USER GUIDE

MEGAscript® Kit
Catalog Numbers AM1330, AM1333, AM1334, AM1338
Publication Number 1330M
Revision G
For Research Use Only. Not for use in diagnostic procedures.

Information in this guide is subject to change without notice.

DISCLAIMER
LIFE TECHNOLOGIES CORPORATION AND/OR ITS AFFILIATE(S) DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED,
INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, OR NON-INFRINGEMENT. TO THE EXTENT
ALLOWED BY LAW, IN NO EVENT SHALL LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) BE LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, OR
UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN
CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING BUT NOT LIMITED TO THE USE THEREOF.

NOTICE TO PURCHASER: LIMITED USE LABEL LICENSE: Research Use Only

The purchase of this product conveys to the purchaser the limited, non-transferable right to use the purchased amount of the product only to perform internal
research for the sole benefit of the purchaser. No right to resell this product or any of its components is conveyed expressly, by implication, or by estoppel.
This product is for internal research purposes only and is not for use in commercial applications of any kind, including, without limitation, quality control and
commercial services such as reporting the results of purchaser's activities for a fee or other form of consideration. For information on obtaining additional
rights, please contact [email protected] or Out Licensing, Life Technologies, 5791 Van Allen Way, Carlsbad, California 92008.

TRADEMARKS
The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners. LabChip is a registered trademark of Caliper
Life Sciences Corporation. Agilent and Bioanalyzer are registered trademarks of Agilent Technologies, Inc.

© 2012 Life Technologies Corporation. All rights reserved.

 Contents

■ MEGAscript® Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Product overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
MEGAscript® Kit procedure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

■ APPENDIX A Supplemental Information . . . . . . . . . . . . . . . . . . . . . . . . . . 19

Related products available from Life Technologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
Quality control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20

■ APPENDIX B Recipes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21

■ APPENDIX C Additional Procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Analysis of transcription products by gel electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Optimizing yield of short transcripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
Synthesis of capped RNA transcripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Using the MEGAscript® Kit to make RNA probes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
Spin column preparation and use . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

■ APPENDIX D Safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
General safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Chemical safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Biological hazard safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Bibliography . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

Documentation and Support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

Obtaining SDSs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Obtaining support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Limited product warranty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

MEGAscript® Kit User Guide 3

Contents

4 MEGAscript® Kit User Guide

 MEGAscript® Kit

IMPORTANT! Before using this product, read and understand the information the
“Safety” appendix in this document.

Product overview
Product MEGAscript® Kits are ultra-high yield in vitro transcription kits. The high yields are
description achieved by modifying typical transcription reaction conditions so that very high
nucleotide concentrations can be effectively used. The MEGAscript® Kits contain in
vitro transcription reaction components for twenty-five or forty 20 µL reactions and a
control template. Each kit will yield a total of 3–5 mg of RNA (approximately 100 µg of
RNA or more per reaction) from the control template supplied with the kit. This
corresponds to 400–650 moles of RNA for each mole of template. Smaller templates
typically yield a lower mass and a higher molar yield of product.
MEGAscript® Kits are intended for the synthesis of large amounts of unlabeled or low
specific activity RNA for a variety of uses including in vitro translation, antisense/
microinjection studies, and isolation of RNA binding proteins. In large-scale
transcription reactions, the concentration of all 4 nucleotides is high, well above the Km
for the enzyme. MEGAscript® Kits typically yield over 10 times more RNA than
conventional in vitro transcription reactions (Krieg and Melton, 1987). MEGAscript®
Kits are not recommended for synthesis of high specific activity probes.

Materials provided The MEGAscript® Kit should be stored in a non-frost-free freezer. Keep all reagents on
with the kit ice while using the kit; the nucleotides and enzymes are especially labile.

Components specific to the RNA polymerase in the kit

The SP6, T7, or T3 Enzyme Mix and the 10X Reaction Buffer are specifically calibrated
for each lot and RNA polymerase. Mixing components from different lots, or from kits
for different RNA polymerases (SP6, T7, T3) will compromise RNA yield.

Cat. no.
AM1333 All 40 rxn kits Component Storage
(25 rxn)

50 µL 80 µL Enzyme Mix (SP6, T7, or T3) –20°C

50 µL 80 µL 10X Reaction Buffer† (SP6, T7, or T3) –20°C
50 µL 80 µL ATP Solution‡ (SP6, T7, or T3) –20°C
50 µL 80 µL CTP Solution (SP6, T7, or T3) –20°C
50 µL 80 µL GTP Solution (SP6, T7, or T3) –20°C
50 µL 80 µL UTP Solution (SP6, T7, or T3) –20°C
† Salts, buffer, dithiothreitol, and other ingredients
‡ The ATP, CTP, GTP, and UTP Solutions are supplied at 75 mM for T7 and T3 kits, or at 50 mM for SP6 kits.

MEGAscript® Kit User Guide 5

 MEGAscript® Kit
MEGAscript® Kit procedure

All MEGAscript® Kits include the following components:

Amount Component Storage

1.75 mL Nuclease-free Water any temp†

100 µL TURBO DNase (2 U/µL) –20°C
10 µL pTRI-Xef, 0.5 mg/mL (Control Template) –20°C
1 mL Ammonium Acetate Stop Solution –20°C
5 M ammonium acetate, 100 mM EDTA
1.4 mL Lithium Chloride Precipitation Solution –20°C
7.5 M lithium chloride, 50 mM EDTA
1.4 mL Gel Loading Buffer II –20°C
1–2X gel loading solution for TBE polyacrylamide
and agarose gels containing: 95% formamide, 0.025% xylene
cyanol, 0.025% bromophenol blue, 18 mM EDTA, and 0.025% SDS
† Store Nuclease-free Water at –20°C, 4°C or room temp.

Materials not • DNA template: The DNA template must have the correct RNA polymerase
provided with the promoter site (T7, T3, or SP6) upstream of the sequence to be transcribed. The
suggested template concentration is 0.5 µg/µL in water or TE (10 mM Tris-HCl
kit
(pH 7–8), 1 mM EDTA).
• (optional) Labeled nucleotide(s): Any [α-32P] labeled nucleotide can be added to
the reaction as a tracer to facilitate quantitation of the RNA synthesized. Any
specific activity is acceptable.
• (optional) For purification of the synthesized RNA:
– Buffer- or water-saturated phenol/chloroform
– Isopropanol
– Spin Columns

MEGAscript® Kit procedure

Preparation of template DNA
Linearized plasmid DNA, and PCR products that contain an RNA polymerase
promoter site can be used as templates for in vitro transcription with the MEGAscript®
Kit. In general, any DNA with a promoter site, that is pure enough to be easily
digested with restriction enzymes can be used for in vitro transcription.

6 MEGAscript® Kit User Guide

 MEGAscript® Kit
MEGAscript® Kit procedure

Figure 1 Phage Polymerase Promoters: Minimal Sequence Requirements

T7 +1
TAATACGACTCACTATAGGGAGA The +1 base (in bold) is the first
base incorporated into RNA during
SP6 +1 transcription. The underline shows
ATTTAGGTGACACTATAGAAGNG the minimum promoter sequence
needed for efficient transcription.
T3 +1
AATTAACCCTCACTAAAGGGAGA
–17 +6

Template size
The MEGAscript® Kit is designed to function best with templates that code for RNA
transcripts of about 0.5 kb and longer. The kit can be used to produce shorter RNA, but
modify the reaction as described in section “Optimizing yield of short transcripts” on
page 24.

