). The complexity of the pro-
duction process of VLPs is a challenge in their development. Also, VLPs require an
adjuvant and repeated administration just like subunit and inactivated viral vaccines.
Nevertheless, the technology used in the production of VLPs is well established, the
biology and safety profile of coronavirus VLPs are understood. Five virus-like par-
ticle candidates for SARS-CoV-2 produced are currently in clinical trials as shown in
Table 1 (WHO, 2020).
4.5 Vectored vaccines

Vectored vaccines are one of the newer platforms for vaccine development. Vectored
vaccines are designed using harmless viruses to deliver the pathogen’s genetic
materials to recipient host cells to produce antigenic proteins to stimulate immune
responses. They are modified versions of different viruses with reduced virulence
and replication potential but maintain their capacity to infect human cells. Com-
monly used vectors which are effective in eliciting strong immune response are
adenovirus, measles, and vesicular stomatitis virus (VSV) vectors. Recombinant
viral-vectored vaccines are developed as either replicating viral vectored vaccines
or non-replicating viral vectored vaccines (Jeyanathan et al., 2020). The non-
replicating type is incapable of self-propagation but has the advantage of reduced
adverse effects. The replicating type, though attenuated, retains its ability to make
new viral particles. Hence they can provide vaccine antigen for a longer time. Con-
sequently, a lower dose of the vaccine may be enough to generate a robust immune
response. Conversely, non-replicating vectors should be administered in higher dos-
ages since they are incapable of forming new antigens (Jeyanathan et al., 2020). The
replication-deficit viral platforms are mostly based on adenovirus or MVA, and most
of these vaccine candidates express the S protein or RBD of SARS-CoV-2.
Replication- competent viral vectors are mainly based on VSV. The presence of
existing antibodies against the viral backbone in people previously exposed to the
vector can reduce the magnitude of the triggered immune responses. In line with this,
administration of booster doses where it is needed becomes challenging as antibodies
against the viral vector produced after the prime vaccination can reduce the immu-
nological response. This problem can be circumvented by using a viral vector with
low human sero-prevalence such as ChAd (adenovirus derived from chimpanzees)
(Jeyanathan et al., 2020). Although this strategy for vaccine development is new, it
has been widely investigated for use in infectious diseases and cancer. The benefits
of this platform include safety and the ability to induce strong T-cell responses with-
out the need for an adjuvant (Draper & Heeney, 2010). Replicating viral vector vac-
cines need to be administered only once for protection and have a natural tropism
for the respiratory mucosa meaning that they are suited for respiratory tract vacci-
nation (Afkhami, Yao, & Xing, 2016). There is already existing technology for their
large-scale manufacturing and storage. Recombinant viral vectors are one of the
most common platforms for COVID-19 vaccine development, with eighteen candi-
dates currently in clinical trials (Fig. 4).
4.6 Nucleic acid vaccines

Nucleic acid vaccines are based on recent trends in vaccine development and involve
the delivery of genetic code for in situ production of viral antigen. They provide the
genetic instructions to the cells in the body and, in turn, the cells translate the infor-
mation into proteins which then stimulate an immune response (Jackson, Anderson,
et al., 2020; Jackson, Kester, Casimiro, Gurunathan, & DeRosa, 2020; Pardi, Hogan,
Porter, & Weissman, 2018). Nucleic acid vaccines are strong inducers of both
humoral and cellular adaptive immune responses, and they are easy to use because
all you need is a genetic sequence that encodes for a viral antigen and a delivery plat-
form to make them. The potential of mRNA vaccine is seen in previous studies of
influenza, rabies, and Zika virus infections in animals (Bahloul, Lassoued, &
Sfar, 2014; Chahal et al., 2016; Pardi et al., 2018; Petsch et al., 2012; Schnee
et al., 2016). The antigen-encoding mRNA is complexed with a carrier such as lipid
nanoparticles. The lipid carrier protects the mRNA when it first enters the body and
also helps it to get inside cells by fusing with the cell membrane. This ensures that the
nucleic acid is efficiently delivered in vivo into the cytoplasm of host cells where
protein translation occurs (Lutz et al., 2017; Pardi et al., 2018). mRNA vaccines
are non-infectious and are synthesized by in vitro transcription, free of microbial
molecules. These advantages distinguish mRNA vaccines from other vaccines in
terms of safety, effectiveness, and anti-vector immunity, allowing for their rapid
and low-cost manufacturing as well as repeated vaccination. mRNA-1273, which
is a COVID-19 vaccine candidate produced by Moderna, and encodes a prefusion
stabilized SARS-CoV-2 S protein encapsulated in lipid nanoparticles. The phase
I clinical trial data indicate that low and medium doses of two repeated parenteral
injections are generally safe and induce strong S protein-specific antibody responses
and a primarily CD4 + T cell response in most trial participants (Jackson, Anderson,
et al., 2020; Jackson, Kester, et al., 2020). The clinically advanced Pfizer and
BioNTech COVID-19 vaccine is also based on this platform. One of the major draw-
backs of mRNA vaccines is the storage temperature of between 70 °C and 20 °C
which complicates the distribution logistics of these vaccines especially in develop-
ing countries. There are eighteen mRNA-based COVID-19 vaccines in clinical trials
(Fig. 4). Plasmid DNA vaccines share several characteristics with mRNA vaccines,
including safety, ease of production, and scalability (Hobernik & Bros, 2018). DNA
molecules are more stable than mRNA and can be stored at 4 °C, thereby simplifying
the storage and distribution of this type of vaccine. Some of the major limitations of
DNA vaccines are poor immunogenicity, repeated administration, and the need for
an adjuvant. Currently, there are ten DNA-based COVID-19 vaccines in clinical
trials as shown in Fig. 4, with some examples represented in Table 1.
5 Relevant SARS-CoV-2 antigen explored in the design

of vaccines
5.1 Structural, sub-structural, and non-structural proteins
SARS-CoV-2, like other CoVs, has four major structural proteins, including the
spike (S) protein, the envelope (E) protein, the membrane (M) protein, and nucleo-
capsid (N) protein (Shin et al., 2020; Wu et al., 2020). Apart from these four struc-
tural proteins, the CoV viruses also encode specific and sub-structural proteins like
hemagglutinin-esterase (HE) protein, 3a/b protein, and 4a/b protein (Zarandi,
Zinatizadeh, Zinatizadeh, Yousefi, & Rezaei, 2021). CoVs genomes also have
non-structural proteins which are more protected than structural proteins. Addition-
ally, compared to non-structural proteins, structural proteins easily undergo mutation
to suit adaptation to the host’s system (Zarandi et al., 2021). Apart from their role in
replication, the other functions of non-structural proteins are yet to be understood
(Chen, Liu, & Guo, 2020).
5.2 Spike (S) protein

The diverse roles played by the structural proteins, especially S protein, make them
target sites for vaccine development. The S protein is the most researched of all struc-
tural proteins because it plays a vital role in the entry of SARS-CoV-2 into host cells
at the infection stage.
Just like other CoV viruses, the SARS-CoV-2 surface possesses homotrimers of
S protein which are fashioned as spikes used for binding to host receptor cells (Nieto-
Torres et al., 2014; Zarandi et al., 2021). The S protein is made up of two sub-units:
S1 and S2 (Fig. 5). While S1 controls binding to ACE2 on the host cell, S2 is respon-
sible for the fusion of the host cell membrane during the process of infection (Xia
et al., 2020). The receptor-binding domain (RBD) is located in S1, and this is where
the infection begins. Endocytosis of SARS-CoV-2 occurs with the binding of RBD to
5 Relevant SARS-CoV-2 antigen explored in the design of vaccines 167
1208
S2`
SS RBD SD2 HR1 CD TM
1 1273
NTD SD1 CH CT
HR2
S1/S2 FP
FIG. 5
Spike protein structure in SARS-CoV-2. SS, signal sequence; S20 , protease cleavage site; FP,
fusion peptide; HR1, heptad repeat 1; CH, central helix; CD, connector domain; HR2, heptad
repeat 2; TM, transmembrane domain; CT, cytoplasmic tail.
Adapted from Kheirandish et al., 2021.
Spike (S) protein

Envelope (E) protein Binding to hos cells & entry
Viral assembly & release Major target of COVID-19 vaccines
Viral pathogenesis S1/S2 S2’
HR1/CH HR2/CT
NTD RBD FP CD
Membrane (M) protein
Membrane stabilization S1 S2
SARS-CoV-2
S1
Nucleocapsid (N) protein
RNA replication ACE2
mRNA replication
Host cell
Viral budding
FIG. 6
Diagrammatic representation of the SARS-CoV-2 structural proteins (Young et al., 2021).
Reproduced by permission of the Elsevier Permissions.
ACE2 receptor (Fig. 6), followed by the release of the viral pack in the host cell cy-
toplasm after the interaction with endosomal proteases. In fact, research has pinned
the high transmission rate of SARS-CoV-2 to the high affinity of its RBD to bind to
ACE2 receptors, an affinity that is 10–20 times higher than that of the SARS-CoV
virus. Cytokine storm which is a characteristic severe immune response in COVID-
19 disease is as a result of the endocytosis of SARS-CoV-2 into lung cells (Zarandi
et al., 2021).
Currently, most pre-clinical and clinical researches on vaccine development are
based on S protein. About 35 of the 47 vaccine candidates undergoing clinical trials
are based on S protein. Components of the S protein exploited as antigens include the
full-length S protein, the RBD domain, the S1, and S2 subunits, the N-terminal
domain (NTD), and the membrane fusion peptide (Ahmad et al., 2021). The infor-
mation acquired during SARS and MERS vaccine development in 2002 and 2012,
respectively, as well as the knowledge about the structure of SARS-CoV-2, has

revealed that S1, S2, and RBD possess epitopes that can be targeted for the induction
of neutralizing antibodies. Analysis of the sera of a cohort of convalescent SARS-
CoV-2 patients revealed the presence of neutralizing antibodies (NAbs) acting on
the S1, RBD, and S2 sites of the virus (Wu et al., 2020). A good number of these
patients (95–100%) demonstrate neutralizing activity 14days after the onset of
COVID-19 symptoms. The neutralizing activities exhibited include IgM, IgG, and an-
tibodies targeting RBD of SARS-CoV-2 (Suganya, Divya, & Parani, 2021; Zhao et al.,
2020). NAbs elicit humoral responses in the host immune system, inhibiting the SARS-
CoV-2 binding to the human receptor, in addition to instigating viral lysis through
antibody-mediated opsonization or complement activation (Jiang, Hillyer, & Du,
2020; Suganya et al., 2021).
Another approach proposed for this target site is the development of glycosylated
SARS-CoV-2 S vaccines since computational studies have revealed that glycosy-
lated SARS-CoV-2 S proteins have more organized conformation compared to
non-glycosylated forms of the protein (Banerjee, Santra, & Maiti, 2020). This
may be because the SARS-CoV-2 S protein is extensively glycosylated in situ
(Shin et al., 2020). Researchers are also exploiting the receptor binding affinity of
the RBD domain of the S1 subunit of the S protein. Studies have revealed that
SARS-CoV-RBD can generate antibodies that cross-react with S2-RBD protein,
leading to SARS-CoV RBD-actuated antisera production. The SARS-CoV-RBD
actuated antisera cross-kill SARS-CoV-2. Hence, the investigation into possible pro-
duction of SARS-CoV RBD-based vaccine are being advocated (Ahmad et al., 2021;
Tai et al., 2020). ChADOx1 vaccine candidate containing optimized full-length
surface S glycoprotein with a tissue plasminogen activator is the most advanced
S protein-based vaccine candidate. In ChADOx1, a replication-deficient chimpanzee
adenovirus was used as a carrier to deliver a SARS-CoV-2 S protein to elicit a
protective immune response. A single dose of ChADOx1 in 6 rhesus macaques pre-
vented the development of SARS-CoV-2 induced pneumonia (Ahmad et al., 2021;
van Doremalen et al., 2020).
Nanotechnology has been employed in the design of S protein-based vaccine can-
didates. The Moderna and Pfizer/BioNTech vaccines have lipid nanoparticles as car-
riers. The mRNA which codes the S protein of the SARS-CoV-2 (Polack et al., 2020)
is loaded into phospholipid membranes (De Soto, 2021). The introduction of the
lipid-based nanoparticles into the host system results in the fusion of its phospholipid
membrane with the host membrane and the discharge of the mRNA into the cyto-
plasm of the target cell. Translation of the mRNA of the S protein occurs at the rough
endoplasmic reticulum, followed by the production of the S protein within the cyto-
plasm. Degradation and expression of the S protein by Major Histocompatibility
Complex I (MHC I) and II (MHC II) then occurs. MHC II is usually present in
antigen-presenting immune cells such as macrophages, B-cells, and dendritic cells.
The S protein fragment is then presented by the MHC II molecule to a T-helper cell,
after which the S protein binds to the T-helper cells with its T-cell receptor protein,
5 Relevant SARS-CoV-2 antigen explored in the design of vaccines 169
as well as binds the MHC II molecule using its CD4+ receptor (Shin et al., 2020).
These reactions cause T-helper cells to release interleukins which causes B cells
to proliferate. In addition to the proliferation of B cells, is its differentiation into
plasma cells, which then releases specific antibodies to the S protein fragment.
The interleukins, in turn, cause the initially produced T-helper cells to proliferate
and form T-helper memory cells. Both the T-helper cells and plasma cells produce
antibodies against some domains of the S protein of SARS-CoV-2 during future at-
tacks (De Soto, 2021). Furthermore, through the MHC I complex, cytotoxic T cells
are able to bind S protein fragments expressed by non-immune cells. This interaction
leads to the release of cytokines by cytotoxic cells and the proliferation and differ-
entiation of B cells into plasma cells. Additionally, the interaction of the S protein
with cytotoxic T cells paves the way for the elimination of cells infected by the
S protein of the SARS-CoV-2 virus in the future (De Soto, 2021).
5.3 Membrane (M) protein

Unlike the S protein, few studies have focused on SARS-CoV-2 M protein (S2M)
(Suganya et al., 2021). The function of the M protein starts with the assembly of viral
particles and the initiation of its budding process (Ahmad et al., 2021; Zarandi et al.,
2021), as well as membrane stabilization functions (Young et al., 2021). M protein is
located amid the S and E proteins in the virus envelope. During the process of viral
particle formation, S2M interacts with N, E, and S proteins as well as with its self
(Ahmad et al., 2021). Recent studies in SARS-CoV-2 recovered patients have
revealed the existence of appreciable CD4+ and CD8+ T cells initiated immune re-
sponses against SARS-CoV-2 M protein (Grifoni et al., 2020). Studies carried out in
the past on immunized rabbits have also revealed that synthetic peptides obtained
from immunodominant epitopes prompted significant antibody-induced immune
reactions, and further highlighting the immunogenicity of S2M (He et al., 2004).
OncoGen (a SARS-CoV-2 vaccine company) has designed a synthetic long peptide
vaccine candidate to target the spike and membrane proteins of the SARS-CoV-2
virus. However, the results of the pre-clinical studies are still being awaited
(Ahmad et al., 2021).
5.4 Nucleocapsid (N) protein

N protein functions in the area of SARS-CoV-2 replication (Fig. 6). During viral as-
sembly, N protein which is located within the viral envelop encloses the RNA to
shape the helical nucleocapsid. Nucleocapsid protein can connect with the RNA vi-
rus genome through its two domains, but through different mechanisms (Zarandi
et al., 2021). None of the SARS-CoV-2 vaccine candidates in clinical trials is based
on N protein alone. However, a Human Adenovirus Type 5 Vector (hAd5) in Phase
I clinical trial, and developed by ImmunityBio, Inc. & NantKwest Inc. encodes S and
N proteins (WHO, 2020). On the other hand, a vaccine candidate designed to target
the spike S1 subunit, membrane protein, and N protein is being developed by the
National Research Centre in Egypt, however, it is still undergoing pre-clinical trials
(Zarandi et al., 2021).
5.5 Envelop (E) protein

The E protein is involved in the pathogenesis of the SARS-CoV-2 virus disease
through its role in the release of the virus and ion channel activity (Karpinski,

Ozarowski, Mrozikiewicz, & Wolski, 2021; Zarandi et al., 2021). Unlike other
structural proteins, the E protein is not a usual target for vaccines since they are not
sufficiently immunogenic because of its structure and low quantity (Karpinski
et al., 2021; Young et al., 2021). Nonetheless, a recent study by Abdelmageed and
co-researchers targeted a multiepitope-based peptide vaccine against the E protein
of human COVID-19 (Abdelmageed et al., 2020). There is a need, however, to thor-
oughly investigate the vaccine to determine its immunogenicity and safety profile
(Ahmad et al., 2021).
6 Nano-based strategies for COVID-19 vaccine development

Various nano-sized formulations have been explored in the development of vaccines
over the years. The use of nano-based systems in the development of vaccines has
shown several benefits over conventional molecular formulations. These benefits
include the ability of the nano-systems to deliver various types of vaccines while
ensuring the protection of the encapsulated antigens from premature degradation
and non-target sites like the macrophages. (Alimardani, Abolmaali, & Tamaddon,
2021). This is largely because the systems are designed in a manner that permits
the proper exposure of the antigen at the same time protecting them from proteases
and nucleases in the body (Ruiz-Hitzky et al., 2020). Also, the fact that nanotechnol-
ogy permits the design and development of nano-sized materials with the required
physicochemical and biologic properties such as size, morphology, solubility among
others, makes it highly useful in the development of vaccine delivery systems. Surface
modification of these nano-sized materials with targeting moieties has been known to
increase uptake by phagocytic APCs (Alimardani et al., 2021). These systems have
also been successfully engineered to reduce antigen toxicity while improving the im-
munogenicity of antigens and adjuvants. They can also act as adjuvants themselves
potentiating the immune responses to vaccines (Alimardani et al., 2021). Some of these
systems also have the advantage of antigen delivery via alternative routes than the par-
enteral routes such as the oral, nasal as well as transdermal routes (Alimardani et al.,
2021). These nano-sized formulations have also been employed to ensure thermo-
stability, thus improving vaccine distribution and decreasing vaccine failures
(Alphandery, 2020). In addition to thermo-stability, the nano-size confers on these
6 Nano-based strategies for COVID-19 vaccine development 171
preparations the ability for easy targeted uptake in desired cells or tissues thus trigger-
ing an optimal immune response against the virus (Shin et al., 2020).
6.1 Nano-carriers for antigen delivery

The use of nano-carriers for antigen delivery is usually done in two ways; by
either loading the antigens inside or on the surface of the nanocarriers. The choice
between the two options usually depends on the antigens’ biological stability, phys-
icochemical characteristics, target sites, and required immunogen release rate
(Alimardani et al., 2021).
6.1.1 Polymeric nano-delivery systems

Polymers have been explored extensively in the world of drug design and delivery
with wide applications. Biocompatibility, as well as biodegradability, are two key
features highly sought after in the selection of polymers for drug delivery. This
supports the extensive use of poly (D, L-lactic-coglycolic acid PGLA) and poly
(D, L-lactide-co-glycolide PLG) in the design and development of nano polymeric
carriers for drug delivery. (Zhao et al., 2014). These systems have also been
employed as delivery systems for vaccines because of their ability to ensure the con-
trolled release of antigens and adjuvants (Kim et al., 2014). In addition, the surface
and particle size of these particles have been modified in vaccine development to
encourage oral, mucosal as well as systemic delivery of antigens (Kim et al.,
2014). Nano-polymeric systems composed of natural polymers such as chitosan have
been studied in mucosal vaccine delivery systems. Chitosan nanoparticles encapsu-
lating hemagglutinin-split influenza were prepared by ionic cross-linking of the
chitosan polymer in the presence of sodium tripolyphosphate. On administration
of the two doses via the nasal route, the chitosan nanosystems were able to produce
antibody responses compared to the response generated by the hemagglutinin-split
influenza virus alone (Kim et al., 2014).
6.1.2 Lipid-based nano-delivery systems

Lipid-based nano-systems such as liposomes have extensively been explored in the
design and development of therapeutics as well as vaccines. They are one of the most
promising approaches in nanotechnology designed for encapsulating as well as the
targeted release of antigens in vaccine development (Raoufi, Bahramimeimandi,
Salehi-Shadkami, Chaosri, & Mozafari, 2021). Their use in developing vaccines re-
ceived an increased level of attention after their immunomodulatory actions were
discovered. Since then, many other reports have shown that their physicochemical
characteristics such as size, structure, and lipid components can be modified to
enhance immunogenicity (Kim et al., 2014). These systems are very efficient in
encapsulating DNA or RNA-based immunogens. About 10 COVID-19 vaccine
candidates make use of lipid-based nano-systems as carriers (Malabadi, Meti, &
Chalannavar, 2021).
Liposomes are made up of biocompatible phospholipid bilayers and this confers

on them the ability to deliver hydrophobic as well as hydrophilic moieties. This prop-
erty is particularly important in vaccine delivery as it could permit the simultaneous
delivery of antigens and adjuvants. In addition to this, the surface of liposomes can be
modified using appropriate functional moieties (such as lipid components of the lipid
bilayer) and targeted to immune cells, thus enhancing immune responses and con-
sequently efficacy of the vaccine (Kim et al., 2014). Reports have shown a combi-
nation of dimethyl dioctadecyl ammonium (DDA) liposomes to enhance immunity
against influenza, chlamydia, and tuberculosis infections (Alving, Beck, Matyas, &
Rao, 2016; Christensen, Smith, Andersen, & Agger, 2011). The mRNA-1273 vac-
cine developed by Moderna is a liposomal formulation encapsulated with nucleoside
modified mRNA that encodes the SAR-COV-2 S glycoprotein. The mRNA-1273 in-
duced anti-SARS-COV-2 responses in all participants without significant toxicity
(Petkar et al., 2021). Also, reports from the pre-clinical trials showed a 94.1% effi-
cacy in preventing COVID-19 after administration of the two-dose regimen (Petkar
et al., 2021). Also, the BNT162b2, by Pfizer and BioNTech is basically a lipid nano-
particle encapsulating nucleoside modified RNA vaccines with encoded membrane-
anchored SARS-COV-2 S protein. It was reported that the two-dose vaccine regimen
was 95% effective against COVID-19 infections, with mild to moderate side effects.
NVX-CoV2373 is another nanoparticulate vaccine candidate, made of trimeric
full-length recombinant S-protein of the SARS-COV-2 and MATRIX-M1 adjuvant.
Studies conducted so far showed it was able to elicit anti-spike IgG antibodies which
possessed ACE2 receptor blocking as well as virus neutralization capabilities
(Magnusson et al., 2018; Rao et al., 2020). In addition to this, NVX-CoV2373 also
induced T and B cell responses and further clinical evaluation produced results that
support the safety of this vaccine candidate (Pandey et al., 2021).
A study by Zhang et al. explored the use of ionizable lipid-based nanoparticles for
the delivery of mRNA encoding the receptor-binding domain (RBD) of SARSCoV2.
The system was made up of ionizable lipid (1,2-distearoyl-sn-glycero-3-phospho-
choline), cholesterol, and pegylated lipids combined in various ratios. The lipids
were dispersed in ethanol and combined with the mRNA contained in a citrate buffer
of pH 4.0, using a T-shaped microfluidic mixer. The nanoparticles were formed
through nano-precipitation (Zhang et al., 2020). On administration of this vaccine
protocol by IM, the authors observed that there was protein expression at the site
of the administration as well as induction of significant SARS COV2 specific IgG
and neutralizing antibodies. The formulation was able to induce SARS COV2 spe-
cific CD4+ and CD8+ effector memory T cells in the spleen. In addition, on storage,
the lipid nano-formulation was stable at room temperature for up to 7 days (Zhang
et al., 2020). Another study by McKay et al. (2020) developed a vaccine strategy
of lipid nanoparticles encapsulating SARSCOV2 spike protein-encoding self-
amplifying RNA (saRNA-LNP). This formulation was observed to induce signifi-
cant SARSCOV2 specific IgG in mice as well as higher cellular response and viral
neutralization (McKay et al., 2020). These are pointers that this could be a very
robust vaccine candidate for the prevention of COVID-19.
6.1.3 Inorganic nano-delivery systems

In addition to their contributions in diagnostics, several inorganic nanoparticles, have
recently been considerably explored in the area of vaccine development and delivery.
This is mainly because of their rigid structure as well as ease of synthesis. (Zhao
et al., 2014). In addition, the fact that these nano-systems possess smaller particle
sizes, have improved stability and permeability as well as high drug loading capacity
have made them ideal for drug delivery. Also, inorganic nanoparticles have been
known to exhibit high cellular uptake, non-immunologic responses, low toxicity,
and distinct physicochemical and biological properties compared to their bulk
counterparts. These properties make them ideal for antigen delivery in vaccine de-
velopment (Poon et al., 2018). Recently, hybrid inorganic nano-systems have been
developed which comprises an inorganic core and an organic outer shell to improve
their safety in vivo (Poon et al., 2018). Gold nanoparticles of various shapes, sizes,
and surface modifications have been widely used as carriers for antigens from viruses
such as the influenza virus (Zhao et al., 2014). Silica-based nanoparticles possess
immense potentials in the area of vaccine design, development, and delivery. This
is primarily due to the fact that they are remarkably biocompatible. Also, the pres-
ence of abundant surface silanol groups, on modification, makes for the introduction
of additional functionality like improved cellular recognition and uptake, better in-
teraction with cells as well as improved absorption of specific biomolecules. These
systems have also been reported to induce very strong humoral in addition to
cell-mediated responses, features that have greatly influenced their use in vaccine
development (Ghaffari et al., 2021). Nuvec®, a silica nanoparticle (combined with
polyethyleneimine), developed by N4 Pharma, has been reported to protect and
aid the delivery of RNA/DNA antigens to targeted cells. In addition, Nuvec® also pos-
sesses high loading capacity, strong bonding, and high cellular uptake. A study by
Theobald (2020) strongly suggested that Nuvec® could be employed as a non-viral
delivery vehicle for vaccines and hence could be a safe and effective alternative to lipid
nanoparticles and non-replicating viral vectors in the development of the SARS-COV2
vaccine. Erasmus et al. (2020) developed an alphavirus –derived replicon RNA vac-
cine candidate (repRNA-COV2S), comprising of SARS-COV-2 S-protein replicons in
a squalene-based emulsion of lipid inorganic nanoparticles (LION). The inorganic
nanoparticles were composed of an inorganic (Superparamagnetic iron oxide,
Fe3O4), and a cationic lipid component (1,2-dioleoyl-3-trimethylammonium propane).
Animal studies conducted in mice and macagues revealed that the vaccine was able to
produce antigen-specific antibody responses, which were comparable to the convales-
cent response from COVID-19 (Erasmus et al., 2020). Another remarkable property of
this vaccine candidate was its ability to elicit robust antibody responses, producing
neutralizing antibodies in young and old mice alike, with the administration of just
one dose (Erasmus et al., 2020). In addition, the strategy of manufacturing the vaccine
in two vials-one of each containing the LION and the other the replicon RNA compo-
nents, makes the scale up of the vaccine formulation easier as incompatibilities
between the components is avoided (Erasmus et al., 2020).
6.1.4 Carbon-based nanomaterials

Carbon-based nanomaterials (CBNs) are fast becoming highly relevant material due to
the existence of diverse allotropes of carbon, from renowned allotropic phases such as
amorphous carbon, graphite, and diamonds to newly discovered auspicious carbon
nanotubes (CNTs), quantum dots (QDs), and fullerene (Zhang et al., 2017). As each
member of the carbon family exhibits inimitable features, they have been widely used
in diverse biological applications including biosensing, drug delivery, tissue engineer-
ing, imaging, diagnosis, and cancer therapy (Bhattacharya et al., 2016). Carbon
nanotubes (CNTs) classified into single-walled carbon nanotube (SWCNT) and
multi-walled carbon nanotube (MWCNT) are hollow cylinders consisting of graphitic
sheets. These systems are recently receiving a lot of attention in the area of vaccine
development and delivery (Kim et al., 2014). This is because these systems are capable
of carrying multiple antigens, are easily taken up by antigen-presenting cells, and dis-
play low toxicity. However, they are largely insoluble and non-degradable, hence it is
vital to determine how this will affect the safety of the carbon-based nano delivery
systems. Several reports have also illustrated the possibility of using carbon-based
nanosystems for the oral delivery of antigens (Kim et al., 2014).
6.2 Nano-vaccine adjuvants

The development of vaccines has been one of the most successful tools in the control of
several infectious diseases. However, studies have shown that some of these vaccines
generate rather weak immune responses. This is as a result of the fact that these vaccine
antigens are made with only certain parts of the pathogens; hence, the need for adju-
vants to aid the provocation of robust immune responses (Petkar et al., 2021). The in-
clusion of an adjuvant in a vaccine formulation has been observed to improve the
immunogenicity of antigens while decreasing the concentration of antigens as well
as the number of doses required to induce protective immunity. These substances have
also been known to improve the efficacy of vaccines in newborns, the elderly as well as
people with compromised immune systems (Petkar et al., 2021).
Nano-emulsions have been widely developed over the years as adjuvants (Zhao
et al., 2014). These systems are composed of either oil-in-water or water-in-oil emul-
sions, either carrying the vaccine antigens in their core or simply mixed with them
(Zhao et al., 2014). The MF59® is a type of oil-in-water emulsion used as a potent
and safe adjuvant in vaccine design and development. The adjuvant effect of the
MF59® has been widely evaluated in the development of influenza vaccines among
others (De Donato et al., 1999; Hagan, 2007). The Matrix-M®, developed by Nova-
vax Inc., is a nano-based saponin-derived adjvant, comprising of saponins from the
tree Quillaja saponaria, mixed with cholesterol and phospholipids. These substances
combine to form stable nanoparticles that can easily be incorporated into various for-
mulations of vaccine antigens. Studies have shown that the inclusion of this adjuvant
can precipitate an antigen dose reduction thereby resulting in the reduction of cost of
production, ultimately leading to the production of a cost-effective vaccine (Machhi
et al., 2021). Recently, the Matrix-M was employed as an adjuvant in a COVID-19
vaccine candidate, NVX-CoV237, also developed by Novax Inc. The Matrix –M

improved the recruitment of APCs at the injection site, thus causing an increase
in T-cell activation in the lymph nodes (Keech et al., 2020).
CoVaccine HT®, an oil-in-water nano-emulsion made of negatively charged
sucrose fatty acid sulphate ester and squalene, was evaluated as an adjuvant with
the SARS-CoV-2 S-protein in mice (Bonam et al., 2021). This research was fuelled
by the fact that the CoVaccine HT® was successfully used in different vaccine for-
mulations including malaria, ebola, zika among many others (Bonam et al., 2021;
Kusi et al., 2011; Lehrer et al., 2018). The study revealed that CoVaccine HT® in-
duced significantly higher antigen-specific antibody titers, cell-mediated immune
responses, as well as virus-neutralizing antibodies, compared to alum, which is
the gold standard of conventional adjuvants (Kusi et al., 2011). In addition to
nano-emulsions, other nano-based adjuvants have also been developed for applica-
tion in the development of COVID-19 vaccines. A recent study by Rao et al. (2020)
designed and developed nano decoys possessing cellular membrane nanovesicles de-
rived from genetically modified 293T/ACE2 and THP-1 cells. These nano-decoys
possess bio-properties such as abundant ACE2 and cytokine receptors, which basi-
cally compete with the host cells, thereby interfering with the process of viral infec-
tion and replication. Adavax, a microcrystalline polysaccharide adjuvant derived
from delta inulin, has also been included in a COVD-19 vaccine candidate developed
by a molecular modelling approach, COVAX-19. The adjuvant was observed to
improve the immunogenicity of the vaccine antigen (Rao et al., 2020).
6.3 Delivery devices

The development of microneedles has become a very powerful tool in the world of
vaccine design and development. This is primarily because these devices have the
ability to elicit a sustained release of vaccine antigens, thus eliminating the need
for multiple doses. This is the case especially with microneedles made with
sustained-release polymers or embedded with nanoparticles. (Menon et al., 2021).
They can also be self-administered, thus eliminating the need for a trained health
professional. In addition to these benefits, microneedles have been reported to induce
robust immune responses against different pathogens. This is due to the presence of
abundant dermal dendritic cells among other immune systems in the skin (Menon
et al., 2021). In a pandemic, such as the one caused by COVID-19, where mass im-
munization program is one of the key tools in the control of the spread of the SARS-
CoV2, the development of microneedles shows a lot of promise in the actualization
of mass immunization. Several companies have developed or repurposed their
microneedles for use in the control of the COVID-19 pandemic. The use of micro-
needle patches for the administration of COVID-19 vaccines is also being proposed
to solve the problem of cold chain storage. The presence of a good number of
antigen-presenting cells on the epidermis and dermis layer of the skin, which is likely
to reduce the dose of vaccines, is included as one of its advantages. There are chances
that microneedle-based formulations may be cost-effective since they may be able to
reduce the need for cold chain storage (O’Shea, Prausnitz, & Rouphael, 2021; Tran
et al., 2020). A study carried out by Kim et al. succeeded in formulating a dissolvable
microneedle matrix delivering SARS-CoV-2 antigen, and it was tested in a mice
model. Vaccine-induced antibodies were generated in significant amounts within
2 weeks post-administration (Kim et al., 2020). In another study, the RBD domain
peptide of the SARS-CoV-2 spike protein was delivered through a microneedle-
based formulation to mice. An ample amount of T-cell response, as well as antibody
generation, was also reported (Kuwentrai et al., 2021). More research is still needed
to determine procedures necessary for upscaling production and commercialization
of a microneedle-based formulation as this will be very beneficial in developing
countries of the world (Kumar & Kumar, 2021).
6.4 Novel alternative routes of administration

The role of nanotechnology in the area of vaccine development as established earlier
is highly invaluable. In addition to the benefits of providing suitable carrier systems
for antigen, acting as adjuvants of stellar quality as well as having a huge impact on
the development of novel delivery devices for a vaccine, nanotechnology has pro-
vided the opportunity for the exploration of various routes for vaccine delivery by
precipitating the birth of a plethora of formulations with various remarkable charac-
teristics. The determination of the most suited route of administration is a very vital
aspect of vaccine design and development. This is particularly important as vaccine
formulations, more than other pharmaceutical formulations, are hugely affected by
the route of administration, as this can determine the extent and quality of immune
responses (Wang, Hu, et al., 2020; Wang, Peng, et al., 2020; Wang, Zhao, et al.,
2020). Certain reports have suggested that establishing mucosal immune protection
by mucosal vaccination either via pulmonary, oral, or intranasal routes, might be
more preferable for preventing COVID-19 since the disease is predominantly a re-
spiratory disease-causing immense pulmonary inflammation (Wang, Hu, et al., 2020;
Wang, Peng, et al., 2020; Wang, Zhao, et al., 2020). Formulations administered via
these routes come in direct contact with the affected epithelial cells in the lungs,
thereby bringing about a fast onset of action which could, in turn, decrease the
symptoms of respiratory distress as well as lung occlusions (Abdellatif, Tawfeek,
Abdelfattah, El-Saber Batiha, & Hetta, 2021). However, the majority of the
COVID-19 vaccine candidates are administered via the parenteral routes, primarily
the intramuscular route in order to achieve prolonged release of the antigen and bring
about higher chances of interaction and uptake by an antigen-presenting cell (Young
et al., 2021). That notwithstanding, when vaccines are administered through this route,
it confers potentially only non-mucosal systemic immunity and thus leaving questions
as regards the durability and efficacy of the mucosal immunity after vaccination, which
is of great importance in the prevention of viral entry through the oro-respiratory tract
(Ashraf et al., 2021). In addition, the nasal and pulmonary routes are also being pro-
jected for the administration of SARS-CoV-2 vaccines because studies have revealed
that resident memory T cells are detected in lung tissues and airways after recovery
from respiratory viral infections (Hogan et al., 2001) which may produce longer-
lasting immunity against SARS-CoV-2 (Young et al., 2021). Despite this reality, sev-
eral researchers are continuously working to develop mucosal as well as other vaccines
that have alternative delivery routes to conventional ones. The mucosal route of admin-
istration offers the benefit of a lower risk of systemic adverse effects of the vaccine
formulation and a needle-free vaccination, making them more patient-friendly and also
eliminating the need for a skilled health professional (Strizova, Smetanova,
Bartunkova, & Milota, 2021). Some reports have postulated that since the nasal cavity
is a major entry point for the SARS_CoV 2, the nasal associated lymphoid tissues
(NALT), could present a promising target for COVID-19 vaccine delivery (Pandey
et al., 2021). The NALT, majorly consisting of dendritic cells, macrophages, and lym-
phoid follicles on the activation have been largely implicated in the clearance of viral
pathogens from the mucous layer (Pandey et al., 2021). A study exploring an intranasal
vaccine candidate for SARS-CoV reported the induction of Trm cells in the lungs,
which are vital for protection from viral infection (Baric et al., 2016). Another study
by An et al. (2020) showed that a single dose of adenovirus type 5 vectored vaccine
encoding the receptor-binding domain of SARS-COV 2 S-protein administered nasally
was able to induce both systemic and local immune responses against the SARS-CoV2
in mice. This was attributed primarily to the induction of mucosal IgA and serum neu-
tralizing antibodies (An et al., 2020). Hassan et al. (2020) also developed a chimpanzee
adenovirus-vectored vaccine which encodes a perfusing stabilized S-protein (Chad-
SAR-CoV-2-S), for delivery via the nasal route. This formulation was reported to in-
duce very high levels of neutralizing antibodies while enhancing systemic and mucosal
immunoglobulin A (IgA) and T-cell responses, thus preventing infection of SARS-
CoV-2 in the upper and lower respiratory tracts (Hassan et al., 2020). China is currently
testing a COVID-19 vaccine designed as an intranasal spray. This vaccine is composed
of weakened flu viruses (H1N1, H3N2, and B) combined with segments of the SARS-
CoV2 s protein, which mimics infection of respiratory viruses and can stimulate im-
mune responses. This candidate promises to provide the advantage of easy scale-up of
industrial production and distribution (Abdellatif et al., 2021).
Also, the oral route of drug delivery being the most preferred due to patient com-
pliance and ease of administration has been studied in the delivery of COVID-19
vaccines. An oral COVID-19 vaccine candidate (VXA-CoV2-1), developed by
VAXART, USA, is designed as an orally administered recombinant coated tablet.
It comprises an enteric-coated tablet containing an adenoviral vector, encoding
for the genes for the S and N-proteins of the SARS-COV2. On administration,
VXA-CoV2-1 triggers a mucosal immune response for defence against viruses caus-
ing respiratory infections as well high titres of neutralizing antibodies against the
SARS-CoV2. Also, the study revealed that there was no sign of mucosal damage
or weight loss in the hamsters used. Due to the fact that this vaccine candidate targets
the N-protein in addition to the S-protein, it promises to provide better protection
against the new viral variants. This has recently received approval for phase II clin-
ical trials (Ashraf et al., 2021). A UK-based company, IsoBio, is currently develop-
ing the Oral Pro-COVID-19®. This candidate is a non-replicating viral vector
vaccine that expresses the S-protein, designed as a thermally stable capsulated form.
This is particularly important as it provides the advantage of self-administration and
needle-free application. In addition, the need for cold-chain storage is eliminated as
the vaccine is designed as a thermally stable capsule. This makes this candidate
especially interesting for developing countries with erratic power supply (Ashraf
et al., 2021).
7 Benefits and challenges of nanotechnology in COVID-19

vaccine development
Nanotechnological approaches provide the most effective tools for the control of
infectious diseases such as COVID-19, from developing stellar preventive measures,
therapeutics, and diagnostics to the design and development of safe and effective
vaccination protocols. Scientists all over the world have in the last year battled with
the development of suitable vaccines in a bid to curb the spread of the SARSCoV 2
virus and nanotechnology has played a crucial role in providing suitable nano-
carriers for antigens, adjuvants, and formulations suitable for delivery via alternative
routes (Abdellatif et al., 2021). The use of nano-based delivery systems for the de-
livery of antigens has paved new pathways and provided several advantages such
as antigen stability, sustained/controlled delivery of antigens as well as evasion of
immune responses (Malabadi et al., 2021). These systems also provide the advantage
of delivering antigens and adjuvants simultaneously, thus resulting in enhanced
immunogenicity (Lutz et al., 2017; Malabadi et al., 2021). Also, surface modification
of nano-carriers has been employed in designing nano-systems for the targeted
delivery of antigens to specific cells to improve immune responses (Kim et al.,
2014). In addition, the development of multifunctional nano vaccines could enhance
the immune response by ensuring target specificity, effectiveness, and stable deliv-
ery of vaccine antigens (Kim et al., 2014). One of the major challenges in the devel-
opment of COVID-19 vaccines is developing vaccine approaches that stimulate
both the T and B cell immunity against the SARS-CoV 2, as well as developing vac-
cines that will be well suited for all populations especially those with compromised
immune systems (Alimardani et al., 2021). Nano-based strategies have been ex-
plored in tackling these problems by encouraging the design and development of vac-
cine systems that induce the immune system optimally. Another major challenge
encountered in the development of COVID-19 vaccines is the issue of the cold chain
storage requirement of some vaccine preparations. It has been estimated that the cost
of cold chain storage alone accounts for about 80% of vaccination costs (Wang, Hu,
et al., 2020; Wang, Peng, et al., 2020; Wang, Zhao, et al., 2020). This is highly prob-
lematic especially for developing countries where the supply of electricity is highly
variable. It is because of this that relevant adjustments to the design of formulation
using nanotechnology can address this problem by striving to make vaccine formu-
lations stable at room temperature. A vaccine comprising lipid nanoparticles as
8 Conclusion and future perspectives 179
delivery vehicles have been modified to stabilize the vaccine antigens being deliv-
ered (Wang, Hu, et al., 2020; Wang, Peng, et al., 2020; Wang, Zhao, et al., 2020).
Despite the benefits that nanotechnology offers in vaccine development, there are
also some issues of concern. One of the major problems of nano-based systems is the
issue of toxicity. There are several molecular mechanisms of toxicity elicited by
nanosystems. Some of these systems have been known to interact with cellular
DNA, interrupting important enzyme functions and thus causing harm to the organ-
ism. There have also been some reports of these systems generating reactive oxygen
species that eventually cause harm to genetic materials or disrupt vital enzyme func-
tions (Pandey et al., 2021). Also, because the process of vaccine development testing
and regulation is long, taking about 10–15 years, and the current COVID-19 vaccine
candidates have been developed within a space of a year, there are concerns about the
safety and long term effects of these formulations (Soleimanpour & Yaghoubi,
2021). The use of a multi-component nano-based vaccine, having complex structural
make-up (Bonam et al., 2021) can bring about an increased cost of production as a
result of a rigorous process of production. Some reports have also argued that since
many nano-vaccines are usually produced in small batches for research, the scale-up
of these systems might be challenging. This is because this process is largely plagued
by variations in size, shapes as well as other properties (Kim et al., 2014). It is how-
ever advocated that self-assemble nano-based vaccine systems be developed to
tackle the many challenges of large-scale production protocols. Also, the process
of surface modification of nano-carriers for vaccines usually involves a time-
consuming, costly and complicated process of purification (Kim et al., 2014).
8 Conclusion and future perspectives

In the absence of an approved cure for the COVID-19, vaccination remains the safest
and most effective way of controlling the pandemic. The advent of nanotechnology
in vaccine development has sought to ensure safe and effective delivery of antigens
as well as improving the immune responses of antigens as suitable adjuvants.
Nano-based systems have been known over the years for their uncanny ability to in-
crease biocompatibility, exhibit controlled as well as targeted release profiles, ensure
superior drug/antigen encapsulation to mention just a few. These desirable properties
have been explored in the development of COVID-19 vaccines. Nano-based strate-
gies have precipitated the development of vaccines at ultra-rapid rates which is of
huge importance in a pandemic such as this. Owing to the delicate and ravaging
nature of the COVID-19, various considerations are made in the development of
suitable vaccines. The structural and sub-structural proteins from the coronavirus
SARS-CoV-2 play diverse roles as target sites for vaccine development. Among
the four structural proteins, spike protein (S protein) of the coronavirus SARS-
CoV-2 is the primary target for most preclinical and clinical researches ongoing
in the development of vaccines. Various components of the S protein are exploited
as antigens and about 35 out of the 47 vaccine candidates undergoing clinical trials
are based on S protein. This study has provided updates on the current and advanced
nanotechnological strategies employed for the development of COVID-19 vaccines.
The nucleic acid vaccine candidate (mRNA-1273) by Moderna and currently in use
is encapsulated in lipid nanoparticles carriers. This typifies the use of nano-based
systems as effective antigen delivery systems. This review also explored several
nano-based adjuvants and novel delivery devices employed in the development of
COVID-19 vaccines. Also, the application of nanotechnology in the development
of these vaccine candidates has created a wide range of formulations that could
be delivered via alternative routes of administrations to the commonly used intra-
muscular route. The use of nanotechnological strategies in the development of
COVID-19 vaccines is still at the incipient stage as very few of these systems are
commercially available. However, these nano-based systems are relevant tools that
could play an excellent role in combating the pandemic.
References
Abdellatif, A. A. H., Tawfeek, H. M., Abdelfattah, A., El-Saber Batiha, G., & Hetta, H. F.
(2021). Recent updates in COVID-19 with emphasis on inhalation therapeutics: Nano-
structured and targeting systems. Journal of Drug Delivery Science and Technology,
63, 102435. https://doi.org/10.1016/j.jddst.2021.102435.
Abdelmageed, M. I., Abdelmoneim, A. H., Mustafa, M. I., Elfadol, N. M., Murshed, N. S.,
Shantier, S. W., et al. (2020). Design of a Multiepitope-Based Peptide Vaccine against
the e protein of human COVID-19: An Immunoinformatics approach. BioMed Research
International, 2020. https://doi.org/10.1155/2020/2683286.
Afkhami, S., Yao, Y., & Xing, Z. (2016). Methods and clinical development of adenovirus-
vectored vaccines against mucosal pathogens. Molecular Therapy - Methods and Clinical
Development, 3, 16030. https://doi.org/10.1038/mtm.2016.30.
Ahmad, J., Hanif, A., Farooqi, T., Hyder, F., Anwar, S., & Rengasamy, K. R. R. (2021). Bio-
medicine & Pharmacotherapy Targets and strategies for vaccine development against
SARS-CoV-2. Biomedicine & Pharmacotherapy, 137, 111254. https://doi.org/10.1016/
j.biopha.2021.111254.
Ahmed, E., Sajjad, N., Ali, A., Aldakeel, F. M., Mateen, A., Alqahtani, M. S., et al. (2021).
International Immunopharmacology SARS-CoV-2 : Insight in genome structure, patho-
genesis and viral receptor binding analysis – An updated review. International Immuno-
pharmacology, 95, 107493. https://doi.org/10.1016/j.intimp.2021.107493.
Alexandrova, R., Beykov, P., Vassilev, D., Jukic, M., & Podlipnik, C. (2021). The virus that
shook the world: Questions and answers about SARS-CoV-2 and COVID-19. Biotechnol-
ogy and Biotechnological Equipment, 35(1), 74–102. https://doi.org/10.1080/
13102818.2020.1847683.
Alimardani, V., Abolmaali, S. S., & Tamaddon, A. M. (2021). Recent advances on
nanotechnology-based strategies for prevention, diagnosis, and treatment of coronavirus
infections. Journal of Nanomaterials, 2021. https://doi.org/10.1155/2021/9495126.
Almazán, F., Dediego, M. L., Sola, I., Zuñiga, S., Nieto-Torres, J. L., Marquez-Jurado, S., et al.
(2013). Engineering a replication-competent, propagation-defective middle east respira-
tory syndrome coronavirus as a vaccine candidate. MBio, 4(5), 1–11. https://doi.org/
10.1128/mBio.00650-13.
References 181
Alphandery, E. (2020). The potential of various nanotechnologies for coronavirus diagnosis/

treatment highlighted through a literature analysis. Bioconjugate Chemistry, 31(8),
1873–1882. https://doi.org/10.1021/acs.bioconjchem.0c00287.
Alving, C. R., Beck, Z., Matyas, G. R., & Rao, M. (2016). Liposomal adjuvants for human
vaccines. Expert Opinion on Drug Delivery, 13(6), 807–816. https://doi.org/
10.1517/17425247.2016.1151871.
An, X., Martinez, M. P., Rezvan, A., Sefat, S. R., Fathi, M., Singh, S., et al. (2020). Single-dose
intranasal vaccination elicits systemic and mucosal immunity against SARS-CoV-2. SSRN
Electronic Journal, 24(9), 1–44. https://doi.org/10.2139/ssrn.3751056.
Ashraf, M. U., Kim, Y., Kumar, S., Seo, D., Ashraf, M., & Bae, Y. S. (2021). Covid-19 vac-
cines (revisited) and oral-mucosal vector system as a potential vaccine platform. Vaccine,
9(2), 1–24. https://doi.org/10.3390/vaccines9020171.
Bahloul, B., Lassoued, M. A., & Sfar, S. (2014). A novel approach for the development and
optimization of self emulsifying drug delivery system using HLB and response surface
methodology : Application to feno fi brate encapsulation. International Journal of Phar-
maceutics, 466(1–2), 341–348. https://doi.org/10.1016/j.ijpharm.2014.03.040.
Banerjee, A., Santra, D., & Maiti, S. (2020). Energetics based epitope screening in SARS
CoV-2 (COVID 19) spike glycoprotein by Immuno-informatic analysis aiming to a suit-
able vaccine development. Journal of Translational Medicine, 18(1). https://doi.org/10.
1186/s12967-020-02435-4.
Baric, R. S., David, C. S., Zhao, J., Zhao, J., Mangalam, A. K., Channappanavar, R., et al.
(2016). Airway memory CD4 + T cells mediate protective immunity against emerging re-
spiratory article airway memory CD4 + T cells mediate protective immunity against
emerging respiratory coronaviruses. Immunity, 44(6), 1379–1391. https://doi.org/
10.1016/j.immuni.2016.05.006.
Bhattacharya, K., Mukherjee, S. P., Gallud, A., Burkert, S. C., Bistarelli, S., Bellucci, S., et al.
(2016). Biological interactions of carbon-based nanomaterials: From coronation to degra-
dation. Nanomedicine: Nanotechnology, Biology, and Medicine, 12(2), 333–351. https://
doi.org/10.1016/j.nano.2015.11.011.
Bonam, S. R., Kotla, N. G., Bohara, R. A., Rochev, Y., Webster, T. J., & Bayry, J. (2021).
Potential immuno-nanomedicine strategies to fight COVID-19 like pulmonary infections.
Nano Today, 36, 101051. https://doi.org/10.1016/j.nantod.2020.101051.
Boopathi, S., Poma, A. B., & Kolandaivel, P. (2020). Novel 2019 coronavirus structure,
mechanism of action, antiviral drug promises and rule out against its treatment. Journal
of Biomolecular Structure and Dynamics, 0, 1–10. https://doi.org/10.1080/
07391102.2020.1758788.
Campos, E. V. R., Pereira, A. E. S., De Oliveira, J. L., Carvalho, L. B., Guilger-Casagrande,
M., De Lima, R., et al. (2020). How can nanotechnology help to combat COVID-19? Op-
portunities and urgent need. Journal of Nanobiotechnology, 18(1), 1–23. https://doi.org/
10.1186/s12951-020-00685-4.
Chahal, J. S., Khan, O. F., Cooper, C. L., McPartlan, J. S., Tsosie, J. K., Tilley, L. D., et al.
(2016). Dendrimer-RNA nanoparticles generate protective immunity against lethal ebola,
H1N1 influenza, and toxoplasma gondii challenges with a single dose. Proceedings of the
National Academy of Sciences of the United States of America, 113(29), E4133–E4142.
https://doi.org/10.1073/pnas.1600299113.
Chang, C. K., Sue, S. C., Yu, T. H., Hsieh, C. M., Tsai, C. K., Chiang, Y. C., et al. (2006).
Modular organization of SARS coronavirus nucleocapsid protein. Journal of Biomedical
Science, 13(1), 59–72. https://doi.org/10.1007/s11373-005-9035-9.
Chao, J. Y., Derespina, K. R., Herold, B. C., Goldman, D. L., Aldrich, M., Weingarten, J., et al.
(2020). Clinical characteristics and outcomes of hospitalized and critically ill children and
adolescents with coronavirus disease 2019 at a tertiary care medical Center in new York
City. Journal of Pediatrics, 223(August), 14–19.e2. https://doi.org/10.1016/j.jpeds.
2020.05.006.
Chauhan, G., Madou, M. J., Kalra, S., Chopra, V., Ghosh, D., & Martinez-Chapa, S. O. (2020).
Nanotechnology for COVID-19: Therapeutics and vaccine research. ACS Nano, 14(7),
7760–7782. https://doi.org/10.1021/acsnano.0c04006.
Chen, Y., Liu, Q., & Guo, D. (2020). Emerging coronaviruses: Genome structure, replication,
and pathogenesis. Journal of Medical Virology, 92(4), 418–423.
Christensen, D., Smith, K., Andersen, P., & Agger, E. M. (2011). Cationic liposomes as vac-
cine adjuvants. Expert Review of Vaccines, 10(4), 513–521.
Chung, Y. H., Beiss, V., Fiering, S. N., & Steinmetz, N. F. (2020). Covid-19 vaccine frontrun-
ners and their nanotechnology design. ACS Nano, 14(10), 12522–12537. https://doi.org/
10.1021/acsnano.0c07197.
Donato, S. D., Grano, D., Minutello, M., Lecchi, G., Faccini, M., & Agnello, M. (1999). Safety
and immunogenicity of MF59-adjuvanted influenza vaccine in the elderly. Vaccine, 17,
3094–3101.
De Soto, J. A. (2021). Evaluation of the Moderna, Pfizer/biotech, Astrazeneca/Oxford and
sputnik V vaccines for Covid-19. Advance Research Journal of Medical Clinical and Sci-
ence, 07(01), 408–414. https://doi.org/10.15520/arjmcs.v7i01.246.
DeDiego, M. L., Álvarez, E., Almazán, F., Rejas, M. T., Lamirande, E., Roberts, A., et al.
(2007). A severe acute respiratory syndrome coronavirus that lacks the E gene is attenu-
ated in vitro and in vivo. Journal of Virology, 81(4), 1701–1713. https://doi.org/10.1128/
jvi.01467-06.
Draper, S. J., & Heeney, J. L. (2010). Viruses as vaccine vectors for infectious diseases and
cancer. Nature Reviews Microbiology, 8(1), 62–73. https://doi.org/10.1038/nrmicro2240.
Erasmus, J. H., Med, S. T., Erasmus, J. H., Khandhar, A. P., Connor, M. A. O., Walls, A. C.,
et al. (2020). An alphavirus-derived replicon RNA vaccine induces SARS-CoV-2 neutral-
izing antibody and T cell responses in mice and nonhuman primates. Science Translational
Medicine, 12(555), 1–17. https://doi.org/10.1126/scitranslmed.abc9396.
Gálvez-Barrón, C., Arroyo-Huidobro, M., Miňarro, A., Añaños, G., Chamero, A., Martı́n, M.,
et al. (2021). COVID-19: Clinical presentation and prognostic factors of severe disease
and mortality in the oldest-old population: A cohort study. Gerontology, 1–14. https://
doi.org/10.1159/000515159.
Garciá, M. M. A., Mancilla-Galindo, J., Paredes-Paredes, M., Tiburcio, Á. Z., & Ávila-
Vanzzini, N. (2021). Mechanisms of infection by SARS-CoV-2, inflammation and poten-
tial links with the microbiome. Future Virology, 16(1), 43–57. https://doi.org/10.2217/fvl-
2020-0310.
Ghaffari, M., Mollazadeh-Bajestani, M., Moztarzadeh, F., Uluda g, H., Hardy, J. G., &
Mozafari, M. (2021). An overview of the use of biomaterials, nanotechnology, and stem
cells for detection and treatment of COVID-19: Towards a framework to address future
global pandemics. Emergent Materials, 4(1), 19–34. https://doi.org/10.1007/s42247-
020-00143-9.
Grifoni, A., Weiskopf, D., Ramirez, S. I., Mateus, J., Dan, J. M., Moderbacher, C. R., et al.
(2020). Targets of T cell responses to SARS-CoV-2 coronavirus in humans with
COVID-19 disease and unexposed individuals. Cell. https://doi.org/10.1016/j.cell.2020.
05.015.
References 183
Hagan, D. T. O. (2007). MF59 is a safe and potent vaccine adjuvant that enhances protection
against influenza virus infection. Expert Review of Vaccines, 6(5), 699–710. https://doi.
org/10.1586/14760584.6.5.699.
Harrison, A. G., Lin, T., & Wang, P. (2020). Mechanisms of SARS-CoV-2 transmission and
pathogenesis. Trends in Immunology, 41(12), 1100–1115. https://doi.org/10.1016/j.
it.2020.10.004.
Hassan, A. O., Kafai, N. M., Dmitriev, I. P., Fox, J. M., Smith, B. K., Harvey, I. B., et al.
(2020). A single-dose intranasal ChAd vaccine protects upper and lower respiratory tracts
against SARS-CoV-2. Cell, 183(1), 169–184. https://doi.org/10.1016/j.cell.2020.08.026.
He, Y., Zhou, Y., Wu, H., Luo, B., Chen, J., Li, W., et al. (2004). Identification of Immuno-
dominant sites on the spike protein of severe acute respiratory syndrome (SARS) corona-
virus: Implication for developing SARS diagnostics and vaccines. The Journal of
Immunology, 173(6), 4050–4057. https://doi.org/10.4049/jimmunol.173.6.4050.
Ho, J. C., Hu, W. H. C., Lam, W. K., Chu, L. W., Zheng, L., Tipoe, G. L., et al. (2001). The
effect of aging on nasal mucociliary clearance, beat frequency and ultrastructure of respi-
ratory cilia. In The 6th Medical Research Conference, Hong Kong, China, 23(13–14)
(p. 66).
Hobernik, D., & Bros, M. (2018). DNA vaccines—How far from clinical use? International
Journal of Molecular Sciences, 19(11), 1–28. https://doi.org/10.3390/ijms19113605.
Hogan, R. J., Usherwood, E. J., Zhong, W., Roberts, A. A., Dutton, R. W., Harmsen, A. G.,
et al. (2001). Activated antigen-specific CD8 + T cells persist in the lungs following recov-
ery from respiratory virus infections. Journal of Immunology, 166, 1813–1822.
Hurst, K. R., Koetzner, C. A., & Masters, P. S. (2009). Identification of in vivo-interacting
domains of the murine coronavirus Nucleocapsid protein. Journal of Virology, 83(14),
7221–7234. https://doi.org/10.1128/jvi.00440-09.
Jackson, L. A., Anderson, E. J., Rouphael, N. G., Roberts, P. C., Makhene, M., Coler, R. N., et al.
(2020). An mRNA vaccine against SARS-CoV-2 — Preliminary report. New England Jour-
nal of Medicine, 383(20), 1920–1931. https://doi.org/10.1056/NEJMoa2022483.
Jackson, N. A. C., Kester, K. E., Casimiro, D., Gurunathan, S., & DeRosa, F. (2020). The
promise of mRNA vaccines: A biotech and industrial perspective. Npj Vaccines, 5(1),
Jeyanathan, M., Afkhami, S., Smaill, F., Miller, M. S., Lichty, B. D., & Xing, Z. (2020). -
mmunological considerations for COVID-19 vaccine strategies. Nature Reviews Immunol-
ogy, 20(October), 615–632. https://doi.org/10.1038/s41577-020-00434-6.
Jiang, S., Hillyer, C., & Du, L. (2020). Jiang S, Hillyer C, Du L. neutralizing antibodies against
SARS- CoV-2 and other human coronaviruses. Trends in Immunology, 41(5), 355–359.
https://doi.org/10.1016/j.it.2020.03.007.
Jimenez-Guardeño, J. M., Regla-Nava, J. A., Nieto-Torres, J. L., DeDiego, M. L., Castaño-
Rodriguez, C., Fernandez-Delgado, R., et al. (2015). Identification of the mechanisms
causing reversion to virulence in an attenuated SARS-CoV for the Design of a Genetically
Stable Vaccine. PLoS Pathogens, 11(10), 1–36. https://doi.org/10.1371/journal.
ppat.1005215.

Karpinski, T. M., Ozarowski, M., Mrozikiewicz, A. S., & Wolski, H. (2021). Theranostics the
2020 race towards SARS-CoV-2 specific vaccines. Theranostics, 11(4), 1690–1702.
https://doi.org/10.7150/thno.53691.
Keech, C., Albert, G., Cho, I., Robertson, A., Reed, P., Neal, S., et al. (2020). Phase 1–2 trial of
a SARS-CoV-2 recombinant spike protein nanoparticle vaccine. New England Journal of
Medicine, 383(24), 2320–2332. https://doi.org/10.1056/nejmoa2026920.
Kim, E., Erdos, G., Huang, S., Kenniston, T., Balmert, S., Carey, C., et al. (2020). Microneedle
array delivered recombinant coronavirus vaccines: Immunogenicity and rapid transla-
tional development. eBioMedicine, 55, 102743.
Kim, M. G., Park, J. Y., Shon, Y., Kim, G., Shim, G., & Oh, Y. K. (2014). Nanotechnology and
vaccine development. Asian Journal of Pharmaceutical Sciences, 9(5), 227–235. https://
doi.org/10.1016/j.ajps.2014.06.002.
Ksiazek, T. G., Erdman, D., Goldsmith, C. S., Zaki, S. R., Peret, T., Emery, S., et al. (2003).
A novel coronavirus associated with severe acute respiratory syndrome. New England
Journal of Medicine, 348(20), 1953–1966. https://doi.org/10.1056/NEJMoa030781.
Kumar, A., & Kumar, A. (2021). Mucosal and transdermal vaccine delivery strategies against
COVID-19. Drug Delivery and Translational Research, 0123456789. https://doi.org/
10.1007/s13346-021-01001-9.
Kusi, K. A., Remarque, E. J., Riasat, V., Walraven, V., Thomas, A. W., Faber, B. W., et al.
(2011). Safety and immunogenicity of multi-antigen AMA1-based vaccines formulated
with CoVaccine HT™ and Montanide ISA 51 in rhesus macaques. Malaria Journal,
10(1), 182. https://doi.org/10.1186/1475-2875-10-182.
Kuwentrai, C., Yu, J., Rong, L., Zhang, B. Z., Hu, Y. F., Gong, H. R., et al. (2021). Intradermal
delivery of receptor-binding domain of SARS-CoV-2 spike protein with dissolvable
microneedles to induce humoral and cellular responses in mice. Bioengineering and
Translational Medicine, 6(1), e10202. https://doi.org/10.1002/btm2.10202.
Lehrer, A. T., Wong, T. A. S., Lieberman, M. M., Humphreys, T., Clements, D. E.,
Bakken, R. R., et al. (2018). Recombinant proteins of Zaire ebolavirus induce potent
humoral and cellular immune responses and protect against live virus infection in mice.
Vaccine, 36(22), 3090–3100. https://doi.org/10.1016/j.vaccine.2017.01.068.
Lokugamage, K. G., Yoshikawa-Iwata, N., Ito, N., Watts, D. M., Wyde, P. R., Wang, N., et al.
(2008). Chimeric coronavirus-like particles carrying severe acute respiratory syndrome
coronavirus (SCoV) S protein protect mice against challenge with SCoV. Vaccine,
26(6), 797–808. https://doi.org/10.1016/j.vaccine.2007.11.092.
Lutz, J., Lazzaro, S., Habbeddine, M., Schmidt, K. E., Baumhof, P., Mui, B. L., et al. (2017).
Unmodified mRNA in LNPs constitutes a competitive technology for prophylactic
vaccines. Npj Vaccines, 2(1), 1–9. https://doi.org/10.1038/s41541-017-0032-6.
Macera, M., De Angelis, G., Sagnelli, C., & Coppola, N. (2020). Clinical presentation of
covid-19: Case series and review of the literature. International Journal of Environmental
Research and Public Health, 17(14), 1–11. https://doi.org/10.3390/ijerph17145062.
Machhi, J., Shahjin, F., Das, S., Patel, M., Abdelmoaty, M. M., Cohen, J. D., et al. (2021).
Nanocarrier vaccines for SARS-CoV-2. Advanced Drug Delivery Reviews, 171(January),
215–239. https://doi.org/10.1016/j.addr.2021.01.002.
Magnusson, S. E., Altenburg, A. F., Bengtsson, K. L., Bosman, F., de Vries, R. D.,
Rimmelzwaan, G. F., et al. (2018). Matrix-M™ adjuvant enhances immunogenicity of
both protein- and modified vaccinia virus Ankara-based influenza vaccines in mice.
Immunologic Research, 66(2), 224–233. https://doi.org/10.1007/s12026-018-8991-x.
Malabadi, R. B., Meti, N. T., & Chalannavar, R. K. (2021). Applications of nanotechnology in
vaccine development for coronavirus (SARS-CoV-2) disease (Covid-19). International
Journal of Research and Scientific Innovation (IJRSI), 8(2), 191–198. Retrieved from
www.rsisinternational.org.
Mason, R. J. (2020). Pathogenesis of COVID-19 from a cell biology perspective. European
Respiratory Journal. https://doi.org/10.1183/13993003.00607-2020.
References 185
Mba, I. E., Sharndama, H. C., Osondu-chuka, G. O., & Okeke, O. P. (2021). Immunobiology
and nanotherapeutics of severe acute respiratory syndrome 2 (SARS-CoV-2): A current
update. Infectious Diseases, 53(8), 559–580. https://doi.org/10.1080/23744235.2021.
1916071.
McKay, P. F., Hu, K., Blakney, A. K., Samnuan, K., Bouton, C. R., Rogers, P., et al. (2020).
Self-amplifying RNA SARS-CoV-2 lipid nanoparticle vaccine induces equivalent preclin-
ical antibody titers and viral neutralization to recovered COVID-19 patients. BioRxiv,
1–14. https://doi.org/10.1101/2020.04.22.055608.
Menon, I., Bagwe, P., Gomes, K. B., Bajaj, L., Gala, R., Uddin, M. N., et al. (2021). Micro-
needles: A new generation vaccine delivery system. Micromachines, 12(4), 1–18. https://
doi.org/10.3390/mi12040435.
Mueller, S., Stauft, C. B., Kalkeri, R., Koidei, F., Kushnir, A., Tasker, S., et al. (2020).
A codon-pair deoptimized live-attenuated vaccine against respiratory syncytial virus is im-
munogenic and efficacious in non-human primates. Vaccine, xxxx, 2–7. https://doi.org/
10.1016/j.vaccine.2020.02.056.
Murdin, A. D., Barreto, L., & Plotkin, S. (1996). Inactivated poliovirus vaccine: Past and present
experience. Vaccine, 14(8), 735–746. https://doi.org/10.1016/0264-410X(95)00211-I.
Naskalska, A., Dabrowska, A., Nowak, P., Szczepanski, A., Jasik, K., Milewska, A., et al.
(2018). Novel coronavirus-like particles targeting cells lining the respiratory tract. PLoS
One, 13(9), 1–21. https://doi.org/10.1371/journal.pone.0203489.
Netland, J., DeDiego, M. L., Zhao, J., Fett, C., Álvarez, E., Nieto-Torres, J. L., et al. (2010).
Immunization with an attenuated severe acute respiratory syndrome coronavirus deleted in
E protein protects against lethal respiratory disease. Virology, 399(1), 120–128. https://doi.
org/10.1016/j.virol.2010.01.004.
Nieto-Torres, J. L., DeDiego, M. L., Verdiá-Báguena, C., Jimenez-Guardeño, J. M.,
Regla-Nava, J. A., Fernandez-Delgado, R., et al. (2014). Severe acute respiratory
syndrome coronavirus envelope protein Ion Channel activity promotes virus fitness and
pathogenesis. PLoS Pathogens, 10(5), e1004077. https://doi.org/10.1371/journal.
ppat.1004077.
O’Shea, J., Prausnitz, M. R., & Rouphael, N. (2021). Dissolvable microneedle patches to en-
able increased access to vaccines against SARS-CoV-2 and future pandemic outbreaks.
Vaccine, 9(4), 320. https://doi.org/10.3390/vaccines9040320.
Pandey, A., Nikam, A. N., Mutalik, S. P., Fernandes, G., Shreya, A. B., Padya, B. S., et al.
(2021). Architectured therapeutic and diagnostic Nanoplatforms for combating SARS-
CoV-2: Role of inorganic, organic, and radioactive materials. ACS Biomaterials Science &
Engineering, 7(1), 31–54. https://doi.org/10.1021/acsbiomaterials.0c01243.
Pardi, N., Hogan, M. J., Porter, F. W., & Weissman, D. (2018). mRNA vaccines-a new era in
vaccinology. Nature Reviews Drug Discovery, 17(4), 261–279. https://doi.org/10.1038/
nrd.2017.243.
Petkar, K. C., Patil, S. M., Chavhan, S. S., Kaneko, K., Sawant, K. K., Kunda, N. K., et al.
(2021). An overview of nanocarrier-based adjuvants for vaccine delivery. Pharmaceutics,
13(4), 1–29. https://doi.org/10.3390/pharmaceutics13040455.
Petsch, B., Schnee, M., Vogel, A. B., Lange, E., Hoffmann, B., Voss, D., et al. (2012). Pro-
tective efficacy of in vitro synthesized, specific mRNA vaccines against influenza a virus
infection. Nature Biotechnology, 30(12), 1210–1216. https://doi.org/10.1038/nbt.2436.
Plotkin, S. A., Orenstein,, W. A., Offit, P. A., & Edwards, K. M. (2017). Vaccines E-book.
Elsevier Health Sciences.
Polack, F., Thomas, S., Kitchin, N., Absalon, J., Gurtman, A., Lockhart, S., et al. (2020).
Safety and efficacy of the BNT162b2 mRNA COVID-19 vaccine. The New England Jour-
nal of Medicine, 10, 1–13. https://doi.org/10.1056/NEJMoa2034577.
Poon, C., Gallo, J., Joo, J., Chang, T., Bañobre-López, M., & Chung, E. J. (2018). Hybrid,
metal oxide-peptide amphiphile micelles for molecular magnetic resonance imaging of
atherosclerosis. Journal of Nanobiotechnology, 16(1), 1–11. https://doi.org/10.1186/
s12951-018-0420-8.
Qian, Z., Travanty, E. A., Oko, L., Edeen, K., Berglund, A., Wang, J., et al. (2012). Innate
immune response of human alveolar type II cells infected with severe acute respiratory
syndrome – Coronavirus. American Journal of Respiratory Cell and Molecular Biology,
10(22), 22–26. https://doi.org/10.1165/rcmb.2012-0339OC.
Rahman, H. S., Aziz, M. S., Hussein, R. H., Othman, H. H., Salih Omer, S. H., Khalid, E. S.,
et al. (2020). The transmission modes and sources of COVID-19: A systematic review.
International Journal of Surgery Open, 26, 125–136. https://doi.org/10.1016/j.
ijso.2020.08.017.
Rao, L., Xia, S., Xu, W., Tian, R., Yu, G., Gu, C., et al. (2020). Decoy nanoparticles protect
against COVID-19 by concurrently adsorbing viruses and inflammatory cytokines. Pro-
ceedings of the National Academy of Sciences of the United States of America,
117(44), 27141–27147. https://doi.org/10.1073/pnas.2014352117.
Raoufi, E., Bahramimeimandi, B., Salehi-Shadkami, M., Chaosri, P., & Mozafari, M. R.
(2021). Methodical design of viral vaccines based on avant-Garde nanocarriers:
A multi-domain narrative review. Biomedicine, 9(5), 1–20. https://doi.org/10.3390/
biomedicines9050520.
Reza-Zaldıvar, E. E., et al. (2021). Infection mechanism of SARS-COV-2 and its implication
on the nervous system. Frontiers in Immunology, 11, 621735. In press. https://doi.org/
10.3389/fimmu.2020.621735.
Ruiz-Hitzky, E., Darder, M., Wicklein, B., Ruiz-Garcia, C., Martı́n-Sampedro, R., del
Real, G., et al. (2020). Nanotechnology responses to COVID-19. Advanced Healthcare
Materials, 9(19), 1–26. https://doi.org/10.1002/adhm.202000979.
Sanclemente-Alaman, I., Moreno-Jimenez, L., Benito-Martı́n, M. S., Canales-Aguirre, A.,
Matı́as-Guiu, J. A., Matı́as-Guiu, J., et al. (2020). Experimental models for the study of
central nervous system infection by SARS-CoV-2. Frontiers in Immunology, 11(8),
1–12. https://doi.org/10.3389/fimmu.2020.02163.
Sarkesh, A., Sorkhabi, A. D., Sheykhsaran, E., Alinezhad, F., Mohammadzadeh, N.,
Hemmat, N., et al. (2020). Extrapulmonary clinical manifestations in COVID-19 patients.
American Journal of Tropical Medicine and Hygiene, 103(5), 1783–1796. https://doi.org/
10.4269/ajtmh.20-0986.
Schnee, M., Vogel, A. B., Voss, D., Petsch, B., Baumhof, P., Kramps, T., et al. (2016). An
mRNA vaccine encoding rabies virus glycoprotein induces protection against lethal infec-
tion in mice and correlates of protection in adult and newborn pigs. PLoS Neglected Trop-
ical Diseases, 10(6), 1–20. https://doi.org/10.1371/journal.pntd.0004746.
Shin, M. D., Shukla, S., Chung, Y. H., Beiss, V., Chan, S. K., Ortega-Rivera, O. A., et al.
(2020). COVID-19 vaccine development and a potential nanomaterial path forward.
Nature Nanotechnology, 15(8), 646–655. https://doi.org/10.1038/s41565-020-0737-y.
Soleimanpour, S., & Yaghoubi, A. (2021). COVID-19 vaccine: Where are we now and where
should we go?. Expert Review of Vaccines: Taylor and Francis Ltd. https://doi.org/
10.1080/14760584.2021.1875824.
References 187
Strizova, Z., Smetanova, J., Bartunkova, J., & Milota, T. (2021). Principles and challenges in
anti-COVID-19 vaccine development. International Archives of Allergy and Immunology,
182(4), 339–349. https://doi.org/10.1159/000514225.
Suganya, S., Divya, S., & Parani, M. (2021). Severe acute respiratory syndrome-coronavirus-2:
Current advances in therapeutic targets and drug development. Reviews in Medical
Virology. https://doi.org/10.1002/rmv.2174.
Tai, W., He, L., Zhang, X., Pu, J., Voronin, D., Jiang, S., et al. (2020). Characterization of the
receptor-binding domain (RBD) of 2019 novel coronavirus: Implication for development
of RBD protein as a viral attachment inhibitor and vaccine. Cellular and molecular immu-
nology, 17(6), 613–620. https://doi.org/10.1038/s41423-020-0400-4.
Tran, K. T. M., Gavitt, T. D., Farrell, N. J., Curry, E. J., Mara, A. B., Patel, A., et al. (2020).
Transdermal microneedles for the programmable burst release of multiple vaccine pay-
loads. Nature Biomedical Engineering. https://doi.org/10.1038/s41551-020-00650-4.
Turoňová, B., Sikora, M., Sch€urmann, C., Hagen, W. J. H., Welsch, S., Blanc, F. E. C., et al.
(2020). In situ structural analysis of SARS-CoV-2 spike reveals flexibility mediated by
three hinges. Science, 370(6513), 203–208. https://doi.org/10.1126/science.abd5223.
van Doremalen, N., Lambe, T., Spencer, A., Belij-Rammerstorfer, S., Purushotham, J. N.,
Port, J. R., et al. (2020). ChAdOx1 nCoV-19 vaccine prevents SARS-CoV-2 pneumonia
in rhesus macaques. Nature, 586(7830), 578–582. https://doi.org/10.1038/s41586-020-
2608-y.
Vellozzi, C., Burwen, D. R., Dobardzic, A., Ball, R., Walton, K., & Haber, P. (2009). Safety of
trivalent inactivated influenza vaccines in adults: Background for pandemic influenza vac-
cine safety monitoring. Vaccine, 27(15), 2114–2120. https://doi.org/10.1016/j.vaccine.
2009.01.125.
Wan, Y., Shang, J., Graham, R., Baric, R. S., & Li, F. (2020). Receptor recognition by the
novel coronavirus from Wuhan: An analysis based on decade-long structural studies of
SARS coronavirus. Journal of Virology, 94(7). https://doi.org/10.1128/jvi.00127-20.
Wang, D., Hu, B., Hu, C., Zhu, F., Liu, X., Zhang, J., et al. (2020). Clinical characteristics of
138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan,
China. JAMA : The Journal of the American Medical Association, 323(11), 1061–1069.
https://doi.org/10.1001/jama.2020.1585.
Wang, J., Peng, Y., Xu, H., Cui, Z., & Williams, R. O. (2020). The COVID-19 vaccine race:
Challenges and opportunities in vaccine formulation. AAPS PharmSciTech, 21(6), 225.
https://doi.org/10.1208/s12249-020-01744-7.
Wang, M. Y., Zhao, R., Gao, L. J., Gao, X. F., Wang, D. P., & Cao, J. M. (2020). SARS-CoV-2:
Structure, biology, and structure-based therapeutics development. Frontiers in Cellular
and Infection Microbiology. https://doi.org/10.3389/fcimb.2020.587269.
WHO. (2020). Draft landscape of COVID-19 candidate vaccines- November 3. World Heal.
Organ.
World Health Organization. (2021). Status of COVID-19 vaccines within WHO EUL/PQ eval-
uation process (20 January 2021). World Health Organization. (February), 2. Retrieved
from https://extranet.who.int/pqweb/sites/default/files/documents/Status_COVID_VAX_
20Jan2021_v2.pdf.
Wu, Z., & McGoogan, J. M. (2020). Characteristics of and important lessons from the coro-
navirus disease 2019 (COVID-19) outbreak in China: Summary of a report of 72314 cases
from the Chinese Center for Disease Control and Prevention. JAMA : The Journal of
the American Medical Association, 323(13), 1239–1242. https://doi.org/10.1001/
jama.2020.2648.
Wu, F., Wang, A., Liu, M., Wang, Q., Chen, J., Xia, S., et al. (2020). Neutralizing antibody
responses to SARS-CoV-2 in a COVID-19 recovered patient cohort and their implications.
SSRN Electronic Journal. https://doi.org/10.2139/ssrn.3566211.
Xia, S., Zhu, Y., Liu, M., Lan, Q., Xu, W., Wu, Y., et al. (2020). Fusion mechanism of 2019-
nCoV and fusion inhibitors targeting HR1 domain in spike protein. Cellular and molecular
immunology. https://doi.org/10.1038/s41423-020-0374-2.
Yang, D. (2021). Application of nanotechnology in the COVID-19 pandemic. International
Journal of Nanomedicine, 16, 623–649. https://doi.org/10.2147/IJN.S296383.
Young, J., Thone, M. N., & Jik, Y. (2021). COVID-19 vaccines : The status and perspectives in
delivery points of view. Advanced Drug Delivery Reviews, 170, 1–25. https://doi.org/
10.1016/j.addr.2020.12.011.
Zarandi, P. K., Zinatizadeh, M. R., Zinatizadeh, M., Yousefi, M. H., & Rezaei, N. (2021).
SARS-CoV-2: From the pathogenesis to potential anti-viral treatments. Biomedicine &
Pharmacotherapy, 137, 111352. https://doi.org/10.1016/j.biopha.2021.111352.
Zhang, N. N., Li, X. F., Deng, Y. Q., Zhao, H., Huang, Y. J., Yang, G., et al. (2020).
A thermostable mRNA vaccine against COVID-19. Cell, 182(5), 1271–1283. https://
doi.org/10.1016/j.cell.2020.07.024.
Zhang, D. Y., Zheng, Y., Tan, C. P., Sun, J. H., Zhang, W., Ji, L. N., et al. (2017). Graphene
oxide decorated with Ru(II)-polyethylene glycol complex for lysosome-targeted imaging
and photodynamic/Photothermal therapy. ACS Applied Materials and Interfaces, 9(8),
6761–6771. https://doi.org/10.1021/acsami.6b13808.
Zhao, L., Seth, A., Wibowo, N., Zhao, C.-X., Mitter, N., Yu, C., et al. (2014). Nanoparticle
vaccines. Vaccine, 32(3), 327–337. https://doi.org/10.1016/j.vaccine.2013.11.069.
Zhao, J., Yuan, Q., Wang, H., Liu, W., Liao, X., Su, Y., et al. (2020). Antibody responses to
SARS-CoV-2 in patients with novel coronavirus disease 2019. Clinical Infectious Dis-
eases, 71(16), 2027–2034. https://doi.org/10.1093/cid/ciaa344.
Zhou, P., Yang, X.-L., Wang, X.-G., Hu, B., Zhang, L., Zhang, W., et al. (2020). A pneumonia
outbreak associated with a new coronavirus of probable bat origin. Nature, 579(7798),
CHAPTER
A review of
hypersensitivity methods
to detect immune
responses to SARS-CoV-2
6
Fernando Dı́az-Espadaa,†, Victor Matheub, and Yvelise Barriosc,*
a
Department of Immunology, Clıńica Puerta de Hierro, Madrid, Spain
b
Servicio de Alergologıá, Floor-2, Edificio de Actividades Ambulatorias, Hospital Universitario de
Canarias, Tenerife, Spain
c
Laboratorio Immunologıá Central Lab, Planta 0, Edificio Principal, Hospital Universitario de
Canarias, Tenerife, Spain
Abbreviations
ACE2 angiotensin-converting enzyme 2
ADCC antibody mediated cellular cytotoxicity
AGEP acute generalized exanthematous pustulosis
BCR B-cell receptor
BAT basophil activation test
CMV cytomegalovirus
COVID-19 coronavirus disease 2019
CoviDCELL® register name of Spike DTH
DTH delayed-type hypersensitivity
DRESS drug reaction with eosinophilia and systemic symptoms
E envelope structural protein of SARS-CoV-2
EIA enzyme immunoassays
FDE fixed drug exanthema
G&C Gell & Coombs
HLA human leukocyte antigen
HCoV human coronavirus
IDT intradermal tests
IGRA interferon gamma release assays
†
RETIRED