Orientation
If sense RNA is needed, it is important to transcribe using the RNA polymerase
corresponding to the phage promoter at the 5', or amino-terminal side of the coding
region of the protein (using promoter 1 in the diagram below). If the template consists
of a plasmid, it should be linearized in the polylinker at the opposite (3' or carboxy-
terminal side) of the protein-coding region.
Antisense (mRNA-complementary) transcripts will be synthesized if the RNA
polymerase corresponding to the RNA phage promoter at the 3', or carboxy-terminal
side of the coding region of the protein is used (using promoter 2 in the diagram
below).

ATG...... ......AAAAAA 3'

5'
promoter 1 promoter 2
3' 5'
Transcription using the RNA polymerase corresponding to promoter 1 will make
sense RNA (the same sequence as the mRNA). If the RNA polymerase for
promoter 2 is used, antisense RNA will be transcribed.

Plasmid templates
DNA should be relatively free of contaminating proteins and RNA. We observe the
greatest yields with very clean template preparations. Most commercially available
plasmid preparation systems yield DNA that works well in the MEGAscript® Kit.

Linearization
Plasmid DNA must be linearized with a restriction enzyme downstream of the insert
to be transcribed. Circular plasmid templates will generate extremely long,
heterogeneous RNA transcripts because RNA polymerases are very processive. It is
generally worthwhile to examine the linearized template DNA on a gel to confirm that
cleavage is complete. Since initiation of transcription is one of the limiting steps of in
vitro transcription reactions, even a small amount of circular plasmid in a template
prep will generate a large proportion of transcript.

MEGAscript® Kit User Guide 7

 MEGAscript® Kit
MEGAscript® Kit procedure

Although we routinely use all types of restriction enzymes, there has been one report
of low level transcription from the inappropriate template strand in plasmids cut with
restriction enzymes leaving 3' overhanging ends (produced by Kpn I, Pst I, etc.;
Schendorn and Mierindorf, 1985).

After linearization
Terminate the restriction digest by adding the following:
• 1/20th volume 0.5 M EDTA
• 1/10th volume of 3 M Na acetate or 5 M NH4 acetate
• 2 volumes of ethanol
Mix well and chill at –20°C for at least 15 min. Then pellet the DNA for 15 min in a
microcentrifuge at top speed. Remove the supernatant, re-spin the tube for a few
seconds, and remove the residual fluid with a very fine-tipped pipet. Resuspend in
dH2O or TE buffer at a concentration of 0.5–1 µg/µL.

Proteinase K treatment
Note that DNA from some miniprep procedures may be contaminated with residual
RNase A. Also, restriction enzymes occasionally introduce RNase or other inhibitors of
transcription. When transcription from a template is suboptimal, it is often helpful to
treat the template DNA with proteinase K (100–200 µg/mL) and 0.5% SDS for 30 min
at 50°C, follow this with phenol/chloroform extraction (using an equal volume) and
ethanol precipitation.

PCR templates
DNA generated by PCR can be transcribed directly from the PCR provided it contains
an RNA Polymerase promoter upstream of the sequence to be transcribed. PCR
products should be examined on an agarose gel before use as a template in
MEGAscript® to estimate concentration, and to verify that the products are unique and
the expected size.

8 MEGAscript® Kit User Guide

 MEGAscript® Kit
MEGAscript® Kit procedure

Procedure
overview
Assemble

1. Thaw the frozen reagents (page 9)

2. Assemble transcription reaction at room temp (page 9)
Mix

3. Mix thoroughly (page 10)

Incubate

4. Incubate at 37°C, 2–4 hr (page 10)

DNase Treatment

5. (optional) Add 1 µL TURBO DNase, mix well and incubate 15 min

at 37°C (page 10)

Transcription 1. Thaw the frozen reagents

reaction assembly Place the RNA Polymerase Enzyme Mix on ice, it is stored in glycerol and will not
be frozen at –20°C.
Vortex the 10X Reaction Buffer and the 4 ribonucleotide solutions (ATP, CTP, GTP,
and UTP) until they are completely in solution. Once thawed, store the
ribonucleotides on ice, but keep the 10X Reaction Buffer at room temperature
while assembling the reaction.
All reagents should be microfuged briefly before opening to prevent loss and/or
contamination of material that may be present around the rim of the tube.

2. Assemble transcription reaction at room temp

The spermidine in the 10X Reaction Buffer can coprecipitate the template DNA if
the reaction is assembled on ice.
Add the 10X Reaction Buffer after the water and the ribonucleotides are already
in the tube.
The following amounts are for a single 20 µL reaction. Reactions may be scaled up
or down if desired.

IMPORTANT! The following reaction setup is recommended when the RNA

produced will be ≥0.5 kb in length. For transcripts shorter than this, consider the
suggestions in section “Optimizing yield of short transcripts” on page 24.

MEGAscript® Kit User Guide 9

 MEGAscript® Kit
MEGAscript® Kit procedure

Note: For convenience, mix equal volumes of the four ribonucleotide solutions
together and add 8 µL of the mixture to a standard 20 µL reaction instead of
adding the ribonucleotides separately.

Amount Component

to 20 µL Nuclease-free Water
2 µL ATP solution
2 µL CTP solution
2 µL GTP solution
2 µL UTP solution
2 µL 10X Reaction Buffer
(1 µL) (optional) [α-32P]UTP as a tracer
0.1–1 µg linear template DNA†
2 µL Enzyme Mix
† Use 0.1–0.2 µg PCR-product template or ~1 µg linearized plasmid
template.

3. Mix thoroughly
Gently flick the tube or pipette the mixture up and down gently, and then
microfuge tube briefly to collect the reaction mixture at the bottom of the tube.

4. Incubate at 37°C, 2–4 hr

The first time a new template is transcribed, the recommended incubation time is
2–4 hours. The optimal incubation time for a given template will vary depending
on the size and transcriptional efficiency of your template. For short transcripts
(less than 500 nt), a longer incubation time (up to ~16 hours) may be
advantageous, since more transcription initiation events are required to
synthesize a given mass amount of RNA, compared to transcription of longer
templates. (See section “Optimizing yield of short transcripts” on page 24 for
more details.)
To determine the optimum incubation time for maximum yield with a given
template, a time-course experiment can be done. To do this, set up a
MEGAscript® reaction, and remove aliquots of the reaction at various intervals
(for example after 1, 2, 4, or 6 hr, and overnight incubation). Assess results by
TCA precipitation or other means (see section “Quantitation of reaction
products” on page 12.)
If the reaction is trace-labeled:
After the incubation (before or after TURBO DNase treatment), remove an aliquot
of trace-radiolabeled reactions to assess yield by TCA precipitation (see step on
page 13).

5. (optional) Add 1 µL TURBO DNase, mix well and incubate 15 min at 37°C
This DNase treatment removes the template DNA. For many applications it may
not be necessary because the template DNA will be present at a very low
concentration relative to the RNA.
a. Add 1 µL TURBO DNase, and mix well (the reaction may be viscous).
b. Incubate at 37°C for 15 min.