189
190 CHAPTER 6 DTH methods and immune response to covid
LMW low molecular weight

M membrane structural protein of SARS-CoV-2
MERS-CoV Middle Eastern respiratory syndrome coronavirus
N nucleocapsid structural protein of SARS-CoV-2
NK natural killer cells
NSAIDs non-steroidal anti-inflammatory drugs
Nsps non-structural proteins of SARS-CoV-2
POC the point-of-care
PPD purified protein derivative
RBD envelope spike protein receptor binding domain (RBD) of SARS-CoV-2
S spike structural protein of SARS-CoV-2
SARS-HCoV Severe Acute Respiratory Syndrome human coronavirus
SARS-CoV-2 severe acute respiratory syndrome-coronavirus-2
SCID severe combined immunodeficiency
SJS Stevens–Johnson syndrome
SLE systemic lupus erythematosus
SMX sulphamethoxazole
SPT skin prick test
TCR T cell receptor
TEN toxic epidermal necrolysis
TH2-IgE type II immunity
TST tuberculin skin test (Mantoux)
WHO World Health Organization
1 Historical perspective
The expression “delayed type hypersensitivity” was introduced in the immunologi-
cal vocabulary by the British immunologists Philip Gell and Robert Coombs (Gell &
Coombs, 1963), in their seminal classification that categorized hypersensitivity dis-
eases of immune origin into four classes (Table 1), according to their particular ef-
fector mechanisms. In its original meaning, the word “hypersensitivity” denoted the
status of a mammalian organism immunized against a microbial pathogen and its
ability to react against it after a new exposure to the same agent. But the enormous
size of the repertoire expressed by the adaptive immune system enables the recog-
nition of an astonishing number of antigenic structures, that extend well beyond the
substances present in infectious (microbial) and non-infectious (ectoparasites, chem-
ical and toxic compounds) agents, and include molecules present in the host tissues
(tumour cells, autoantigens). Although the immune system machinery is under a
strict control regime, subtle alterations in its functioning can result in exaggerated
reactions that may cause damage to the tissues of the host. As the 1960s progressed,
the dysfunction of the immune system was increasingly recognized as a pathogenic
mechanism, counteracting the previous appreciation, firmly rooted in the first few
decades of the 20th century, of its beneficial effects in the prevention and resolution
of infectious diseases. In the context in which G&C gave birth to their celebrated
classification, the word hypersensitivity was employed to describe exclusively the
Table 1 Classification of hypersensitivity reactions.
Type II Type IV
Type I a b Type III a b c d
Latency Immediate (seconds Min to hours Min to hours Up to 12 h 12 h to days 12 h to days 12 h to days 12 h to days
to minutes)
Immune IgE IgG/IgM IgG/IgM IgG/IgM CD4 + TH1 CD4 + TH2 CD8 + CD4 + TH17
reactant cells cells T cells cells
Antigens Eukaryotic antigens Cell Cell Soluble antigens Intracellular Parasitic Virus Medications
Foreign/self enzymes, toxins, membrane membrane Bacterial antigens bacteria, virus worms Medications (haptens, p-i)
venoms, xenobiotics molecules molecules Viral particles Medications Chemicals
Drugs acting as Extracellular Antibody (haptens, (haptens,
haptens matrix pharmaceuticals p-i) p-i)
Drugs (hapt)
Effector Mast cell C0 deposition Interference Immunocomplex Macrophage Eosinophilic Cytotoxic Neutrophilic
mechanism degranulation IgE Phagocytosis with cell C0 deposition, activation inflammation infiltration
mediated ADCC function PMN influx. Granuloma
Histamine, PMN influx formation
leukotrienes
Beneficial Parasitic expulsion, Extracellular Clearance bacterial Control Granuloma Virus Enhance
Reactions toxin removal: bacteria lysis. antigens and viral Mycobacterial eggs from removal phagocytosis
increased peristalsis, particles infection helminths bacteria/virus
mucous secretion,
edema, diarrhoea
Detrimental Allergic diseases, MBT/Rh/HA Myasthenia Serum sickness Insulitis DRESS SJS/TEN Pustular
reactions anaphylaxis Autoimmune gravis, Graves Arthus reaction syndrome Contact psoriasis
hypothyroidis, disease, SLE, reactive dermatitis DAGEP
Good Pasture Chronic arthritis,
Pemphigus idiopathic polyarteritis
Rheumatic urticaria nodosa, allergic
fever alveolitis, PSGN
ADCC, antibody dependent cellular cytotoxicity; DAGEP, drug induced acute generalized exanthematous pustulosis; DRESS: drug reaction with eosinophilia and systemic symptoms; HA,
hemolytic anaemia; MBT, mismatched blood transfusion; PSGN, post-streptococcal glomerulonephritis; Rh, rhesus incompatibility; SJS/TEN, Stevens-Johnson syndrome/toxic epidermal
necrolysis; SLE, systemic lupus erythematosus.
harmful reactions that occurred during immune responses. In an effort to avoid its
ambiguous meaning, G&C describe these pathogenic responses as “allergic reactions
producing tissue damage”.
The G&C classification divides hypersensitivity reactions into four pathophysi-
ological categories. The first three types describe reactions conveyed by antibodies
and are considered “immediate” because its manifestations occur within the first 24 h
after the initial triggering event, whereas the fourth type described hypersensitivity
reactions accomplished by the T cell arm of the immune system and is considered
“delayed” because the reactions are not seen until 24–48 h. The great amount of ad-
vances in our understanding of the functioning of the immune system since the year
of G&C report, have led to a re-interpretation of their classification. While types
I and III have remained unchanged since G&C devised their classification of hyper-
sensitivity reactions, types II and IV have been subclassified in two and four sub-
types, respectively, and a fifth type of hypersensitivity reaction has been proposed
to accommodate sarcoid diseases. Despite these advances, we think that the simple
G&C classification has withstood the test of time reasonably well and is still widely
used to describe the pathologies resulting from unwanted reactions of the immune
responses.
But it must be considered that the system devised by G&C to categorize delete-
rious reactions induced by rather innocuous substances can be easily applied to cat-
egorize beneficial reactions used by the immune system that allows the host to get rid
of microbial invaders. In this regard, in vivo tests based on the G&C principles are
currently used not only to diagnose patients who have experienced hypersensitivity
reactions to certain substances but also to investigate the immune status of individ-
uals affected by a particular microbial infection. Both the skin tests to demonstrate
immune reaction to certain substances (contact dermatitis) and the tuberculin reac-
tion are both diagnostic procedures contemplated as G&C Type IV reactions that re-
veal either a pathological hypersensitivity event or a normal immune response to a
past microbial infection. Well before the discovery of T cell recirculation and the
existence of skin resident memory cells, Richard Wagner wrote, in his emotive hom-
age to the figure of Clemens von Pirquet, “Out of the darkness of inner parts of the
body and submerged tissues, the pathological processes and reactions were
projected onto the surface and moved into bright light” (Wagner, 1964). Today’s
immunologists take advantage of this projection and have in their hands a simple
and affordable method to investigate the immune reaction to a wide variety of
microbial and non-microbial challenges.
It is important to take into account that some clinical symptoms may overlap
among the different classes of hypersensitivity and that many small molecular weight
drugs can cause all types of hypersensitivity reactions, mostly involving type I or
type IV hypersensitivity reactions. Adverse reactions to drugs (medications) are par-
ticularly important in clinical practice (Edwards & Aronson, 2000) and were defined
by the World Health Organization (WHO) in 1972 as “a response to a drug which is
noxious and unintended, and which occurs at doses normally used in humans for the
prophylaxis, diagnosis, or therapy of disease, or for the modification of physiological
function”.
2 Hypersensitivity reactions 193
In this chapter, the general characteristics of each of the types of hypersensitivity

described in Gell and Coombs classification will be summarized and the immune
mechanisms involved in its four categories (Table 1), with special reference to type
IV reactions including their application to the study of Covid-19 responses.
2 General overview, classification and description

of hypersensitivity reactions
2.1 Type I hypersensitivity-immediate/IgE mediated
In the first category of the G&C classification, the hypersensitivity reaction was due to
cell-bound antibodies of the IgE class, and is distinguished by a time lag of seconds to
minutes between exposure to the allergenic substance and the onset of symptoms.
The idea that this reaction was a consequence of the activity of the immune system
was originally advanced by Von Pirquet and Shick (1903) and later von Pirquet coined
the word allergy to describe the adverse effect induced by the reaction (Von Pirquet,
1906). The observation that a serum from an allergic subject could transfer immediate
hypersensitivity to the skin of a non-allergic subject (the Prausnitz–K€ustner test)
(Prausnitz & Kustner, 1921) triggered the search for the molecule responsible for
the hypersensitivity reaction. Despite the efforts of many laboratories, the nature of
this factor, soon named by Coca and Grove (1923) as “atopic reagin”, remained elusive
for the next four decades. Late in the 1960s, when all other antibody classes had been
discovered and G&C had devised their hypersensitivity classification, the “reaginic
antibody” was independently identified by two laboratories. The new immunoglobu-
lin, the 5th antibody class and the rarest of the serum immunoglobulins, was finally
designated immunoglobulin E at the WHO meeting in Lausanne in 1968 (Bennich
et al., 1968). Antibodies of the IgE class have been only found in mammals.
Although best known as the mediator of type I hypersensitivity to many inani-
mate substances, IgE antibodies were first considered a fundamental component
of the immunity against multicellular parasites, particularly nematodes (Jarret &
Miller, 1982). However, it was soon recognized that IgE was also produced in re-
sponse to other non-infectious and innocuous environmental substances that do
not have in common any chemical characteristics that define them as allergens
(Galli, Tsai, & Piliponsky, 2008). This apparent innocuity was challenged by the fact
that allergenic molecules include xenobiotics (poison ivy), enzymes (proteases from
pollen and dust mites, phospholipase A2 from Hymenoptera venoms), toxins (ricin),
venoms (from biting arthropods, cnidaria, reptiles) and irritants (diesel exhaust
particles) (Palm, Rosenstein, & Medzhitov, 2012). This wide range of biological
activities can have potentially harmful effects on the host and in this regard, the
allergic reaction can be considered to be a rapid immune response that protects
mammals against acute toxicity (Profect, 1991).
Allergens can enter the body by inhalation, ingestion, injection or by skin or mu-
cosal contact. It has been observed that the repeated penetration of an antigen trans-
mucosally and at very low doses is a particularly efficient way of inducing IgE
responses. IgE synthesis is a prototypical thymus-dependent response requiring the

help of the TH2 subset of T lymphocytes (type II immunity) (Del Prete, 1992). In the
inductive phase of the immune recognition, allergenic molecules that enter the body
through the epithelial barriers are taken up and processed by dendritic/Langerhans
cells. Allergenic proteins contain T cell epitopes that are selectively presented to
CD4 + T helper cells associated to Class II HLA molecules. In the absence of danger
signals of microbial origin, cytokines produced by damaged epithelial cells (Il-33)
(Zhao & Hu, 2010) or mechanically injured dendritic cells (TSPL) polarize
T cells to acquire a T helper type 2 (TH2) phenotype (Liu, 2006; Oyoshi, Larson,
Ziegler, & Geha, 2010). B cells recognize allergenic molecules through their
B-cell receptor (BCR) and are triggered by the TH2 cytokines Il-4 and Il-13 to un-
dergo class–switch recombination to IgE (and IgG4)-producing cells (De Vries,
Punnonen, Cocks, de Waal Malefyt, & Aversa, 1993). The encounter between
TH2 and the B cells occurs both in lymphoid germinal centres and in local mucosal
sites (respiratory mucosa) (Takhar et al., 2007).
Once released into the circulation, most of the produced IgE binds to the
high-affinity receptor FcεRI on the surface of mast cells and basophiles (Metzger,
Kinet, Blank, Miller, & Ra, 1989). Once bound, IgE acts as a specific antigen (aller-
gen) receptor on the surface of those cells. Re-exposure to the same allergen initiates
a process of intracellular signalling after cross linking of cytophilic specific IgE, fol-
lowed by cell degranulation and rapid release of preformed (histamine, tryptase/
chymase) or newly synthesized lipid mediators (prostaglandin D2, leukotriene
C4), that mediate an aggressive early inflammatory reaction within 10–15 min after
exposure to the allergen (Tharp, 1990). A late phase reaction, characterized by
further oedema and recruitment of inflammatory cells, occurs several hours after
exposure and is conveyed by bioactive cytokines (Il-1, 4, 5, 13, TNF-a, GM-CSF)
produced by mast cells/basophiles within 4–6 h after allergen exposure (Dispenza,
2019). The ensuing symptoms depend on the site of allergen exposure, and can vary
from a local reaction (skin rash, urticaria, eczema, edema and mucus secretion, rhi-
nitis, angioedema, bronchospasm, diarrhoea, increased intestinal peristalsis) to a sys-
temic response (anaphylaxis) in case of oral ingestion or intravenous administration
(medications, stinging insect venoms) of the allergenic substance.
The consideration of the type II immunity (TH2-IgE) as an old evolutionary system
to provide protection against helminthic parasites, led to the consideration that type
I hypersensitivity reactions may be mistargeted responses against innocuous, non-
noxious substances (hygiene hypotheses) (Strachan, 1989). More recently, Palm
et al. (2012) proposed a different interpretation of the allergic reactions, arguing that
IgE antibodies play a key role in the recognition of noxious environmental substances
and that the reactions triggered by IgE provide a mostly beneficial function to the host,
although they can become harmful when excessive. From an evolutionary perspective,
it is reasonable that untoward biological activities conveyed by environmental agents
provoke a protective immune reaction. The effector arm of type II immunity is ideally
suited to cope with those unwanted activities, promoting both expulsion of parasites
(increase of peristaltic movements) and the elimination of potentially toxic substances
(mucus secretion, sneezing, itching, coughing, tear production, vomiting, diarrhoea,

vasodilatation, appearance of exudative fluids, dilution by edema). From an evolution-
ary perspective, the quick and sensitive response of type II immunity would provide
mammals with a singular and adversive mechanism to detect and avoid unfavourable
environments.
Some of the mechanisms responsible for hypersensitivity reactions to drugs and
other low molecular weight compounds are special cases of type I hypersensitivity,
and may be considered hapten-driven events. The reactivity of those molecules de-
pends on their ability to react with proteins, producing an hapten-carrier conjugate
that can elicit an immune response (Landsteiner, 1945). Haptens are small molecules
that are not immunogenic by themselves but become immunogenic after covalent
conjugation to a macromolecule, usually a protein. The attached hapten and their sur-
rounding carrier amino acids create a new antigenic determinant that is recognized as
non self by the immune system.
Beta-lactam antibiotics, sulphanilamides, quinolones, iodinated radiocontrast
media, muscle relaxants are all drugs that are able to bind covalently to proteins
and induce IgE-mediated anaphylaxis or hypersensitivity reactions (Pichler,
2019). Adverse reactions to β-lactam antibiotics (penicillin, cephalosporin) is an ex-
ample of drug-induced type I hypersensitivity (Parker, 1981). The β-lactam ring is
opened after nucleophilic attack by free amino groups (lysine ε-amino groups) of
proteins, and the exposed carbonyl moiety forms amide bonds, creating a new peni-
cilloic antigenic determinant for antibodies (Weltzien & Padovan, 1998). Other
drugs (sulphamethoxozole, SMX) act as pro-haptens, and can bind to self-proteins
only after being metabolized (nitroso metabolite, SMX-NO) (Naisbitt et al.,
1999). Considering the metabolic transformation of some drugs and the production
of protein adducts, the existence of these drug allergies can be considered as a
particular case of a hypersensitivity reaction to xenobiotics (Li & Uetrecht, 2010).
Skin tests are the accepted standard methods to investigate Type I, IgE mediated
reactions. The most common test to reveal specific IgE sensitization is the skin prick
test (Pepys, 1975). After 10–15 min of reaction, the presence of a raised wheal with
erythema at the site of the allergen puncture of 3 mm or greater in diameter indicates
the presence of specific IgE antibodies. Although prick tests correlate well with clin-
ical findings, they do not have a high level of sensitivity. Thus, when a prick test to a
particular allergen is negative but allergy is still suspected, an intradermal test (sub-
cutaneous injection) should be used instead. Although intradermal injections may be
unpleasant for the patient and the reaction may be too strong, the test permits the use
of a greater amount of allergen and is more sensitive than the prick test.
Skin tests may not be suitable when there is a high risk of triggering a severe re-
action or the patient has signs of eczema or psoriasis. In these cases, or when the
patient is under a medication that can interfere with the test, the determination of
IgE specific to a particular allergen in a serum sample is an alternative method to
study potentially sensitized subjects. Derived from the old radio-allergo-sorbent-test
(W€ uthrich & Kopper, 1975), the enzyme immunoassays (EIA) are widely used in
clinical practice, but their predictive value and sensitivity are less than traditional
skin tests. Skin tests and measurements of specific IgE antibodies in serum give com-
plementary information for the diagnosis of allergic diseases.
When the skin test or the specific IgE immunoassays are not conclusive,
the basophil activation test (BAT), that measures either histamine release
(Ostergaard, Ebbensen, Nolte, & Skov, 1990) or CD63 upregulation (González-
Muñoz, Villota, & Moneo, 2008) following stimulation of blood basophiles with
allergen in vitro, emerged as a new diagnostic tool. The test tries to reproduce
in vitro the allergic reaction in patients sensitized to particular allergens. Both
EIA and BAT studies should be used in patients in whom skin challenge can cause
reactions of unpredictable severity.
2.2 Type II hypersensitivity-IIa/IIb antibody mediated

Antibodies mediate the killing of extracellular pathogens via different mechanisms,
designed to increase the phagocytic capacity of defensive cells or to induce the lysis
of the invading organism. The same mechanisms are responsible for tissue injury
when antibodies of the IgG or IgM class bind to antigens present on cell membranes
or in the extracellular matrix, resulting in cellular damage.
These reactions in which free antibodies induce tissue damage are contemplated
as Type II hypersensitivity in G&C classification. The antigens recognized in type II
reactions can either be endogenous (self-antigens) or exogenous (foreign antigens
lodged onto a host, such as drugs or transfused blood components). In the case of
self-antigens, the mechanism of immune tolerance is breached and self-reactive
antibodies are produced that attach to endogenous molecules in the tissue of the host.
Symptoms of type II reactions to exogenous antigens appear after minutes to hours,
and the damage is limited to the cells or tissue where the reactions take place. Type II
reactions can be divided into two subtypes: type IIa and type II b.
Type IIa refers to reactions characterized by destruction of haematopoietic and
non-haematopoietic cells. Antibody bound to antigens on the cellular membrane
of the target cells can induce their death by three different mechanisms: ingestion
by phagocyte cells, antibody mediated cellular cytotoxicity (ADCC) by natural killer
cells (NK) or activation of the complement system. When the target of the autoan-
tibodies are components of extracellular material (basal membrane, adhesion mole-
cules), the deposited antibodies may induce tissue necrosis by disrupting the cell
matrix, impairing cellular adhesion or inducing complement dependent inflamma-
tory reactions.
Phagocytosis is enhanced when IgG antibody-coating target cells (opsonisation)
bind to FcγRI/IIA receptors present on cells such as macrophages and neutrophiles
(McKenzie & Schreiber, 1998). Cytotoxicity is mainly due to NK cells, that recog-
nize the Fc region of cell-bound antibodies through their FcγRIIIA receptor
(Trinchieri & Valiante, 1993), which promotes the release of preformed perforin
and granzymes resulting in apoptotic death of the target cells (Peters et al., 1991).
The complement system is activated by IgM or IgG antibodies bound to the mem-
brane of target cells, resulting in cell lysis after the assembly of the membrane attack
complex (C5b-C9). However, this lytic mechanism may not be very efficient, due to
the phenomenon of homologous restriction, whereby cells are protected from lysis by
autologous complement by a self-recognition mechanism that inhibits the late phases
of complement attack, composed of the cell membrane proteins protectin (CD59),
cofactor protein MCP (CD46) and decay-accelerating factor DAF (CD55) (Gorter
et al., 1996). Nevertheless, the first steps of complement fixation results in the de-
position and covalent binding of iC3b to the cell membrane of blood cells, which
renders these cells susceptible to phagocytosis by specialized macrophages in the
liver and spleen that express the iC3b complement receptors CR3 (CD11b/CD18)
and CR4 (CD11c/CD18) (Takizawa, Tsuji, & Nagasawa, 1996). This particular
way of cell destruction links complement fixation to phagocytosis, and enhances
the deleterious effects (anaemia, neutropenia or thrombocytopenia) of type IIa hy-
persensitivity reactions. Moreover, complement fixation on target cells results in
the local production of anaphylotoxins (C3a, C5a) that recruit polymorphonuclear
leukocytes (Forema, Glovsky, Warner, Horvath, & Ward, 1996) and amplify tissue
injury through the release of hydrolytic enzymes after their autolysis.
Type IIa hypersensitivity is typified by the reactions of preformed antibodies in
mismatched blood transfusion (Davenport & Mintz, 2007) and in the haemolytic dis-
ease of the newborn (Rhesus incompatibility) (Murray & Roberts, 2007), which lead
to alloimmune destruction of red blood cells. The different types of autoimmune de-
struction of blood cells (autoimmune haemolytic anaemia, ANCA-dependent neutro-
penias, idiopathic thrombocytopenic purpura) and organ-specific autoimmune
diseases (autoimmune hypothyroidisms, anti-GBM nephritis and Goodpasture syn-
drome, pemphigus vulgaris) are also examples of type IIa reactions in which anti-
bodies directed against self-antigens promote the destruction of cells and tissues
(Kumar, Abbas, & Aster, 2021). A special case of type IIa hypersensitivity is rheu-
matic fever, in which epitope similarity between streptococcal antigens and myocar-
dial or brain antigens may explain the presence of reacting antibodies that contribute
to pathologies affecting these organs (Cunningham et al., 1989; Guilherme, Kalil, &
Cunningham, 2006).
Although drug hypersensitivity reactions are most frequently mediated by IgE
(Type I) or T cells (type IV), they can also induce anaemia, neutropenia, thrombocy-
topenia and hepatic dysfunction, all hallmarks of IgG mediated, type IIa hypersensi-
tivity reactions. To become immunogenic, drugs act as haptens, requiring conjugation
to a cell surface protein on blood cells or other carrier proteins. Antibiotics (penicillins,
cephalosporins), antihypertensive drugs (alpha methyldopa), thiazides, quinidine and
other drugs can induce haemolytic anaemia and thrombocytopenic purpura through
this mechanism (Kaufman et al., 1993; Petz, 1993).
In type IIb hypersensitivity, autoantibodies bind to receptors on the target cells,
inducing dysfunction of the affected organ. In Graves’ disease, anti-thyrotropin re-
ceptor antibodies act as agonists and stimulate the thyroid gland to produce excessive
amounts of thyroid hormone (hyperthyroidism) (Chen et al., 2003). In some cases of
chronic idiopathic urticaria, FcεRI on mast cells are recognized by auto IgG anti-
bodies, which causes the degranulation of the target cells and the onset of urticaria
(Niimi et al., 1996). In myasthenia gravis, autoantibodies against the acetylcholine

receptor (Sch€ onbeck, Chrestel, & Hohlfeld, 1990) present on the membrane of stri-
ated muscle cells induce internalization and reduce the efficiency of neuromuscular
signal transduction.
Many common laboratory techniques (immunoassays, direct and indirect anti-
globulin tests, fluorescence) are used to diagnose the pathologies associated with
type II hypersensitivity reactions. Skin tests are not reliable to diagnose drug induced
Type II reactions and the drug provocation tests are high-risk methods that are not
widely used. In vitro tests to determine NK cell activity associated to type II reactions
(Viel et al., 2018) are difficult to do and can only be performed in specialized
laboratories.
2.3 Type III hypersensitivity-immune complex-mediated

The first historical description of a type III reaction was reported by Maurice Arthus
in 1903 (Arthus, 1903). Arthus observed that when rabbits were given repeated sub-
cutaneous injections of horse serum—a non-toxic material—during a period of time,
a local reaction (erythema, edema, induration) occurred a few hours after the fourth
injection (Arthus reaction). The local reaction gets worse after subsequent injections,
becoming purulent and with signs of haemorrhagic necrosis. In 1905, von Pirquet
and Schick extended the Arthus reaction to the blood, as they observed that repeated
intravenous injections with a protective anti-diphtheria horse antiserum caused sys-
temic complications in children that they called “serum sickness” and attributed it to
“the reaction of antigen (“toxins”) and antibody (“anti-toxins”)” (Von Pirquet &
Schick, 1905). Symptoms developed in 1 or 2 weeks after exposure to the antigen.
Type III and type II hypersensitivity reactions are similar in that antibodies of the
IgG or IgM classes are implicated, but in type III reactions the antigenic molecules
are soluble and not cell bound as happens in type II hypersensitivity. In type III, the
antigen-antibody encounter occurs in the blood, forming circulating immune com-
plexes which can occasionally deposit in the endothelium of blood vessels or migrate
out of plasma and deposit in host tissues. Antigens can be foreign proteins either of
microbial origin or pharmaceutical products dispensed in the course of medical ther-
apies or endogenous proteins (autoimmunity). Signs of type III reactions typically
occur several hours after antigen infusion in pre-sensitized individuals.
The pathogenicity of an immune complex depends on the antigen–antibody ratio.
In either antibody or antigen excess, the complex is soluble, and can be easily re-
moved by phagocytic cells or eliminated in excreted urine. Precipitating complexes
occur under certain conditions (mild antigen excess) and these complexes deposit in
vascular endothelium, glomerular basement membrane, synovial lining and alveolar
membranes of the lung.
Antigen–antibody complexes trigger the classical complement pathway. This
process leads to covalent binding of C3 to the Ig component of the immune complex
and further conversion to iC3b by complement regulators (Vivanco, Muñoz,
Vidarte, & Pastor, 1999). The complement activation by the antigen-antibody
complex is a double-edged sword. On the one hand, the iC3b deposited in immuno-
complexes facilitates solubilisation (Whaley & Ahmed, 1989) or removal through
interaction with CR1 receptors on phagocytic cells in the liver (Katyal,
Sivasankar, & Das, 2001). Although it might seem counter-intuitive, another bene-
ficial effect of C3b deposition is the disaggregation of immune complexes in smaller
entities (Miller & Nussenzweig, 1975) that can be more easily engulfed by phago-
cytic cells (Petersen, Baatrup, Jepsen, & Svehag, 1985). An important component of
humoral anti-viral responses might be the reactions initiated by complement depo-
sition on antigen–antibody complexes, that can contribute to the elimination of an-
tibody coated circulating viral particles (Rajan, 2003). In this context, the C3b is said
to have “neutralized” the virus.
But on the other hand, anaphylatoxins (C3a, C5a) liberated during the early phase
of complement fixation attract and activate polymorphonuclear leucocytes
(Mayadas, Tsokos, & Tsuboi, 2009) which release mediators that cause inflamma-
tory damage to the tissues. Anaphylatoxins can also activate local mast cells, induc-
ing their degranulation and the release of mediators that increase vasodilatation and
vasopermeability. Depending on the site of deposition, symptoms of vasculitis (of
endothelial cells of blood vessels), purpuric rash (dermis), arthritis (joints) or glo-
merulonephritis (renal glomeruli) can develop. In the case of inhalational entry,
hypersensitivity pneumonitis (allergic alveolitis) can ensue. The “farmer’s lung”
disease (Campbell, 1932) is a potentially dangerous hypersensitivity pneumonitis
that has attained considerable importance in respiratory medicine, and afflicts agri-
cultural workers exposed to organic material such as dust of improperly dried grains
or spores of fungus that grow in certain crops.
Hypersensitivity III reactions are implicated in a number of autoimmune, infec-
tious or drug-induced diseases. Systemic lupus erythematosus (SLE), a chronic,
autoimmune inflammatory disorder of connective tissue, is a prototypic type III
hypersensitivity disease, in which antibodies against nuclear components react with
released chromatin from apoptotic debris forming immune complexes. In the more
severe forms of SLE, these immune complexes can deposit in different organs, lead-
ing to a wide variety of abnormalities including nephritis, arthritis, cutaneous rash
(small vessels) and mesenteric vasculitis or mononeuritis (medium to large size
vessels) (Aranow, Diamond, & Mackay, 2008).
Infectious diseases like hepatitis B, bacterial endocarditis and yersiniosis display
a continuous source of antigens to form circulating immune complexes, causing
polyarteritis nodosa, poststreptococcal glomerulonephritis and reactive arthritis,
respectively (Kumar et al., 2021).
At the current time, serum sickness is associated with medications containing het-
erologous proteins (snake antivenom immunoglobulins, anti-thymocyte globulin,
protein vaccines, thrombolytic therapies, chimeric monoclonal antibodies) or with
insect stings. The local injection of the antigen may cause a necrotizing skin lesion
(Arthus reaction). Repeated transfusions containing residual amounts of plasma or
infusion of normal plasma in IgA deficient patients may induce anaphylactoid reac-
tions suggestive of type III hypersensitivity. Despite the wide use of medications
containing potential inducers of type III reactions, the annual rate of serum sickness
incidence is low (Rixe & Tavarez, 2021).
2.4 Type IV hypersensitivity-IVa/IVb/IVc/IVd-T cell mediated

Type IV hypersensitivity reactions are delayed responses (DTH) that involve
T lymphocytes as the major effector cells. The nature of the delayed skin reactions
was first revealed by Karl Landsteiner, who proved that the reaction was mediated by
the cellular and not the antibody arm of the immune response (Landsteiner & Chase,
1942). After the intradermal injection of antigen in a sensitized individual, a cellular
infiltration producing erythema, swelling and induration occurs at the site of the le-
sion 24–48 h later. Antigens engulfed by phagocytic cells are presented to local
T cells, which become activated and orchestrate the influx of other cell types that
amplify tissue injury through the release of cytokines or lysosomal enzymes
(Poulter, Seymour, Duke, Janossy, & Panayi, 1982).
Delayed hypersensitivity reactions were first described in 1890 by Robert Koch,
during his failed attempts to induce protective reactions against infections with tu-
berculous bacilli (Koch, 1890). After intradermal injection of a filtrate of heat-killed
bacilli, Koch described for the first time a delayed inflammatory response in individ-
uals who had been exposed to the tubercule bacillus. Despite the failure to induce a
protective response, the tuberculin reaction (aka as the PPD skin test) soon became
an important diagnostic test for tuberculosis. Methods of local application of tuber-
culin were promptly developed by Maurice Mantoux (Mantoux, 1908) and Claude
von Pirquet (Von Pirquet, 1909), who coined the expression “tuberculin reaction”.
Von Pirquet used a method of cutaneous scratch to apply tuberculin, a method that
was less reproducible than the intradermal injection employed by Mantoux. Decades
later, Florence Seibert obtained a purified protein derivative (PPD) by acid/salt pre-
cipitation of a tuberculin preparation (Seibert, 1934) that gave fewer non-specific
reactions than tuberculin after intradermal injection, enabling the creation of a
reliable test for tuberculosis.
Certain subsets of T cells are specifically designed to deal with intracellular path-
ogens of viral, bacterial, fungal or protozoan origin. Specifically activated T cells of
the CD8 + category function to destroy infected cells, either directly (cytotoxicity) or
after recruitment of other cells that participate in the immune response. Memory
T cells, mostly Tαβ with an effector phenotype (Clark et al., 2006) infiltrate the skin
and become tissue resident T cells that can be reactivated upon antigen encounter. In
a physiological setting, these cells are part of the immune surveillance system, local-
ized in one of the principal sites of entry of microbial pathogens (Tokura,
Phadungsaksawasdi, Kurihara, Fujiyama, & Honda, 2021). Experiments conducted
in the 1990s in SCID mice engrafted with human cells revealed that both CD4 and
CD8 T cells were involved in delayed skin reactions to tuberculin (Tsicopoulos
et al., 1998).
As it happens in other cases of hypersensitivity reactions, delayed responses can
be directed against self-molecules, and this process can end up causing autoimmune
damage to the host tissues. Moreover, the adverse reactions to some drugs and che-
micals also have notorious delayed type hypersensitivity manifestations, and are
even more common than immediate type I allergic reactions and in some cases they
can be life-threatening. Many drugs or chemicals are capable of eliciting type IV re-
actions, including beta-lactam antibiotics, quinolones, tetracyclines, certain NSAIDs
like oxicam, X-ray contrast media, metallic ions, poison ivy, local anaesthetics, al-
lopurinol, anticonvulsants, anticoagulants like LMW heparins, and antiviral and
antifungal medications (Brandt & Bircher, 2017).
The covalent binding of drugs to self-proteins (hapten–carrier complex) can eas-
ily explain antibody-based hypersensitivity reactions, and the same mechanism can
be involved in some cases of delayed type hypersensitivity reactions to medical
drugs. Beta-lactam antibiotics can form covalent links with peptides bound in the
groove of surface HLA molecules or react with self-proteins, that after intracellular
processing, yield hapten modified peptides, giving rise to new T cell epitopes
(Weltzien & Padovan, 1998). But in some cases, drugs and other chemicals that lack
hapten characteristics bind noncovalently to the immune receptors involved in T cell
activation, promoting the polyclonal or oligoclonal stimulation of T cells. These
compounds that modified T cell reactivity are of great medical relevance. Unlike
conventional type IV hypersensitivity, the induction of reactions by the pharmaco-
logical interaction of drugs with immune receptors (p-i concept, Pichler, 2008) does
not require a previous drug-specific sensitization. In some cases (sulphamethoxa-
sole), the drug alters the T cell receptor directly, initiating a signalling event that
must be completed by conventional TCR-HLA interactions. In others (abacavir,
carbamazepine), the drugs interact with peptide-binding pockets of certain HLA
alleles inducing changes in the shape of bound self-peptides (Ramsbottom, Carr,
Jones, & Rigden, 2018). This seems to be sufficient to create neoepitopes that trigger
unwanted T cell responses, probably involving preactivated T cells. Abacavir, an an-
tiretroviral agent indicated for the treatment of HIV-1 infection, binds to the peptide
cleft of the allele B*5701, and induces a severe and systemic hypersensitivity
reaction, precluding its use in patients expressing that allele (Mallal et al., 2002).
See Fig. 1 for a more detailed description of drug-induced type IV hypersensitivity
reactions.
Naı̈ve T lymphocytes differentiate into distinct subpopulations depending on the
nature of the invading antigen, the type of presenting cell and the cytokine microen-
vironment. Depending on the T cell subpopulation involved, type IV reactions can be
further subdivided into Ia, IVb, IVc and IVd subtypes. Each of the distinct
T phenotypes release certain chemokines and cytokines that preferentially recruit
and activate monocytes (type IVa), eosinophils (type IVb), or neutrophils (type
IVd). In type IVc reactions cytotoxic T lymphocytes participate in the direct killing
of target cells.
Type IVa reactions are mediated by the TH1 lymphocyte subset. A prototypical
example is the tuberculin reaction, characterized by a preferential TH1-type cytokine
profile with significant increases in the numbers of IL-2 and IFN-gamma mRNA-
expressing cells (Tsicopoulos et al., 1992) and activation of macrophages.
FIG. 1
Models of drug interactions with the T cell receptor/peptide/HLA complex that modify T cell
reactivity. A normal event in T cell recognition is depicted in A). A processed peptide (only five
aa are shown for simplicity) fits into the floor of the binding cleft of a HLA molecule. Typically,
two amino acid side chains bind into particular anchor pockets (p) in the base of the groove.
A TCR paratope is locked into the topside of the peptide. The trimolecular complex is further
stabilized by interactions between the TCRαβ chains and the α helix domains of the HLA
molecule (). In the hapten model (B), a drug/chemical (e.g., penicillin, ) binds covalently to a
self-protein that is processed by an APC and presented as short peptides, some of which can
bear the haptenized fragment (neoepitope). If recognized by the TCR of a non-tolerized T cell,
an unpredicted immune response can ensue. In (C), (p-i TCR concept) a drug/chemical like
sulphamethoxazole () bind non-covalently to the paratope of a TCR, and alters its
conformation inducing a stimulatory signal regardless of the bound peptide, that is
complemented by the canonical TCR-HLA interactions. The reaction is similar to that seen in
an alloimmune response. Alternatively (D), the drug (e.g., abacavir) () can bind non-
covalently to the binding pocket of an HLA molecule (p-i HLA concept), altering the shape of
the permissible peptides without the requirement of intracellular processing or allowing the
attachment of a different array of peptides. The new epitopes can induce a polyclonal
activation of T cells. The p-i-HLA concept has also been called “altered peptide repertoire
model”.
Mycobacterium tuberculosis (a pathogen that resides inside macrophages of the host)

induces a delayed type response that isolates bacteria-laden macrophages and initi-
ates the formation of granulomas, a cluster of organized immune cells that contain/
prevent the spreading of the infectious agent. Although granuloma formation is a
protective mechanism, the cytokines and lytic enzymes secreted by the macrophages
and other cells in the granuloma may cause extensive damage to the surrounding tis-
sues. In most cases, granulomas, literally “small nodules”, have an infectious origin
(Williams & Williams, 1983), but sometimes (as in sarcoidosis, see below) the
involved antigen is unknown.
One of the best known examples of autoimmune type IVa reactions is insulitis,
the destruction of pancreatic insulin-producing beta cells by infiltrating
T lymphocytes that occur in the early phases of insulin-dependent diabetes mellitus.
It has been proposed that a previous infection with group B coxsackieviruses can
precipitate the onset of insulitis (Fohlman & Friman, 1993), highlighting the asso-
ciation between autoimmune diseases and viral infections.
In type IVb reactions, TH2 lymphocytes produce Il-4, 5 and 13 that induce eo-
sinophilic inflammation and allergic symptoms. Activated eosinophils can migrate
and cause systemic injury (DRESS: drug reaction with eosinophilia and systemic
symptoms) (Bocquet, Bagot, & Roujeau, 1996). Type IVb reactions can extend the
inflammation of allergic disorders. Many medications can induce DRESS syn-
drome, including anti-convulsants, antibiotics, anti-inflammatory or anti-cancer
drugs (Adler et al., 2017). The mechanism by which the drugs activate the
T cell system involves the formation of covalent bonds with self-peptides (hapten
model), creating new T cell epitopes, or inserting into the groove of HLA mole-
cules and modifying the bound peptide (p-i concept). TH2 driven granulomatous
responses to helminthic eggs can be found in the liver and intestine of patients
affected with parasitic worms (Wynn, Thompson, Cheever, & Mentink-Kane,
2004).
Type IVc cytotoxic CD8 T lymphocytes kill target cells by release of the apopto-
sis inducers perforin/granzyme B, granulysin and Fas ligand. The better studied pa-
thologies are Stevens-Johnson syndrome (SJS, Lyell syndrome) and toxic epidermal
necrolysis (TEN). SJS and TEN are acute, potentially fatal skin reactions that are
considered parts of a disease spectrum. TEN is the more severe form of the disease
(Dodiuk-Gad, Chung, Valeyrie-Allanore, & Shear, 2015). The targeted cells in SJS/
TEN are keratinocytes of the skin and mucous membranes that are killed by the im-
mune attack of cytotoxic lymphocytes. Although SJS/TEN can be triggered by in-
fections such as pneumonia, herpes virus and hepatitis, in most cases they are
caused by certain medications, including antimicrobials (nevirapine), NSAIDs,
drugs and anticonvulsants (Baryaliya et al., 2011).
Contact dermatitis is a classic example of a non-infectious type IV hypersensi-
tivity reaction, an eczematous skin reaction induced by many small reactive chemi-
cals (metal ions, latex, cosmetics, synthetic dyes, poison ivy) (Murphy, Atwater, &
Mueller, 2021), that react with and modify immune receptors (p-i concept).
In Type IVd, neutrophilic infiltration causes severe inflammatory skin diseases,