10 MEGAscript® Kit User Guide

 MEGAscript® Kit
MEGAscript® Kit procedure

Recovery of the The degree of purification required after the transcription reaction depends on what
RNA will be done with the RNA. Four different methods follow, choose one or more
according to your application and resources.

MEGAclear™ Kit
The MEGAclear™ Kit was developed specifically for purifying RNA from high yield in
vitro transcription reactions. The quick and simple procedure removes nucleotides,
short oligonucleotides, proteins, and salts from RNA. The RNA recovered can be used
for any application that requires high purity RNA.

Lithium chloride precipitation

Lithium Chloride (LiCl) precipitation is a convenient and effective way to remove
unincorporated nucleotides and most proteins. Lithium chloride precipitation,
however, does not precipitate transfer RNA and may not efficiently precipitate RNAs
smaller than 300 nucleotides. Also, the concentration of RNA should be at least 0.1 µg/
µL to assure efficient precipitation. To precipitate from MEGAscript® reactions that are
thought to have very low yields of RNA, do not dilute the transcription reaction with
water prior to adding the LiCl Precipitation Solution in the step below.

1. Stop the reaction and precipitate the RNA by adding 30 µL Nuclease-free Water
and 30 µL LiCl Precipitation Solution.

2. Mix thoroughly. Chill for ≥30 min at –20°C.

3. Centrifuge at 4°C for 15 min at maximum speed to pellet the RNA.
4. Carefully remove the supernatant. Wash the pellet once with ~1 mL 70% ethanol,
and re-centrifuge to maximize removal of unincorporated nucleotides.

5. Carefully remove the 70% ethanol, and resuspend the RNA in a solution or
buffer† appropriate for your application. Determine the RNA concentration and
store frozen at –20°C or –70°C.

Spin column chromatography

Spin columns will remove unincorporated nucleotides.
Prepared spin columns such as NucAway™ Spin Columns can be used by following
the manufacturer’s instructions. Alternatively, instructions for preparing spin columns
are given in section “Spin column preparation and use” on page 29.

Phenol:chloroform extraction and isopropanol precipitation

This is the most rigorous method for purifying transcripts. It will remove all enzyme
and most of the free nucleotides from MEGAscript® Kit reactions. Since the RNA is
precipitated, this method can also be used for buffer exchange.

1. Add 115 µL Nuclease-free Water and 15 µL Ammonium Acetate Stop Solution,

and mix thoroughly.

† Life Technologies offers several products for RNA storage; these include:
Nuclease-free Water (not DEPC-treated): Cat. no. AM9930–AM9939
THE RNA Storage Solution: Cat. no. AM7000, AM7001
TE Buffer: Cat. no. AM9860, AM9861
0.1 mM EDTA: Cat. no. AM9912

MEGAscript® Kit User Guide 11

 MEGAscript® Kit
MEGAscript® Kit procedure

2. Extract with an equal volume of phenol/chloroform (it can be water-saturated,

buffer-saturated, or acidic), and then with an equal volume of chloroform.
Recover aqueous phase and transfer to new tube.

3. Precipitate the RNA by adding 1 volume of isopropanol and mixing well.

4. Chill the mixture for at least 15 min at –20°C. Centrifuge at 4°C for 15 min at
maximum speed to pellet the RNA. Carefully remove the supernatant solution
and resuspend the RNA in a solution or buffer† appropriate for your application.

5. Store frozen at –20°C or –70°C.

Quantitation of Quantitation by UV light absorbance

reaction products Reading the A260 of a diluted aliquot of the reaction is clearly the simplest way to
determine yield, but any unincorporated nucleotides and/or template DNA in the
mixture will contribute to the reading. Typically, a 1:300 dilution of an aliquot of a
MEGAscript® reaction will give an absorbance reading in the linear range of a
spectrophotometer.
For single-stranded RNA, 1 A260 unit corresponds to 40 µg/mL, so the RNA yield can
be calculated as follows:

A260 x dilution factor x 40 = µg/mL RNA

Assessing RNA yield with RiboGreen®

If you have a fluorometer, or a fluorescence microplate reader, Molecular Probes’
RiboGreen® fluorescence-based assay for RNA quantitation is a convenient and
sensitive way to measure RNA concentration. Follow the manufacturer’s instructions
for using RiboGreen®.

Quantitation by ethidium bromide fluorescence

The intensity of ethidium bromide staining can be used to get a rough estimation of the
RNA yield.
Ethidium bromide spot assay
If unincorporated nucleotides have been removed, an ethidium bromide spot
assay can be used to quantitate RNA concentration. Make a standard curve with
several 2-fold dilutions of an RNA solution of known concentration. Start at about
80 ng/µL, and go down to about 1.25 ng/µL. Make a few dilutions of the unknown
RNA, and add ethidium bromide to 1 ng/µL to each dilution of both RNAs. Spot
2 µL of the standard curve RNA samples and the unknown RNA dilutions onto
plastic wrap placed on a UV transilluminator. Compare the fluorescence of the
RNAs to estimate the concentration of the unknown RNA sample. Make sure that
the sample dilutions are in the linear range of ethidium bromide fluorescence.
This assay will detect as little as 5 ng of RNA with about a 2-fold error.
Denaturing gel electrophoresis
If unincorporated nucleotides have not been removed from the reaction, an
aliquot of the MEGAscript® reaction should be run on a denaturing agarose or
acrylamide gel alongside an aliquot of an RNA of known concentration. See
section “Additional Procedures” on page 23 for instructions on running gels. Stain
the samples with ethidium bromide, and simply compare the intensity of the
unknown sample to the known RNA to estimate its concentration.

12 MEGAscript® Kit User Guide

 MEGAscript® Kit
MEGAscript® Kit procedure

Agilent® bioanalyzer and RNA LabChip® Kits

RNA can be evaluated on an Agilent® 2100 bioanalyzer using one of their RNA
LabChip® Kits to get an idea of what percentage of the transcription products are full-
length. Follow the manufacturer’s instructions for using the bioanalyzer and the RNA
LabChip® Kit.

Quantitation by trace radiolabeling

1. TCA precipitation
If a trace amount of radiolabel was included in the MEGAscript® reaction, it can
be used to determine yield. First precipitate with TCA to determine the
proportion of radiolabel that was incorporated into RNA. (TCA will precipitate
nucleic acids as small as 18 nt.)
a. Dilute 1 µL of the completed MEGAscript® reaction into 150 µL of carrier
DNA or RNA (1 mg/mL), and mix thoroughly. Sheared Salmon Sperm DNA
(Cat. no. AM9680) can be used for this purpose.
b. Transfer 50 µL of the RNA + carrier nucleic acid mixture to aqueous
scintillation cocktail and count in a scintillation counter. This will measure
the total amount of radiolabel present in the reaction mixture
(unincorporated and incorporated counts).
c. Transfer another 50 µL of the RNA + carrier nucleic acid mixture to a
12 x 75 mm glass tube, and add 2 mL of cold 10% TCA (trichloroacetic acid).
Mix thoroughly and place on ice for 10 min. This will precipitate nucleic
acids, but not free nucleotides.
d. Collect the precipitate via vacuum filtration through a Whatman GF/C glass
fiber filter (or its equivalent).
e. Rinse the tube twice with 1 mL of 10% TCA and then rinse once with 3–5 mL
of 95% ethanol. Pass each of the rinses through the GF/C filter.
f. Place the filter in a scintillation vial, add aqueous scintillation cocktail, and
count in a scintillation counter. This will give the TCA precipitated counts
(radiolabel that was incorporated into RNA).
g. Divide the cpm in the above step by the cpm in step b. to determine the
fraction of label incorporated into RNA (multiply by 100 for percent
incorporation).
TCA ppt cpm x 100 = % incorporation
Total cpm

2. Calculation of yield
Once the percent incorporation of radiolabel is known, it can be used to calculate
the mass yield of RNA transcribed in the MEGAscript® reaction. Each 1%
incorporation corresponds to about 2 µg of RNA synthesized in a T7 or T3
reaction. For SP6 Kits, each 1% incorporation corresponds to about 1.3 µg of RNA
synthesized.
In a T7 or T3 reaction, if all four nucleotides are incorporated equally, 198 µg of
RNA will be produced if all of the 7.5 mM of NTP is incorporated into RNA (the
sum of the molecular masses of the 4 nucleotides in RNA is about 1320).

MEGAscript® Kit User Guide 13

 MEGAscript® Kit
Troubleshooting

7.5 mM 1320 g 1.98 x 105 g =

x x 20 µL = 1.98 x 10–4 g = 198 µg
106 µL 1000 mM 109

The standard SP6 MEGAscript® reaction contains 5 mM of each NTP, so when

that value is substituted in the above equation the maximum theoretical yield for
SP6 MEGAscript® reactions is 132 µg.

Troubleshooting
Use of the Control The pTRI-Xef control template is a linearized TRIPLEscript plasmid containing the
Template 1.85 kb Xenopus elongation factor 1α gene under the transcriptional control of tandem
SP6, T7, and T3 promoters (pTRI-Xef 1). Any one of the three RNA polymerases can be
used to synthesize the control RNA. When transcribed with the following RNA
polymerases, sense transcripts of the indicated length are produced from this
template:

Enzyme Transcript Size

SP6 1.92 kb
T7 1.89 kb
T3 1.86 kb

These transcripts will produce a 50.2 kD protein when translated.

1. Reaction setup
Use 2 µL (1 µg) of pTRI-Xef in a standard MEGAscript® reaction as described in
section “Transcription reaction assembly” on page 9.

2. Expected yield from the control reaction

The yield from the control reaction for T7 and T3 Kits should be 80–100 µg of
RNA, and 50–80 µg with the SP6 Kits. If a [32P]NTP was added to the
transcription reaction as a tracer, approximately 30–40% of the radiolabel should
be incorporated.

3. What to do if the control reaction doesn’t work as expected

If the yield of RNA from the control reaction is low, something may be wrong
either with the procedure or the kit, or the quantitation is in error.
a. Double check the RNA quantitation
To confirm that the quantitation is correct, verify the yield by an independent
method. For example if TCA precipitation was used to assess yield, try also
running an aliquot of the reaction on an agarose gel.
b. Try the positive control reaction again
If the yield is indeed low by two different measurements, there may be a
technical problem with the way the kit is being used. For example, the
spermidine in the 10 X Reaction Buffer may cause precipitation of the
template DNA if it is not diluted by the other ingredients prior to adding the
DNA. (This is the reason that the water is added first.) Repeat the reaction,
following the procedure carefully. If things still don’t go well, contact
Technical Services for more ideas.

14 MEGAscript® Kit User Guide

 MEGAscript® Kit
Troubleshooting

Troubleshooting The amount of RNA synthesized in a standard 20 µL MEGAscript® reaction should be

low yield 50 µg and may exceed 100 µg; however, there is a great deal of variation in yield from
different templates. If the yield is low, the first step in troubleshooting the reaction is to
use the pTRI-Xef control template in a standard MEGAscript® reaction.

1. Neither my template nor the control reaction works

Double check that you have followed the procedure accurately, and consider
trying the control reaction a second time. If the kit control still doesn’t work, it is
an indication that something may be wrong with the kit, call our Technical
Support group for more ideas.

2. The control reaction works, but my template gives low yield

If the transcription reaction with your template generates full-length, intact RNA,
but the reaction yield is significantly lower than the amount of RNA obtained
with the pTRI-Xef control template, it is possible that contaminants in the DNA
are inhibiting the RNA polymerase. A mixing experiment can help to differentiate
between problems caused by inhibitors of transcription and problems caused by
the sequence of a template. Include three reactions in the mixing experiment,
using the following DNA templates:

1. 1 µL pTRI-Xef control template

2. experimental DNA template (0.5 µg plasmid or
2–6 µL PCR product)
3. a mixture of 1 and 2

Assess the results of the mixing experiment by running 2–4 µL of a 1:5 dilution of
each transcription reaction on a denaturing gel as described in section “Analysis
of transcription products by gel electrophoresis” on page 23.
a. Transcription of the control template is inhibited by the presence of your
template. (See Figure 2.A)
This implies that inhibitors are present in your DNA template. Typical
inhibitors include residual SDS, salts, EDTA, and RNases. Proteinase K
treatment frequently improves template quality.
Treat template DNA with Proteinase K (100–200 µg/mL) and SDS (0.5%) for
30 min at 50°C, followed by phenol/chloroform extraction and ethanol
precipitation. Carry-over of SDS can be minimized by diluting the nucleic
acid several fold before ethanol precipitation, and excess salts and EDTA can
be removed by vigorously rinsing nucleic acid pellets with cold 70% ethanol
before resuspension.
b. Adding your template to the reaction with the control template does not
inhibit synthesis of the control RNA. (See Figure 2.B)

MEGAscript® Kit User Guide 15

 MEGAscript® Kit
Troubleshooting

This result indicates that the problem may be inherent to your template.
i. Use a different polymerase for transcription if possible
Templates differ in transcription efficiency depending on the initiation
efficiency of their promoter, the presence of internal termination signals, and
their length. If the problem is due to the first or second of these issues,
changing the RNA polymerase promoter used to transcribe the fragment
may alleviate the problem.
ii. Check the amount and quality of template
Another possibility is that the template quantitation is inaccurate. If
quantitation was based on UV absorbance and the DNA prep had
substantial amounts of RNA or chromosomal DNA, the amount of template
DNA may be substantially less than the calculated value.
Also, check an aliquot of the template DNA on an agarose gel to make sure it
is intact and that it is the expected size.
iii. Extend the reaction time
Another parameter that can be adjusted is reaction time. Extending the
standard 2–4 hr incubation to 6–10 hr or even overnight may improve yield.

Figure 2 Possible outcomes of mixing experiment.

1 - control template
2 - experimental template
3 - mixture of 1 and 2

A
1 2 3

B
1 2 3

Multiple reaction Reaction products produce a smear when run on a denaturing gel
products, If the RNA appears degraded (e.g. smeared), remove residual RNase from the
transcripts of the DNA template preparation before in vitro transcription. Do this by digesting the
wrong size DNA prep with proteinase K (100–200 µg/mL) in the presence of 0.5% SDS for
30 min at 50°C, follow this with phenol/chloroform extraction. The RNase
Inhibitor that is present in the transcription reaction, can only inactivate trace
RNase contamination. Large amounts of RNase contamination will compromise
the size and amount of transcription products.