such as pustular psoriasis (of probable autoimmune origin) (Naik & Cowen, 2013)
and acute generalized exanthematous pustulosis (associated with medications: anti-
biotics, antifungals, antimalarials, anti-inflammatories) (Szatkowski & Schwartz,
2015). The reaction is initiated by TH17 cells that attract neutrophiles after secreting
CXCL-8 (Il-8) and Il-17 (Lochmatter, Zawodniak, & Pichler, 2009).
A special case of hypersensitivity is sarcoidosis, a systemic granulomatous
disease of unknown origin. In a prototypical granulomatous-type hypersensitivity,
TH1/TH2 cells orchestrate a reaction to wall off macrophages laden with undigested
mycobacteria/metazoan parasites preventing pathogen spread. In the case of sarcoid-
osis, the nature of the offending antigen is not clear. Some authors have suggested
that sarcoidosis should be considered a fifth type of hypersensitivity reaction (Rajan,
2003), that would include granulomatous responses to foreign inanimate material.
Early attempts to identify the antigen in spleen extracts of patients suffering from
sarcoidosis (Kveim reaction) (Chase, 1961), were not conclusive. More recently,
bacterial DNA was identified in sarcoidosis lesions, suggesting that mycobacteria
could be important players in the pathogenesis of sarcoidosis (Song et al., 2005).
On the other hand, recent findings reveal that T cells from sarcoidosis patients
recognize peptides derived from several self-molecules including vimentin and
β-actin. An intriguing possibility is that, in sarcoidosis patients, molecular mimicry
drives a T cell response to certain microbial antigens into an autoimmune reaction
(Wahlstrom et al., 2009). In this respect, sarcoidosis could be considered a special
case of type IVa reactions.
DTH skin reactions may be used to reveal previous exposures to intracellular
pathogens (fungi, bacteria). Antigenic material is injected intradermally into the
skin. Appearance of swelling and erythema usually > 5–10 mm in 48–72 h indicates
that the subject is already exposed to the antigen. Of clinical relevance are DTH skin
reactions to detect past infections with M. tuberculosis (Mantoux test), Mycobacte-
rium leprae (lepromin test) or fungi (Candida, Coccidioides). Although once com-
mon, DTH reactions, used for the purpose of detecting a past infection, are now only
employed for tuberculosis screening.
Delayed type hypersensitivity reactions to chemicals are best studied by a patch
test and it is widely used in predicting sensitivity to contact allergens. Patch tests are
safer and more comfortable for the patient than intradermal tests.
Cell mediated immunity can be easily tested by DTH intradermal skin testing. In
this respect, DTH reactions are a useful method to investigate T cell anergy in immu-
nocompromised or immunodeficient patients. Screening requires the use of several
common recall antigens. Two is the minimum number of antigens required to detect
delayed hypersensitivity in 100% of normal subjects (Gordon, Krouse, Kinney,
Stiehm, & Klaustermeyer, 1983). Problems of antigen availability can be overcome
by using a multiple test device (Multitest CMI, Institute Mèrieux), that permits the
simultaneous intradermal application of seven ubiquitous recall antigens: candida,
tuberculin (PPD), tetanus, diphtheria, trichophyton, streptococcus and proteus.
3 Skin test application of hypersensitivity reactions 205
3 Skin test application of hypersensitivity reactions: In vivo

measurements of immune responses
Skin tests are diagnostic tools for identifying the mechanisms of hypersensitivity to
substances. The major methods routinely used are intraepidermal, intradermal and
patch testing (Demoly, Romano, & Bousquet, 2008).
Percutaneous or intraepidermal tests, also usually called skin prick test (SPT) or
prick-puncture test, were initially described by Lewis and Grant in 1924, although
Dr. Blackley in 1865 was the first to carry out a skin test on himself with pollen from
Lolium perenne. In the 1970s, Pepys developed and standardized the performance of
prick-puncture skin tests. The most common procedure is currently carried out by
dropping a drop of the extract to be studied on the skin of the forearm and subse-
quently punctured with a sterile lancet with a tip length of 1.0 mm (Sanico,
Bochner, & Saini, 2002). Some studies have also used the upper back as location
for SPT (Berot et al., 2020). An alternative variant also used is to first immerse
the lancet in the well of a tray with the extract and then puncture the skin, applying
the extract and prick in the same step. This variant has been extensively used in cases
of food allergy studies, where the technique is also called prick-prick or prick by
prick (Sanico et al., 2002).
Once the prick test is carried out, the skin is dried without rubbing, and then wait
15 min to see if there is reactivity in the puncture area. If there are specific IgE an-
tibodies on the surface of cutaneous mast cells, a wheal and erythema occur at the
puncture site since histamine release begins at 5 min and peaks at 30 min. SPT are
safely used in the case of inhalants, foods, drugs, or insect stings.
Intracutaneous or Intradermal tests (IDT) are also used for the diagnosis of
allergic diseases mediated by IgE or type I hypersensitivity. In these cases, their
use is more restricted due to the higher percentage of false positives (Gorevic,
1997). The usual procedure employs insulin syringes loaded with the extract and,
with the bevel of the needle facing upwards at an angle of 45°, an amount of between
0.01 and 0.05 mL is administered without inserting the entire needle (Ansotegui
et al., 2020). The allergen concentration used in this method is usually 1/100 or
1/1000 of that used for SPT. The immediate reading of the tests for the study of type
I hypersensitivity reactions is like that of the prick tests, around 15–20 min after the
injection (Demoly et al., 2008). They are used in allergy studies in cases where prick
tests are negative, mainly in studies with drugs, Hymenoptera venom and very
occasionally with moulds.
In the case of drug allergy studies, skin tests with immediate reading to
beta-lactamic antibiotics, and specifically, to penicillins, have an extraordinary per-
formance (Romano et al., 2020), and are commonly used in allergy services
(Castells, 2018). The use of skin tests with other antibiotics has a slightly lower per-
formance but they are a fundamental pillar in diagnosing the diseases (Romano &
Caubet, 2014). The intradermal tests also have major relevance to allergy from
chemotherapeutic agents such as platins (Caiado et al., 2013).
When the patients have suffered non-immediate reactions and the suspect path-
ogenic mechanism is a T-cell mediated hypersensitivity (Lerch & Pichler, 2004;
Rozieres, Vocanson, Saı̈d, Nosbaum, & Nicolas, 2009), skin IDT is also useful
(Joshi & Khan, 2021), but more controversial (Phillips et al., 2019). In those cases,
the late reading of IDT can be delayed from 12 h to several days later (Romano et al.,
2004). In some diseases such as acute generalized exanthematous pustulosis
(AGEP), Stevens-Johnson syndrome (SJS) or toxic epidermal necrolysis (TEN)
(Iriki et al., 2014), the reading of the skin tests must be done at 24–48 h or even
1 week after IDT. In these disorders, the presence of effector-memory T cells and
intraepidermal CD8(+) T cells with the local production of interferon gamma after
the introduction of the triggering agent (Mizukawa et al., 2002) but also the presence
of skin resident memory T cells have been shown (Tokura et al., 2021).
Patch tests are diagnostic tools mainly in contact dermatitis. But also, non-
immediate drug reactions like those previously named AGEP, SJS and TEN, drug
reactions with eosinophilia and systemic symptoms (DRESS) (Cabañas et al., 2020),
single organ diseases and fixed drug exanthema (FDE) (Patel, John, Handler, &
Schwartz, 2020), could also benefit from the use of a skin patch test for effective diag-
nosis (Copaescu, Gibson, Li, Trubiano, & Phillips, 2021). In all those conditions, a late
reading of at least 48 h or more (Bhujoo et al., 2021) would give us a picture similar to
that seen in contact dermatitis and would approximate a true etiological diagnosis
(Belsito, 1989) with T cell involvement (Adam, Pichler, & Yerly, 2011).
4 In vitro methods to measure immune responses after

SARS-Cov-2 infection
The human immune system makes antibodies and produces different lineages of
T cells in response to SARS-CoV-2 infection. The early prediction of disease progres-
sion could be of help to assess the optimal treatment strategies, and an integrated
knowledge of T-cell and antibody responses is urgently needed to find out biomarkers
to monitor the COVID-19 disease. The development of reliable tests to detect those
different arms of the immune response has been the objective of many research groups.
In this review we aim to summarize the general aspects of the more relevant tests used
in the clinical setting and to understand the advantages of the delayed type hypersen-
sitivity (DTH) skin test, a simple and very informative method to measure immune
T cell responses after SARS-CoV-2 infection and after vaccine administration.
4.1 SARS-CoV-2 protein description

The description of the relevant composition of the virus is important to understand
the immunological targets that could be used to investigate the immune response
generated after virus exposure and to study the immunogenicity of different vaccine
approaches.
SARS-CoV-2 is a member of the family Coronaviridae and order Nidoviridiae.
This family comprises two subfamilies, Coronavirinae and Torovirinae and
4 In vitro methods to measure immune responses 207
members of the subfamily Coronavirinae are subdivided into four genera:

(a) Alphacoronavirus contains the human coronavirus (HCoV)-229E and HCoV-
NL63; (b) Betacoronavirus includes HCoV-OC43, Severe Acute Respiratory
Syndrome human coronavirus (SARS-HCoV), HCoV-HKU1, and Middle Eastern
respiratory syndrome coronavirus (MERS-CoV); (c) Gamma coronavirus includes
viruses of whales and birds and; (d) Delta coronavirus includes viruses isolated
from pigs and birds (Burrell, Howard, & Murphy, 2016). SARS-CoV-2 belongs
to Beta coronavirus together with two highly pathogenic viruses, SARS-CoV
and MERS-CoV. SARS-CoV-2 is an enveloped and positive-sense single-stranded
RNA (+ssRNA) virus (Kramer, Schwebke, & Kampf, 2006). The new coronavirus
shares about 82% of its genome with SARS CoV-1 and both coronaviruses also
share the same cellular receptor, which is the angiotensin-converting enzyme 2
(ACE2) (Gheblawi et al., 2020).
The proteins of SARS CoV consist of two large polyproteins: ORF1a and
ORF1ab, four structural proteins: spike (S), envelope (E), membrane (M), and
nucleocapsid (N), and eight accessory proteins: ORF3a, ORF3b (NP_828853.1,
not present in SARS CoV-2), ORF6, ORF7a, ORF7b, ORF8a, ORF8b, and ORF9b
(NP_828859.1, not present in SARS CoV-2) (Liu, Fung, Chong, Shukla, &
Hilgenfeld, 2014). The non-structural proteins (nsps) are involved in virus proces-
sing and replication, while the structural proteins help in the assembly and release
of new viral copies. The structural proteins produced are, e.g., spike (S) protein, en-
velope (E) protein, membrane (M) protein, and nucleocapsid (N) protein. The
M protein is the most abundant, while the E protein is the smallest in size among
all the four structural proteins. More specifically, the M protein acts as a central or-
ganizer in assembling and shaping the viral envelope by interacting with other struc-
tural proteins. It binds with S and N proteins for the completion of new viral
assemblies. The E protein is abundantly expressed in the replication cycle in the
infected cells, although a small portion of it is incorporated into the viral envelope
and mainly contributes to the viral assembly and budding. The N protein exhibits its
functions by interaction with the positive RNA strand of the viral genome, thereby
forming a helical ribonucleocapsid complex. It also interacts with other structural
membrane proteins during the assembly of virions (Papageorgiou & Mohsin, 2020).
The envelope spike (S) protein receptor binding domain (RBD) of SARS-CoV-2
was shown to be structurally similar to that of SARS-CoV, despite amino acid
variation at some key residues. In general, the spike protein of coronavirus is divided
into the S1 and S2 domain, in which S1 is responsible for receptor binding and S2
domain is responsible for cell membrane fusion. The S1 domain of SARS-CoV and
SARS-CoV-2 share around 50 conserved amino acids (Lu et al., 2020).
4.2 Understanding the adaptive immune response in covid19

patients
During the early stages of the pandemic, there was a clear focus on the development
of methods to detect humoral immune responses to SARS-CoV-2. For most acute
viral infections and following vaccination, seroconversion and the presence of
neutralising antibodies (Abs) is a clear functional correlate of immunity

(Zinkernagel & Hengartner, 2006). However, the point-of-care (POC) serological
tests to define SARS-CoV-2 exposure and presumably immunity that were intro-
duced in the market at the beginning of the pandemic performed poorly
(Baumgarth, Nikolich-Žugich, Lee, & Bhattacharya, 2020). These POC tests had
poor specificity and sensitivity and therefore, many unreliable results confounded
the true rate of positives after infection. Moreover, many of these POC tests intended
to distinguish the time of infection, assuming that production of IgM would be
equivalent to an ongoing infection and that an IgG positive test result would repre-
sent a much later stage of an active infection or a past infection and convalescence
status.
Soon after the introduction of conventional ELISAs to measure different isotypes
and neutralising Abs, it was clear that the performance data of these new generation
tests to detect humoral immune responses were more accurate and their results better
reflect the immune status of the investigated individuals. One critical point in the
development of reliable methods was to identify the immunodominant antigen that
drives the humoral immune responses in SARS-CoV-2 infected individuals (Piccoli
et al., 2020). Although there are several candidates, the more obvious were the spike
and nucleocapsid proteins. Nucleocapsid and spike IgG titres are highly correlated
(Piccoli et al., 2020). The spike protein is the target of SARS-CoV-2 neutralising
antibodies and RBD of the spike protein is the target of >90% of neutralising
antibodies in COVID-19 (Premkumar et al., 2020). Serological studies have found
that, as expected, high antigen viral load results in higher antibody titres. Neutralis-
ing and total anti-spike antibodies correlate with severe disease (Premkumar
et al., 2020).
It was evident that, after optimization of the conventional ELISAs, there was an
urgent need for the study of the cellular immune responses in SARS-CoV-2 infec-
tion. Antibodies can be a useful surrogate marker of CD4 + T cell responses in many
infections and that is one of the reasons why antibody assays, which are more prac-
tical to perform in large cohorts of patients and easier to handle, are the first inves-
tigated part of the immune responses. However, there are some reasons to believe
that in SARS-CoV-2 infection these antibody titres are poor predictors on the devel-
opment of specific anti-SARS-CoV-2 CD4 + T cells and to some extent this could be
explained because of immunological differences in the pattern of antigen immuno-
dominance in T cell responses (M, spike, and N proteins co-dominant) (Grifoni et al.,
2020). One special situation is the asymptomatic cases of SARS-CoV-2 individuals
where there is a tendency to have low or undetectable antibodies but high numbers of
circulating T cells showing that early T cell responses could result in absence of clin-
ical disease symptoms (Sekine et al., 2020). This also could be explained by the fact
that among the best-known risk factors for severe disease is the age of the infected
person. Older individuals are less likely to make a coordinated adaptive immune
response to SAR-CoV-2 (Grifoni et al., 2020).
4 In vitro methods to measure immune responses 209
4.3 In vitro methods to measure SARS-CoV-2 cellular immune

responses
In general terms, the evaluation of population immunity is based on antibody detec-
tion studies. However, in the context of evidence for cellular responses in seroneg-
ative exposed individuals (Gallais et al., 2021) and the potential waning of antibody
responses over time (Ojeda et al., 2021; Shrotri et al., 2021), current surveillance
methods are likely to be underestimating both exposure and immunity. Moreover,
CD4 + and CD8 + T cells targeting structural viral proteins appear to confer broad
and long-lasting protection against SARS-CoV (15) (Liu et al., 2017). Thus, a better
understanding of the role of T cells in the long-term protection from COVID-19 is
crucial in estimating population-level immunity, vaccine development, and long-
term surveillance of vaccine efficacy (Dan et al., 2021).
Extensive research has been conducted to identify epitopes involved in T-cell re-
sponses, including a large study of overlapping peptides spanning the entire SARS-
CoV-2 proteome (Grifoni et al., 2020), showing that spike protein epitope pools are
the most immunogenic stimuli (Aiello et al., 2021; Murugesan et al., 2020).
Different assays have been used to measure SARS-CoV-2- specific T-cell re-
sponses, including intracellular cytokine staining, activation-induced markers and
interferon gamma release assays (IGRAs). Although an extensive review of detailed
protocols is out of the scope of this review, we will review the basic principle of the
IGRA, which is the more common method employed in studies in vitro, in order to
better understand the advantages and disadvantages of this assay compared to the
DTH in vivo method.
Interferon gamma release assays (IGRAs). Interferon gamma is a Th1-type cy-
tokine, induced upon stimulation of T cells by a specific-antigen, T-cell mitogens
and some pharmacologic stimuli. IFN-gamma is synthesized by a CD4 +Th1 helper
subset, some CD8 + T-cell subpopulations, NK cells and activated macrophages.
IFN-gamma release assays after T cell stimulation have been explored in several in-
fectious diseases and cytokine release-based tests in whole blood are routinely or ex-
perimentally used for cytomegalovirus (CMV) infection monitoring (Kim, 2020),
and have been explored for hepatitis B virus (Dammermann et al., 2015), toxoplas-
mosis (Mahmoudi, Mamishi, Suo, & Keshavarz, 2017) and cystic echinococcosis
(Petrone et al., 2017, 2020) diagnosis. This approach has also been used to investi-
gate SARS-CoV-2 T cell responses (Petrone et al., 2021). At this moment there are
several commercially available options to investigate interferon gamma release
methods in the COVID clinical setting. Whole IGRA blood assays are very conve-
nient in terms of using them in a clinical laboratory outside of the more dedicated
research facilities (Martı́nez-Gallo et al., 2021). One important aspect is to determine
the specific response to peptides corresponding to proteins encoded by different viral
genomic regions (spike, membrane, nuclear proteins or others), as well as the deter-
mination of optimal concentrations and read-out that have been employed in the
different available methods, because differences in the published results could cor-
respond to methodological details. In conclusion, IGRAs are an important diagnostic
tool in COVID infected and vaccinated individuals but, in order to expand its use,
some uncertainties about the cut-off values and the real-life correspondence with
protection from infection needs to be further defined to augment the prognostic value
of a positive IGRA result.
As explained before, the Mantoux tuberculin skin test (TST) was developed early
in the 20th century, and although with some drawbacks, it is still present in the actual
medical practice (Richeldi, 2009). During the last few decades it has been used in
parallel with the IGRA tests, producing an enormous amount of data permitting
the comparison of both methods (Hass & Belknap, 2019). All these data have been
used to improve the diagnosis of latent tuberculosis infection, where the performance
of IGRA tests have been demonstrated to be superior in terms of discriminating in-
fection in vaccinated individuals (Lewinsohn et al., 2017). This has been achieved
using IGRA tests with peptides not present in the vaccine formulation that are not
possible to distinguish in the TST test.
However, the analysis of the situation in SARS-CoV-2 infection is completely
different. In these COVID patients the focus of the results should be the sensitivity
of the test, finding as many individuals as possible that either by natural exposure or
after vaccination could have developed an adaptive T cell response. In that scenario
an in vivo presentation of the antigen to the T-cell population could be superior if
these two methods are compared (see Table 2 to understand differences exhibited
between IGRA and TST).
Table 2 Comparison of DTH skin test and interferon-gamma release assays.

DTH IGRA
Advantages – Low cost – Single visit

– Easy to perform – Positive and negative
– Ability to test a large number of controls into the test
individuals in a short-period of time – Objective results
– Could be single visit if results are sent – Electronic laboratory
by phone report
– Electronic results report – Use of selected peptides
Disadvantages – More subjective-reader variability – Higher cost for reagents
– Influence of boost phenomenon – Blood extraction facilities
– Handle of sample
– More difficult technical
laboratory phase
Common – Affected by immunocompetence of – Affected by
individuals immunocompetence of
individuals
5 Novel application of a DTH method 211
5 A novel application of a DTH method to measure immune

responses after SARS-CoV-2 infection
During the critical months of the COVID pandemic situation, it was necessary to
think in some practical approach to diagnose SARS-CoV-2 exposure in immuno-
compromised individuals that were not capable of producing antibodies due to their
subjacent immunological defect. As humoral immunodeficient patients are the most
frequent presentations of primary and secondary immunodeficiency situations, there
was a lack of specific tests to analyse this subgroup of COVID -infected individuals
using the conventional ELISAs developed at that time. To overcome this, our PID
clinical group (Barrios et al., 2020) developed a COVID-specific skin test based
on RBD of the spike protein of SARS-CoV-2 (CoviDCELL®). All the research
was conducted after the protocol was approved by the ethical committee of the Hos-
pital (CHUC_2020_92) and in accordance with the requirements expressed in Law
737/2015 about biomedical research and the Declaration of Helsinki (revised Brasil,
October 2013).
Briefly, 25 μL (0.1 mg/mL final concentration) of a RBD commercially available
protein (Vitro, Spain) was injected intradermally via a 25-gauge needle in the ventral
part of the arm. The final concentration used was similar to the concentration used in
the tuberculin test (Badaro et al., 2020). A Candida albicans extract was used as a
control reaction to assess cellular immune competence of the participants. All anti-
gen dilutions were made under sterile conditions. Patients were instructed to send a
photo with the skin test reaction after 15 min and 6, 12, 24 and 48 h after injection.
The protocol was performed according to usual clinical practice and following the
Allergology Procedures Manual and the Safety and Quality Recommendations in
Allergology (RESCAL-2018) of the Spanish Society of Clinical Allergology
(SEAIC) to carry out allergology procedures (E2). According to the manual,
intra-epidermal and intradermal skin tests are at Level A defined as the “set of tests
that meet the following criteria of low complexity, short duration (the patient must
remain under observation for less than 2 h) and, finally, low risk of reaction.” The
tests were carried out in the area of diagnostic techniques of the Allergy Service
according to the usual clinical practice. Intradermal tests were not performed in pa-
tients with a history of grade II or higher anaphylaxis. Erythema and indurations were
registered. A skin test (spike and candida-DTH) was considered positive if the area of
erythema was greater than 10 mm at least after 6 h. The first group of results were
obtained from CoviDCell tests performed in healthy individuals (not exposed to
SARS-CoV-2 virus) or in immunocompetent-infected individuals (Barrios et al.,
2021). In these immunocompetent individuals, testing for IgG-specific anti-RBD
antibodies (Euroimmun, L€ ubeck, Germany) was also performed and the results
correlated with the skin test outcomes.
Shown in Fig. 2 is a representative set of skin reactions obtained in this group of
exposed immunocompetent individuals. As described with the tuberculin DTH test
there is some variability in the biologic response according to the stratification of the
FIG. 2
Upper: example of response to Candida (C) antigen after intradermal test in a subject
at 12, 24, 48 and 72 h. Below: example of response to Spike (S) antigen after intradermal test
in a subject with a fully recovered SARS-CoV-2 disease at 12, 24, 48 and 72 h.
patients into different groups depending on their clinical presentation. From this set
of tests, it was evident that DTH using RBD derived S protein from SARS-CoV-2 is a
simple method to investigate immunity after virus exposure. The DTH test that was
performed in a group of non-exposed individuals was negative in all of the cases,
showing a high specificity of the test. Moreover, comparisons between specific
anti-RBD IgG and spike-DTH cutaneous test results, to identify the exposed individ-
uals, showed a concordance number of 84.3%. In this set of exposed individuals,
CoviDCELL® showed a superior capacity to identify exposed individuals.
Although until this manuscript has been written, there were no more scientific
public data regarding the use of DTH to assess immune exposure to SARS-CoV-2,
several biotech companies have announced the use of peptide-base or protein-
derived moieties from different parts of the virus with the intended use of developing
commercial delayed type hypersensitivity tests to assess T-cell immunity after infec-
tion or to measure immunogenicity elicited by the vaccines. One of the concerns re-
garding the anti-COVID-19 DTH reaction is the performance of the test with the new
variants produced by the virus. In this regard, ELISAs can be more susceptible to
changes in the conformational epitopes recognized by the patient’s antibodies.
But T-cells recognize many linear epitopes, and a substantial number of changes
in the potential epitopes between the variants would be required to affect the
T-cell recognition. These facts suggest that the skin test will be relatively unaffected
by the virus variants.
6 DTH to measure immunogenicity elicited by covid vaccines 213
6 DTH to measure immunogenicity elicited by covid vaccines

The same protocol of CoviDCELL was implemented to investigate immunogenicity
produced after vaccination (Barrios et al., 2021). For this study, prioritized health
care workers group vaccinated at the Hospital Universitario de Canarias and
vaccinated with the BNT162b2 mRNA Pfizer vaccine were offered to participate
in the study approved by the ethical committee of the Hospital (CHUC_
2021_04).
The results showed that the CoviDCELL test was positive in 73% of the individ-
uals after a single dose of vaccine. All participants developed a positive DTH test
after two doses of the vaccine, showing that both vaccine doses are needed for
the detection of an in vivo T cell immune reaction. The kinetics of the DTH skin re-
action was more rapid (in 12 h) and wanes faster (in 48 h) in vaccinated individuals
compared with naturally immunized patients due to a prior infection. Fig. 3 shows a
representative set of skin reactions obtained in this group of vaccinated immunocom-
petent individuals.
These results demonstrate that the DTH test is an affordable and simple method
that could help in the future to answer basic immunogenicity questions on large-scale
population vaccine studies.
FIG. 3
Upper: example of response to Spike (S) antigen after intradermal test at 12, 24, 48 and 72 h
in a fully vaccinated subject with a mRNA vaccine. Below: example of response to Spike
(S) antigen after intradermal test at 12, 24, 48 and 72 h in a subject with a fully recovered
SARS-CoV-2 disease and two doses of a mRNA vaccine.
7 Future prospects of DTH to study SARS-CoV-2

immunogenicity
At the moment of writing this review, our clinical group have submitted results
obtained in vaccinated immunodeficient patients and vaccinated kidney-transplant
patients for publication. Also, we have conducted a 6-month follow-up DTH study
of immunocompetent health care workers to address the question of “For how long
will the immunogenicity provided by the vaccines last?”.
Many biological aspects of the test need to be further investigated. For example,
the influence of the diameter and kinetics of the reaction in determining the distinc-
tion between natural vs vaccinated immune responses, the correspondence with the
IGRAs available to improve the cut-off definition of positive tests and also the in-
teresting possibility of a boost influence of the intradermal injection in the sequential
analysis of the same individuals (an initial negative DTH test primes the immune
system so that a subsequent test becomes positive). There are also many technolog-
ical details that could be addressed in the next several months like the digital treat-
ment of the images but also to work on automatic algorithms that allow the
processing of large amounts of data that could be necessary to handle in immunoge-
nicity studies conducted in large populations. Properly designed and powered
longitudinal studies will provide insights in these areas.
It is evident that an old test could still compete in the forefront repertoire of
methods that will allow us to know better this new challenge of the SARS-CoV-2
pandemic. The relevance of this work is the revision of methods more imaginative
and simpler, to afford the tremendous challenge of this pandemic in the coming
years.
Acknowledgements
To the patients and participants in the DTH-studies.
To our collaborators (Dr. Franco and Dra. Alava) and technical assistants for their contin-
ued help and support.
Victor Matheu and Yvelise Barrios have registered (50%) CoviDCELL® 202199800
402351.
References
Adam, J., Pichler, W. J., & Yerly, D. (2011). Delayed drug hypersensitivity: Models of T-cell
stimulation. British Journal of Clinical Pharmacology, 71, 701–707.
Adler, N. R., Aung, A. K., Ergen, E. N., Trubiano, J., Goh, M. S. Y., & Phillips, E. J. (2017).
Recent advances in the understanding of severe cutaneous adverse reactions. British
Journal Dermatology, 177, 1234–1247.
Aiello, A., Fard, S. N., Petruccioli, E., Petrone, L., Vanini, V., Farroni, C., et al. (2021). Spike
is the most recognized antigen in the whole-blood platform in both acute and convalescent
COVID-19 patients. International Journal of Infectious Diseases, 106, 338–347.
References 215
Ansotegui, I. J., Melioli, G., Canonica, G. W., Caraballo, L., Villa, E., Ebisawa, M., et al.
(2020). IgE allergy diagnostics and other relevant tests in allergy, a World Allergy
Organization position paper. World Allergy Organization Journal, 13, 100080.
Aranow, C., Diamond, B., & Mackay, M. (2008). Systemic lupus erythematosus in clinical
immunology. Principles and practice. In R. R. Rich, T. A. Fleisher, W. T.
Shearer, H. W. Schroeder Jr.,, A. J. Frew, & C. M. Weyand (Eds.), Clinical immunology.
Principles and practice. Philadelphia: Elsevier (Chapter 51).
Arthus, M. (1903). Injections repetees de serum du cheval chez le lapin. Comptes rendus des
s
eances de la Soci et
e de biologie et de ses filiales, 55, 817–820.
Badaro, R., Machado, B. A. S., Duthie, M. S., Araujo-Neto, C. A., Pedral-Sampaio, D.,
Nakatani, M., et al. (2020). The single recombinant M. tuberculosis protein DPPD
provides enhanced performance of skin testing among HIV-infected tuberculosis patients.
AMB Express, 10, 133.
Barrios, Y., Franco, A., Alonso-Larruga, A., Sánchez-Machı́n, I., Poza-Guedes, P.,
Gonzalez, R., et al. (2020). Success with multidisciplinary team work: Experience of a
primary immunodeficiency unit. Journal of Investigational Allergology and Clinical Im-
munology, 30, 208–210.
Barrios, Y., Franco, A., Sanchez-Machin, I., Poza-Guedes, P., Gonzalez-Perez, R., &
Matheu, V. (2021). A novel application of delayed-type hypersensitivity reaction to
measure cellular immune response in SARS-CoV-2 exposed individuals. Clinical Immu-
nology, 226, 108730.
Barrios, Y., Franco, A., Sánchez-Machı́n, I., Poza-Guedes, P., González-Perez, R., &
Matheu, V. (2021). The beauty of simplicity: Delayed-type hypersensitivity reaction to
measure cellular immune responses in RNA-SARS-Cov-2 vaccinated individuals. Vac-
cines (Basel), 9, 575. https://doi.org/10.3390/vaccines906057.
Baryaliya, M., Sanmukhani, J., Patel, T., Paliwal, N., Shah, H., & Tripathi, C. (2011).
Drug-induced Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), and
SJS-TEN overlap: A multicentric retrospective study. Journal of Postgraduate Medicine,
57, 115–119.
Baumgarth, N., Nikolich-Žugich, J., Lee, F. E., & Bhattacharya, D. (2020). Antibody
responses to SARS-CoV-2: Let’s stick to known knowns. Journal of Immunology, 205,
2342–2350.
Belsito, D. V. (1989). The immunologic basis of patch testing. Journal of the American Acad-
emy of Dermatology, 21, 822–829.
Bennich, H. H., Ishizaka, K., Johansson, S. G. O., Rowe, D. S., Stanworth, D. R., &
Terry, W. D. (1968). Immunoglobulin IgE, a new class of human immunoglobulin.
Bulletin World Health Organization, 38, 151–152.
Berot, V., Gener, G., Ingen-Housz-Oro, S., Gaudin, O., Paul, M., Chosidow, O., et al. (2020).
Cross-reactivity in beta-lactams after a non-immediate cutaneous adverse reaction:
Experience of a reference centre for toxic bullous diseases and severe cutaneous adverse
reactions. Journal of the European Academy of Dermatology and Venereology, 34, 787–794.
Bhujoo, Z., Ingen-Housz-Oro, S., Gener, G., Gaudin, O., Fleck, M., Verlinde-Carvalho, M.,
et al. (2021). Patch tests in nonimmediate cutaneous adverse drug reactions: The impor-
tance of late readings on day 4. Contact Dermatitis. https://doi.org/10.1111/cod.13981.
Bocquet, H., Bagot, M., & Roujeau, J. C. (1996). Drug-induced pseudolymphoma and drug
hypersensitivity syndrome (Drug Rash with Eosinophilia and Systemic Symptoms:
DRESS). Seminars in Cutaneous Medicine and Surgery, 15, 250–257.
Brandt, O., & Bircher, A. J. (2017). Delayed-type hypersensitivity to oral and parenteral drugs.
Journal der Deutschen Dermatologischen, 15, 1111–1132.
Burrell, C. J., Howard, C. R., & Murphy, F. A. (2016). Fenner and White’s medical virology
(5th ed.). United States: Academic Press.
Cabañas, R., Ramı́rez, E., Sendagorta, E., Alamar, R., Barranco, R., Blanca-López, N., et al.
(2020). Spanish guidelines for diagnosis, management, treatment, and prevention of
DRESS syndrome. Journal of Investigational Allergology and Clinical Immunology,
30, 229–253.
Caiado, J., Venemalm, L., Pereira-Santos, M. C., Costa, L., Barbosa, M. P., & Castells, M.
(2013). Carboplatin-, oxaliplatin-, and cisplatin-specific IgE: Cross-reactivity and value
in the diagnosis of carboplatin and oxaliplatin allergy. The Journal of Allergy and Clinical
Immunology. In practice, 1, 494–500.
Campbell, J. M. (1932). Acute symptoms following work with hay. British Medical Journal, 2,
143–144.
Castells, M. (2018). New role for the modern allergist in drug allergy: Assess, diagnose, and
de-label. Annals of Allergy, Asthma & Immunology, 121, 515–516.
Chase, M. (1961). The preparation and standardization of Kveim testing antigen. American
Review of Respiratory Disease, 84, 86–88.
Chen, C.-R., Pichurin, P., Nagayama, Y., Latropha, F., Rapaport, B., & McLachlan, S. M.
(2003). The thyrotropin receptor autoantigen in Graves disease is the culprit as well as
the victim. Journal of Clinical Investigation, 111, 1897–1904.
Clark, R. A., Chong, B., Mirchandani, N., Brinster, N. K., Yamanaka, K., Dowgiert, R. K.,
et al. (2006). The vast majority of CLA + T cells are resident in normal skin. Journal
of Immunology, 176, 4431–4439.
Coca, A. F., & Grove, E. F. (1923). A study of the atopic reagin. Proceedings of the Society for
Experimental Biology and Medicine, 21, 49.
Copaescu, A., Gibson, A., Li, Y., Trubiano, J. A., & Phillips, E. J. (2021). An updated review
of the diagnostic methods in delayed drug hypersensitivity. Frontiers in Pharmacology.
https://doi.org/10.3389/fphar.2020.573573.
Cunningham, M. W., McCormack, J. M., Fenderson, P. G., Ho, M. K., Beachey, E. H., &
Dale, J. B. (1989). Human and murine antibodies cross-reactive with streptococcal
M protein and myosin recognize the sequence GLN-LYS-SER-LYS-GLN in M protein.
Journal of Immunology, 143, 2677–2683.
Dammermann, W., Bentzien, F., Stiel, E. M., K€ uhne, C., Ullrich, S., Schulze Zur Wiesch, J.,
et al. (2015). Development of a novel IGRA assay to test T cell responsiveness to HBV
antigens in whole blood of chronic Hepatitis B patients. Journal of Translational
Medicine, 13, 157.
Dan, J. M., Mateus, J., Kato, Y., Hastie, K. M., Yu, E. D., Faliti, C. E., et al. (2021). Immu-
nological memory to SARSCoV-2 assessed for up to 8 months after infection. Science
(New York, N.K.), 371(6529), eabf4063. https://doi.org/10.1126/science.abf4063.
Davenport, R. D., & Mintz, P. D. (2007). Transfusion medicine. In R. A. McPherson, & M. R.
Pincus (Eds.), Henry’s clinical diagnosis and management by laboratory methods
(pp. 669–684). Philadelphia: Saunders Elsevier.
De Vries, J. E., Punnonen, J., Cocks, B. G., de Waal Malefyt, R., & Aversa, G. (1993). Regu-
lation of the human IgE response by IL4 and IL13. Research in Immunology, 144, 597–601.
Del Prete, G. (1992). Human Th1 and Th2 lymphocytes: Their role in the pathophysiology of
atopy. Allergy, 47, 450–455.
Demoly, P., Romano, A., & Bousquet, J. (2008). In vivo methods for the study of allergy.
In N. F. Adkinson, J. W. Yunginger, W. W. Busse, B. S. Bochner, F. E. R. Simons, &
S. T. Holgate (Eds.), Middleton’s allergy: Principles and practice (pp. 1267–1280).
Amsterdam: Mosby, Inc.
References 217
Dispenza, M. C. (2019). Classification of hypersensitivity reactions. Allergy and Asthma