Reaction products run as more than one band, or as a single band smaller than
expected
1. Sample is not adequately denatured in the gel

16 MEGAscript® Kit User Guide

 MEGAscript® Kit
Troubleshooting

If the amount of RNA produced is acceptable, but the size of the product is
unexpected, consider that the RNA may be running aberrantly due to secondary
structure. Sometimes the RNA will run as two distinct bands on a native agarose
gel, but when the same RNA is run on a denaturing gel, it will migrate as a single
band of the expected size.

2. Premature termination of transcription

If denaturing gel analysis shows the presence of multiple bands or of a single
band smaller than the expected size, there may be problems with premature
termination by the polymerase. Possible causes of this are sequences which
resemble the phage polymerase termination signals, stretches of a single
nucleotides, and GC-rich templates.
• Different phage polymerases recognize different termination signals, so
using a different polymerase promoter may help.
• Termination at single polynucleotide stretches can sometimes be alleviated
by decreasing the reaction temperature (Krieg, P.A. 1990). We suggest testing
30°C, 20°C and 10°C. However, decreasing the reaction temperature will also
significantly decrease the yield of the reaction.
• There is a report that single-stranded binding (SSB) protein increased the
transcription efficiency of a GC rich template (Aziz and Soreq, 1990).

Reaction products are larger than expected

1. Persistent secondary structure
MEGAscript® products occasionally run as 2 bands; 1 larger than the expected
size, and 1 at the expected size. This may occur with transcripts from the pTRI-Xef
control template, even when the RNA is denatured during the electrophoresis.
This phenomenon occurs because of persistent secondary structure. To verify this,
the band that migrates at the expected size can be excised from the gel and run in
a second denaturing gel. If the RNA runs as a doublet in the second gel also, it is a
good indication that the larger band is simply an artifact of electrophoresis.

2. Circular template
Longer-than-expected transcription products will be seen if any of the template
molecules are circular. This is typically caused by incomplete digestion of a
plasmid template. Since the RNA polymerases are extremely processive, even a
small amount of circular template can produce a large amount of RNA.

MEGAscript® Kit User Guide 17

 MEGAscript® Kit
Troubleshooting

18 MEGAscript® Kit User Guide

 A Supplemental Information

Related products available from Life Technologies

MEGAclear™ MEGAclear™ purifies RNA from transcription, and other enzymatic reactions
yielding high quality RNA free of unincorporated nucleotides, enzymes and buffer
Cat. no. AM1908
components with close to 100% recovery of input RNA.
mMESSAGE mMACHINE® High yield transcription kits for production of large amounts of capped RNA.
These kits employ Life Technologies’s novel, patented MEGAscript® technology,
Cat. nos. AM1340, AM1344, AM1348
and include cap analog. Kits are available with T7, SP6, and/or T3 RNA
polymerase.
mMESSAGE mMACHINE® T7 Ultra The mMESSAGE mMACHINE® T7 Ultra Kit incorporates Anti-Reverse Cap Analog
Kit (ARCA) into Life Technologies's patented high yield transcription technology to
generate RNA transcripts that yield much higher amounts of protein when
Cat. nos. AM1345
translated in vitro or in vivo, than messages with traditional cap analog. The
increased translation efficiency provided by ARCA is further enhanced by the
addition of a poly(A) tail to the transcripts. Experiments comparing ARCA and
ARCA/poly(A) tailed transcripts to cap analog and cap analog/poly(A) tailed
transcripts show significantly higher levels of protein synthesis with ARCA capped
RNA.
RNase-free Tubes & Tips RNase-free tubes and tips are available in most commonly used sizes and styles.
They are guaranteed RNase- and DNase-free.

RNaseZap® RNase Decontamination Solution. RNaseZap® is simply sprayed, poured, or wiped

onto surfaces to instantly inactivate RNases. Rinsing twice with distilled water will
Cat. nos. AM9780, AM9782, AM9784
eliminate all traces of RNase and RNaseZap®.
NucAway™ Spin Columns Guaranteed RNase- and DNase-free, NucAway™ Spin Columns provide a fast,
efficient way to remove unincorporated nucleotides, and to effect buffer exchange
Cat. no. AM10070
after probe synthesis and other reactions.
RNA Storage Solutions Three different choices for safe, RNase-free resuspension of RNA pellets. Choose
one or more of the following:
THE RNA Storage Solution, Cat. no. AM7000, AM7001
0.1 mM EDTA, Cat. no. AM9912
TE Buffer, Cat. no. AM9860, AM9861
TURBO DNA-free™ Kit The TURBO DNA-free™ Kit employs Life Technologies’s exclusive TURBO™ DNase
(patent pending); a specifically engineered hyperactive DNase that exhibits up to
Cat. no. AM1907
350% greater catalytic efficiency than wild type DNase I. The kit also includes a
novel reagent for removing the DNase without the hassles or hazards of phenol
extraction or alcohol precipitation—and without heat inactivation, which can cause
RNA degradation. TURBO DNA-free™ is ideal for removing contaminating DNA
from RNA preparations.

MEGAscript® Kit User Guide 19

 Appendix A Supplemental Information
A Quality control

Electrophoresis Reagents Life Technologies offers gel loading solutions, agaroses, acrylamide solutions,
powdered gel buffer mixes, nuclease-free water, and RNA and DNA molecular
weight markers for electrophoresis.
Proteinase K Proteinase K is a non-specific serine protease commonly used in molecular
biology to remove protein contaminants from nucleic acids. Life Technologies
Cat. no. AM2542, AM2548
supplies Proteinase K in powder form, and as a 50% glycerol solution.
Phenols Life Technologies offers a full line of prepared phenol solutions for most
molecular biology needs. These premixed, quality-tested, saturated phenols are
ready-to-use and eliminate the handling concerns associated with preparing
phenol for use from solid phenol.
Cap Analog & Variants Cap analog, m7G(5')ppp(5')G, is used for the synthesis of 5' capped RNA by in vitro
transcription. Cap analog is also used as a highly specific inhibitor of the initiation
step of protein synthesis. Life Technologies also offers cap analog variants. All of
the Cap Analog products are tested in vitro transcription, and are certified
nuclease-free.
ARCA 7-methyl (3'-0-methyl) GpppG, anti-reverse cap analog, can be added to in vitro
transcription reactions to produce capped RNA transcripts that incorporate the
Cat. no. AM8045
cap only in the correct orientation.

Quality control
Functional testing All components are tested in a functional MEGAscript® assay as described in this
procedure. A 20-µL reaction containing 1 µg of the control template DNA which codes
for a ~1.9 kb transcript synthesized >90 µg of RNA after a 2 hr incubation.

Nuclease testing Relevant kit components are tested in the following nuclease assays:

RNase activity
A sample is incubated with labeled RNA and analyzed by PAGE.

Nonspecific endonuclease activity

A sample is incubated with supercoiled plasmid DNA and analyzed by agarose gel
electrophoresis.

Exonuclease activity
A sample is incubated with labeled double-stranded DNA, followed by PAGE
analysis.

Protease testing A sample is incubated with protease substrate and analyzed by fluorescence.

20 MEGAscript® Kit User Guide

 B Recipes

10X TBE TBE is generally used at 1X final concentration for preparing gels and/or for gel
running buffer.

IMPORTANT! Do not treat TBE with diethylpyrocarbonate (DEPC).

Concentration Component for 1 L

0.9 M Tris base 109 g

0.9 M Boric Acid 55 g
20 mM 0.5 M EDTA solution 40 mL

Dissolve with stirring in about 850 mL nuclease-free water. Adjust the final
volume to 1 L.
Alternatively, Life Technologies offers nuclease-free solutions of 10X TBE
(Cat. nos. AM9863, AM9865) and ready-to-resuspend powdered 10X TBE packets
(Cat. no. AM9864). Both are made from of ultrapure molecular biology grade
reagents.

Denaturing 5% acrylamide /8M urea gel

acrylamide gel mix 15 mL is enough gel solution for one 13 x 15 cm x 0.75 mm gel.

1. Mix the following:

for 15mL Component

7.2 g Urea (high quality)

(Cat. no. AM9902)
1.5 mL 10X TBE
1.9 mL 40% Acrylamide (19 acryl:1 bis-acryl)
(Cat. no. AM9022, AM9024)
to 15 mL ddH2O

2. Stir at room temperature until the urea is completely dissolved, then add:
120 µL 10% ammonium persulfate
16 µL TEMED

3. Mix briefly after adding the last two ingredients, which will catalyze
polymerization, then pour gel immediately. (It is not necessary to treat the gel
mixture with diethylpyrocarbonate)

MEGAscript® Kit User Guide 21

 Appendix B Recipes
B

Gel set up
• Follow the manufacturers instructions for the details of attaching gels to the
running apparatus.
• Use 1X TBE as the gel running buffer.
• It is very important to rinse the wells of urea-containing gels immediately before
loading the samples.

Electrophoresis conditions
Gels should be run at about 20 V/cm gel length; for 13 cm long gel this will be about
250 V. Alternatively, denaturing acrylamide gels of this size can be run at ~25 mAmp,
constant current.

RNase-free water 1. Add DEPC to 0.05% to double-distilled, deionized water (i.e. add 0.5 mL per liter
of water).

2. Stir well, incubate several hours to overnight at 37°C or 42°C.

3. Autoclave 2 L or smaller volumes for at least 45 min. The scent of DEPC should be
either not detectable or only very slightly detectable.

22 MEGAscript® Kit User Guide

 C Additional Procedures

Analysis of transcription products by gel electrophoresis

Agarose or The size of MEGAscript® reaction products can be assessed by running an aliquot of
acrylamide? the reaction on an agarose or polyacrylamide gel. Transcripts larger than about 1.5 kb
should be run on agarose gels, whereas polyacrylamide gels (4–5%) are better for
sizing smaller transcripts. Since secondary structure in the transcript may cause
aberrant migration and/or multiple bands, the gel should be run under denaturing
conditions. For agarose gels, this means glyoxal or formaldehyde gels, prepared and
run according to standard procedures (Molecular Cloning, A Laboratory Manual,
1989). Instructions for preparing and running denaturing acrylamide gels are supplied
in section “Recipes” on page 21.

Sample To get good resolution of the RNA, load ~1 µg per gel lane. For denaturing
preparation polyacrylamide gels add an equal volume of Gel Loading Buffer II to each sample, and
heat for 3–5 min at 80–90°C. (Gel Loading Buffer II cannot be used with glyoxal
agarose gels and it will not completely denature samples run on formaldehyde agarose
gels. Use a loading buffer specifically formulated for the type of agarose gel you plan
to run.)
To stain the RNA with ethidium bromide during electrophoresis do one of the
following:

1. Add 0.5 µg/mL ethidium bromide to the gel mix

2. Add 0.5 µg/mL ethidium bromide to the running buffer
3. Add 10 µg/mL ethidium bromide to the RNA samples (and gel loading buffer)
before loading the gel.
(Because single-stranded nucleic acids bind ethidium less efficiently than double-
stranded nucleic acids, the fluorescence of RNA samples on a denaturing agarose gel
will be less intense than the same amount of DNA.)

Visualizing reaction Ethidium bromide stained samples

products View ethidium bromide stained gels on a UV transilluminator. Ideally there will be a
single, tight band at the expected molecular weight. See section “Multiple reaction
products, transcripts of the wrong size” on page 16 for troubleshooting suggestions if
this is not what appears on your gel.

Radioactively-labeled transcripts
If the transcription reaction contained a radiolabeled nucleotide tracer (e.g. [α-
32P]UTP), the RNA can be visualized by autoradiography. Agarose gels should be
dried before exposing to X-ray film, but thin (0.75 mm thick) polyacrylamide gels may
be transferred to filter paper, covered with plastic wrap, and exposed directly (when

MEGAscript® Kit User Guide 23

 Appendix C Additional Procedures
C Optimizing yield of short transcripts

32P is used). Approximate exposure times for visualizing low specific activity
transcripts (e.g. when 1 µL of 800 Ci/mmol, 10 mCi/mL [α-32P] UTP was used in the
MEGAscript® reaction) are about 10–30 min with an intensifying screen, or several
hours to overnight without a screen, when 1 µL of the undiluted reaction is run on the
gel. A recipe for standard denaturing (i.e. 8 M urea) polyacrylamide gels is given in
section “Recipes” on page 21.

Optimizing yield of short transcripts

The MEGAscript® Kit is designed to function best with transcription templates larger
than ~0.5 kb. Under these conditions, 1 µg of plasmid DNA template per 20 µL
reaction gives maximal RNA yield. Increasing the incubation time, template, or
polymerase concentration does not generally increase the yield of the reaction.
However, with smaller templates, these parameters may require adjustment to
maximize reaction yields.
Several types of small transcript templates (<0.5 kb) can be used in MEGAscript®
reactions. These include plasmid vectors containing small inserts, PCR products, and
synthetic oligonucleotides which can either be entirely double-stranded or mostly
single-stranded with a double-stranded promoter sequence (Milligan et al. 1987).
Using oligonucleotides, and PCR-derived templates, almost all of the DNA is template
sequence, compared to plasmid templates which include non-transcribed vector DNA.

1. Increase the reaction time

Increasing the incubation time is the easiest variable to change and should be
tried first. Try increasing the incubation time to 4 or 6 hr. This allows each RNA
polymerase molecule to engage in more initiation events.

2. Increase the template concentration

Increasing the template concentration is the next variable that should be tested.
This can be helpful because, with short templates, the initiation step of the
transcription reaction is rate limiting. For a 60 nt transcript generated from an
85 bp PCR product, 50 ng of template was found to be saturating. Increasing the
amount of template 5 fold, to 250 ng, resulted in only a 30% increase in yield. It is
important to remember that 1 µg of a short template contains a much larger molar
amount of DNA than 1 µg of a longer template. The 50 ng of template in the
above example provided 0.9 pmoles of template (and 0.9 pmoles of promoters),
compared to the approximately 0.3 pmoles template in 1 µg of the pTRI-Xef
control template. In general, for optimum yield of short transcripts, use about 0.5–
2 pmoles of template. For very short templates (i.e. ~20–30 nt), use the upper end
of this range.
If the short template is contained in a plasmid, it may not be possible to add the
optimum molar amount. For example, 2 pmoles of template consisting of a 30 bp
insert in a 2.8 kb vector would require 4 µg of plasmid DNA. Such large mass
amounts of DNA may be detrimental. Thus, it is better to either remove the
template from the vector, or to do the transcription reaction under conditions of
sub-optimal template concentration.