Proceedings, 40, 470–473.
Dodiuk-Gad, R. P., Chung, W.-H., Valeyrie-Allanore, L., & Shear, N. H. (2015). Stevens-
Johnson syndrome and toxic epidermal necrolysis: An update. American Journal of
Clinical Dermatology, 16, 475–493.
Edwards, R., & Aronson, J. K. (2000). Adverse drug reactions: Definitions, diagnosis, and
management. Lancet, 356, 1255–1259.
Fohlman, J., & Friman, G. (1993). Is juvenile diabetes a viral disease? Annals of Medicine, 25,
569–574.
Forema, K. E., Glovsky, M. M., Warner, R. L., Horvath, S. J., & Ward, P. A. (1996).
Comparative effect of C3a and C5a on adhesion molecule expression on neutrophils
and endothelial cells. Inflammation, 20, 1–9.
Gallais, F., Velay, A., Nazon, C., Wendling, M. J., Partisani, M., Sibilia, J., et al. (2021).
Intrafamilial exposure to SARS-CoV-2 associated with cellular immune response without
seroconversion, France. Emerging Infectious Diseases, 27, 113–121.
Galli, S. J., Tsai, M., & Piliponsky, A. M. (2008). The development of allergic inflammation.
Nature, 454, 445–454.
Gell, P. G. H., & Coombs, R. R. A. (1963). The classification of allergic reactions underlying
disease. In R. R. A. Coombs, & P. G. H. Gell (Eds.), Clinical aspects of immunology
(pp. 317–337). Oxford: Blackwell scientific Publications.
Gheblawi, M., Wang, K., Viveiros, A., Nguyen, Q., Zhong, J. C., Turner, A. J., et al.
(2020). Angiotensin-converting enzyme 2: SARS-CoV-2 receptor and regulator of the
renin-angiotensin system: Celebrating the 20th anniversary of the discovery of ACE2.
Circulation Research, 126, 1456–1474.
González-Muñoz, M., Villota, J., & Moneo, I. (2008). Analysis of basophil activation by flow
cytometry in pediatric house dust mite allergy. Pediatric Allergy and Immunology, 19,
342–347.
Gordon, E. H., Krouse, H. A., Kinney, J. L., Stiehm, E. R., & Klaustermeyer, W. B. (1983).
Delayed cutaneous hypersensitivity in normals: Choice of antigens and comparison to
in vitro assays of cell-mediated immunity. Journal of Allergy and Clinical Immunology,
72, 487–494.
Gorevic, P. D. (1997). Drug allergy. In A. P. Kaplan (Ed.), Allergy (pp. 620–643).
Philadelphia: W.B. Saunders.
Gorter, A., Blok, V. T., Haasnoot, W. H., Ensink, N. G., Daha, M. R., & Fleuren, G. J. (1996).
Expression of CD46, CD55, and CD59 on renal tumor cell lines and their role in preventing
complement-mediated tumor cell lysis. Laboratory Investigation, 74, 1039–1049.
Grifoni, A., Weiskopf, D., Ramirez, S. I., Mateus, J., Dan, J. M., Moderbacher, C. R., et al.
(2020). Targets of T cell responses to SARS-CoV-2 coronavirus in humans with
COVID-19 disease and unexposed individuals. Cell, 181, 1489–1501.
Guilherme, L., Kalil, J., & Cunningham, M. (2006). Molecular mimicry in the autoimmune
pathogenesis of rheumatic heart disease. Autoimmunity, 39, 31–39.
Hass, M. K., & Belknap, R. W. (2019). Diagnostic test for latent tuberculosis infection. Clinics
in Chest Medicine, 40, 829–837. https://doi.org/10.1016/j.ccm.2019.07.007.
Iriki, H., Adachi, T., Mori, M., Tanese, K., Funakoshi, T., Karigane, D., et al. (2014).
Toxic epidermal necrolysis in the absence of circulating T cells: A possible role for
resident memory T cells. Journal of the American Academy of Dermatology, 71,
214–216.
Jarret, E. E., & Miller, H. R. (1982). Production and activities of IgE in helminth infection.
Progress in Allergy, 31, 178–233.
Joshi, S. R., & Khan, D. A. (2021). Non-IgE-mediated drug hypersensitivity reactions. Current
Allergy and Asthma Reports, 31, 41.
Katyal, M., Sivasankar, B., & Das, N. (2001). Complement receptor 1 in autoimmune disor-
ders. Current Science, 81, 907–914.
Kaufman, D. W., Kelley, J. P., Johannes, C. B., Sandler, A., Harmon, D., Stolley, P. D., et al.
(1993). Acute thrombocytopenic purpura in relation to the use of drugs. Blood, 82,
2714–2718.
Kim, S.-H. (2020). Interferon-γ release assay for cytomegalovirus (IGRA-CMV) for risk
stratification of posttransplant CMV infection: Is it time to apply IGRA-CMV in routine
clinical practice? Clinical Infectious Diseases, 71, 2386–2388.
Koch, R. (1890). A remedy for tuberculosis. Lancet, 136, 1085–1086.
Kramer, A., Schwebke, I., & Kampf, G. (2006). How long do nosocomial pathogens persist on
inanimate surfaces? A systematic review. BMC Infectious Diseases, 6, 130.
Kumar, V., Abbas, A. K., & Aster, J. C. (2021). Robbins & Cotran, pathologic basis of disease
(Chapter 6). Philadelphia: Elsevier.
Landsteiner, K. (1945). The specificity of serological reactions. Cambridge, MA: Harvard
University Press.
Landsteiner, K., & Chase, M. W. (1942). Experiments on transfer of cutaneous sensitivity to
simple compounds. Proceedings of the Society for Experimental Biology, 49, 688–690.
Lerch, M., & Pichler, W. J. (2004). The immunological and clinical spectrum of delayed drug-
induced exanthems. Current Opinion in Allergy and Clinical Immunology, 4, 411–419.
Lewinsohn, D. M., Leonard, M. K., LoBUe, P. A., Cohn, D. L., Daley, C. L., Desmond, E.,
et al. (2017). Official American Thoracic Society/infectious diseases. Society of America/
Centers for disease control and prevention. Clinical practice guidelines: Diagnosis of
tuberculosis in adults and children. Clinical Infectious Diseases, 64, 111–115.
Li, J., & Uetrecht, J. P. (2010). The danger hypothesis applied to idiosyncratic drug reactions.
Handbook of Experimental Pharmacology, 196, 493–509.
Liu, Y. J. (2006). Thymic stromal lymphopoietin: Master switch for allergic inflammation.
Journal of Experimental Medicine, 203, 269–273.
Liu, D. X., Fung, T. S., Chong, K. K., Shukla, A., & Hilgenfeld, R. (2014). Accessory proteins
of SARS-CoV and other coronaviruses. Antiviral Research, 109, 97–109.
Liu, W. J., Zhao, M., Liu, K., Xu, K., Wong, G., Tan, W., et al. (2017). T-cell immunity of
SARS-CoV: Implications for vaccine development against MERS-CoV. Antiviral Re-
search, 137, 82–92.
Lochmatter, P., Zawodniak, A., & Pichler, J. (2009). In vitro tests in drug hypersensitivity
diagnosis. Immunology Allergy Clinics of North America, 29, 537–554.
Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., & Wu, H. (2020). Genomic characterisation and
epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor
binding. Lancet, 395, 565–574.
Mahmoudi, S., Mamishi, S., Suo, X., & Keshavarz, H. (2017). Early detection of Toxoplasma
gondii infection by using an interferon gamma release assay: A review. Experimental
Parasitology, 172, 39–43.
Mallal, S., Nolan, D., Witt, C., Masel, G., Martin, A. M., Moore, C., et al. (2002). Association
between presence of HLA-B*5701, HLA-DR7, and HLA-DQ3 and hypersensitivity to
HIV-1 reverse-transcriptase inhibitor abacavir. Lancet, 359, 727–732.
Mantoux, C. (1908). Intradermo-reaction de la tuberculine. Comptes rendus de l’Acad emie des
sciences, Paris, 147, 355–357.
References 219
Martı́nez-Gallo, M., Esperalba, J., Pujol-Borrell, R., Sandá, V., Arrese-Muñoz, I., Fernández-
Naval, C., et al. (2021). Commercialized kits to assess T-cell responses against
SARS-CoV-2 S peptides. A pilot study in health care workers. Medicina Clinica
(Barc). https://doi.org/10.1016/j.medcli.2021.09.013. S0025-7753(21)00529-7. English,
Spanish.
Mayadas, T. N., Tsokos, G. C., & Tsuboi, N. (2009). Mechanisms of immune complex-
mediated neutrophil recruitment and tissue injury. Circulation, 120, 2012–2024.
McKenzie, S. E., & Schreiber, A. D. (1998). Fc gamma receptors in phagocytes. Current
Opinion in Hematology, 5, 16–21.
Metzger, H., Kinet, J. P., Blank, U., Miller, L., & Ra, C. (1989). The receptor with high affinity
for IgE. Ciba Foundation Symposium, 147, 93–101.
Miller, G. W., & Nussenzweig, V. (1975). A new complement function: Solubilization of
antigen-antibody aggregates. Proceedings of the National Academy of Sciences of the
Mizukawa, Y., Yamazaki, Y., Teraki, Y., Hayakawa, J., Hayakawa, K., Nuriya, H., et al.
(2002). Direct evidence for interferon-gamma production by effector-memory-type intrae-
pidermal T cells residing at an effector site of immunopathology in fixed drug eruption.
The American Journal of Pathology, 161, 1337–1347.
Murphy, P. B., Atwater, A. R., & Mueller, M. (2021). Allergic contact dermatitis. In Stat-
Pearls. Treasure Island (FL): StatPearls Publishing. Available from: https://www.ncbi.
nlm.nih.gov/books/NBK532866/.
Murray, N. A., & Roberts, I. A. G. (2007). Haemolytic disease of the newborn. Archives of
Disease in Childhood, 92, 83–88.
Murugesan, K., Jagannathan, P., Pham, T. D., Pandey, S., Bonilla, H. F., Jacobson, K., et al.
(2020). Interferon-gamma release assay for accurate detection of SARS-CoV-2 T cell
response. Clinical Infectious Diseases, ciaa1537. https://doi.org/10.1093/cid/ciaa1537.
Naik, H. B., & Cowen, E. W. (2013). Autoinflammatory pustular neutrophilic diseases.
Dermatological Clinics, 31, 405–425.
Naisbitt, D. J., Hough, S. J., Gill, H. J., Pirmohamed, M., Kitteringham, N. R., & Park, B. K.
(1999). Cellular disposition of sulphamethoxazole and its metabolites: Implications for
hypersensitivity. British Journal of Pharmacology, 126, 1393–1407.
Niimi, N., Francis, D. M., Kermani, F., O’Donell, B. F., Hide, M., Kobza-Black, A., et al.
(1996). Dermal mast cell activation by autoantibodies against the high affinity IgE recep-
tor in chronic urticaria. Journal of Investigative Dermatology, 106, 1001–1006.
Ojeda, D. S., Gonzalez Lopez Ledesma, M. M., Pallares, H. M., Costa Navarro, G. S.,
Sanchez, L., Perazzi, B., et al. (2021). Emergency response for evaluating SARS-CoV-
2 immune status, seroprevalence and convalescent plasma in Argentina. PLoS Pathogens,
17, e1009161. https://doi.org/10.1371/journal.ppat.1009161.
Ostergaard, P. A., Ebbensen, F., Nolte, H., & Skov, P. S. (1990). Basophil histamine release in
the diagnosis of house dust mite and dander allergy of asthmatic children. Comparison
between prick test, RAST, basophil histamine release and bronchial provocation. Allergy,
45, 231–235.
Oyoshi, M. K., Larson, R. P., Ziegler, S. F., & Geha, R. S. (2010). Mechanical injury polarizes
skin dendritic cells to elicit a TH2 response by inducing cutaneous thymic stromal
lymphopoietin expression. Journal of Allergy and Clinical Immunology, 126, 976–984.
Palm, N. W., Rosenstein, R. K., & Medzhitov, R. (2012). Allergic host defences. Nature, 484,
465–472.
Papageorgiou, A. C., & Mohsin, I. (2020). The SARS-CoV-2 spike glycoprotein as a drug and
vaccine target: Structural insights into its complexes with ACE2 and antibodies. Cell, 9,
2343. https://doi.org/10.3390/cells9112343.
Parker, C. W. (1981). Hapten immunology and allergic reactions in humans. Arthritis and
Rheumatism, 24, 1024–1036.
Patel, S., John, A. M., Handler, M. Z., & Schwartz, R. A. (2020). Fixed drug eruptions: An
update, emphasizing the potentially lethal generalized bullous fixed drug eruption.
American Journal of Clinical Dermatology, 21, 393–399.
Pepys, J. (1975). Skin testing. British Journal of Hospital Medicine, 14, 412–416.
Peters, P. J., Borst, J., Oorschot, V., Fukuda, M., Kr€ahenb€ uhl, O., Tschopp, J., et al. (1991).
Cytotoxic T lymphocyte granules are secretory lysosomes, containing both perforin and
granzymes. The Journal of Experimental Medicine, 173, 1099–1109.
Petersen, I., Baatrup, G., Jepsen, H. H., & Svehag, S. E. (1985). Complement-mediated
solubilization of immune complexes and their interaction with complement C3 receptors.
Complement, 2, 97–110.
Petrone, L., Albrich, W. C., Tamarozzi, F., Frischknecht, M., Gomez-Morales, M. A.,
Teggi, A., et al. (2020). Species specificity preliminary evaluation of an IL-4-based test
for the differential diagnosis of human echinococcosis. Parasite Immunology, 42,
e12695. https://doi.org/10.1111/pim.12695.
Petrone, L., Petruccioli, E., Vanini, V., Cuzzi, G., Najafi Fard, S., Alonzi, T., et al. (2021).
A whole blood test to measure SARS-CoV-2-specific response in COVID-19 patients.
Clinical Microbiology and Infection, 27(2), 286.e7–286.e13. https://doi.org/10.1016/j.
cmi.2020.09.051.
Petrone, L., Vanini, V., Amicosante, M., Corpolongo, A., Gomez Morales, M. A.,
Ludovisi, A., et al. (2017). A T-cell diagnostic test for cystic echinococcosis based on
Antigen B peptides. Parasite Immunology, 39(12), e12499. https://doi.org/10.1111/
pim.12499.
Petz, L. D. (1993). Drug-induced autoimmune hemolytic anemia. Transfusion Medicine
Reviews, 7, 242–254.
Phillips, E. J., Bigliardi, P., Bircher, A. J., Broyles, A., Chang, Y. S., Chung, W. H., et al.
(2019). Controversies in drug allergy: Testing for delayed reactions. Journal of Allergy
and Clinical Immunology, 143, 66–73.
Piccoli, L., Park, Y. J., Tortorici, M. A., Czudnochowski, N., Walls, A. C., Beltramello, M.,
et al. (2020). Mapping neutralizing and immunodominant sites on the SARS-CoV-2
spike receptor-binding domain by structure-guided high-resolution serology. Cell, 183,
1024–1042.
Pichler, W. J. (2008). The p-i concept: Pharmacological interaction of drugs with immune
receptors. World Allergy Organization, 1, 96–102.
Pichler, W. J. (2019). Immune pathomechanism and classification of drug hypersensitivity.
Allergy, 74, 1457–1471.
Poulter, L. W., Seymour, G. J., Duke, O., Janossy, G., & Panayi, G. (1982). Immunohisto-
logical analysis of delayed-type hypersensitivity in man. Cellular Immunology, 74,
358–369.
Prausnitz, C., & Kustner, H. (1921). Studien aber die Oberempfindlichkeit. Zentralblatt fur €
Bakteriologie: I. Abt. Originale C, 86, 160.
Premkumar, L., Segovia-Chumbez, B., Jadi, R., Martinez, D. R., Raut, R., Markmann, A., et al.
(2020). The receptor binding domain of the viral spike protein is an immunodominant and
highly specific target of antibodies in SARS-CoV-2 patients. Science Immunology, 5(48),
eabc8413. https://doi.org/10.1126/sciimmunol.abc8413.
References 221
Profect, M. (1991). The function of allergy: Immunological defense against toxin. The
Quaterly Review of Biology, 66, 23–62.
Rajan, T. Y. (2003). The Gell–Coombs classification of hypersensitivity reactions:
A re-interpretation. Trends in Immunology, 24, 376–379.
Ramsbottom, K. A., Carr, D. F., Jones, A. R., & Rigden, D. J. (2018). Critical assessment of
approaches for molecular docking to elucidate associations of HLA alleles with adverse
drug reactions. Molecular Immunology, 101, 488–499.
Richeldi, L. (2009). Diagnosing latent tuberculosis infection. Guess who’s coming to dinner?
American Journal of Respiratory and Critical Care Medicine, 1-2, 180. https://doi.org/
10.116/rccm.200904-0562ED.
Rixe, N., & Tavarez, M. M. (2021). Serum sickness. In StatPearls. Treasure Island (FL): Stat-
Pearls Publishing. Available from: https://www.ncbi.nlm.nih.gov/books/NBK538312/.
Romano, A., Atanaskovic-Markovic, M., Barbaud, A., Bircher, A. J., Brockow, K.,
Caubet, J. C., et al. (2020). Towards a more precise diagnosis of hypersensitivity to
beta-lactams—An EAACI position paper. Allergy, 75, 1300–1315.
Romano, A., Blanca, M., Torres, M. J., Bircher, A., Aberer, W., Brockow, K., et al. (2004).
Diagnosis of nonimmediate reactions to beta-lactam antibiotics. Allergy, 59, 1153–1160.
Romano, A., & Caubet, J. C. (2014). Antibiotic allergies in children and adults: From clinical
symptoms to skin testing diagnosis. The Journal of Allergy and Clinical Immunology.
In practice, 2, 3–12.
Rozieres, A., Vocanson, M., Saı̈d, B. B., Nosbaum, A., & Nicolas, J. F. (2009). Role of T cells
in nonimmediate allergic drug reactions. Current Opinion in Allergy and Clinical
Immunology, 9, 305–310.
Sanico, A. M., Bochner, B. S., & Saini, S. S. (2002). Skin testing methods. In D. C.
Adelman, T. B. Casale, & J. Corren (Eds.), Manual of allergy and immunology
(pp. 485–486). Philadelphia: Lippincott, Williams & Wilkins.
Sch€onbeck, S., Chrestel, S., & Hohlfeld, R. (1990). Myasthenia gravis: Prototype of the
antireceptor autoimmune diseases. International Review of Neurobiology, 32, 175–200.
Seibert, F. B. (1934). The isolation and properties of the purified protein derivative of tuber-
culin. American Review of Tuberculosis, 30, 713–720.
Sekine, T., Perez-Potti, A., Rivera-Ballesteros, O., Strálin, K., Gorin, J.-B., Olsson, A., et al.
(2020). Robust T cell immunity in convalescent individuals with asymptomatic or mild
COVID-19. Cell, 183, 158–168.
Shrotri, M., van Schalkwyk, M. C. I., Post, N., Eddy, D., Huntley, C., Leeman, D., et al. (2021).
T cell response to SARS-CoV-2 infection in humans: A systematic review. PLoS One, 16,
e0245532. https://doi.org/10.1371/journal.pone.0245532.
Song, Z., Marzilli, L., Greenlee, B. M., Chen, E. S., Silver, R. F., Askin, F. B., et al. (2005).
Mycobacterial catalase-peroxidase is a tissue antigen and target of the adaptive immune
response in systemic sarcoidosis. Journal of Experimental Medicine, 201, 755–767.
Strachan, D. P. (1989). Hay fever, hygiene, and household size. British Medical Journal, 299,
1259–1260.
Szatkowski, J., & Schwartz, R. A. (2015). Acute generalized exanthematous pustulosis
(AGEP): A review and update. Journal of the American Academy of Dermatology, 73,
843–848.
Takhar, P., Corrigan, C. J., Smurthwaite, L., O’Connor, B. J., Durham, S. R., Lee, T. H., et al.
(2007). Class switch recombination to IgE in the bronchial mucosa of atopic and nonatopic
patients with asthma. Journal of Allergy and Clinical Immunology, 119, 213–218.
Takizawa, F., Tsuji, S., & Nagasawa, S. (1996). Macrophage phagocytosis upon iC3b
deposition on apoptotic cells. FEBS Letters, 397, 269–272.
Tharp, M. D. (1990). IgE and immediate hypersensitivity. Dermatologic Clinics, 8, 619–631.

Tokura, Y., Phadungsaksawasdi, P., Kurihara, K., Fujiyama, T., & Honda, T. (2021).
Pathophysiology of skin resident memory T cells. Frontiers in Immunology, 11, 1–19.
Trinchieri, G., & Valiante, N. (1993). Receptors for the Fc fragment of IgG on natural killer
cells. Nature Immunology, 12, 218–234.
Tsicopoulos, A., Hamid, Q., Varney, V., Ying, S., Moqbel, R., Durham, S., et al. (1992).
Preferential messenger RNA expression of Th1-type cells (IFN-gamma +, IL-2 +) in clas-
sical delayed-type (tuberculin) hypersensitivity reactions in human skin. Immunology,
148, 2058–2061.
Tsicopoulos, A., Pestel, J., Fahy, O., Vorng, H., Vandenbusche, F., Porte, H., et al. (1998).
Tuberculin-induced delayed-type hypersensitivity reaction in a model of hu-PBMC-SCID
mice grafted with autologous skin. The American Journal of Pathology, 152, 1681–1688.
Viel, S., Pescarmona, R., Belot, A., Nosbaum, A., Lombard, C., Walzer, T., et al. (2018).
A case of type 2 hypersensitivity to rasburicase diagnosed with a natural killer cell
activation assay. Frontiers in Immunology, 29, 1–4.
Vivanco, F., Muñoz, E., Vidarte, L., & Pastor, C. (1999). The covalent interaction of C3 with
IgG immune complexes. Molecular Immunology, 36, 843–852.
Von Pirquet, C. (1906). Allergie. Munchener Medizinische Wochenschrift, 30, 1457–1458.
Von Pirquet, C. (1909). Frequency of tuberculosis in childhood. Journal of the American
Medical Association, 52, 675–678.
Von Pirquet, C., & Schick, B. (1905). In F. Deuticke (Ed.), Die Serumkrankheit Leipzig
und Wien.
Von Pirquet, C., & Shick, B. (1903). Zur theorie der inkubationszeit. Wiener Klinische
Wochenschrift, 16, 1244.
Wagner, R. (1964). Clemens von Pirquet, discoverer of the concept of allergy. Bulletin New
York Academy of Medicine, 40, 229–235.
Wahlstrom, J., Dengjel, J., Winqvist, O., Targoff, I., Persson, B., Duyar, H., et al. (2009).
Autoimmune T cell responses to antigenic peptides presented by bronchoalveolar lavage
cell HLA-DR molecules in sarcoidosis. Clinical Immunology, 133, 353–363.
Weltzien, H. U., & Padovan, E. (1998). Molecular features of penicillin allergy. The Journal
of Investigative Dermatology, 110, 203–206.
Whaley, K., & Ahmed, A. E. (1989). Control of immune complexes by the classical pathway.
Behring Institute Mitteilungen, 84, 111–120.
Williams, G. T., & Williams, W. J. (1983). Granulomatous inflammation—A review. Journal
of Clinical Pathology, 36, 723–733.
W€uthrich, B., & Kopper, E. (1975). Determination of specific IgE serum antibodies using the
Radio-Allergo-Sorbent-Test (RAST) and its significance for the diagnosis of atopic
allergy. Schweizerische Medizinische Wochenschrift, 105, 1337–1345 (Article in German).
Wynn, T. A., Thompson, R. W., Cheever, A. W., & Mentink-Kane, M. M. (2004). Immuno-
pathogenesis of schistosomiasis. Immunological Reviews, 201, 156–167.
Zhao, W., & Hu, Z. (2010). The enigmatic processing and secretion of interleukin-33. Cellular
and molecular immunology, 7, 260–262.
Zinkernagel, R. M., & Hengartner, H. (2006). Protective ’immunity’ by pre-existent neutral-
izing antibody titers and preactivated T cells but not by so-called ’immunological memory.
Immunological Reviews, 211, 310–319.
CHAPTER
Hesitancy to get
vaccinated against
COVID-19 and how it
might be overcome
7
Charles S. Pavia∗
a
Department of Biomedical Sciences, NYIT College of Osteopathic Medicine, New York Institute of
Technology, Old Westbury, NY, United States
b
Division of Infectious Diseases, New York Medical College, Valhalla, NY, United States
∗
One evening, as a young teenager in the 1960s, I watched a televised movie entitled
“The Story of Louis Pasteur”. It impressed me so much that I began to seriously con-
sider pursuing a career in medicine or one of the biological sciences. I subsequently
chose the latter career path and, several years, later I received my Ph.D. degree in
microbiology and immunology. The movie was a classic Hollywood production
originally released for public viewing in 1937 and was a “Best Picture” nominee.
The lead character was the accomplished and well-known actor, Paul Muni, who
won a “Best Actor” award from the motion picture industry for his outstanding per-
formance in his portrayal of Pasteur—considered by many in the medical and scien-
tific community to be one of the founding fathers of modern microbiology and
immunology. He was a chemist by training (as well as being a self-made accom-
plished artist), and he coined the term “microbe”, based on his many discoveries
and drawings of what he observed under the microscope often to the displeasure
of some of his contemporaries, especially the medical establishment. Many of its
members were reluctant initially to go along with some of his experimentally derived
ideas and concepts, based in part because they seemed quite radical at the time given
the limitations of biomedical science 150 + years ago. Despite possibly putting his
career and reputation in jeopardy by occasionally going beyond acceptable medical
ethics when his work involved certain types of human studies, which were less re-
strictive then than they are now, Pasteur persevered working tirelessly and with much
conviction to prove his sceptics wrong, and indeed he showed through careful exper-
imentation that things (minute living organisms) not visible to the naked eye can in-
deed cause disease. By doing so, he debunked the previously held belief, by some of
his counterparts, in the theory of “spontaneous generation”, and is credited with

223
224 CHAPTER 7 Hesitancy to get vaccinated against COVID-19
providing us with the germ theory of disease. Eventually, many of his original scep-
tics started to accept his ground-breaking findings as being true.
While some parts of the movie may have been slight exaggerations and overly
dramatic renditions of actual events of those described in Pasteur’s biography
(Vallery-Radot, 1929), from which the movie got much of its material, it nonetheless
had quite a number of heart-warming and inspiring scenes to go along with scientif-
ically accurate pieces of information. Foremost among Pasteur’s many life-altering
achievements was his development of two diverse vaccines—one for preventing
anthrax in livestock animals, and the other for preventing/treating human rabies
(Fig. 1)—both being dreaded diseases having very high levels of mortality, both then
and now, in the absence of appropriate medical intervention. With these historical
accounts highlighting some of the key events in Pasteur’s career as the background,
it is amazing and at times disturbing to observe how certain aspects of this past
scenario from another era is playing out closely today in the wake of the current
COVID-19 pandemic. In this regard, many people, mostly outside the medical com-
munity, but a significant few within, have refused or remain hesitant to receive any of
the available COVID-19 vaccines. Given the seriousness of COVID-19 with its life-
threatening potential and the worldwide emergence of multiple highly contagious/
virulent mutants, such as the Delta variant, of the etiologic agent SARS-CoV-2,
FIG. 1
This relatively large and impressive portrait of Pasteur, done by Albert Edelfeldt in 1885 and
having the dimensions of 155 cm in height and 127.5 cm in width, shows him observing one of
his rabies “cultures” using rabbit spinal cord material that presumably enabled him to grow
the rabies virus. The original painting hangs majestically in the dining room of Pasteur’s
former home/laboratory located on the campus of the Pasteur Institute in Paris.
Hesitancy to get vaccinated against COVID-19 225
this reluctance to get vaccinated is very difficult to understand and has led to tragic
results. In addition, the vaccine options against COVID-19 are multiple (Table 1) and
involve either the use of a purified mRNA component of the virus or a viral vector
formulation, with both types having excellent safety and efficacy results based on
extensive clinical trials and, as of September 2021, have been approved or are near-
ing full approval from the FDA for use in the United States. In July 2021, as part of a
nationally televised briefing (White House COVID-19 Response Team, 2021),
highly regarded public health officials from the U.S. Centers for Disease Control
and Prevention (CDC) and the National Institutes of Health provided updates on a
new surge nationwide in hospitalizations and deaths due to COVID-19, and have
pointed out correctly that we are now entering into a “pandemic of the unvacci-
nated”. This comment by the director of the CDC is supported by data showing that
in some locations > 99% of the current wave of victims developing serious disease
are among the unvaccinated, leading to the obvious conclusion that these negative
outcomes could have been avoided if these victims had chosen to receive the vaccine
beforehand. This surge in cases has continued and even increased in many locations
in the months that followed.
What are the reasons for such hesitancy/resistance or for some of the obstacles to
get vaccinated? Here are some major examples (summarized in Table 2):
• Let’s take a wait and see attitude—observe how vaccine recipients respond/react
to the vaccine, in terms of making sure that the vaccine is safe and there will not
be any negative outcomes, and/or that it really works;
• Fear of needles or being jabbed and having to endure a possibly painful
injection—this is mostly a psychological or behavioural reaction that may have
been triggered by prior unpleasant experiences when receiving injections for
various other medications or from during a routine blood draw;
• Difficulty in gaining access to vaccine sites by the elderly, the severely disabled
and impoverished people, or in mobile inoculation units being able to safely reach
these home-bound or institutionalized people;
• Exercise our “free will” or constitutional rights—in the United States these
claims are often invoked by referring to the first amendment of the US
Constitution, and falling in line with not having to be compelled to take the
vaccine as a requirement to participate in the activities associated with any
organization, location or function, such as a governmental agency, an academic
institution, transportation venues, sport teams, sport/recreational, entertainment
or indoor dining facilities, places of worship, or an employer;
• Moral beliefs held by members of certain religious groups that are against various
forms of medical intervention; and perhaps the most egregious of them all;
• Believing or being swayed by the many forms of misinformation/disinformation
or conspiracy theories, such as stating that the science behind the vaccine’s
development and success is fake, or not to be trusted, or we are being used as
“guinea pigs”, which is being spread over various Internet social media platforms
and some cable news networks by mostly unscrupulous individuals, some of
whom claim to have expertise on medical matters, but actually don’t.
Table 1 Comparison of the key features of the COVID-19 vaccines that are produced by the four leading manufacturers.
Serious
Vaccine Type of Number of Storage Authorized for EUAb pending adverse
manufacturer vaccine doses method Efficacy use in the U.S.a final approval events
Moderna mRNA 2c
4–10 Co
> 94% Yes Yesd Raree
Pfizer mRNA 2c 80 oC > 95% Yes Yesd Raree
Janssen Viral vector 1c 4–10 oC 66.3% Yes Yes Yesf
Astra-Zeneca Viral vector 2 4–10 oC 63%–84% Yes Yesd Yesf
a
Information that was available as of August 2021.
b
In the U.S., an EUA (Emergency Use Authorization) was originally given for these vaccines for people aged >16, which was subsequently expanded to >12 years of
age.
c
As of October 2021, additional booster injections were highly recommended for these vaccines by the FDA and CDC.
d
In the U.K., an EUA no longer applies for the Pfizer, Moderna and Astra-Zeneca vaccines which now have been granted final approval for use. In the U.S. as of
August 2021, the Pfizer vaccine was given FDA approval, while the other 3 are undergoing further evaluation for full approval by the FDA.
e
Milder and temporary forms of myocarditis and pericarditis have occurred in a small number of young adults with these vaccines.
f
Blood clots have been reported in a small number of female vaccine recipients < 50 years of age with these vaccines.
Table 2 Characteristics of the anti-COVID vaccine phenomenon.

Reason Basis or source
Delay in getting vaccinated Vaccine must be fully approved

Fear of adverse events Some serious side effects have been reported
Anxiety/fear of inoculations Behavioural/psychological reaction
Inaccessibility to vaccine sites Problem with logistics or infrastructure
Freedom of choice/expression Political convictions or posture
Moral or religious objections Misguided religious teachings or upbringing
Vaccine is not safe or effective Misinformation/conspiracy theories spread mostly
Experimental data is fake by disreputable, non-scientific/non-medical people
It is important to realize that the anti-vaccine sentiment is not limited to the United
States, but it is a global problem (Hornsey, Harris, & Fielding, 2018) and had been
well established as a recurring theme multiple times prior to the onset of the current
pandemic often with devastating consequences. Even certain political leaders and
other professionals of varying degrees of influence have joined the anti-vaccine
bandwagon. This is reminiscent of what has occurred in the pre-COVID days with
certain other infectious diseases (reviewed in Smith, 2017), where “herd immunity”
which can develop when a sufficient number of people survive a natural infection,
has been invoked as the only mechanism whereby the spread of SARS-Cov-2 can be
blocked leading allegedly to its eventual disappearance within the general popula-
tion. Evidence in support of the pervasiveness and effects of these untenable reasons
against the COVID-19 vaccine comes from recently published data put forth by the
Kaiser Foundation (Hamel, Kirzinger, Munana, & Brodie, 2021), and these are as
follows.
In terms of demographics, 27% of the people in the United States remains
vaccine-resistant, saying they probably or definitely would not get a COVID-19 vac-
cine even if it were available for free and deemed safe by scientists and public health
officials. Vaccine hesitancy is highest among those who identify as belonging to a
certain political party (42%), those in the 30–49 age group (36%), and rural residents
(35%), especially those living in certain parts of the Midwest and Southeast sections
of the United States where less than 50% of the population has gotten vaccinated, and
where concurrently there has been an alarming new surge (as of July/August 2021) in
COVID-19 cases requiring hospitalization. In addition, 35% of African American
adults (a group that has had to bear a disproportionate burden of the effects of the
pandemic) say they definitely or probably would not get vaccinated, citing as major
reasons that they don’t trust vaccines in general (47%) or that they are worried they
may get sick with COVID-19 from just the vaccine alone (50%). This situation sug-
gests that messages combatting particular types of misinformation may be especially
important for increasing vaccine confidence among this group. Perhaps most aston-
ishingly, are the data showing that as much as one third of those who say they are
considered to be essential workers and 29% of those who perform services in a health
care delivery setting will not take the vaccine. The resistance of people to receive
COVID-19 vaccines is even more perplexing given the excellent track record of
other vaccines, some of which have been with us for nearly 100 years as part of
routine preventive care. These have been designed to protect us against smallpox,
tuberculosis (with BCG) and polio, followed, more recently, with the DPT (diphthe-
ria, pertussis, tetanus), MMR (measles, mumps, rubella), and chickenpox vaccines. It
should be noted that, in most jurisdictions, the latter three childhood vaccine
combinations are required before young children can start school at the elementary
level.
So, in light of the foregoing, how would a modern-day Pasteur react to the rel-
atively high level of resistance to get vaccinated against COVID-19, and what might
be a solution to this problem? Given his personality for scientific rigour combined
with the overwhelming evidence showing the vaccine’s safety (with few exceptions)
and efficacy, he probably would be highly disappointed with the overall public re-
sponse to getting vaccinated, especially by those who remain unconvinced on why
the vaccine is so important from a public health perspective, and why there is such
lack of confidence given the many advances made in medicine over the past 100 +
years. He would also be very outspoken and adamant against the sceptics who per-
petuate false or misleading information about the vaccine. If requested (and this
would seem highly likely given his prestige), he would probably be making frequent
public appearances on various news programs similar to what the current wave of
public health medical experts are doing now. He might even have his own podcast
where he could dispense valuable information to the misinformed or uninformed
public and reinforce the importance of getting vaccinated. He would probably find
it amusing and perhaps a bit misguided that incentives, such as monetary and other
rewards, are being offered in certain parts of the United States to try to get people
vaccinated, even though vaccines are being administered free of charge in most,
if not all, locations. To him, it would seem like deja vu in terms of what he experi-
enced with the obstacles that he had to face in dealing with his disbelieving scientific
and medical contemporaries, when he was making his groundbreaking and life-
changing discoveries in the late 1800s, at a time when complex biomedical processes
were still poorly understood, and initially underappreciated.
Another variable that awaits more clarity is whether and/or when patients, who
may have acquired some form of natural immunity after recovering from COVID-19,
should get vaccinated, if at all. This provokes the following question: are they no
longer susceptible, or are less vulnerable, to serious disease, after re-exposure to
SARS-CoV-2, that getting vaccinated would be unnecessary? It is believed, how-
ever, that solid immunity against COVID-19 may gradually wane (Centers for
Disease Control and Prevention, 2021a), and thus booster injections with one of
the available vaccines may still be necessary in order to provide optimal protection
against re-infection. A somewhat related recommendation, also coming from the
CDC, states that, starting in September 2021, another or third booster shot will have
to be given to earlier vaccines to maximize vaccine-induced protection and prolong
its durability, and that these booster shots will be offered for all Americans, who had
received their last (second) dose or had recovered from a prior infection with
SARS-CoV-2 at least 8 months previously.
Beyond what a contemporary Pasteur might be inclined to do, what else could be
done? Various organizations have made numerous suggestions, along these lines, in-
cluding several promoted and offered by the CDC (Centers for Disease Control and
Prevention, 2021b), and a few more that this author will offer. They include the fol-
lowing services that could be implemented. A large number of healthcare profes-
sionals and qualified scientists (primarily microbiologists and immunologists) are
needed to support COVID-19 vaccination efforts nationwide. It is important they re-
ceive the necessary training to effectively meet the demands of their roles. Training
must be ongoing as new COVID-19 vaccines become available and as vaccine rec-
ommendations evolve and more is learned about the vaccines and how to improve
and maintain the vaccination process. In terms of educating the lay public, they
are essential to ensuring that the American population is vaccinated safely as soon
as possible, based on a true understanding on why this is an important undertaking.
Furthermore, as parents’ most trusted source of information on vaccines, paediatric
healthcare professionals play a critical role in helping parents and guardians under-
stand the importance of COVID-19 vaccination and assuring them that COVID-19
vaccines are safe and effective, and that they are important steps in protecting their
children’s health (both physical and mental). Parents need to be reminded that fully
vaccinated people are less likely to spread the virus that causes COVID-19. Getting
all family members 12 years and older (and when recommended, children less than
12 years of age) vaccinated can protect other family members around you, including
people at increased risk for severe illness from COVID-19. Students also need to be
reminded that, after they are fully vaccinated, they will be able to resume many
activities with family and friends, such as going to parties, weddings, graduation
exercises, and other social gatherings that they have missed due to prior restrictions
that were imposed on everyone at the height of the pandemic.
As part of the education process, students should be contacted and encouraged
to learn more from reliable sources derived from rigorously peer-reviewed articles,
especially those found on medically-based Internet sites, such as PubMed, reputable
blog and social media posts, properly mentored student-driven publications and so-
cial groups. A feedback mechanism should be created in order for students to ask
questions and get a meaningful response quickly about COVID-19 vaccination, such
as by using either e-mail, online video conferences (via Zoom, Skype, Facetime or
any other similar provider), or by phone number. Any student concerns or questions
should be proactively addressed and the spread and harm of misinformation should
be countered by sharing credible and accurate information. Students, as well as other
participants, should be warned about relying on unregulated or non-scientifically
based sources of information that are circulating on the Internet or other similar plat-
forms. Students should be warned about the dangers caused by misinformation
and disinformation, and health literacy should be promoted as a means to be fully
informed in understanding the benefits of being vaccinated as well as the negative
outcomes that could arise if the vaccine is not received.
Although much of the preceding suggestions pertain mostly to the adolescent age
group, similar interventions should also be considered for those attending colleges
and universities after completing high school, to reinforce and update what students
had learned previously about vaccines. Hopefully, as this younger and now well-
informed generation matures into adulthood, they will be representative of a popu-
lation having much greater acceptance and less resistance to getting vaccinated when
deemed necessary by experts in the health care community for both now and, just as
important, later on, when other future serious outbreaks may arise.
As an additional approach, schools, at both the elementary and high school level,
can also take the initiative by recruiting the suitably trained medical professionals or
scientists to come to their classrooms, when this becomes allowable, and supplement
the curriculum by providing a better understanding of the vaccine process. In order to
accomplish this task more effectively, local health departments, especially those
within the jurisdiction of the schools, should provide the schools with a registry
of trained personnel who would be willing to come to the schools and share their
knowledge and expertise pertaining to the COVID-19 vaccines with the students,
along with the teachers and administrators, as well as answering any questions or
concerns that students may have on this topic, preferably at no additional cost to
the school district.
Another possible program worth considering would be for medical schools to of-
fer a short course on the vaccine process to be attended by elementary and high
school teachers to better educate them on this topic with all of its subtle nuances.
Upon completion of the course, the teachers would receive a certificate of recogni-
tion (similar to CME credits) showing that they had participated successfully in this
learning exercise. As such, they would be well equipped to return to their respective
schools with what they had learned about vaccines and share this information with
their students, during one of their standard classroom sessions or remotely (typically
when the subject of “Biology” is being taught or during “Health Class”). Presumably,
the best time to give this course would be during the summertime when most medical
schools are less active with their didactic responsibilities as part of the regular pre-
clinical curriculum, and where most of the first- and second-year medical students
are not on campus due to being on an extended break for their summer vacation.
In so doing, this would not impose an undue burden on the school’s infrastructure
or their faculty who would be providing this pertinent information to the participants
in this program.
In conclusion, people should not be fearful of receiving any of the available anti-
COVID-19 vaccines. The benefits of getting jabbed far outweigh the minimal risks
of having an adverse or serious outcome. Historically, vaccines have had an excellent
track record in terms of saving lives, reducing morbidity caused by a wide variety of
infectious agents, and easing the burden of the health care community and infrastruc-
ture. In addition, the various and somewhat innovative interventions put forth in this
chapter, that are designed to educate people about the COVID-19 vaccines, with the
goal of getting as many people vaccinated, especially towards dealing with the exist-
ing anti-vaccine trend, may be seen as a daunting task. Accordingly, it will require a
References 231
well-organized and coordinated effort, a well-equipped infrastructure and coopera-

tive interactions among all parties involved in order to make these interventions a
success and not just wishful thinking. Such opportunities to try to gain much wider
vaccine acceptance would perhaps be in keeping with the often-quoted comment by
the legendary Pasteur of: “dans les champs de l’observation, le hasard ne favorise que
les esprits prepares” (“in the field of observation, chance favours only the prepared
mind”) (Pasteur, 1939), in honour of him as we approach in the coming year of 2022
the bicentennial of his birth.
References
Centers for Disease Control and Prevention. (2021a). Frequently asked questions about
COVID-19 vaccination. 19 August 2021. https://www.cdc.gov/coronavirus/2019-ncov/
vaccines/faq.html#::text¼Yes%2C%20you%20should%20be%20vaccinated,ve%20al
ready%20had%20COVID%2D19.
Centers for Disease Control and Prevention. (2021b). How schools can support COVID-19
vaccination. June 29, 2021. https://www.cdc.gov/vaccines/covid-19/planning/school-
located-clinics/how-schools-can-support.html.
Hamel, L., Kirzinger, A., Munana, C., & Brodie, M. (2021). KFF COVID-19 monitor:
December 2020. https://www.kff.org/coronavirus-covid-19/report/kff-covid-19-vaccine-
monitor-december-2020/. accessed on July 22, 2021.
Hornsey, M. J., Harris, E. A., & Fielding, K. S. (2018). The psychological roots of anti-
vaccination attitudes: A 24-nation investigation. Health Psychology, 37(4), 307–315.
https://doi.org/10.1037/hea0000586.
Pasteur, L. (1939). Discours prononce à Douai, le 7 decembre 1854, à l’occasion de l’instal-
lation solennelle de la Faculte des lettres de Douai et de la Faculte des sciences de Lille. In
P. Vallery-Radot (Ed.), Vol. 7. Speech delivered at Douai on December 7, 1854 on the
occasion of his formal inauguration to the Faculty of Letters of Douai and the Faculty
of Sciences of Lille (p. 131). Oeuvres de Pasteur; Paris, France: Masson and Co. http://
gallica.bnf.fr/ar k:/12148/bpt6k7363q/f137.chemindefer.
Smith, T. C. (2017). Vaccine rejection and hesitancy: A review and call to action. Open Forum
Infectious Diseases, 4(3). https://doi.org/10.1093/ofid/ofx146.
Vallery-Radot, R. (1929). The life of Pasteur. Garden City, NY: Garden City Publishing
Co., Inc.
White House COVID-19 Response Team. (2021). White House COVID-19 Response
Team Briefing. https://www.c-span.org/video/?513463-1/cdc-director-warns-pandemic-
unvaccinated. July 16, 2021.
CHAPTER
The emergence of
SARS-CoV-2 variants
of concern in Australia
by haplotype coalescence
8
reveals a continental link
to COVID-19 seasonality
Tre Tomaszewskia, Volker Gurtlerb, Kelsey Caetano-Anollesc, and Gustavo
Caetano-Anollesa,∗
a
Evolutionary Bioinformatics Laboratory, Department of Crop Sciences, University of Illinois,
Urbana, IL, United States
b
RMIT University, Melbourne, VIC, Australia
c
∗
1 Introduction
The COVID-19 pandemic illustrates how a virus is capable of overcoming barriers to
its persistence by rapidly changing its genomic makeup. Thanks to extensive world-
wide genome sequencing efforts, researchers now have direct access to information
about the levels of genetic variation unfolding in the evolving viral population, as
well as variations associated with physiological responses of human or animal hosts.
As of January 15, 2022, the GISAID initiative (https://www.gisaid.org) sponsored by
many governments in partnership with public health and research institutions
(Elbe & Buckland-Merrett, 2017; Khare et al., 2021; Shu & McCauley, 2017) has
collected over 7 million genomic sequences of the SARS-CoV-2 virus, making them
freely accessible to the scientific community for analysis. In parallel, the open-
source Nextstrain project (https://nextstrain.org) made available a continuously
updated phylogenomic view of this data alongside with powerful and portable
analysis and visualization tools. These resources provide a unique window into
our evolutionary understanding of a human pathogen of great significance.
Genetic variation refers to the existence of differences among the genomes of a
set of closely or more distantly related organisms or viruses. This diversity in
233
234 CHAPTER 8 The emergence of SARS-CoV-2 variants of concern
genomic makeup constitutes one primary source of phenotypic diversity, i.e., diversity
in observable biological characteristics (traits). The other primary source involves epi-
genetic variation. Genetic variation results from the effects of a multiplicity of pro-
cesses, including spontaneous mutation, error-prone replication, recombination, and
genetic exchange. Mutations can be small-scale or large-scale alterations in the nucle-
otide sequence of genomic DNA present in most life forms or RNA typical of some
viruses. Small-scale alterations include exchange (substitution), addition (insertion) or
removal (deletion) of nucleotides in a sequence. Large-scale alterations include dupli-
cations, translocations or inversions of larger nucleic acid segments. Regardless of
their nature, the physiological impact of these alterations typically materializes at
the level of proteins or functional RNA. Nucleotide triplets for the most part encode
for amino acids, which control the physiological activities of the cell by serving as the
building blocks of proteins. A non-synonymous mutation leading to change in one or
more amino acids of a polypeptide sequence can alter the structure and functioning of
the mutated protein. For example, in the case of the SARS-CoV-2 virus, a single amino
acid substitution at position 614 of the viral spike glycoprotein (from aspartic acid to
glycine, referred to as the D614G mutation) that occurred during the first wave of the
pandemic resulted in increased viral transmissibility (Voltz et al., 2021). Distinct
viruses holding one or a unique constellation of these types of mutations are generally
called “variants” (Lauring & Hodcroft, 2021). At the protein level, mutations cause
amino acid substitutions (e.g., D614G), which are called “amino acid variants.”
Genetic variants arise in the context of evolving populations. Thus, mutations in
single or multiple genomic locations are often the subject of evolutionary effects
on fitness (e.g., natural selection) or the effect of chance events on sampling
(e.g., genetic drift). In the case of viruses, their fate can depend for example on
whether they confer competitive advantage to viral replication, rates of transmission,
immune escape, or virulence. Mutations that do not provide an advantage are often
eliminated from the population, unless “founder effects” on newly established viral
populations extend their persistence. Epidemiologically, a mutation that alters trans-
missibility, disease severity, or immune or vaccine escape becomes a “mutation of
concern” (MOC) and its presence in a variant a candidate for surveillance and re-
sponse. More importantly, a “variant of concern” (VOC) is a variant of the virus
exhibiting a constellation of mutations associated with statistically significant and
experimentally verified increases in virus transmissibility, disease severity, immune
and vaccine escape, diagnostic test evasion, or other clinical or epidemiological
criteria of significance. VOCs become immediate priority for surveillance and
response, especially when their prevalence increases worldwide.
Haplotypes are sets of mutations that are often inherited together. In the case of
viruses, haplotypes are known to represent mutations that appear tightly linked with
each other. For example, the D614G mutation of the SARS-CoV-2 spike protein is
part of an haplotype of four mutations that also alter the NSP12 polymerase (P323L),
50 untranslated region (UTR), and silently the NSP3 papain-like protein (F106F).
This haplotype was the first gene set to be fixed in the worldwide viral population
during the first wave of the COVID-19 pandemic in early 2020. Since VOCs are
2 Methods 235
mutation constellations reflecting successful viral variants that have overtaken the
global population, there is an implicit assumption that these constellations are stable
haplotypes. This assumption however has not been fully tested. Here we explore the
appearance and accumulation of major mutations typical of VOCs in Australia as
the viral disease progresses towards becoming endemic. We study the constellation
of mutations characteristic of VOCs to determine if the mutation sets acted as hap-
lotypes and to test if these haplotypes are the subject of regional variation in
Australia. Our goal is to explore processes behind the emergence of VOCs in a viral
pandemic, including effects of viral seasonal behavior.
2 Methods
The metadata for 7,175,152 SARS-CoV-2 genome sequences was downloaded from
GISAID (https://www.gisaid.org) on January 18, 2022. The metadata were then
filtered for sequences marked “complete” with “human” hosts and a “location” field
containing the case-insensitive term “Australia,” which reduced the set to 58,378
sequences. Of these, the sequences were collected between January 1, 2020 and
January 13, 2022 (743 days) and submitted for deposition to GISAID between
January 31, 2020 and January 17, 2022 (717 days) (see acknowledgements in
Supplementary information in the online version at https://doi.org/10.1016/bs.
mim.2022.03.003 for complete list of Accession IDs used).
The Australian region (state/territory) for each sequence was then extracted from
the “location” field, resulting in sequences belonging to each of eight regions
(Table 1). The metadata was then labeled by “period,” which was derived from
the collection date’s year and calendar quarter. This was done so that, for example,
January 1, 2020 to March 31, 2020 was designated as “Period 1” and January 1, 2022
to March 31, 2022 as “Period 9”.
The sequence metadata provide the field “AA Substitutions,” which contains a
comma-separated list of each identified amino acid substitution (against the refer-
ence sequence NC_045512) by protein name, reference amino acid, amino acid
Table 1 Sequences by state/territory of Australia.