3. Increase the RNA polymerase concentration

24 MEGAscript® Kit User Guide

 Appendix C Additional Procedures
Synthesis of capped RNA transcripts C

The concentration of RNA polymerase in the kit is optimal for transcription of

templates larger than 500 nucleotides, templates coding much smaller transcripts
may benefit from adding additional RNA polymerase. Adding 200 units more
polymerase may increase yields with very short templates by allowing more
initiation events to occur in a given amount of time (see figure 3). We suggest
adding high concentration polymerase (e.g. Cat. nos. AM2075, AM2085, and
AM2063), not the 10X Enzyme Mix from the MEGAscript® Kit. Increasing the
enzyme should be the last variable tested after increasing incubation time and
optimizing template concentration.

Figure 3 RNA Polymerase Titration in MEGAscript® Reaction with an 85 bp Template.

MEGAscript® reactions used 200 ng of an 85 bp PCR product that codes a 60 nt RNA. Incubation
was for 6 hours, and reaction products were quantitated by measuring the incorporation of a
trace amount of 32P-UTP.

RNA Synthesized (µg)

Units T7 Polymerase

Synthesis of capped RNA transcripts

Background In vivo, most mRNA molecules have a 5' 7-methyl guanosine residue or cap structure
which functions in initiation of protein synthesis and protects mRNA from
degradation by intracellular nucleases. Capped in vitro transcripts can be synthesized
by adding cap analog directly to the MEGAscript® reaction. It is frequently not
necessary to cap RNA for in vitro translation experiments. The Retic Lysate IVT™
translation Kit, for example, is supplied with alternative buffers optimized for
translating uncapped mRNA.
Note: mMESSAGE mMACHINE® Kits contain cap analog premixed with nucleotides:
they are optimized for the synthesis of capped RNAs.

In vitro transcripts which will be microinjected into oocytes or other cells, used for
transfection experiments or for in vitro splicing reactions, should generally be capped.
The standard strategy to synthesize capped transcripts is to reduce the level of GTP to
10% of the normal concentration and replace the remaining 90% with cap analog
(Krieg and Melton, 1987). This results in a high proportion of capped transcripts, but
unfortunately it also significantly decreases the yield of the transcription reaction,
often to less than 20% of normal yield. To conserve cap analog which is a relatively
expensive reagent, and to increase the RNA yield, the ratio of cap analog to GTP can be
decreased. Four to one cap:GTP is frequently used, but ratios as low as 1:1 are also
used. The table below shows the effect of varying the ratio of cap analog to GTP on the
yield of RNA.

MEGAscript® Kit User Guide 25

 Appendix C Additional Procedures
C Synthesis of capped RNA transcripts

Cap analog: RNA synthesized (µg)

Concentration of cap analog:GTP
GTP ratio (mM)
3 hour 6 hour

0:1 0: 7.5 91.1 132.6

1:1 3.75: 3.75 87.6 132.6
2:1 5: 2.5 58.2 60.3
4:1 6: 1.5 43.1 43.8
8:1 6.67: 0.83 27.2 28.2
10:1 6.82: 0.68 24.6 25.5

In this experiment, the quantity of RNA synthesized depended on the concentration of

GTP in the reaction. When the concentration of GTP is reduced from 7.5 mM to
3.75 mM the yield of RNA was unaffected, but reducing the GTP to 2.5 mM reduced
RNA yield by approximately 50%. Further decreases in GTP concentration resulted in
even larger decreases in yield. A similar experiment is shown in Figure 5 except that a
template coding for the smaller ß-globin mRNA was used.
Figure 4 Effect of Cap Analog:GTP Ratios on the Yield of Globin RNA. Globin mRNA was
synthesized in T7-MEGAscript® reactions in which the concentration of cap analog was varied
in a similar manner as shown in the table on the previous page. The reactions were incubated
at 37°C using 1 µg of T7-globin template DNA (0.5 kb insert).
50
3 hrs
45 6 hrs
Globin RNA Synthesized (µg)

40

35

30

25

20

15

10
0 1 2 3 4 5 6 7
Concentration Cap Analog

26 MEGAscript® Kit User Guide

 Appendix C Additional Procedures
Synthesis of capped RNA transcripts C

Figure 5 Translation of Globin RNAs from Figure 4. Globin mRNA (6 µg/mL, a sub-saturating
level) was translated in with Retic Lysate IVT™ for 60 minutes at 30°C with 12.5 µCi of [35S]-
methionine (1200 Ci/mmol). The incorporation of acid-precipitable cpm shown is the average of
two duplicate samples.
100

90

80

Incorporation of [35S]-Met (thousand cpm)

70

60

50

40

30

20

10

0
0 1 2 3 4 5 6 7
Concentration Cap Analog

With both templates, RNA yield is dramatically reduced at levels of cap analog at
6 mM and GTP at 1.5 mM (a 4:1 ratio). These are the conditions we recommend for
most capped RNA synthesis reactions because at least 80% of the RNA synthesized
will be capped. Although the ratio of capped RNAs synthesized can be increased by
increasing the ratio of cap analog to GTP, the reduced yields don't generally justify it.
Two additional points worth noting. The total yield of RNA was higher with the larger
template. Also the transcription reaction goes to completion sooner with the larger
template. Therefore, it may be desirable to adjust the reaction time depending on the
length of the transcript and the concentration of GTP in the reaction. The translation of
globin mRNA in a reticulocyte lysate is known to be very dependent on the presence
of a 5' cap. Notice that in the experiment shown in figure 5, at a 4:1 ratio of cap analog
to GTP the translational efficiency was only 15% lower than with a 10:1 ratio.

Reaction set-up The reaction setup that follows uses a 4:1 ratio of cap analog to GTP.

1. Assemble the reaction at room temperature in the order shown: the final volume
is 20 µL.

IMPORTANT! Spermidine in the Reaction Buffer can lead to precipitation of the

template DNA if the reaction is assembled on ice.

Note: For convenience, equal volumes of the four ribonucleotide solutions can be
mixed together and 8 µL added to a standard 20 µL reaction as one component
instead of adding 2 µL of each of the four separate ribonucleotide solutions.

MEGAscript® Kit User Guide 27

 Appendix C Additional Procedures
C Using the MEGAscript® Kit to make RNA probes

Volume Component

to 20 µL Nuclease-free water
2 µL ATP solution (75 mM T7 or T3; 50 mM SP6)
2 µL CTP solution (75 mM T7 or T3; 50 mM SP6)
2 µL UTP solution (75 mM T7 or T3; 50 mM SP6)
2 µL 1:5 dilution of GTP solution (15 mM T7 or T3; 10 mM SP6)
to 4–6 mM Cap Analog (6 mM for T7 or T3; 4 mM for SP6):
3 µL of 40 mM stock = 6 mM
2 µL of 40 mM stock = 4 mM
2 µL 10X Reaction Buffer
(0.25–0.5 µL) (optional) labeled rNTP as a tracer, e.g. [α-32P]UTP (any
specific activity is acceptable)
-- µL 1 µg linearized template DNA
2 µL Enzyme Mix

2. Mix contents by flicking the tube or mixing with a pipettor and then microfuge
tube briefly to collect the reaction mixture at the bottom of the tube.