State/territory Number of sequences Proportion of sequences
Victoria 22,011 0.434

New South Wales 21,922 0.432
Queensland 3142 0.062
Australian Capital Territory 1927 0.038
South Australia 761 0.015
Western Australia 588 0.012
Tasmania 222 0.004
Northern Territory 171 0.003
location within the sequence, and the substituting amino acid (formatted as < Protein
Name >_<Reference AA ><AA Protein Location ><Substitution AA >). The list
for each sequence was transformed into a one-hot encoding for each of the 9281 mu-
tational substitutions, indexed by the Accession ID, and the derived region and
period.
Grouped by these derived attributes, a simple summation of each possible muta-
tion across sequences provided the occurrence count for each region-period group-
ing. Dividing the summation of any mutation by the total number of sequences within
the group provided the prevalence of each amino acid substitution for each region-
period. These groups were then aggregated and regrouped by mutation, enabling
regional comparisons of the prevalence of each mutation by time period (year-
quarter).
Since substitution groups containing low variance or spurious substitutions were
undesired for further analysis, the groups were filtered by a “relevancy” heuristic.
The prevalence of any given substitution was required to be above a threshold of
0.1 in more than 2 regions for at least one period, although there was no requirement
that this threshold was met during the same period.
Review of the initial results revealed certain variant-specific substitutions occur-
ring in improbable time-periods (e.g., simultaneous mutations appearing in signifi-
cant amounts 3 quarters prior to announced detection). Further analysis of the data
indicated 292 instances were labeled with collection dates that were only identified
by year. These were reconciled by using the submission date as a proxy. The entire
process detailed above was then repeated to achieve final results.
Extraction and transformation was performed using the Python library Pandas
(McKinney, 2010; Pandas Development Team, 2022). The Python library
“matplotlib” (Caswell, Droettboom, Lee, et al., 2021; Hunter, 2007) was used to
produce raw plots of the data, followed by an additional arrangement, annotation,
and graphical modification using Adobe Illustrator. Source code and supplementary
information can be found at https://doi.org/10.1016/bs.mim.2022.03.003.
3 VOCs in Australia
SARS-CoV-2 variants are organized around a master genomic sequence of the virus
that originated in the city of Wuhan in China (accession NC_045512.2, version
March 30, 2020; previously “Wuhan seafood market pneumonia virus”). Many
mutations have been added to, and subtracted from, this master sequence since
the beginning of the pandemic. These genomic changes can be traced through their
phylogenies (Fig. 1A). Phylogenies are hypotheses of history and genealogical
relationship among groups of genomes (evolving taxa) in the form of tree structures
(networks without reticulations). They harbor specific connotations of ancestry
and an implied time axis, which enables the study of important epidemiological
phenomena such as viral spread, variant introduction, and rates of genomic
change and epidemic growth. Splits in the branches of these trees define clades,
FIG. 1
The mutational landscape of the SARS-CoV-2 virus at the beginning of 2022 and its historical
spread throughout the Australian continent. (A). A maximum likelihood phylogenetic tree
describes the worldwide history of the SARS-CoV-2 genome. The timetree of 3347 genomes
randomly sampled between December 2019 and January 2022 was obtained from Nextstrain
(https://nextstrain.org) on January 15, 2022. The tree unfolds time of genome collection date
from left to right. Its leaves (taxa indicated with circles) are colored according to clade (group
of taxa with a common evolutionary origin) and emerging variants of concern (VOCs)
nomenclature. The origin of VOCs occurs when a clade originates along branches of the
phylogeny. Note the early arrival of VOC alpha, followed by VOC delta and then VOC omicron.
The timeline of clades and VOCs show three successive phases driven by proteome flexibility
and rigidity, environmental sensing and vaccine-driven immune escape, which are shaded in
light yellow, blue and salmon, respectively (Caetano-Anolles, Hernandez, Mughal,
Tomaszewski, & Caetano-Anolles, 2022). (B). Plots show numbers of newly confirmed cases
per 1000 people (in logarithmic scale and as 7-day rolling averages) and smooth percentages
of genomes holding major VOCs in Australia since the beginning of the recorded COVID-19
pandemic. COVID-19 and genome data are derived from Johns Hopkins Univ., CSSE and
GISAID, respectively. (C). Spike map showing the population density of Australia as a grid of
vertical bars depicting number of people per square kilometer of land area (courtesy of
Alasdair Rae, Automatic Knowledge Ltd., Sheffield, UK). The different states/territories of
Australia are identified with colored numbers using shades that correspond to increasing
latitudes of their population medians across cells (from red to turquoise). The pie chart
describes the relative number of total cases (cumulative, confirmed and under investigation)
reported by the Department of Health, States and Territories for individual regions on
February 4, 2022.
i.e., groups of taxa with a common evolutionary origin. Clades are often defined by
the statistical distribution of distances between phylogenetic clusters followed by
lineage merging based on mutations that are shared. As of February 2022, genome
sequences have been clustered into 11 GISAID clades (L, S, O, V, G, GH, GR, GV,
GRY, GK, and GRA) or 23 Nextstrain clades defined by a year-letter nomenclature.
In the case of Nextrain clades, a new clade must differ by at least 2 mutations from its
parent major clade (Hodcroft, Hadfield, Neher, & Bedford, 2020). The tree shown in
Fig. 1A uses the Nextstrain nomenclature to pinpoint the evolutionary appearance of
major VOCs along a timeline that originated when the first two clades (19A and 19B)
diverged from each other. In the figure, the current VOC omicron wave is repre-
sented by major clades 21 K and 21 L, which originated from a larger more basal
clade that gave rise to VOC alpha. Nextstrain clades of VOC omicron correspond
to the recent GISAID clade GRA. In addition, clades can be defined at lower gran-
ularity using the Phylogenetic Assignment of Named Global Outbreak LINeages
(Pangolin) tool that automatically assigns sequences to lineages and sublineages
(Rambault et al., 2020). For example, VOC omicron corresponds to Pangolin lineage
B.1.1.529 and the previously prevalent VOC delta to lineage B.1.617.2, both of
which harbor numerous sublineages.
VOCs emerged in October 2020, less than half a year after the first wave of the
pandemic. VOC alpha (also known as Nextstrain clade 20I or Pangolin lineage
B.1.1.7) appeared in the United Kingdom and was the first to expand quickly world-
wide, probably correlated with significant increases in transmissibility and infection
rates (Davies et al., 2021). VOC beta (20H, B.1.351) appeared in December 2020,
following its first report in South Africa, and VOC gamma (20 J, P.1) appeared in
the Amazonian region of Brazil in January 2021. The highly prevalent VOC delta
(21A, B.1.617.2), while first discovered in India in October 2020, became predominant
worldwide in June 2021, almost completely replacing other developing VOCs. Finally,
VOC omicron was first identified in Botswana and South Africa early in November
2021 and is currently sweeping the world, replacing VOC delta. A global analysis
of the spread of the different VOCs (except omicron) and an estimate of effective
reproduction numbers revealed rapid replacement of previously circulating variants
and transmissibility increases ranging from 25% (alpha) to 97% (delta) (Campbell
et al., 2021). These estimates are expected to increase substantially with VOC omicron.
We here focus on the COVID-19 pandemic in Australia and the effects that lat-
itude has on the establishment of VOC-induced disease. Compared to responses from
the US and European countries, the disease mitigation strategies employed by fed-
eration and local governments of the Australian Commonwealth have been swift and
effective. This provides a unique opportunity to study VOC emergence at many lat-
itude levels in a country that has been able to control infection for the majority of the
pandemic (Fig. 1B). The first confirmed case of COVID-19 was identified in Vic-
toria on January 25, 2020. Both the central government and individual states
responded swiftly to the outbreak by closing borders. This controlled the first wave
to some degree by the beginning of April. However, a second and more deadly wave
emerged in Victoria during May and June 2020. Although it was largely localized to
3 VOCs in Australia 239
Melbourne, it was considerably more widespread than the initial wave. Strict lock-
down managed to control the disease by November 2020. In order to curb cluster
outbreaks, Australia pursued a zero-COVID public health policy of suppression
(i.e., “find, test, trace, isolate and support”) that minimized domestic community
transmission, enforced strict international border controls, and curbed local out-
breaks via lockdowns and exhaustive contact tracing. The policy lasted until late
2021. Despite efforts and a nationwide vaccination program, VOC delta levels in-
creased in April 2021 and a “delta wave” overtook the country in June 2021 with
a significant outbreak in New South Wales. Major city lockdowns during July
through December 2021 were unable to suppress the rise of case numbers, which
was notably exacerbated by the VOC omicron wave that began in 2022. At the be-
ginning of December 2021 there were 211,654 reported cases. After only 2 months
(up to February 4, 2022), that number of total cases increased to 2,319,029, with
940,596 cases corresponding to New South Wales and 870,416 to Victoria. Despite
these large case numbers, only 4073 total deaths were reported for the entire country.
We note that the “delta wave” that started in April 2021 and was predominant for a
period of 5–6 months was largely responsible for a significant number of these
deaths. The first cases of VOC omicron were reported in Sydney on November
28, 2021, and in Darwin and Sydney on November 29, 2021, all infected travelers
returning from southern Africa. Fig. 1B describes the percentage of sequenced ge-
nomes corresponding to the main VOCs alpha, delta and omicron that were present
in Australia. Remarkably, VOC omicron (21K) took over the identity of most of ge-
nome samplings in less than a month, replacing the fully prevalent VOC delta (21J).
Australia is inhabited by 26 million people, making the country the most popu-
lous in Oceania. However, because of its significant size (the 6th largest nation in the
world), Australia has a very low population density of 3 people/km2. Furthermore,
most people live in major urban areas, which largely correspond to the capital cities
of the state/territories. The largest cities include Sydney (4.6 million in habitants),
Melbourne (4.2 million), Brisbane (2.2 million), Perth (1.9 million) and Ade-
laide (1.2 million). The Gold Coast, Newcastle and Wollongong add an extra 1.2
million. Fig. 1C shows a spike map of the population density of Australia. It iden-
tifies the different states/territories of Australia with numbers colored according to
the latitudes of their population medians: 1, Northern Territory (12°S); 2, Queens-
land (27°S); 3, Western Australia (32°S); 4, New South Wales (33°S); 5, South
Australia (35°S); 6, Australian Capital Territory (ACT) (35.2°S); 7, Victoria
(39°S); and 8, Tasmania (43°S). Regions 1–4 can be dissected from regions
5–8 by a –34°S latitude transect, separating the largest cities of Sydney and Mel-
bourne from each other by 4°, 713 km air distance, and a state boundary half-way
between the two cities. Most reported COVID-19 cases correspond to the largest cit-
ies located within a 30°S to 50°S latitude corridor, which was previously iden-
tified to be associated with seasonality during the first wave of the pandemic
(Caetano-Anolles et al., 2022). A pie chart describing the proportion of total cumu-
lative cases in states/territories shows that 88% of cases appeared in New South
Wales and Victoria, driven mainly by the Sydney and Melbourne metropolitan areas
(Fig. 1C). A comparison of lineages identified in genome sequences sampled from

these two states before the rise of VOC omicron on October 18, 2021 showed Pan-
golin sublineage B.1.617.2.30 was almost exclusively observed in Victoria following
a survey of 4184 and 13,536 sequences from New South Wales and Victoria, respec-
tively (Fig. 2). Other sublineages were also differentially present in the two states.
These initial results suggest a seasonal underpinning of the genetic differences
responsible for lineage diversification. This initial exploration prompted us to under-
take a more exhaustive analysis.
4 Prevalence of amino acid variants in Australia

In order to track the prevalence of individual mutations as they emerged during the
entire span of the pandemic, we analyzed 50,744 genome sequences drawn from the
7 regions (state/territories) of Australia, partitioning them into those acquired in each
of the 9 calendar quarters. Sequences collected between January 1, 2020 and January
13, 2022 were downloaded on January 18, 2022 (Table 1). From these sequences, a
total of 9281 amino acid substitutions (variants) were identified and subsequently
filtered with a “relevancy” criterium determined by asserting that substitutions must
hit a prevalence threshold of 0.1 (10%) for more than two quarters and in more than
two regions. Note that the threshold, number of quarters, and number of regions are
dynamic. While there are some limitations to this heuristic, the filtering criterion
guarantees that we are not missing any significant mutations, especially those that
become VOC “markers.” The figures included in the Supplementary information
in the online version at https://doi.org/10.1016/bs.mim.2022.03.003 section show ac-
cumulation plots of individual amino acid variants corresponding to the major VOCs
appearing in Australia, i.e., VOC alpha (Fig. S1), VOC delta (Fig. S2) and VOC om-
icron (Fig. S3). Fig. S4 describes accumulation plots of other amino acid variants that
were retained following our relevancy criterion. Collectively, the plots describe the
set of the most significant mutations that appeared in individual proteins of the viral
proteomes in the different regions of Australia and along the 9 quarters of the pan-
demic. Prevalence ranged from 0 to 1, with 1 implying that 100% of genome se-
quences collected during an individual quarter contained that mutation. In the
following subsection we describe the most salient patterns observed in the accumu-
lation plots.
4.1 The emergence of first haplotypes

Variant accumulation plots showed that the first major haplotypes reported world-
wide were also present in Australia (Fig. 3). We found that the D614G amino acid
substitution of the spike (S-protein) and the P323L substitution of the NSP12
polymerase that mediates viral replication were coupled (sometimes loosely) in
all Australian regions (Fig. 3A). These substitutions are part of a 4-mutation haplo-
type (labeled here as haplotype 5) that was first established in Europe after its first
FIG. 2
A seasonal effect during the VOC delta wave of Australia. (A). Assignment of pangolin lineages to 4184 and 13,536 genome sequences from New
South Wales (NSW) and Victoria (VIC), respectively. VIC and NSW account for most of VOC delta cases in Australia. (B) The bar plots describe the
incidence of pangolin lineages according to date genome sequence acquisition. Lineages assigned to only one sequence are not graphed.
FIG. 3
The noisy rise of first SARS-CoV-2 haplotypes in Australia. (A). Accumulation plots describing the prevalence of the D614G amino acid
substitution of the spike (S) protein and the P323L substitution of the NSP12 polymerase show their joint but noisy emergence and partial
decoupling until the second quarter of 2021. Overlapping plots of the two markers make evident the coupling-decoupling patterns in the
haplotype (haplotype 5). (B). Accumulation of the R203K and G204R markers of the nucleocapsid (N) protein reveal a tight coupling of the
haplotype (haplotype 2) during the start of the pandemic but a later decoupling that began in the last quarter of 2020.
4 Prevalence of amino acid variants in Australia 243
report in Germany and spread throughout continents during the January–April period
of 2020. The haplotype is the most stable so far and is believed to be linked to
increases of COVID-19 infectivity (Becerra-Flores & Cardozo, 2020; Korber
et al., 2020). Mutations were already present in most Australian regions at 60% prev-
alence levels during the first quarter of 2020, but at lower levels in Tasmania, ACT
and Southern Australia. Remarkably, while these markers of haplotype 5 were max-
imally prevalent worldwide, their prevalence only reached 100% in the third quarter
of 2021 for all regions of Australia. We also note that the emergence of the haplotype
was noisy and sometimes decoupled across regions until the second quarter of 2021.
Temporal decoupling was evident in the Northern Territory, Queensland, New South
Wales, and Western Australia, i.e., regions above the 34°S latitude transect that are
warmer. The slow establishment of haplotype 5 may be explained by the zero-
COVID public health policy of the country.
The R203K and G204R markers of the nucleocapsid protein (N-protein) emerged
as a tightly linked haplotype (haplotype 2) in all regions during the start of the pan-
demic (Fig. 3B). Mutation decoupling occurred between the third quarters of 2020
and 2021 in Queensland and Victoria. Prevalence reached highest levels between the
third quarter of 2020 and the first quarter of 2021 in regions above the 34°S latitude
transect that are colder, especially in ACT, Victoria and Tasmania (which reached
100% prevalence levels), but was found to significantly decrease in regions closer
to the Equator. These patterns and the rise of the haplotype during the winter in
the Southern Hemisphere suggest a seasonal effect. We note that the haplotype dis-
appeared from Australia in the third quarter of 2021 when VOC delta took over the
viral population but later re-emerged forcefully as a tightly linked haplotype with the
rise of VOC omicron at the end of 2021. These mutations are located in the serine/
arginine-rich linker that separates the N-terminal and C-terminal RNA-binding do-
mains of the N-protein, which we found is intrinsically disordered (Tomaszewski
et al., 2020).
4.2 Emergence of haplotypes associated with VOCs alpha,

delta and omicron
A classification of accumulation plots revealed the existence of 18 additional
haplotypes, which were associated with VOCs alpha, delta and omicron. These
haplotypes were composed of 2–12 variants in 1–6 proteins.
The core mutant constellation of VOC alpha was defined by a central haplotype
of 12 amino acid variants (haplotype 1), which affected the S-protein, N-protein, the
accessory ORF8 immune evasion protein, and the NSP3 papain-like proteinase scaf-
fold. Fig. 4A shows accumulation plots and an overlap plot describing the tight cou-
pling of this large haplotype in Australia between the fourth quarter of 2020 and the
third quarter of 2021. The only significant difference in variant accumulation was
observed in R52I of ORF8, which started to accumulate in the third quarter of
2020 in South Australia (blue curve in plot overlap). The early appearance of this
marker suggests an episode of early recruitment. As expected, prevalence of the
FIG. 4
Core haplotypes of VOC alpha, delta and omicron. (A). Accumulation plots describing the
prevalence of the 12 amino acid variants of haplotype 1 of VOC alpha. The plot overlap
describes the tight curve overlap of the 12 markers, revealing only a decoupling pattern in the
curves of variant R52I of the ORF8 protein. (B). Accumulation plots describing the prevalence
of the 8 amino acid variants of haplotype 6 of VOC delta. The “plot overlap” describes the tight
curve overlap of the 7 markers. Note that there was decoupling associated with variants
P1469S of NSP3 and T77A of NSP6. (C) Accumulation plots describing the prevalence of
representative variants (first in the lists) of the 6 haplotypes that make up the core of VOC
omicron (haplotypes 12–17). For all panels, plots describe variant accumulation in the 8
regions of Australia and are labeled with the name of the amino acid variant colored according
to its presence in the mutant constellation reported for VOCs worldwide (green, VOC alpha;
blue, VOC delta; red, VOC omicron; black, other). The icons for the alpha, delta and omicron
haplotype cores are being used in the network of Fig. 5.
haplotype across regions was low (below 60%) since it follows the low prevalence
of VOC alpha (see Fig. 1B). However, the haplotype was surprisingly absent in
Tasmania.
The core mutant constellation of VOC delta involved an 8-variant haplotype
(haplotype 6) affecting 6 proteins—the N-protein, ORF7b, the NSP3 protease,
4 Prevalence of amino acid variants in Australia 245
NSP4, NSP6 and the NSP14 exonuclease (Fig. 4B). Minor differences in variant
accumulation were observed in P1469S of NSP3 (most notably in Victoria and the
Northern Territory) and in T77A of NSP6 (in South Australia and the Northern
Territory). Remarkably, haplotype prevalence reached 90–100% in regions below
the 34°S latitude transect (South Australia, ACT, Victoria and Tasmania) during
the third quarter of 2021, while for example, it reached only 60% in New South Wales.
Finally, the core mutant constellation of VOC omicron involved a set of 6
haplotypes (haplotypes 12–17) containing 2–8 variants, each of which affected
1–5 proteins, including the S-protein, N-protein, and the membrane (M) and enve-
lope (E) structural proteins, NSP3, NSP5, NSP6 and NSP14 (Fig. 4C). Haplotypes
13, 16 and 17 affected sites exclusively present in the S-protein. Haplotypes 12 and
14 also involved a significant number of S-protein markers. Accumulation curves
showcase how VOC omicron overtook the entire viral population in all regions
and in a period of only two calendar quarters, the last quarter of 2021 and the first
quarter of 2022. Curve overlaps for variants in each haplotype revealed an absence of
significant decoupling patterns. We note, however, that all six haplotypes harbored
common patterns of accumulation, which suggests they exhibit similar behavior
across regions. This merits placing these haplotypes within a single haplotype core.
We also note that S-protein variants A67V and V143del of haplotype 14 and N210del
and N212I of haplotype 17 appeared in advance of VOC delta in the first quarter of
2021, which suggests that these markers were recruited from markers that were al-
ready present in the viral population in early 2021. Furthermore, the N-protein var-
iant P13L of haplotype 12, which is associated with the N-terminal region of the
nucleocapsid that is intrinsically disordered (Tomaszewski et al., 2020), appeared
during the first wave of the pandemic in the first quarter of 2020, reaching very high
prevalence levels in Tasmania. This marker, which was part of a predicted pathway
of mutational change involving protein flexibility/rigidity (Tomaszewski et al.,
2020), likely represents the oldest variant of the VOC omicron haplotype core.
4.3 Amino acid variants and haplotypes shared by VOCs

Out of all variants and haplotypes identified in our analysis of mutational prevalence,
only a handful were shared between VOCs in Australia. Out of a total of 98 markers,
74 were present in haplotypes but only 7 of these were shared between two or three
VOCs. They defined the only 4 shared haplotypes (out of a total of 20) described
above. Conversely, 6 out of 24 single-standing variants were shared between two
VOCs. These numbers suggest limited but yet significant recruitment during
VOC emergence in episodes of variant and haplotype coalescence.
Haplotypes 2, 3 and 4, as well as single-standing variants P681H and N501Y of
the S-protein were shared between VOCs alpha and omicron. Haplotype 2 (described
above) involved two mutations in the central intrinsically disordered linker of the
N-protein, haplotype 3 involved three deletions in the N-terminal domain (NTD)
of the S-protein (H69del, V70del, and Y144del), and haplotype 4 involved two de-
letions (S106del and G107del) in NSP6. In turn, only 4 variants unified VOCs delta
and omicron, i.e., variants S96I, G142D and T478K of the S-protein and variant
T492I of NSP4. Only the most ancestral haplotype, haplotype 5 mentioned above,
unified all three VOCs.
4.4 Amino acid variants that are not part of established VOC
constellations
We identified a number of amino acid variants with significant prevalence that did
not belong to established VOC constellations (see CoVariants; https://covariants.
org). Accumulation plots are shown in Fig. S4 in Supplementary information in
the online version at https://doi.org/10.1016/bs.mim.2022.03.003. Mutants E484K
and A701V of the S-protein, T205I of the N-protein, T85I of NSP2, K835N of
NSP3, and K90R of NSP5 followed increases that mirrored those of VOC alpha
markers. Similarly, G215C of the N-protein and V71I of ORF7a followed increases
similar to those of VOC delta. Finally, V1069 of NSP3 increased together with the
emergence of VOC omicron. Mutants with increases that mirrored those of VOC al-
pha markers reached 100% prevalence in ACT during the last quarter of 2020. An-
other set reached prevalence in ACT during the second quarter of 2021 (R385K of
the N-protein, P129L of NSP2, H1274Y of NSP3, and H234Y of NSP15). We cannot
explain why the ACT region fostered all of these mutations at high levels. The high
prevalence reached by S197L of the N-protein and F308Y of NSP4 in Tasmania can-
not be explained either, especially because both mutations had patterns of accumu-
lation that were linked (suggesting an haplotype). They may represent specific
mutational bursts that occurred in those regions.
5 A network view of haplotype diversity and VOC emergence

A network view can help better describe the haplotype and variant makeup of VOCs.
Fig. 5 shows a “haplotype network” describing the viral population landscape of
Australia that unfolded throughout the COVID-19 pandemic. Nodes of the graph
are either haplotypes or individual amino acid variants coalescing into VOC-specific
constellations. Edges describe common patterns of prevalence in accumulation plots.
Circles portray levels of haplotype coalescence. Outer-most circles host amino acid
variants and haplotypes shared between VOCs. Circles closer to the core haplotypes
host variants and haplotypes with patterns of prevalence that resemble more tightly
those of the core. The network reveals significant and unanticipated patterns of emer-
gence and diversification, which we discuss in the following subsections.
5.1 Haplotype and variant reuse

The currently widespread VOC omicron appears to have drawn markers from hap-
lotypes and variants of VOC alpha more than from VOC delta. With the exception of
the ancestral haplotype 5 typical of all three VOCs, VOC omicron shares 3 haplo-
types with VOC alpha (haplotypes 2, 3 and 4) involving markers of the S-protein,
5 A network view of haplotype diversity and VOC emergence 247
FIG. 5
A network of haplotypes describes the emergence of major VOCs in Australia. Nodes are
either haplotypes or individual amino acid variants coalescing into VOC-specific
constellations. Edges describe common patterns of prevalence in accumulation plots. Circles
portray levels of haplotype coalescence. Outer-most circles host amino acid variants and
haplotypes shared between VOCs. Haplotypes are labeled with numbers and variants are
labeled with names that follow accepted nomenclature from the Human Genome Variation
Society. Names are colored according to their presence in established VOCs worldwide or in
black when uniquely present in Australia.
N-protein and NSP6, respectively. In turn, VOC omicron shares only 4 variants with
VOC delta. These markers, 3 of which are S-protein variants, coalesce into VOC
delta’s core. In other words, VOC alpha contributed almost half of its markers
(11 out of 24 total) and 4 out of its 5 haplotypes to VOC omicron, while VOC delta
contributed only 17% of its markers (6 out of 35 total) and only 1 out of its 7
haplotypes to the makeup of the new VOC.
Going back in time, a number of omicron-specific variants were already present
in significant number during the first wave of the pandemic early in 2020.
These include the S477N variant of the S-protein and the P13L variant of the
N-protein. Other omicron-specific markers appeared by the end of 2020 and begin-
ning 2021 in Australia, including K417N and to a lesser level A67V, N440K, H655Y,
N679K, D796Y of the S-protein and K38R, S1265del, and L1266I of NSP3 (Fig. S3
in Supplementary information in the online version at https://doi.org/10.1016/bs.
mim.2022.03.003). Similarly, several delta-specific variants were already present
in 2020 and very early in 2021, including A222V, L452R and P681R of the
S-protein, 182 T of the M-protein, D377Y of the N-protein, P822L of NSP3,
A446V of NSP6, T181I of NSP6 and to a lesser level V82A of ORF7a, T40I of
ORF7b, P822L of NSP3, P1228L of NSP3, and P77L of NSP13 (Fig. S2 in Supple-
mentary information in the online version at https://doi.org/10.1016/bs.mim.2022.
03.003). Finally, alpha-specific variants were already significantly present during
the end of the first wave, including R52I of ORF8 and T183I of NSP3 (Fig. S1 in
Supplementary information in the online version at https://doi.org/10.1016/bs.
mim.2022.03.003). Many of these reused markers were part of several haplotypes.
In order to strengthen the argument of significant reuse of markers in variant
combinations, we explored their presence in 137,605 sequences of the S-protein re-
trieved worldwide on November 14, 2020 (Showers, Leach, Kechris, & Strong,
2022). For VOC omicron, D614G of haplotype 5, H69del, V70del and Y144del
of haplotype 3 (shared with VOC alpha), D796Y and N679K of haplotype 12,
A67V, Y143del and T547K of haplotype 14, and N440K of haplotype 19, were pre-
sent in the dataset sometimes in combination with others. For example, H69del and
V70del variants of haplotype 3 were present in 1066 genomes as a H69del-V70del-
N439K-D614G combination and in numerous other arrangements in another 698 se-
quences, including 22 sequences of a 10-variant combination of 6 VOC omicron-
specific and 3 VOC-alpha-specific markers (H69del-V70del-Y145del-N501Y-
A570D-D614G-P681H-T716I-S982A-D1118H). Thus, 5 out of 8 haplotypes affect-
ing S-proteins in VOC omicron recruited markers appearing in 2020. Other free-
standing markers were also recruited, including S477N, D574Y, G339D, G142D
and T478K (both shared with VOC delta), and P681R (shared with VOC alpha).
In particular, S477N was present in 8080 sequences as the second most popular com-
bination of the set (S477N-D614G). For VOC delta, T19R and D950N of haplotype 7
(the only S-protein markers in haplotypes), G142D and T478K shared with VOC om-
icron, P681R, L452R and A222V were also present in the dataset. In particular,
A222V appeared in 7088 sequences as a L18F-A222V-D614G combination and
in 169 sequences as a L5F-A222V-D574Y-D614G-H655Y combination (which in-
cludes H655Y of VOC omicron). As expected for VOC alpha, we found 22 instances
of the 10-variant combination containing all S-protein markers of haplotype 1
(A570D, T716I, S982A, D1118H), haplotype 3 (H69del, V70del, Y145del) and hap-
lotype 5 (D614G) and the two free-standing variants N501Y and P681H that collec-
tively characterize the S-protein constellation of this viral variant (H69del-V70del-
Y145del-N501Y-A570D-D614G-P681H-T716I-S982A-D1118H). Recall that the
first appearance of VOC alpha occurred a few weeks before the sampling date of
the dataset in the United Kingdom. To summarize, 16 S-protein variants of VOC
omicron, 7 of VOC delta and all variants of VOC alpha were already present before
November 2020. The appearance of 10-variant combinations of markers of VOCs

delta and alpha is particularly significant and suggests the existence of massive viral
recruitment, perhaps mediated by recombination.
5.2 Haplotype size and coalescence

Results of our analyses reveal an apparent correlation between haplotype size, VOC
age and coalescence. VOC alpha emerged earlier than VOCs delta and omicron in
both Australia and the rest of the world (Fig. 1B). Half of the 24 variants of VOC
alpha coalesced into the largest known haplotype, haplotype 1. With the exception
of 3 variants, the rest coalesced into 4 additional haplotypes, 3 of which had accu-
mulation patterns that resembled those of the core. Conversely, 23 out of the 36 var-
iants of VOC delta coalesced into 7 haplotypes, the largest of which (haplotype 6)
had a substantially smaller number of markers than haplotype 1 of VOC alpha.
A total of 13 variants remained unlinked, suggesting a lower level of haplotype co-
alescence operating during the reign of VOC delta. VOC omicron originated very
recently. It involved recruitments of many VOC-specific markers that appeared quite
early in the pandemic (especially the N-protein variant P13L of haplotype 12). As
expected, the levels of coalescence of VOC omicron are the lowest of the three VOCs
judged by a non-unified constellation core of 6 haplotypes, the existence of 7 periph-
eral haplotypes, and 14 additional unlinked markers. In particular, the 28 markers of
the constellation core, which harbor quite distinct accumulation patterns (Fig. 4),
represent only about half of the 58 markers of VOC omicron in Australia. Thus, older
haplotypes are larger and exhibit higher levels of coalescence, assuming they have
not been completely replaced by incoming haplotypes of VOCs and are part of a
growing pool of viral genetic diversity.
5.3 Haplotypes and protein interactions

We have observed distinct groups of proteins that have been mutated in the different
VOCs. The core haplotypes of VOCs alpha and delta involved a diverse set of pro-
teins, while those of VOC omicron are now highly enriched in mutations affecting
the S-protein. Fig. 6 shows a network of SARS-CoV-2 proteins with links describing
their joint presence in haplotypes. Pie charts representing selected nodes of the net-
work describe how intramolecular interactions define haplotypes within individual
molecules. Since haplotypes typically arise by evolutionary constraints imposed on
protein-protein interactions, intramolecular interactions (e.g., allosteric interac-
tions), or indirectly through shared or linked functions, the network suggests how
the creation of mutant constellations contribute to the gradual enhancement of mo-
lecular interactions that benefit viral persistence. In the network, VOC alpha inter-
actions (lines colored in green in the graph) involving the spike and nucleocapsid
structural proteins were extended by interactions involving a number of nonstruc-
tural and accessory proteins in VOCs delta and omicron (lines in blue and red,
respectively). The central S-protein, N-protein and NSP3 protease connection
established via multiple markers of haplotype 1 in VOC alpha was atomized in
FIG. 6
A network of SARS-CoV-2 proteins mediated by haplotypes. Nodes are proteins and lines of
the graph are protein interaction expressed as joint protein presence in an haplotype. Pie
charts are nodes describing the relative number of haplotypes made up of only variants of that
protein in the mutant VOC constellations. Pie slices and lines of the graph corresponding to
VOC alpha, delta and omicron are colored green, blue and red, respectively.
the haplotypes of VOC delta but was later (and forcefully) regained in VOC omicron
through S-protein links to both N-protein (haplotype 12) and NSP3 (haplotype 14),
N-protein-specific haplotype 18, NSP3-specific haplotype 20, and 6 core haplotypes
with a multiplicity of S-protein markers. This solidification of the functionalities of
the spike, nucleocapsid and NSP3 papain protease in VOC omicron makes evident
their well-known centrality in viral transmissibility, disease severity, and immune
escape. The S-protein plays critical roles in viral attachment to host cells. Its highly
immunogenic properties and roles in transmissibility and virulence has made the
spike glycoprotein trimer a target for drug and vaccine mitigation (Harvey et al.,
2021). The N-protein, which packages the RNA genomes, is the most abundant viral
protein and is essential for replication, virion assembly, and regulation of the viral
life cycle (Bai, Cao, Liu, & Li, 2021). In addition, the two structural domains of
the N-protein are separated by an intrinsically disordered linker that is highly sensi-
tive to proteolysis and generates at least five proteoforms that bind structured RNA
(Lutomski, El-Baba, Bolla, & Robinson, 2021). This endows the N-protein with a
host of regulatory and immunogenic properties. Finally, the multidomain NSP3
papain-like protease acts on the viral polyproteins, interacts with other NSPs and
RNA to form the replication/transcription complex, antagonizes the host innate
immune response, and supports viral survival (Lei, Kusov, & Hilgenfeld, 2018).
The central role of these three proteins is enhanced in VOCs by an additional central
hub associated with authophagy, the NSP6 protein (Fig. 6). NSP6 has been shown to
induce autophagosome formation and NLRP3 inflammasomes, mediating caspase-1
activation and secretion of pro-inflammatory cytokines known to induce
inflammatory cell death (Cottam et al., 2011; Sun, Huang, Xu, & Hu, 2021). The
inflammasomes are multimeric sensor proteins that are critical components of the
innate immune system. However, their aberrant activation can cause serious disor-
ders, including cascades leading to the severe acute respiratory syndrome (SARS)
caused for example by SARS-CoV-2 (Rodrigues et al., 2021). The NSP6-specific
haplotype 4 of VOC alpha shows an early central role in this aberrant activation
of the innate immune system, which was later complemented by the delta-specific
core haplotype 6 and haplotype 9, which are linked to N-protein and ORF3a. Re-
markably, the ORF3a viroporin has been shown to inhibit autophagosome-lysosome
fusion by interacting with a protein of the homotypic fusion and protein sorting
(HOPS) complex (Zhang et al., 2021). This mechanism helps the virus escape deg-
radation. The central role of NSP6 continues in VOC omicron with markers of hap-
lotype 4, haplotype 15 and an extra free-standing NSP6 marker (Figs. 5 and 6), which
prompts evaluation of how VOC omicron mutations are softening aberrant immunity
activations.
The rise of VOC delta haplotypes appear to optimize interactions of the N-protein
with the M-protein and S-protein, and VOC omicron haplotypes similarly now
optimize interactions between the M-protein and both the E-protein and the
S-protein (Fig. 6). Intraviral interactions between these three structural proteins have
been reported to play essential roles in the viral life cycle (e.g., Artika, Dewantari, &
Wiyatno, 2020). They hijack the cellular network of the host. The central intrinsi-
cally disordered serine/arginine-rich spacer of the N-protein that separates its two
domains is vital for effective viral replication. The transmembrane M-protein consist
of an N-terminal ectodomain and a C-terminal endodomain. The endodomain inter-
acts with multiple regions of both the N-protein and S-protein for oligomerization,
RNA encapsulation and mature virus particle formation but also with the E-protein
through two transmembrane and the cytoplasmic domains (Hsieh, Li, Chen, & Lo,
2008). The interactions of the M-protein with the S-protein, E-protein and N-protein
of SARS-CoV-2 have been recently modeled using protein-protein docking and mo-
lecular dynamic simulation (Kumar, Kumar, Garg, & Giri, 2021). The M protein acts
as receptor, while the E-protein, N-protein and S-protein act as protein ligands. For
example, transient helices in the domains and linkers of the N-protein establish in-
teractions with a number of proteins, including the M-protein (Lu et al., 2021) and
NSP3 of the viral-replicase transcription complex (Hurst, Koetzner, & Masters,
2013). Clearly, the haplotype-mediated network of proteins shown in Fig. 6 makes
these interactions evident in VOC evolution.
5.4 VOC omicron haplotype variants cluster along the S-protein

sequence
Given the centrality of the spike in viral-host recognition and the enrichment of
S-protein variants in the mutant constellation of VOC omicron, we explored the lo-
cation of omicron-specific mutations along the sequence of the S-protein. We asked
if amino acid substitutions in haplotypes were clustered in domains along the
sequence. Remarkably, Fig. 7 shows haplotypes markers grouped around defined
FIG. 7
Mutations of the S-protein characteristic of VOC omicron cluster in groups according to
haplotype and are enriched in immune evasion functions associated with the RBD region. The
diagram maps mutations onto the different regions of the S-protein molecule from N-terminus
to C-terminus in the amino acid sequence, with markers specific to VOCs alpha and delta
indicated in the top and those specific for VOC omicron in the bottom. Clusters 1, 2 and 3
represent mutations arising from nucleotide substitutions at codon sites that are either
negatively selected or are evolving under no detectable selection in non-omicron sequences.
SP, signal peptide; NTD, N-terminal domain; RBD, receptor-binding domain; RBM, receptor-
binding motif; CS, cleavage site; FP, fusion peptide; IFP, internal fusion peptide; HR1, heptad
repeat 1; HR2, heptad repeat 2; TM, transmembrane domain.
regions of the S-protein. Most variants in haplotypes 3, 14 and 17 mapped to the

N-terminal domain (NTD) while those of haplotypes 13, 16 and 19 did so to the re-
ceptor binding domain (RBD). In particular mutations in the receptor-binding motif
(RBM) correspond to those of haplotype 13. Mutations affecting the S2 transmem-
brane subunit were part of haplotype 12. The 8 free-standing mutations (labeled in
black) mapped to other positions but were tightly associated with haplotypes. For
example, RBM-linked N501Y and S477N and markers of haplotype 13 had common
patterns in accumulation plots and were close in protein location (Fig. 5). Similarly,
H655Y and haplotype 12 were also similarly associated and so did K417N and hap-
lotype 19. Thus, markers coalesce into haplotypes following clustering patterns in
defined regions of the S-protein.
All mutations of VOC omicron are under gene-wide positive selection (Viana
et al., 2022). In a recent study, however, mutations in the S-protein amenable to nat-
ural selection analysis methods that focus on patterns of synonymous and non-
synonymous mutations (together with patterns of mutational convergence and
prevalence) revealed 13 mutations arising from nucleotide substitutions at codon

sites that were either negatively selected or were evolving under no detectable selec-
tion in non-omicron sequences (Martin et al., 2022). Mutations at these sites were
likely interacting with each other, were collectively adaptive, and may be imposing
functions typical of the VOC omicron viral population. Remarkably, these mutations
clustered into three distinct groups of epistatically-interacting substitutions, which
we highlight in Fig. 7. These clusters clearly correspond to haplotypes defined in
our study. Cluster 1 mutations, which affect the N-terminal region of RBD, are part
of haplotype 16. Cluster 2 mutations, which affect the RBM region of RBD, are part
of haplotype 13. Finally, cluster 3 mutations, which affect the fusion domain of the S2
subunit, are part of haplotype 12. Such congruence strengthens our conclusions.
5.5 Haplotypes follow the three phases of the COVID-19 pandemic

The timeline of clades and VOCs shows three successive phases driven by proteome
flexibility/rigidity, environmental sensing, and vaccine-driven immune escape
(Fig. 1). These proposed phases were based mostly on mutation bursts appearing
in the S-protein (Caetano-Anolles et al., 2022). We find that the development of
haplotypes with S-protein markers (Fig. 7) faithfully followed the phases of the time-
line (Fig. 1).
(i) VOC alpha appeared during the second phase of environmental sensing but
carried with it markers typical of protein flexibility/rigidity. It did so after
recruiting the D614G mutation of haplotype 5, which was already highly
prevalent during the first wave of the pandemic. In silico modeling and cryo-
EM-based conformational dynamic studies showed that D614G disturbed
neighboring hydrogen bonding interactions between the S1 and S2 subunits of
pairs of protomers of the spike and contacts with the fusion peptide (FP) region
(Korber et al., 2020; Xu et al., 2021). Population genetic analysis indicated that
D614G provided a selective advantage associated with higher viral loads and
younger age of patients (Voltz et al., 2021). Note that recruitment of Haplotype
5 was soon followed by haplotype 2, which impacted the intrinsically
disordered linker of the N-protein (Tomaszewski et al., 2020). Besides
recruiting these flexibility-associated haplotypes, VOC alpha developed two
main haplotypes affecting spike functionality. The core haplotype 1 involved
A570D, T716I, S982A and D1118H, all of them altering regions of increased
protein disorder (see Fig. 6B in Caetano-Anolles et al., 2022) in domains of the
C-terminal S2 subunit. In turn, haplotype 3 involved three deletions, H69del,
V70del, and Y144del, which were all located in the NTD region holding a
galectin-like structure associated with viral seasonality. The two free-standing
S-protein markers, N501Y and P681H were the first variants to impact the RBD
region responsible for binding ACE2 and other crucial ligands. The N501Y
marker makes up one of 6 key contact residues of RBD shown to increase both
ACE2 receptor affinity and infectivity and virulence (Starr et al., 2020).
The P681H marker alters one of 4 residues comprising the insertion that creates
the S1/S2 furin cleavage site between the S1 and S2 subunits (see Harvey et al.,
2021). All of these haplotypes and markers were later recruited by VOC
omicron, demonstrating their functional centrality.
(ii) VOC delta appeared during the beginning of the immune escape phase. Its
haplotypes did not retain mutations in the S-protein, except for D614G of
haplotype 5. Instead, it added a large number of mutations in other proteins. Only
two of its 6 haplotypes contained S-protein markers; haplotype 7 contained T19R
and D950N and haplotype 8 contained E156G, F157del and R158del. All of these
markers are located in the environmental sensing NTD region. Free-standing
markers were also NTD-enriched (T96I, G142D, A222V) but contained markers
in the immunogenic RBD region (T478K, L452R) and the furin cleavage site
(P681R). Some of these are the only markers shared with VOC omicron (Fig. 5)
(iii) VOC omicron is now displacing other VOCs at a worldwide level after
recruiting markers from VOC alpha rather than VOC delta and developing a
large marker constellation by haplotype coalescence. However, the massive
acquisition of mutations in the RBD region (with 3 haplotypes) is balanced by
mutations in the NTD and the S2 subunit regions, with 3 and 2 haplotypes,
respectively (Fig. 7). This indicates a significant commitment to immune
escape as we enter the endemic phase of COVID-19 prevalence.
6 Continental links to seasonality

Effective COVID-19 transmission appears restricted to a 30°N to 50°N latitude cor-
ridor in both the Northern and Southern Hemispheres (Caetano-Anolles et al., 2022).
Here we explore differences in mutation accumulation patterns of haplotypes and
free-standing markers that exist between regions of Australia that span different lat-
itudes, revealing a continental link to viral seasonal behavior. In our analysis, calen-
dar quarters are able to coarse-grain general patterns of prevalence. This feature
allows to visualize region-specific patterns. Because the Australian continent spans
a roughly 10°N to 45°N latitude corridor, we used a –34°S latitude transect to
dissect regions 1–4 that are closer to the Equator (from the Northern Territory to
New South Wales) from the colder and more southern regions 5–8 (from South
Australia to Tasmania). This transect separates the largest cities of Sydney and
Melbourne from each other. These cities have been major contributors to cases in
Australia, with Melbourne contributing to more deadlier outcomes.
6.1 Core haplotypes of VOCs reveal latitude-linked patterns

of seasonality
We first concentrated on core haplotypes of VOCs alpha, delta and omicron
(Fig. 8). We excluded haplotypes arising before the first appearance of VOCs, i.e.,
the D614G containing haplotype 5, which was recruited by all three VOCs, and the
FIG. 8
Patterns of mutation accumulation in core VOC haplotypes reveal seasonal behaviour.
N-protein-specific haplotype 2, which was recruited by VOCs alpha and omicron.

In the case of VOC delta we retained all six VOC-specific haplotypes and in the case
of VOC omicron we retained only the central 6-haplotype core. We then analyzed
mutant accumulation curves of all markers belonging to these haplotypes separately
for regions 1–4 and regions 4–8. To make differences explicit, we overlapped curves
of the four regions in each subset. We reasoned that if markers were tightly linked to
each other in an haplotype, curve overlaps would show minimum differences in ac-
cumulation between regions. Alternatively, if markers were decoupled then curves
would show idiosyncratic patterns. Remarkably, we found significant decoupling
patterns in the curves of regions 1–4, which lie outside of the seasonality-linked
30°N to 50°N latitude corridor.
In the case of VOC alpha (Fig. 8A), the incidence of markers in regions 1–4 was
highly variable, as showcased by the multiplicity of accumulation patterns (curves).
As an example, regions 1–4 displayed 12 distinct curves in quarters 1 and 2 of 2021,
while regions 5–8 displayed only 5. Haplotypes shared with VOC omicron (haplo-
types 3 and 4) unfolded between the third quarter of 2021 and the first quarter of 2022
significant variability in regions 1–4 (7 curves) compared to those of regions 5–8
(4 curves).
When considering haplotypes of VOC delta, the distinction between accumula-
tion patterns became significant (Fig. 8B). A focus on the second quarter of 2021
revealed 16 distinct curves for region 1–4 versus 14 curves for region 5–8. As the
prevalence of VOC delta decreased two calendar quarters later, 12 curves were
evident for regions 1–4 while 6 existed for regions 4–8. This suggests VOC delta
haplotypes show a pattern of increased coalescence in regions spanning the latitude
corridor of seasonality. Please note that VOC delta harbored relatively few markers
in the S-protein when compared to the other VOCs, suggesting seasonal patterns also
arise from multi-protein interactions.
Finally, the rise of VOC omicron again shows a clear distinction between corridor
and non-corridor regions (Fig. 7C). Note, however, the significant diversity of accu-
mulation patterns that exists below the 34°S latitude transect and the highly
coupled patterns above that latitude in colder regions of Australia. The distinction
is particularly relevant because of the many haplotypes that make up the VOC
omicron core.
6.2 Free-standing markers also support seasonal behavior in

Australia
The accumulation of the T95I, G142D and T478K free-standing markers of the
S-protein and the T492I marker of NSP4, all of which are shared by VOCs delta
and omicron, are particularly insightful (Fig. 9). Markers accumulated significantly
in regions 5–8 (especially in South Australia, Victoria and Tasmania) in the second
and third quarters of 2021 (winter) while significant accumulation in regions 1–4
were only evident in the fourth quarter of 2021, a time that coincided with the rise
of VOC omicron. Curiously, T95I started to accumulate earlier than the other
FIG. 9
Free-standing mutations shared by VOCs also show unexpected links to seasonality.
markers but at low prevalence levels (10% levels) in regions 1–4. We postulate all
these markers are sensor proteins recruited by VOCs delta and omicron. Their accu-
mulation support the genetic differences we detected between New South Wales and
Victoria in Fig. 2.
The temporal accumulation of the N501Y and P681H markers of the S-protein
that are shared by VOCs alpha and omicron was also interesting. Prevalence peaked
during the fourth quarter of 2020 reaching 60–100% levels in South Australia and
ACT, disappearing in the third quarter of 2021 and quickly increasing with the rise
of VOC omicron. Again, accumulation in regions 1–4 was in general lower, with the
exception of Queensland. Out of all 6 markers, T478K was the first to reach and
maintain 100% prevalence levels, doing so in the second quarter of 2021 at a time
VOC delta was just starting to accumulate in the planet. All of these rather noisy
patterns of accumulation suggest VOCs engaged in latitude-dependent recruitment
of markers that were already significantly present in the early viral population.
7 Discussion
A recent opinion article claims there is no “transparent” path of transmission linking
VOC omicron to its predecessors and no explanation for the unusual array of muta-
tions that appeared to have evolved outside scrutiny of researchers (Mallapaty,
2022). Indeed, VOC omicron was able to quickly develop a large constellation of
mutations affecting not only the S-protein but also many other proteins of functional
significance (Viana et al., 2022). Similarly, its appearance out of thin air was unan-
ticipated and puzzling. Our results, however, do show that many of VOC omicron
mutations were already present during the first year of the pandemic. They were
recruited piecemeal a year later to be part of a complex mutant constellation. In fact,
16 S-protein variants of VOC omicron, 7 of VOC delta, and all variants of VOC alpha
were already present before November 2020 forming for example combinations of
10 variants in a genome sequence. Some of these mutant combinations were present
in large numbers in the viral population that was sampled for sequencing. These re-
sults strongly support the existence of massive viral recruitments occurring already
during the first waves of the pandemic. The fact that we found that the molecular
profile of VOC omicron did not appear monolithically in different regions of
Australia also challenges two other theoretical explanations for the origin of VOC
omicron (Mallapaty, 2022), namely that all mutations evolved in one patient as part
of a long-term infection or that their emergence occurred unseen in other animal
hosts (e.g., rodents). These scenarios, which are more compatible with evolutionary
founder effects and super-spreader events are therefore unlikely.
VOC omicron was first detected by a genomic surveillance team in November
2021 after a resurgence of infections in the Gauteng Province of South Africa. By
mid-December, this new VOC was present in 87 countries in patterns that
suggested rapid transmission in regions with high levels of population immunity.
7 Discussion 259
Such fulminant appearance was tracked with a time-calibrated Bayesian phyloge-

netic analysis that placed the origin of the most recent common ancestor to October
9, 2021 and revealed that viral spread from the Gauteng province to other provinces
of South Africa occurred from late October to late November 2021 (Viana et al.,
2022). In these studies, selection and recombination analyses showed gene-wide pos-
itive selection and a possible single recombination event within the NTD region of
the spike occurring after the appearance of the three known VOC omicron lineages.
We note, however, that the maximum likelihood phylogenetic tree of Fig. 1A sug-
gests the origin of VOC omicron is associated with an ancestor that appeared much
earlier, perhaps dating back to mid-2020. Thus, earlier possible recombination
events are still demanding dissection. Similarly, the rise of the complex molecular
profile of VOC omicron and those of previous VOCs have not been explained.
For example, the S-protein profile of VOC omicron in Australia (Fig. 7) follows
the 37 mutations described by Viana et al. (2022) for the genomes of South Africa.
The match, however, does not address the very early and noisy appearance of the
individual mutations that make up the mutant constellation of VOC omicron in
the different regions of Australia as it was displacing the VOC delta constellation
in the last month of the last calendar quarter of 2021 (Figs. S1–S4 in Supplementary
information in the online version at https://doi.org/10.1016/bs.mim.2022.03.003).
Note that the first reports of VOC omicron in Australia occurred on November
28–29, 2021, yet prevalence of sequences and daily cases increased massively some
few weeks later (Fig. 1B) without reopening Australia’s international and regional
borders and under lockdowns, extensive contact tracing, and strong mandatory quar-
antine restrictions. How could this massive increase in prevalence occur in a country
with one of the highest vaccination rates and toughest restriction policies of the
planet? While some restrictions were lifted by the end of December 2021 following
Phase 3 of the National Transition plan, our plots reveal VOC omicron was already
overtaking the entire Australian viral pool. Was VOC omicron already present in
significant numbers in Australia before the first infection cases were reported in
South Africa?
An absence of clear evolutionary paths of transmission that could explain the
origin of VOCs suggest an “emergence” in mutational landscapes of viral evolu-
tion. Here we explore this possible theoretical scenario. To do so, we studied pat-
terns of mutation accumulation in regions of Australia, keeping only mutations
that fulfill a “relevance” filtering criterion of significant presence in the evolving
viral population. The mutations we identified and tracked matched profiles for the
most prevalent VOCs that appeared in Australia (Fig. 1B), i.e., VOCs alpha, delta
and omicron (Figs. S1–S4 in Supplementary information in the online version at
https://doi.org/10.1016/bs.mim.2022.03.003). We find that patterns of mutation
accumulation were remarkably conserved for sets of mutations, a hallmark of hap-
lotypes. This allowed to partition mutant constellations into haplotype groups and
free-standing markers of VOCs, which were then studied by construction of
haplotype networks.
7.1 Mutational landscapes of viral evolution

The SARS-CoV-2 genome is regarded as one of the most stable among positive-
strand RNA viruses due to its NSP14-mediated 30 -50 exoribonuclease proofreading
activities, which repair polymerase errors during RNA replication (Ogando et al.,
2020). However, the appearance of numerous variants, some of which jeopardize
vaccination performance and many of which coincide with convergently gained
spike mutations, has casted doubt on this notion of stability (Williams & Burgers,
2021). In fact, copying errors during viral replication combined with recombination,
genomic re-assortment, and host-induced editing (e.g., via host RNA deaminases)
push RNA viruses close to an “error threshold” of too many deleterious mutations
compromising their persistence (Domingo, Sheldon, & Perales, 2012). When muta-
tions of the “master” sequence combine with each other in the evolving viral pop-
ulation, this emerging “cloud” of variants defines a mutational landscape that the
viral “quasispecies” seeks to optimize (Caetano-Anolles et al., 2022). In doing so,
the viral population becomes “structured” by mutation accumulation. This structur-
ing has been recently documented in the United States (Tasakis et al., 2021) and
England (V€ ohringer et al., 2021).
Tasakis et al. (2021) examined 62,211 SARS-CoV-2 genomes sampled in the
United States from January 2020 through April 2021. The frequency of mutations
were compared between variants in 42 states, as well as those imported from other
countries. The study found mutations were accumulating in genomes and mutant
strains were converting to VOCs through a combination of genetic drift and selection
mediated by serial “super spreader” founder events in a sea of mutational bursts.
Unique variants circulating in year 2020 were divided into two groups, lineages
closely related to the parental Wuhan strain containing few variations, and descen-
dants of the European G-clade containing the D614G mutation of the spike. Such
variants likely arose due to single base substitutions that led to serial founder events.
The virus continued to evolve by accumulating mutations even after implementation
of public-wide vaccination in 2021. Mutational signature analysis also revealed an
increasing trend of amino acid mutations, which suggested a primary role of RNA
modifying enzymes in the generation of mutations. Fourteen of the most notable
missense mutations (mostly C > T) with a frequency of more than 10% were under
positive selection regimes (including T85I of NSP2, P323L of NSP12, D614G of the
S-protein and Q57H of the ORF3a viroporin). Finally, the gradual appearance of var-
iants between late 2020 and late March 2021, including more evolved strains of VOC
alpha, highlighted the need for a combination of strict containment as well as
vaccination approaches.
An epidemiological study in England conducted on 281,178 viral genome se-
quences collected from COVID-positive patients identified 328 PANGO lineages
distributed in 315 English local authorities between September 2020 and June
2021 (V€ ohringer et al., 2021). The highly-diverse lineages that were present in
the Fall of 2020 were followed by the massive sweeps of VOCs alpha and delta.
Remarkably, there was an observed pattern of sub-epidemic waves, each driven
7 Discussion 261
by new mutations, especially in the S-protein. For example, after the initial emergence
of the virus, the second wave was predominantly led by two sublineages, B.1 and
B.1.1, and interestingly, its prevalence pattern was geographically diverse with higher
rates of prevalence observed in the North of England compared to the South. Similarly,
the third wave was driven by VOC alpha. With every new epidemic wave, a new
lineage and mutations came to the forefront, which helped the virus escape previous
immunity. A number of refractory variants containing the E484K mutation of the
S-protein (including VOCs beta, gamma, eta, iota and zeta) followed the demise of
VOC alpha and preceded the rise of VOCs kappa and delta. These lineages introduced
a number of new mutations, which were then replaced by the VOC delta constellation.
Both studies suggest that the SARS-CoV-2 genome is evolving dynamically,
with bursts of mutation accumulation followed by sweeps. Patterns of sub-epidemic
waves and the rise of VOCs suggest major global shifts in the selective landscape and
possible convergence between lineages (Martin et al., 2022). In addition, the viral
genome appears to undergo evolutionary change in response to its host, even under
implementation of selective pressures such as vaccination. Mutational changes are
particularly exacerbated when super spreader events drive infrequent mutations to
prominence (Choi et al., 2020).
Our analysis of SARS-CoV-2 genomes in Australia is in line with findings for the
United States and England. Mutations accumulated in bursts while haplotypes were
generated in waves. Two haplotypes were the first to accumulate during the initial
wave of the pandemic early in 2020, haplotype 5 (involving the S-protein and
NSP12) and haplotype 2 (involving the N-protein). The rise of VOC alpha early
in 2021 took advantage of these two haplotypes but also generated an additional
three, haplotype 1 (involving the S-protein, N-protein, ORF8 and NSP3), haplotype
3 (involving the S-protein) and haplotype 4 (involving NSP6). The rise of VOC delta
mid-2021 displaced most markers of VOC alpha but retained haplotype 5. Instead it
generated 6 additional haplotypes of its own, which were highly enriched in markers
of the S-protein. Remarkably, the arrival of VOC omicron at the end of 2021 dis-
placed most markers from VOC delta but retained haplotype 5, recruited the van-
ished haplotypes 2, 3 and 4 and two free-standing S-protein markers of VOC
alpha, and 3 S-protein markers and one NSP4 marker from VOC delta. The three suc-
cessive waves involved 24, 35 and 59 markers, showcasing the gradual structuring of
the mutational landscape of the viral population.
7.2 VOC emergence by haplotype coalescence

Our survey explores the rise of mutant constellations in Australia. We find constel-
lations are made up of haplotypes and free-standing markers. The existence of an
haplotype implies for example that evolutionary constraints are acting on intramo-
lecular and intermolecular interactions. Collectively, these constraints are impacting
the physiologies of the viral life cycle. Mutation accumulation plots show that many
of these interactions do not rise monolithically. Instead, there is significant variation
in the timing of appearance and accumulation of haplotype markers in the different
regions of Australia. This suggests there is a global emergence process that depends
on the regional environment and is developing independently of selective sweeps.
To illustrate, Fig. 3A shows the noisy appearance of the two amino acid variants
of haplotype 5, the oldest and most stable haplotype. Markers did not accumulate
uniformly in the different regions as their prevalence was approaching 100%. They
did so idiosyncratically as shown by accumulation curves for the two N-protein
markers of haplotype 2 (Fig. 3B) Their fate was more haphazard and never reached
100% prevalence levels in regions closer to the Equator. In contrast, other haplotypes
did not decouple but showed distinct accumulation patterns in the different regions
(e.g., haplotype 1 of VOC alpha; Fig. 4A).
The atomization of mutant constellations into haplotypes was unanticipated and
shows VOCs are highly dynamic entities that are capable of adding and eliminating
markers from their individual makeup. However, there is some structure to the as-
sembly of haplotypes. When there is no recombination or rearrangement, haplotype
structure reflects the age distribution of mutations in an evolving phylogenetic tree of
viral variants. In the presence of horizontal processes of genetic exchange, every se-
quence site that is subject to mutation can follow a tree but site-specific trees must be
reconciled. In other words, horizontal exchange shuffles genetic variation. This com-
plicates standard views of population genetics, such as forward-in-time evolution of
allele frequencies and backward-in-time genealogical models. One example is the
duality between the Wright-Fisher diffusion for genetic drift and its genealogical
counterpart, the coalescent, which has been only recently modeled to incorporate
the effects of recombination (Griffiths, Jenkins, & Lessard, 2016). Here, an ancestral
recombination graph must be reconciled with genetic drift by diffusion in a land-
scape of mutations in an attempt to explain how ancestral genetic material is dis-
persed across ancestors of a contemporary population. In the case of VOCs of a
viral quasispecies, we have little understanding of these processes. Instead, we
can define haplotypes experimentally by detecting congruent patterns of accumula-
tion of their markers. Patterns that are similar suggest a “coalescence” of haplotypes
or free-standing markers into a same regional behavior. We exploit this coalescence
in an “haplotype graph” that describes how haplotypes share markers and similarities
in patterns of accumulation across regions of Australia (Fig. 5). Three clear sub-
graphs describing the three major VOCs that appeared in Australia are unified by
the universally present haplotype 5 that contains the D614G marker of the spike.
Other haplotypes and free-standing markers also unify VOC makeup. Haplotype
coalescence is described by core haplotypes acting as hubs.
7.3 Haplotypes and seasonal behavior

Beta-coronaviruses, including SARS-CoV-2, are considered “winter viruses” be-
cause of their high transmission rates in the winter season. Winter viruses include
the influenza virus (Tamerius et al., 2011), norovirus (Martinez, 2018), and common
cold viruses (Eccles, 2005), all of which display the highest incidence rates during
wintertime (Nickbakhsh et al., 2020). Transmission patterns in these seasonal viruses
7 Discussion 263
depend strongly on environmental factors, host susceptibility, and the type and level
of immune response that the host mounts against viral infection. Direct and indirect
contact play a significant role in transmission of respiratory viruses. Airborne trans-
mission for example is greatly affected by susceptibility, weather, temperature,
topography, and air quality, all of which contribute to seasonal behavior (Pica &
Bouvier, 2012). In addition, the host’s environment (e.g., time spent indoors), host
defense (e.g., impaired mucociliary clearance through cold and dry air inhalation),
and changes in viral infectability and stability along with climatic conditions are
known to impact the seasonal behavior of respiratory viruses (Tamerius et al.,
2011). Viral transmissibility can also be very high during initial stages of an epi-
demic due to lower immunity, and environmental factors cannot stop transmission
at times (Grenfell & Bjørnstad, 2005). In the case of the influenza virus, temperature
and relative humidity have the greatest impact on seasonality (Lowen, Mubareka,
Steel, & Palese, 2007; Pica & Bouvier, 2012).
The effect of seasonal variations on the transmissibility of SARS-CoV-2 has
become a topic of great interest (Kissler, Tedijanto, Goldstein, Grad, & Lipsitch,
2020). Seasonality warrants attention because it could assist in formulating informed
actionable responses to the COVID-19 pandemic. Emerging evidence suggests that
an association exists between seasonal variations and the survival and transmissibil-
ity of SARS-CoV-2, with higher latitude, colder temperatures, and lower humidity
levels being associated with higher incidence of COVID-19 (Burra et al., 2021; Liu
et al., 2021; Sajadi et al., 2020). Considering the structure of SARS-CoV-2, it is log-
ical that the virus could be sensitive to environmental conditions. The viral capsid
that encases the proteins and genetic material is surrounded by a lipid bilayer
likely to be affected by environmental conditions like temperature and humidity
(Moriyama, Hugentobler, & Iwasaki, 2020). In fact, our research suggests that the
seasonality of COVID-19 can be explained by the presence of a galectin-like struc-
ture in the NTP region of the S1 subunit of the spike protein (Caetano-Anolles et al.,
2022). The NTD, together with the RBD region, facilitates the viral attachment to
cells by recognizing and binding to sugars and other receptors of the host cell
(Pourrajab, 2021). Galectins are a family of evolutionarily conserved effector pro-
teins that regulate a wide range of biological processes including pre-mRNA splicing
and various kinds of cellular interactions, as well as pathogen recognition and in-
flammatory responses (Dings, Miller, Griffin, & Mayo, 2018). These diverse roles
appear to mostly involve binding to the carbohydrate moieties of glycoconjugates
present on the surface of cells (Caetano-Anolles et al., 2022). The presence of cel-
lular structures similar to galectins in the viral spike protein suggests they play a role
in helping SARS-CoV-2 attach to host cells by using the same carbohydrate recep-
tors used by galectins when evading host immune responses (possibly by masking
itself from host galectins; Pourrajab, 2021). Such hypotheses about the role of these
galectin like structures in SARS-CoV-2 have been corroborated by findings on the
administration of SARS-Cov-2 galectin like inhibitors, which reportedly decrease
SARS-CoV-2 loads in patients (Sethi, Sanam, Munagalasetty, Jayanthi, & Alvala,
2020). Remarkably, a relationship between temperature shifts and the activity of
galectins in clearance of pathogens of “cauliflower” corals (Pocillopora damicor-

nis), which is necessary to establish a healthy symbiosis with dinoflagellates, was
recently established (Wu et al., 2019). Lower temperatures were associated with in-
creased pathogen survival. On the other hand, increased temperatures enhanced host
cells galectin-mediated pathogen recognition and clearance with the activity reach-
ing a maximum at the temperatures between 25 °C and 30 °C. We found a similar
association between galectin activity and temperature in SARS-CoV-2 (Caetano-
Anolles et al., 2022). It appears galectin-like structures significantly impact the
seasonal behavior of SARS-CoV-2 and need to be further investigated.
The spike appears not the only protein mediating seasonal behavior in SARS-
CoV-2. Our analysis revealed latitude-dependent differences in mutation accumula-
tion patterns of haplotypes and free-standing markers. These differences involved
markers affecting a wide range of proteins. When focusing on core haplotypes of
VOCs, we detected significant diversity of accumulation patterns below a 34°S lat-
itude transect and highly coupled patterns at higher (and colder) latitudes of Australia
(Fig. 8). The core haplotype of VOC alpha involved 4 proteins, the 6 haplotypes of
VOC delta involved 12 proteins, and the 6 haplotypes of the core VOC omicron in-
volved 7 proteins, all of which included a range of structural, accessory and non-
structural proteins. Similarly, a focus on free-standing markers shared by VOCs
revealed noisy patterns of accumulation suggestive of latitude-dependent recruit-
ment of markers (Fig. 9). As with haplotypes, free-standing markers involved a range
of 9 structural, accessory and non-structural proteins. While the S-protein was part
of these mutant constellations, VOC alpha was enriched in mutants affecting regions
that modulate flexibility/rigidity of the spike (including mutations in the C-terminal
S2 subunit and the furin site), VOC delta was enriched in mutants altering the
environment-sensing NTD region but also contained markers in the immunogenic
RBD region, and now, VOC omicron is recruiting mutations in the RBD region nec-
essary for immune evasion but at the same time balanced by mutations in the NTD
and the S2 subunit regions. This progression mirrors the three successive phases of
the pandemic we previously proposed: flexibility/rigidity, environmental sensing,
and vaccine-driven immune escape (Caetano-Anolles et al., 2022).
7.4 Conclusions
Recent analyses of accumulating genome sequence data suggest that the SARS-CoV-2
virus is evolving in bursts while developing with each new VOC an increasing con-
stellation of mutations. This indicates that the virus is furthering persistence by adapt-
ing to the external environment and to the physiology and behavior of its human hosts
(Caetano-Anolles et al., 2022). Although most of the mutations are evolutionarily neu-
tral, VOC markers are under strong positive selection and their haplotype structure
suggest this is occurring by fostering beneficial intramolecular and/or intermolecular
interactions. A rate of 25 amino acid substitutions per year has been reported (esti-
mated with a molecular clock) and the latest VOC omicron shows at least 37 mutations
in the spike protein alone (Cameroni et al., 2021; V€ohringer et al., 2021). The increase
References 265
in immune host populations by vaccination and treatments may lead to increasing

immune evasion strategies. This is already evident in the large number of mutants tar-
geting the immunogenic regions of the spike protein (Fig. 7). This highlights the need
for genomic surveillance in different geographic locations of the world to better
understand viral adaptation, mutational patterns, the rise of viral sub-lineages, and
transmission.
Our study finds there is a rationale behind the emergence of VOCs in Australia.
The noisy rise of haplotypes by molecular optimization involves a coalescence into
monolithic constellations that are only decoupled by seasonal behavior. Thus, viral
evolution is tailored by the seasonal periodicities of the planet that arise from
Earth’s tilted axis relative to the plane of its orbit. We will soon expect an endemic
COVID-19 with outbreaks moving across the Earth every year along a sinuous curve
parallel to the “midsummer” curve of solar radiation. Such behavior will follow pat-
terns not far away from those of influenza (Deyle, Maher, Hernandez, Basu, &
Sugihara, 2016; Hope-Simpson, 1981).
References
Artika, I. M., Dewantari, A. K., & Wiyatno, A. (2020). Molecular biology of coronaviruses:
Current knowledge. Heliyon, 6(8), e04743.
Bai, Z., Cao, Y., Liu, W., & Li, J. (2021). The SARS-CoV-2 nucleocapsidprotein and its role in
viral structure, biological functions, and a potential target for drug or vaccine mitigation.
Viruses, 13, 1115.
Becerra-Flores, M., & Cardozo, T. (2020). SARS-CoV-2 viral spike G614 mutation exhibits
higher case fatality rate. International Journal of Clinical Practice, 74, e13525.
Burra, P., Soto-Dı́az, K., Chalen, I., Gonzalez-Ricon, R. J., Istanto, D., & Caetano-Anolles, G.
(2021). Temperature and latitude correlate with SARS-CoV-2 epidemiological variables but
not with genomic change worldwide. Evolutionary Bioinformatics, 19. 1176934321989695.
Caetano-Anolles, K., Hernandez, N., Mughal, F., Tomaszewski, T., & Caetano-Anolles, G.
(2022). The seasonal behaviour of COVID-19 and its galectin-like culprit of the viral
spike. Methods in Microbiology, 50, 27–81. https://doi.org/10.1016/bs.mim.2021.10.002.
Cameroni, E., Bowen, J. E., Rosen, L. E., Saliba, C., Zepeda, S. K., et al. (2021). Broadly neu-
tralizing antibodies overcome SARS-CoV-2 omicron antigenic shift. Nature, 602,
664–670.
Campbell, F., Archer, B., Laurenson-Schafer, H., Jinnai, Y., Konings, F., et al. (2021). In-
creased transmissibility and global spread of SARS-CoV-2 variants of concern as at
2021. Euro Surveillance, 26(24), 2100509.
Caswell, T. A., Droettboom, M., Lee, A., et al. (2021). Matplotlib/Matplotlib, v3.5.1. Zenodo.
https://doi.org/10.5281/zenodo.5773480.
Choi, B., Choudhary, M. C., Regan, J., Sparks, J. A., Padera, R. F., et al. (2020). Persistence
and evolution of SARS-CoV-2 in an immunocompromised host. New England Journal of
Medicine, 383(23), 2291–2293.
Cottam, E. M., Maier, H. J., Manifava, M., Vaux, L. C., Chandra-Schoenfelder, P., et al.
(2011). Coronavirus nsp6 proteins generate autophagosomes from the endoplasmic
reticulum via an omegasome intermediate. Autophagy, 7, 1335–1347.
Davies, N. G., Abbott, S., Barnard, R. C., Jarvis, C. I., Kucharski, A. J., et al. (2021). Estimated
transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England. Science,
372(6538). eabg3055.
Deyle, E. R., Maher, M. C., Hernandez, R. D., Basu, S., & Sugihara, G. (2016). Global
environmental drivers of influenza. Proceedings of the National Academy of Science of
the USA, 113, 13081–13086.
Dings, R. P., Miller, M. C., Griffin, R. J., & Mayo, K. H. (2018). Galectins as molecular targets
for therapeutic intervention. International Journal of Molecular Sciences, 19(3), 905.
Domingo, E., Sheldon, J., & Perales, C. (2012). Viral quasispecies evolution. Microbiology
and Molecular Biology Reviews, 76, 159–216.
Eccles, R. (2005). Understanding the symptoms of the common cold and influenza. The Lancet
Infectious Diseases, 5(11), 718–725.
Elbe, S., & Buckland-Merrett, G. (2017). Data, disease and diplomacy: GISAID’s innovative
contribution to global health. Global Challenges, 1, 33–46.
Grenfell, B., & Bjørnstad, O. (2005). Epidemic cycling and immunity. Nature, 433(7024),
366–367.
Griffiths, R. C., Jenkins, P. A., & Lessard, S. (2016). A coalescent dual processes for a Wright-
fisher diffusion with recombination and its application to haplotype partitioning. Theoretical
Population Biology, 112, 126–138.
Harvey, W. T., Carabelli, A. M., Jackson, B., Gupta, R. K., Thomson, E. C., et al. (2021).
SARS-CoV-2 variants, spike mutations and immune escape. Nature Reviews Microbiol-
ogy, 19, 409–424.
Hodcroft, E. B., Hadfield, J., Neher, R. A., & Bedford, T. (2020). Year-letter genetic clade
naming for SARS-CoV-2 on Nextstrain.org. Nextstrain. https://nextstrain.org/blog/
2020-06-02-SARSCoV2-clade-naming.
Hope-Simpson, R. E. (1981). The role of season in the epidemiology of influenza. Journal of
Hygiene (London), 86(1), 35–47.
Hsieh, Y.-C., Li, H.-C., Chen, S.-C., & Lo, S.-Y. (2008). Interactions between M protein and
other structural proteins of severe, acute respiratory syndrome-associated coronavirus.
Journal of Biomedical Science, 15(6), 707–717.
Hunter, J. D. (2007). Matplotlib: A 2D graphics environment. Computing in Science &
Engineering, 9(3), 90–95.
Hurst, K. R., Koetzner, C. A., & Masters, P. S. (2013). Characterization of a critical interaction
between the coronavirus nucleocapsid protein and nonstructural protein 3 of the viral
replicase-transcriptase complex. Journal of Virology, 87, 9159–9172.
Khare, S., Gurry, C., Freitas, L., Schultz, M. B., Bach, G., et al. (2021). GISAID’s role in
pandemic response. CCDC Weekly, 3(49), 1049–1051.
Kissler, S. M., Tedijanto, C., Goldstein, E., Grad, Y. H., & Lipsitch, M. (2020). Projecting the
transmission dynamics of SARS-CoV-2 through the postpandemic period. Science,
368(6493), 860–868.
Korber, B., Fischer, W. M., Gnanakaran, S., Yoon, H., Theiler, J., et al. (2020). Tracking
changes in SARS-CoV-2 spike: Evidence that D614G increases infectivity of the
COVID-19 virus. Cell, 182, 812–827.
Kumar, P., Kumar, A., Garg, N., & Giri, R. (2021). An insight into SARS-CoV-2 membrane
protein interaction with spike, envelope, and nucleocapsid proteins. Journal of Biomolec-
ular Structure and Dynamics. https://doi.org/10.1080/07391102.2021.2016490.
Lauring, A. S., & Hodcroft, E. B. (2021). Genetic variants of SARS-CoV-2—What do they
mean? JAMA, 325(6), 529–531. https://doi.org/10.1001/jama.2020.27124.
References 267
Lei, J., Kusov, Y., & Hilgenfeld, R. (2018). NSP3 of coronaviruses: Structures and functions of
a large multi-domain protein. Antiviral Research, 149, 58–74.
Liu, X., Huang, J., Li, C., Zhao, Y., Wang, D., Huang, Z., et al. (2021). The role of seasonality
in the spread of COVID-19 pandemic. Environmental Research, 195, 110874.
Lowen, A. C., Mubareka, S., Steel, J., & Palese, P. (2007). Influenza virus transmission is
dependent on relative humidity and temperature. PLoS Pathogens, 3(10), e151.
Lu, S., Ye, Q., Singh, D., Cao, Y., Diedrich, J. K., et al. (2021). The SARS-CoV-2 Nucleocapsid
phosphoprotein forms mutually exclusive condensates with RNA and the membrane-
associated M protein. Nature Communications, 12, 502.
Lutomski, C. A., El-Baba, T. J., Bolla, J. R., & Robinson, C. V. (2021). Multiple roles of
SARS-CoV-2 N protein facilitated by proteoform-specific interactions with RNA, host
proteins, and convalescent antibodies. JACS Au, 1, 1147–1157.
Mallapaty, S. (2022). The hunt for the origins of omicron. Nature, 602, 26–27.
Martin, D. P., Lytras, S., Lucaci, A. G., Maier, W., Gr€ uning, B., et al. (2022). Selection
analysis identifies unsusual clustered mutational changes in omicron lineage BA.1 that
likely impact spike function. bioRxiv. https://www.biorxiv.org/content/10.1101/2022.
01.14.476382v1.
Martinez, M. E. (2018). The calendar of epidemics: Seasonal cycles of infectious diseases.
McKinney, W. (2010). Data structures for statistical computing in Python. In S. van der
Walt, & J. Millman (Eds.), Proceedings of the 9th Python in science conference (pp.
56–61).
Moriyama, M., Hugentobler, W. J., & Iwasaki, A. (2020). Seasonality of respiratory viral in-
fections. Annual Review of Virology, 7, 83–101.
Nickbakhsh, S., Ho, A., Marques, D. F., McMenamin, J., Gunson, R. N., & Murcia, P. R.
(2020). Epidemiology of seasonal coronaviruses: Establishing the context for the
emergence of coronavirus disease 2019. The Journal of Infectious Diseases, 222(1),
17–25.
Ogando, N. S., Zevenhoven-Dobbe, J. C., Meer, Y. V. D., Bredenbeek, P. J., Posthuma, C. C.,
Snijder, E. J., et al. (2020). The enzymatic activity of the nsp14 exoribonuclease is critical
for replication of MERS-CoV and SARS-CoV-2. Journal of Virology, 94(23).
e01246–01220.
Pandas Development Team. (2022). Pandas-dev/pandas: Pandas 1.1.5. Zenodo. https://doi.
org/10.5281/zenodo.5893288.
Pica, N., & Bouvier, N. M. (2012). Environmental factors affecting the transmission of
respiratory viruses. Current Opinion in Virology, 2(1), 90–95.
Pourrajab, F. (2021). Targeting the glycans: A paradigm for host-targeted and COVID-19 drug
design. Journal of Cellular and Molecular Medicine, 25(13), 5842–5856.
Rambault, A., Holmes, E. C., O’Toole, A., Hill, V., McCrone, J. T., Ruis, C., et al. (2020).
A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemi-
ology. Nature Microbiology, 5, 1403–1407.
Rodrigues, T. S., de Sá, K. S. G., Ishimoto, A. Y., Becerra, A., Oliveira, S., et al. (2021).
Inflammasomes are activated in response to SARS-CoV-2 infection and are associated
with COVID-19 severity in patients. Journal of Experimental Medicine, 218, e20201707.
Sajadi, M. M., Habibzadeh, P., Vintzileos, A., Shokouhi, S., Miralles-Wilhelm, F., &
Amoroso, A. (2020). Temperature, humidity, and latitude analysis to estimate potential
spread and seasonality of coronavirus disease 2019 (COVID-19). JAMA Network Open,
3, e2011834.
Sethi, A., Sanam, S., Munagalasetty, S., Jayanthi, S., & Alvala, M. (2020). Understanding the
role of galectin inhibitors as potential candidates for SARS-CoV-2 spike protein: In silico
studies. RSC Advances, 10(50), 29873–29884.
Showers, W. M., Leach, S. M., Kechris, K., & Strong, M. (2022). Analysis of SARS-CoV-2
mutations over time reveals increasing prevalence of variants in the spike protein and
RNA-dependent RNA polymerase. Infection, Genetics and Evolution, 97, 105153.
Shu, Y., & McCauley, J. (2017). GISAID: Global initiative on sharing all influenza data –
From vision to reality. Eurosurveillance, 22(13), 30494.
Starr, T. N., Greaney, A. J., Hilton, S. K., Ellis, D., Crawford, K. H. D., Dingens, A. S., et al.
(2020). Deep mutational scanning of SARS-CoV-2 receptor binding domain reveals
constraints on folding and ACE2 binding. Cell, 5, 1295–1310.
Sun, X., Huang, Z., Xu, W., & Hu, W., et al. (2021). SARS-CoV-2 non-strucural protein
6 triggers LRRP3-dependent pyroptosis by targeting TP6AP1. Cell Death & Differentia-
tion. https://doi.org/10.1038/s41418-021-00916-7.
Tamerius, J., Nelson, M. I., Zhou, S. Z., Viboud, C., Miller, M. A., & Alonso, W. J. (2011).
Global influenza seasonality: Reconciling patterns across temperate and tropical regions.
Environmental Health Perspectives, 119(4), 439–445.
Tasakis, R. N., Samaras, G., Jamison, A., Lee, M., Paulus, A., et al. (2021). SARS-CoV-2 var-
iant evolution in the United States: High accumulation of viral mutations over time likely
through serial founder events and mutational bursts. bioRxiv. https://doi.org/10.1371/jour-
nal.pone.0255169.
Tomaszewski, T., DeVriers, R. S., Dong, M., Bhatia, G., Norsworthy, M. D., Zheng, X., et al.
(2020). New pathways of mutational change in SARS-CoV-2 proteomes involve regions
of intrinsic disorder important for virus replication and release. Evolutionary Bioinformat-
ics, 16. 1176934320965149.
Viana, R., Moyo, S., Amoako, D. G., Tegally, H., Scheepers, C., et al. (2022). Rapid epidemic
expansion of the SARS-CoV-2 omicron variant in southern Africa. Nature. https://doi.org/
10.1038/s41586-022-04411-y.
V€ohringer, H. S., Sanderson, T., Sinnott, M., De Maio, N., Nguyen, T., et al. (2021). Genomic
reconstruction of the SARS-CoV-2 epidemic in England. Nature, 600(7889), 506–511.
Voltz, E., Hill, V., McCrone, J. T., Proce, A., Jorgensen, D., et al. (2021). Evaluating the
effects of SARS-CoV-2 spike mutation D614G on transmissibility and pathogencity. Cell,
184(1), 64–75.
Williams, T. C., & Burgers, W. A. (2021). SARS-CoV-2 evolution and vaccines: Cause for
concern? The Lancet Respiratory Medicine, 9(4), 333–335.
Wu, Y., Zhou, Z., Wang, J., Luo, J., Wang, L., & Zhang, Y. (2019). Temperature regulates the
recognition activities of a galectin to pathogen and symbiont in the scleractinian coral
Pocillopora damicornis. Developmental & Comparative Immunology, 96, 103–110.
Xu, C., Wang, Y., Liu, C., Zhang, C., Han, W., Hong, X., et al. (2021). Conformational
dynamics of SARS-CoV-2 trimeric spike glycoprotein in complex with receptor ACE2
revealed by cryo-EM. Science Advances, 7(1). eabe5575.
Zhang, Y., Sun, H., Pei, R., Mao, B., Zhao, Z., & Li, H., et al. (2021). The SARS-CoV-2 pro-
tein ORF3a inhibits fusion of autophagosomes with lysosomes. Cell Discovery, 7, 31.
CHAPTER
COVID-19 vaccines
for high risk and
immunocompromised
patients
9
Charles S. Paviaa,b,* and Maria M. Plummerc
a
Department of Biomedical Sciences, NYIT College of Osteopathic Medicine,
New York Institute of Technology, Old Westbury, NY, United States
b
Division of Infectious Diseases, New York Medical College, Valhalla, NY, United States
c
Department of Clinical Specialties, Division of Pathology, NYIT College of Osteopathic Medicine,
New York Institute of Technology, Old Westbury, NY, United States
1 Introduction
The COVID-19 pandemic has had a major negative impact on public health and its
worldwide infrastructure and resources. Perhaps the most recognized devastating
outcomes of this crisis are the high rates of morbidity and mortality, and the toll
it has taken on people who have underlying co-morbidities or risk factors (Garg
et al., 2020). Among these, include groups within the general population who are
diabetic (Garg et al., 2020; Gao et al., 2020), obese (de Frel et al., 2020), elderly
(Centers for Disease Control and Prevention, 2021), and possibly immunocom-
promised (Kates et al., 2020; Office of the AIDS Research Advisory Council,
2021), especially people who are infected with the human immunodeficiency virus
(HIV) and who subsequently progress to developing acquired immunodeficiency
disease (AIDS) (Office of the AIDS Research Advisory Council, 2021). Many of
these well-characterized victims have a more severe course of COVID-19, leading
to increased numbers of hospitalized patients and deaths relative to the percentages
occurring in people having little or no pre-conditions (Garg et al., 2020), although,
as will be discussed later on, the pattern in the HIV/AIDS group has been reported
to be less clear and inconsistent (Office of the AIDS Research Advisory Council,
2021). Also included in this latter group having immune defects are transplant
recipients, cancer patients and autoimmune cases where an immunocompromised
or hyperimmune condition leads to intense treatment with certain medications that
adversely affect various components of the immune system. The key reasons why
269
270 CHAPTER 9 COVID-19 vaccines for high risk and immunocompromised
patients
Table 1 Immune defect-related conditions/host factors potentially putting

people at greater risk for a negative outcome due to COVID-19 and their status
as potential vaccinees.
Defect or Candidate for
host a COVID-19
condition Cause or mechanisms vaccine
HIV HIV-mediated gradual killing of CD4 + T cells Yesa

infection/AIDS
Type 2 Hyperglycaemia interferes with killing by phagocytic Yes
diabetes cells
Obesity Adaptive immune system dysfunction; slight Yes
lymphopenia and poor regulation of ACE2 receptor
Aging Immunologic “memory” tends to decline with age Yes
Cancer Chemotherapy or immune checkpoint inhibitors Yesb
interfere with various immune functions
Organ Immunosuppressive drugs used to prevent rejection Yesb
transplant of the transplant also interfere with various immune
functions
Autoimmune Treating with anti-inflammatory agents and/or Yesb
disorder immune modulators interferes with various immune
functions
a
Humoral immunity may be weakened in some patients due to severely reduced numbers of potentially
reactive T cells needed to assist B cells to differentiate into antibody-producing plasma cells; activation of
cell-mediated immunity (in the form of cytotoxic T cells) directed against many pathogens is also severely
depressed; vaccine recipients may require multiple boosters.
b
Immune response impairment is somewhat similar to HIV-infected patients but the loss of activated
T cells is less severe, possibly making the need for multiple boosters not as frequent or less likely.
high-risk factors lead to increased susceptibility to COVID-19 are summarized in

Table 1, and are similar to the role they play in the pathogenesis of various other
infections. Fortunately, several different types of vaccines are now available that
can be used to protect these susceptible patients from developing serious, life-
threatening disease due to the etiologic agent of COVID-19, SARS-CoV-2. In this
regard, this chapter focuses on some of the subtle nuances and challenges that
COVID-19 vaccines play in protecting people who are at the greatest risk for devel-
oping serious illness using HIV/AIDS as the primary example.
2 Development of COVID-19 vaccines

The speed with which safe and effective vaccines have been developed to prevent
COVID-19 has been nothing short of being extraordinary and perhaps even beyond
original expectations. In just about a few months after the pandemic became recog-
nized as an almost unparalleled global catastrophe and a sense of urgency had crept
into the picture, potential vaccines were produced by several manufacturers and
became available for testing. This outcome is a testament to the hard work and
diligence of the research community and pharmaceutical industry in cooperating
2 Development of COVID-19 vaccines 271
in this venture, along with the huge response of the general population willing to
participate in clinical trials that were needed to verify the worthiness of these vac-
cines. Even many of the recognized medical/scientific “experts” had predicted that
vaccines would likely not be available for routine use for about 1.5–2 years after the
initiation of experiments in trying to develop them. Certainly, in the back of many
minds was the gloomy feeling that it may even take much longer given the relative
lack of success, after much effort and a large amount of funds had already been
invested, over a span of many years, in trying to develop highly effective vaccines
for malaria, HIV infection and EBOLA virus disease (EVD)—diseases having high
rates of morbidity and mortality (similar outcomes to COVID-19), but which have
been known and well characterized for well over a century (for malaria) and for
nearly a half century (for HIV infection and EVD). On the other hand, the annual
development of vaccines to combat influenza (aka “the flu”) caused by the genetic
variants of the influenza virus did offer encouragement that an effective COVID-19
vaccine could be produced within a relatively short period of time.
In the United States, as of November 2021, two types of anti-COVID-19 vaccines
are in use and available to everyone from ages 5 and above. For several months prior
to this, only people >11 years of age were eligible to receive any one of these vac-
cines based on authorizations made by the U. S. Food and Drug Administration
(FDA) followed by recommendations from the Centers for Disease Control and Pre-
vention (CDC). One type of vaccine consists of purified messenger RNA (mRNA)
given in two intramuscular injections with the 2nd injection given 3–4 weeks after
the first one. In October, 2021, an additional booster injection was recommended by
the FDA and the CDC for those recipients who completed their initial series at least
6 months previously and who are > 65 years of age or have certain other risk factors.
Soon after this announcement was made, the booster recommendation was amended
to include everyone ages 18 and older. The mRNA encodes for the SARS-CoV-2
spike protein. The other vaccine has a viral vector formulation with a live but safe
adenovirus serving as the vector for carrying the genome of the SARS-CoV-2 spike
protein and, until recently, it was thought that a second booster injection would not
be needed for one of the two viral vector versions currently available. However,
serious consideration is now being given to modify this strategy to include additional
boosters for all vaccines with allowances for “mixing and matching” with the mRNA
vaccines based on recommendations by the FDA to be followed by further consid-
eration by the CDC. In both cases, the spike protein had been shown to be highly
immunogenic and the key protective component in pre-clinical studies, and is
associated with a vigorous antibody response. The time frame for these events
was as follows. After an initial Emergency Use Authorization (EUA), that was issued
in December 2020 and then followed by a second one in February 2021 by the FDA,
the two mRNA vaccines produced by Pfizer (Pearl River, NY) and Moderna
(Cambridge, MA) have either received final approval or are pending final
approval for routine use as of late October 2021. This is also true for the viral vector
vaccines produced by Janssen/Johnson & Johnson (Titusville, NJ) and Astra-Zeneca
(Cambridge, UK) which have received an EUA for adults (> 15 year’s old) in the
U.S. It should be noted that in the United Kingdom much earlier approval was given
patients
in December 2020 and January 2021, for some of these vaccines, by the U.K. Health
Department, following recommendations by the Medicare and Health Care Regula-
tory Authority in the Department of Health and Social Care. It is worth noting that,
from the very beginning, the rapid deployment of these vaccines, especially in the
U.S., was partially aided by the involvement of the U.S. federal government under
the program known as “Operation Warp Speed” (United States Federal Government,
2020). Although some people may have viewed this program as having political
overtones, it nonetheless did provide considerable financial and logistical support
to the pharmaceutical industry for accelerating the development and distribution
of multiple vaccine doses throughout much of the U.S. in a nearly unprecedented
and efficient fashion. Also, as an additional benefit of this process, starting in June
2021, surplus vaccine that was being produced in the U.S. (as well as by some of the
other vaccine-producing countries) was then shipped abroad to various countries that
were unable to procure enough vaccine to immunize their citizenry. Still, despite
these humanitarian efforts, in some low-income countries, less than 1% of the pop-
ulation is fully vaccinated, and the success rate is only slightly better in lower-
middle-income countries, compared with more than half in high-income countries.
Thus, such a situation reinforces the ongoing problem of trying to achieve global
vaccine equity. Another related challenge/concern, as pointed out in another chapter
of this volume (Pavia, 2022), is that universal acceptance of the COVID-19 vaccines
is lacking due mostly to hesitancy and the spread of misinformation or a general lack
of a full understanding on the overall benefits of getting vaccinated amid a worldwide
medical disaster. Unfortunately, these anti-vaccine sentiments still linger and will
continue to be deeply engrained in the minds of an ignorant subpopulation and others
unwilling to accept well established facts long after the pandemic has passed.
3 The use of COVID-19 vaccines for the high-risk patient

population with the emphasis on HIV-infected patients
As with the general population, people who are diabetic, obese, elderly and immu-
nocompromised, such as those with HIV/AIDS, should be strongly encouraged to
receive one of the available vaccines as a preventive measure against developing
COVID-19. Interestingly, there appears to be an intriguing association/connection
between diabetes and obesity. In this regard, although not all obese individuals have
type 2 diabetes mellitus, and not everyone with type 2 diabetes mellitus is obese, it is
known that obesity is the most important environmental risk factor for diabetes and,
in fact, more than 80% of patients with this condition are obese (Kumar, Abbas, &
Aster, 2020). The major problem in type 2 diabetes mellitus is hyperglycaemia which
causes dysfunction of the immune response so that these patients become more sus-
ceptible to infections (Berbudi, Rahmadika, Tjahjadi, & Ruslami, 2020). There have
been many studies to determine what else is involved as to why this risk factor
impairs the host immune defense, especially against pathogens. The mechanisms
that have been elucidated include suppression of cytokine expression, defects in
phagocytosis leading to the failure to kill microorganisms, and reduced activation
3 COVID-19 vaccines for the high-risk patient population 273
of lymphocytes in response to a stimulus (Berbudi et al., 2020). Therefore, both

innate immune response defects, such as dysfunction of neutrophils and macrophages
and of the adaptive immune response (including T cells) are thought to cause
weaknesses of host defense mechanisms against invading pathogens (Berbudi et al.,
2020). With regards to the role that obesity plays in this context, McLaughlin,
Ackerman, Shen, and Engleman (2017) suggested that chronic inflammation in adipose
tissue is likely to play an important role in the development of obesity-associated insulin
resistance that is characteristic of type 2 diabetes. This inflammatory response may be
related to adipose cell hypertrophy, hypoxia, and/or intestinal leakage of bacteria and
their metabolic products, and that M1 macrophages, interferon-gamma secreting Th1
cells, CD8+ T cells and B cells promote insulin resistance partly through secretion
of proinflammatory cytokines (McLaughlin et al. (2017)). Another study (Richard,
Wadowski, Goruk, et al., 2017) having similar findings suggests that patients with
obesity and type 2 diabetes mellitus have additional immune dysfunction when com-
pared to obese individuals who are metabolically healthy. These immune abnormali-
ties include impaired neutrophil function and T cell responses to antigenic challenge.
Foremost among these risk groups having immune-associated defects, it would
seem that people with HIV/AIDS would benefit most from getting vaccinated given
their severely immunocompromised condition in the absence of any anti-retroviral
treatment designed to improve/restore their immune function. This is because
HIV infection mainly targets the immune system, though many other tissue sites
and organs can be affected. AIDS, which is caused by HIV, results in a severe im-
munodeficiency, mostly affecting cell-mediated immunity, via infection and death of
CD4 + T cells and impairment in the function of surviving helper T cells after the
virus enters the body via mucosal tissues and blood where it can also infect macro-
phages and dendritic cells (Murray, Rosenthal, & Pfaller, 2020). These latter two cell
types play a key role as being antigen-presenting cells, along with B cells, that are
involved in the somewhat complex yet coordinated process of eventually producing
antibodies intended to neutralize the virus. Collectively, these events that are medi-
ated by HIV severely disrupt a good portion of the human body’s defense mecha-
nisms against infectious disease by preventing activation of primarily the adaptive
immune response. In addition, HIV becomes established in lymphoid tissues of
the body and may remain latent for a long period of time, which is variable. This
leads to a major and continuous breakdown of host defenses, a large increase in
the viral load, and profound, life-threatening clinical disease. The typical person with
AIDS presents with long-lasting fever (>1 month), fatigue, weight loss, diarrhea, and
generalized lymph node enlargement. After a period of time which varies, a wide
range of serious opportunistic infections, secondary neoplasms, or clinical neuro-
logic and renal disease may develop (Murray et al., 2020). Without treatment, most
patients with HIV infection progress to AIDS after a chronic phase lasting from 7 to
10 years. However, over the past few years, highly active antiretroviral therapy
(HAART) is a regimen that has been widely used to manage and treat HIV/AIDS
patients with considerable success in many cases (Saag, 2021.
Surprisingly, in the overall picture, some evidence to date (reviewed in Brown,
Spinelli, & Gandhi, 2021) does not suggest that HIV/AIDS patients have a markedly
patients
higher susceptibility to SARS-CoV-2 infection, although disparities in the social

determinants of maintaining good health and certain other comorbidities likely
have a greater influence, especially with regards to gaining access to supportive
health care and continuation of treatment regimens such as HAART. Inconsistencies
exist, in this regard, since there are also other reports from separate facilities describ-
ing increased, decreased, or no difference in outcomes of COVID-19 in this patient
population, especially in terms of the fatality rate (Bertagnolio et al., 2021; Boulle
et al., 2020; Johnston, 2021; Office of the AIDS Research Advisory Council, 2021).
These studies have come from various locations, each with a different underlying
HIV prevalence and access to various treatment regimens. The majority of the
published literature has not supported a significantly higher risk for severe disease
among HIV/AIDS patients in the United States and Europe (Brown et al., 2021; Office
of the AIDS Research Advisory Council, 2021), although a large, population-based
study in South Africa reported a higher rate of death due to COVID-19 (Boulle
et al., 2020). Higher rates of comorbidities associated with COVID-19 severity among
HIV/AIDS patients is an area that still needs to be evaluated and monitored closely. The
immediate impact of COVID-19 is that it could lead to decreased access to HIV pre-
vention services and HIV testing, and hampering HIV treatment access and virologic
suppression, which could lead to worsening of HIV control and delays in achieving
other desirable positive outcomes. Also, along these lines, the CDC has concluded
(CDC, 2020) that people with HIV who are on effective HIV treatment have the same
risk for developing COVID-19 as people who do not have HIV, although the risk for
people with HIV becoming seriously ill is greatest for those who have a low CD4
T-cell count and are not on effective HIV treatment such as with HAART.
In light of the foregoing, what are some of the relevant intervening factors
that could influence the response pattern of the HIV/AIDS patient population to
COVID-19? Examples of these variables are as follows:
(i)What is the stage (early versus late) of HIV infection?

(ii)What is the current plasma HIV load?
(iii)What is the current peripheral blood CD4 + count?
(iv) Is the patient currently receiving HAART?
(v) And, if so, for how long (just starting versus long term), and how is the patient
responding to HAART?
(vi) Is the patient currently co-infected with an opportunistic pathogen?
With this information in mind, additional questions arise pertaining to the use of
COVID-19 vaccines for the HIV/AIDS group, and they include:
(i) Are the vaccines safe and what level of protection would these vaccines offer to
this patient population?
(ii) And if so, which vaccine should be administered to them?
(iii) How often should they receive booster injections?
(iv) And at what point, if at all, should they be vaccinated after they have recovered
from a naturally acquired infection with SARS-CoV-2?
3 COVID-19 vaccines for the high-risk patient population 275
The answers to most of these questions are relatively straightforward and not too
complicated. According to the CDC (2020), the U.S. vaccine safety system makes
sure all vaccines are as safe as possible. COVID-19 vaccines have gone through
rigorous safety tests and have met or even exceeded similar standards as for other
vaccines that have been produced for nearly a century and have been in routine
use for over 60 years. People with HIV have been included in clinical trials, though
there is limited safety and efficacy data available as they pertain specifically to this
group. So far, there are no data indicating that the vaccines are not safe and effective
for people with HIV, including adolescents between 12 and 15 years nor has it been
shown that the COVID-19 vaccines interfere with the effectiveness of HIV medica-
tions used in certain treatment regimens, such as HAART. There have been no
unusual links or enhanced negative reactions between HIV or other types of immuno-
suppression with any of the rare serious adverse events that have been reported for
the COVID-19 vaccines within the general population. Much of this information has
been provided by the British HIV Association (2021) and the World Health
Organization (2021), who have also indicated that HIV-infected people generally
will likely produce a weaker response to the COVID-19 vaccines, but they are still
expected to be protected from developing serious illness. This protection, however,
may be to a lesser extent, especially for those individuals with low CD4 + counts
(< 100/mm3). Nonetheless, the U.K. Department of Health recommends that people
with HIV, regardless of their CD4 + count, should receive a COVID-19 vaccine. In
addition, because some people with HIV, especially those with a very low CD4
T-cell count, may be at increased risk for severe illness due to COVID-19, the
CDC recommendation (CDC, 2020) advises that people with HIV may receive
the vaccine as long as they do not have other conditions that would exclude them,
such as a known severe allergic reaction or immediate allergic reaction of any sever-
ity after receiving a previous dose or to a component of the COVID-19 vaccine. The
vaccines authorized for use in the United States and the United Kingdom do not con-
tain live infectious virus so they are expected to be safe in people with low CD4 cell
counts. It is a general rule that people with T-cell defects should not be given live
vaccines, even though they are attenuated, so that they are supposed to only immu-
nize the recipient and not cause disease. However, the attenuated pathogen in such
vaccines could possibly mutate and revert to a more virulent form and cause serious
disease in the immunocompromised host. Examples of this type of vaccine, that are
currently used routinely, include the measles, chickenpox and one of the anti-
shingles vaccines. This same concept applies for the COVID-19 viral vector vaccine
products except they are not “true” live, attenuated vaccines, in the traditional sense.
This is because the available ones now in widespread use, that are produced by
Jannsen/Johnson & Johnson and Astra-Zeneca, consist of a live, but replication-
incompetent, human adenovirus vector, encoding for the recombinant SARS-
CoV-2 spike (S) glycoprotein, stabilized in its pre-fusion form. This differs from
the vaccines produced by Pfizer and Moderna which use only synthetic mRNA as
the immunogen. The viral vector’s purpose is to introduce the DNA, that encodes
for the spike protein, into the human body in a somewhat unique way so that multiple
patients
copies of it can be produced in vivo, over a short period of time, until the crippled
virus immunogen is neutralized by the immune response that is being induced by
the “replicating antigens” (R.J. North, personal communication) of SARS-CoV-2.
This provides a persistent, albeit temporary, stimulus to the vaccinee. Given the
strength and durability of this type of response, this usually means that, theoretically,
and similar to what occurs with a truly live vaccine, a repeat (i.e., a booster) injection
may not be necessary. As noted earlier, this consideration on whether to give boosters
of the viral vector vaccine was being re-evaluated in October 2021 by the U.S. FDA
and CDC, and starting in November 2021, a third (booster) injection is now highly
recommended for most eligible people irrespective of what type of vaccine was
previously given.
Additional features of the viral vector vaccine is that it is considered to be safe
even for immunocompromised patients, including those with HIV/AIDS, given
that the viral vector has been shown to be harmless in one of the most recently pub-
lished studies on this topic (Hammer et al., 2013). Nonetheless, prior to this finding,
there was some initial concern about a potential association observed more than a
decade ago between adenovirus vector-based vaccines and an increased risk of ac-
quiring HIV infection among men who received this type of vaccine (Buchbinder,
McElrath, Dieffenback, & Corey, 2020, 18). This unexpected finding was detected
in two HIV vaccine trials that used adenovirus vector containing products
(Buchbinder et al., 2008; Gray et al., 2011) but these vaccines were constructed
differently and are not related to the structure of the COVID-19 vaccines. The reason
for this previously observed HIV risk remains uncertain, although several follow-up
studies have suggested a possible interference in the HIV-specific vaccine response
or in the CD4 cell susceptibility to HIV infection induced by this kind of vaccine as
an unexpected side effect (Frahm et al., 2012; Perreau, Pantaleo, & Kremer, 2008).
Accordingly, specific studies on this issue with this type of COVID-19 vaccine
should be considered by closely monitoring the response patterns of HIV-infected
people to various immune parameters that would include periodically measuring
CD4 T cell counts, viral loads and anti-spike protein antibody levels subsequent
to being vaccinated. In addition, testing for delayed-type hypersensitivity responses,
as shown recently by Barrios et al. (2021) for recovering COVID-19 patients without
HIV, may also provide valuable insights on the importance of cellular immune re-
sponses mediated by CD8 + T cells that directly kill virally infected cells as being an
additional defense mechanism for prospective vaccine recipients. There are still,
however, other unresolved issues. For example, will the currently available vaccines
be fully protective against variants of SARS-CoV-2, especially the highly invasive/
infectious Delta variant that was first identified in December 2020 (Nature, 2021;
Torjesen, 2021), along with the Omicron variant with its pecular set of mutations
that was recognized and had spread to many countries in the latter part of 2021? What
is the longevity of protection that is provided by any of these vaccines; and will
additional boosters be needed beyond what is currently being done or recommended?
In this regard, it is still unclear or not fully known how much SARS-CoV-2
antigen(s) is needed, or produced in vivo to induce an immune response that leads
to optimal protection against COVID-19. Somewhat encouraging news, along these
References 277
lines, was recently reported (CNN, 2021) indicating that the Janssen/Johnson &
Johnson vaccine provided lasting protection of at least 8 months duration and it
afforded protection against the Delta and other variants. Although there had already
been prior preliminary evidence (reviewed in Chen & Wherry, 2020) supporting an
important role for both CD4 + and CD8 + T cells in the immunologic memory com-
ponent in the host response to COVID-19, it is likely that additional related news on
these topics will be forthcoming in the coming months. In light of these potential
concerns/issues, it should be realized that, in the final analysis, the overall benefits
of receiving any of the authorized COVID-19 vaccines in a pandemic situation
currently outweigh the potential risks, even for people with impaired immune sys-
tems or other co-morbid conditions.
Funding
None to declare.
Author contribution
The authors equally contributed to the conceptualization and writing of the manuscript.
Conflict of interest
The authors declare that they have no conflicts of interest. It should be noted that the citing of
commercially available vaccine products should not be construed as an endorsement. They are
being cited for the sole purpose of providing examples of vaccines that are in either the near-
approval stage, have been approved or been given preliminary authorization for use for im-
munization purposes by authorizing/governmental agencies, after the manufacturers provided
data showing that they have met the minimal standards for successfully completing and
fulfilling the required clinical trial testing parameters for safety and efficacy.
References
Barrios, Y., Franco, A., Sanchez-Machin, I., Poza-Guedes, P., Gonzalez-Perez, R., &
Matheu, V. (2021). A novel application of delayed-type hypersensitivity reaction to mea-
sure cellular immune response in SARS-CoV-2 exposed individuals. Clinical Immunol-
ogy, 226, 108730. https://doi.org/10.1016/j.clim.2021.108730/.
Berbudi, A., Rahmadika, N., Tjahjadi, A. I., & Ruslami, R. (2020). Type 2 diabetes and its
impact on the immune system. Current Diabetes Reviews, 16(5), 442–449. https://doi.
org/10.2174/1573399815666191024085838.
Bertagnolio, S., Thwin, S. S., Silva, R., Ford, N., Baggaley, R., Vitoria, M., et al. (2021).
Clinical characteristics and prognostic factors in people living with HIV hospitalized
with COVID-19: Findings from the WHO Global Clinical Platform. July 2021. https://
theprogramme.ias2021.org/Abstract/Abstract/2498.
Boulle, A., Davies, M. A., Hussey, H., Ismail, M., Morden, E., et al. (2020). Risk factors for
COVID-19 death in a population cohort study from the Western Cape Province, South
Africa. Clinical Infectious Diseases, ciaa1198. https://doi.org/10.1093/cid/ciaa1198.
patients
British HIV Association. 2021 SARS-CoV-2 vaccine advice for adults living with HIV:
British HIV Association (BHIVA) & Terrence Higgins Trust (THT) guidance. Available
online: https://www.bhiva.org/SARS-CoV-2-vaccine-advice-for-adults-living-with-HIV-
update. 11 January 2021.
Brown, L. B., Spinelli, M. A., & Gandhi, M. (2021). The interplay between HIV and
COVID-10: Summary of the data and responses to date. Current Opinion in HIV & AIDS,
16, 63–73. https://doi.org/10.1097/COH.0000000000000659.
Buchbinder, S. P., McElrath, M. J., Dieffenback, C., & Corey, L. (2020). Use of adenovirus
type-5 vectored vaccines: A cautionary tale. Lancet, 396(10260), E68–E69. Available
online: https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)32156-5/
fulltext#articleInformation.
Buchbinder, S. P., Mehrotra, D. V., Duerr, A., Fitzgerald, D. W., Mogg, R., Li, D., et al.
(2008). Efficacy assessment of a cell-mediated immunity HIV-1 vaccine (the Step Study):
A double-blind, randomised, placebo-controlled, test-of-concept trial. Lancet, 372,
1881–1893.
Centers for Disease Control and Prevention. 2020. COVID-19 and HIV. Available online:
https://www.cdc.gov/hiv/basics/covid-19.html. 20 October 2020.
Centers for Disease Control and Prevention. 2021. COVID-19 risks and vaccine information
for older adults. https://www.cdc.gov/aging/covid19/covid19-older-adults.html. Updated
1 August 2021.
Chen, Z., & Wherry, E. J. (2020). T cell response in patients with COVID-19. Nature Reviews
Immunology, 20, 529–535. https://doi.org/10.1038/s41577-020-0402-6.
CNN. 2021 J & J Covid-19 vaccine lasts at least 8 months, protects against Delta variant,
studies find. Available online: https://www.cnn.com/2021/07/01/health/johnson-vaccine-
delta-variant/index.html. 1 July 2021.
de Frel D, et al. 2020. The impact of obesity and lifestyle on the immune system and suscep-
tibility to infections such as COVID-19. Frontiers in Nutrition. Nov 19;7:597600,
eCollection 2020. https://doi.org/10.3389/fnut.2020.597600.
Frahm, N., DeCamp, A. C., Friedrich, D. P., Carter, D. K., Defawe, O. D., Kubin, J. G., et al.
(2012). Human adenovirus-specific T cells modulate HIV-specific T cell responses to an
Ad5-vectored HIV-1 vaccine. The Journal of Clinical Investigation, 122, 359–367.
Gao, F., Zheng, K. I., Wang, X. B., Sun, Q. F., Pan, K. H., Wang, T. Y., et al. (2020). Obesity is
a risk factor for greater COVID-19 severity. Diabetes Care, 43, e72–e74. https://doi.org/
10.2337/dc20-0682.
Garg, S., Kim, L., Whitaker, M., O’Halloran, A., Cummings, C., Holstein, R., et al. (2020).
Hospitalization rates and characteristics of patients hospitalized with laboratory-
confirmed coronavirus disease 2019. COVID-NET, 14 states. Morbidity and Mortality
Weekly Report, 69, 458–464. https://doi.org/10.15585/mmwr.mm6915e3.
Gray, G. E., Allen, M., Moodie, Z., Churchyard, G., Bekker, L. G., Nchabeleng, M., et al.
(2011). Safety and efficacy of the HVTN 503/Phambili study of a clade-B-based
HIV-1 vaccine in South Africa: a double-blind, randomized, placebo-controlled test-of-
concept phase 2b study. The Lancet. Infectious Diseases, 11, 507–515.
Hammer, S. M., Sobieszczyk, M. E., Janes, H., Karuna, S. T., Mulligan, M. J., Grove, D., et al.
(2013). Efficacy trial of a DNA/rAd5 HIV-1 preventive vaccine. The New England
Journal of Medicine, 369, 2083–2092.
Johnston, R. (2021). The first 6 months of HIV-SARS-CoV-2 coinfection: Outcomes for
6947 individuals. Current Opinion in HIV & AIDS, 16, 54–62. https://doi.org/10.1097/
COH.0000000000000654.
References 279
Kates, O. S., et al. (2020). Coronavirus disease 2019 in solid organ transplant: a multicenter
cohort study. Clinical Infectious Diseases. https://doi.org/10.1093/cid/ciaa1097.
Kumar, V., Abbas, A., & Aster, J. (2020). Robins and cotran pathophysiology of disease
(10th ed.). London, UK: Elsevier.
McLaughlin, T., Ackerman, S. E., Shen, L., & Engleman, E. (2017). Role of innate and
adaptive immunity in obesity-associated metabolic disease. The Journal of Clinical
Investigation, 127(1), 5–13, 5199693. https://doi.org/10.1172/JCI88876. 28045397.
Murray, P. R., Rosenthal, K. S., & Pfaller, M. A. (2020). Medical microbiology (9th ed.).
London, UK: Elsevier.
Nature. Delta coronavirus variant: Scientists brace for impact. 2021. Available online: https://
www.nature.com/articles/d41586-021-01696-3. 22 June 2021.
Office of the AIDS Research Advisory Council. 2021. Guidance for COVID-19 and People
with HIV j NIH. https://clinicalinfo.hiv.gov/en/guidelines/covid-19-and-persons-hiv-
interim-guidance/interim-guidance-covid-19-and-persons-hiv. Updated 26 February 2021.
Pavia, C. (2022). Hesitancy to get vaccinated against COVID-19 and how it might be over-
come. In C. S. Pavia & V. Gurtler (Eds.), 50. Methods in Microbiology, COVID-19:
Biomedical Perspectives (pp. 223–231). London: UK: Elsevier.
Perreau, M., Pantaleo, G., & Kremer, E. J. (2008). Activation of a dendritic cell-T cell axis
by Ad5 immune complexes creates an improved environment for replication of HIV
in T cells. The Journal of Experimental Medicine, 205, 2717–2725.
Richard, C., Wadowski, M., Goruk, S., et al. (2017). Individuals with obesity and type 2
diabetes have additional immune dysfunction compared with obese individuals who are
metabolically healthy. BMJ Open Diabetes Research & Care, 5, e000379. https://doi.
org/10.1136/bmjdrc-2016-000379.
Saag, M. S. (2021). HIV infection—Screening, diagnosis, and treatment. The New England
Journal of Medicine, 384, 2131–2143.
Torjesen, I. (2021). Covid-19: Delta variant is now UK’s most dominant strain and spreading
through schools. BMJ, 373. https://doi.org/10.1136/bmj.n1445, n1445.
United States Federal Government. 2020 Operation Warp Speed. Available online: https://
www.defense.gov/Explore/Spotlight/Coronavirus/Operation-Warp-Speed/. 15 May 2020.
World Health Organization. 2021 Coronavirus disease (COVID-19): COVID-19 vaccines and
people living with HIV. Available online: https://www.who.int/news-room/q-a-detail/
coronavirus-disease-(covid-19)-covid-19-vaccines-and-people-living-with-hiv. 14 July 2021.

My First Book Chapter

Uploaded by

Copyright:

Available Formats

My First Book Chapter

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

My First Book Chapter

Uploaded by

Copyright:

Available Formats

Methods in Microbiology

First edition 2022

Copyright © 2022 Elsevier Ltd. All rights reserved.

For information on all Academic Press publications

Publisher: Zoe Kruze

CHAPTER 1 Sensitive methods for detection

CHAPTER 2 The seasonal behaviour of COVID-19 and its

3. COVID-19 diagnostics ................................................................... 91

CHAPTER 4 CRISPR use in diagnosis and therapy for COVID-19...123

CHAPTER 5 Recent and advanced nano-technological

4. Vaccine development strategies and platforms ............................ 155

CHAPTER 6 A review of hypersensitivity methods to detect

4.2 Understanding the adaptive immune response in covid19

CHAPTER 7 Hesitancy to get vaccinated against COVID-19

CHAPTER 8 The emergence of SARS-CoV-2 variants of concern

6. Continental links to seasonality.................................................... 254

CHAPTER 9 COVID-19 vaccines for high risk and

Ezinwanne Nneoma Ezeibe

John Dike Nwabueze Ogbonna

2 General approaches for the detection of SARS-CoV-2

3 Isothermal amplification methods for sensitive detection of

amplification; however, specifically designed heating devices are still needed. In

4 Sensitive detection of SARS-CoV-2 via RT-RPA

Table 1 List of concentrations of primers, probes, nucleases, inhibitors and

Exo-probe Fw & Rw 500 nM 420 nM, can be varied in the

5 General considerations for designing an ultrasensitive

5.1 Primer design

5.2 Probe design

5.3 Reaction temperature

6 Comparative reviews of recently published RT-RPA assays

8 Before you begin

9 Key resources table

Reagent or resource Source Identifier

Bacterial and virus strains

10 Materials and equipment

11 Step-by-step method details

murine RNase inhibitor, 1 μL of RNA sample, 20 μL of DI-H2O, and 0.5 μL of

11.2 Detection of SARS-CoV-2 N- or S-gene using nfo probes

11.3 Optional steps

11.4 Simultaneous dual N- and S-gene detection using paired exo

The seasonal behaviour

2 The seasonal behaviour of viruses

2.2 Drivers of seasonality in trade-off performance spaces

Table 1 Triangles describing persistent systems.

General Economy Flexibility Robustness Yafremava et al.,

(i) Environment: Robustness embodies mechanisms that use information to

mosquitoes and tick require that vectors avoid being dormant in

While some seasonal drivers may be significant contributors to the epidemic

2.3 Finding significant correlations

2.4 Distinguishing error from chaos in time series

3 The seasonal behaviour of COVID-19

by studying time series describing seasonal recurrences on one or more particular

3.1 Spatial distribution approaches

3.2 Temporal distribution approaches

4 Viral genomic make up and seasonality

ribosome-profiling techniques and that a complement of 23 unannotated viral ORFs

4.1 Mutational change in rapidly expanding viral populations

4.2 A structuring quasispecies as paradigm of viral mutational

diversification process. In fact, a recent analysis of mutations in SARS-CoV-2 ge-