3. Incubate 2–4 hours and continue the procedure from step 4. on page 10.

Using the MEGAscript® Kit to make RNA probes

The MEGAscript® Kit can be used to transcribe low specific activity radiolabeled
probes, and non-isotopically labeled RNA probes. The MEGAscript® Kit should not be
used to prepare RNA probes that are radiolabeled to high specific activity, because the
kit is not configured to transcribe RNA efficiently in conditions of very low nucleotide
concentrations – use the MAXIscript® Kit instead.

Synthesis of low RNA probes that are radiolabeled to low specific activity are used to detect very
specific activity abundant RNA species such as ribosomal RNAs, or overexpressed messages. We do
not include a procedure here because the amount of radiolabel required in the reaction
radiolabeled
varies greatly depending on the specific activity needed. In general though, the
probes ribonucleotide concentration used with MEGAscript® Kits should not be changed, in
other words, use 7.5 mM of each NTP for T7 and T3 Kits, and 5 mM for SP6 Kits. Any
radiolabel added should contribute to this amount.

Synthesis of The MEGAscript® Kit can be used to synthesize large amounts of both biotinylated
nonisotopically and digoxigenin-labeled probes. These reactions are set up with a mixture of labeled
and unlabeled nucleotides at typical MEGAscript® nucleotide concentrations. Biotin-
labeled probes
or digoxigenin-modified nucleotides should be used at a ratio of 1:2 or 1:3 with
standard nucleotide. For most efficient incorporation, the pH of nucleotide solutions
should be close to neutrality. Gel purification or precipitation with LiCl or NH4OAc
and ethanol can be used to remove unincorporated nucleotides.

28 MEGAscript® Kit User Guide

 Appendix C Additional Procedures
Spin column preparation and use C

Spin column preparation and use

Unincorporated labeled nucleotides can be removed by size exclusion
chromatography on RNase-free Sephadex G-25 or G-50 spin columns. The following is
a procedure for the preparation and use of spin columns:

1. Resuspend and equilibrate Sephadex G-25 or G-50 with 2 volumes of TE (10 mM

Tris-HCL, pH 8.0, 1 mM EDTA), then wash with several volumes of TE.

2. Place the resuspended and washed resin in 1.5 volumes of TE in a glass bottle and
autoclave. Store at 4°C until use.

3. Rinse a 1–3 mL spin column thoroughly with distilled water; frits may be pre-
installed, or made by plugging the bottom of a 1 mL syringe with a support such
as siliconized glass beads.

4. Pipet 1–3 mL of the prepared, well mixed resin into the washed spin column.
Place the column in a 15 mL plastic centrifuge tube and spin at 2,000 rpm for
10 min in a centrifuge with a swinging-bucket rotor.

5. Place the end of the spin column containing the spun resin into an appropriate
microfuge tube (typically, 0.5 mL) and insert the assembly into a new 15 mL
centrifuge tube.

6. Load 20–100 µL of the sample onto the center of the resin bed (dilute sample with
nuclease-free water or TE Buffer if necessary), and spin at 2,000 rpm for 10 min.
The eluate collected in the microfuge tube should be approximately the same
volume as the sample loaded onto the column, and it will contain about 75% of
the nucleic acid applied to the column.

IMPORTANT! It is important that the centrifugation conditions for column

packing and sample purification be identical; varying them could lead to either
incomplete recovery or dilution of the sample. The spin column can be tested by
loading 100 µL of TE onto it and centrifuging: 100 µL of eluate should be
recovered. If recovery is much greater or less than 100 µL, the column is not
equilibrated and should be tested again.

MEGAscript® Kit User Guide 29

 Appendix C Additional Procedures
C Spin column preparation and use

30 MEGAscript® Kit User Guide

 D Safety

General safety
WARNING! GENERAL SAFETY. Using this product in a manner not specified
in the user documentation may result in personal injury or damage to the
instrument or device. Ensure that anyone using this product has received
instructions in general safety practices for laboratories and the safety
information provided in this document.
· Before using an instrument or device, read and understand the safety
information provided in the user documentation provided by the
manufacturer of the instrument or device.
· Before handling chemicals, read and understand all applicable Safety Data
Sheets (SDSs) and use appropriate personal protective equipment (gloves,
gowns, eye protection, etc). To obtain SDSs, see the “Documentation and
Support” section in this document.

Chemical safety
WARNING! GENERAL CHEMICAL HANDLING. To minimize hazards,
ensure laboratory personnel read and practice the general safety guidelines for
chemical usage, storage, and waste provided below, and consult the relevant
SDS for specific precautions and instructions:
Read and understand the Safety Data Sheets (SDSs) provided by the chemical
manufacturer before you store, handle, or work with any chemicals or
hazardous materials. To obtain SDSs, see the “Documentation and Support”
section in this document.
· Minimize contact with chemicals. Wear appropriate personal protective
equipment when handling chemicals (for example, safety glasses, gloves, or
protective clothing).
· Minimize the inhalation of chemicals. Do not leave chemical containers
open. Use only with adequate ventilation (for example, fume hood).
· Check regularly for chemical leaks or spills. If a leak or spill occurs, follow
the manufacturer's cleanup procedures as recommended in the SDS.
· Handle chemical wastes in a fume hood.
· Ensure use of primary and secondary waste containers. (A primary waste
container holds the immediate waste. A secondary container contains spills
or leaks from the primary container. Both containers must be compatible
with the waste material and meet federal, state, and local requirements for
container storage.).
· After emptying a waste container, seal it with the cap provided.
· Characterize (by analysis if necessary) the waste generated by the particular
applications, reagents, and substrates used in your laboratory.
· Ensure that the waste is stored, transferred, transported, and disposed of

MEGAscript® Kit User Guide 31

 Appendix D Safety
D Biological hazard safety

according to all local, state/provincial, and/or national regulations.

· IMPORTANT! Radioactive or biohazardous materials may require special
handling, and disposal limitations may apply.

Biological hazard safety

WARNING! Potential Biohazard. Depending on the samples used on this
instrument, the surface may be considered a biohazard. Use appropriate
decontamination methods when working with biohazards.

WARNING! BIOHAZARD. Biological samples such as tissues, body fluids,

infectious agents, and blood of humans and other animals have the potential to
transmit infectious diseases. Follow all applicable local, state/provincial, and/or
national regulations. Wear appropriate protective equipment, which includes
but is not limited to: protective eyewear, face shield, clothing/lab coat, and
gloves. All work should be conducted in properly equipped facilities using the
appropriate safety equipment (for example, physical containment devices).
Individuals should be trained according to applicable regulatory and company/
institution requirements before working with potentially infectious materials.
Read and follow the applicable guidelines and/or regulatory requirements in
the following:
In the U.S.:
· U.S. Department of Health and Human Services guidelines published in
Biosafety in Microbiological and Biomedical Laboratories found at:
www.cdc.gov/biosafety
· Occupational Safety and Health Standards, Bloodborne Pathogens
(29 CFR§1910.1030), found at:
www.access.gpo.gov/nara/cfr/waisidx_01/ 29cfr1910a_01.html
· Your company’s/institution’s Biosafety Program protocols for working with/
handling potentially infectious materials.
· Additional information about biohazard guidelines is available at:
www.cdc.gov
In the EU:
· Check local guidelines and legislation on biohazard and biosafety precaution
and refer to the best practices published in the World Health Organization
(WHO) Laboratory Biosafety Manual, third edition, found at: www.who.int/
csr/resources/publications/biosafety/WHO_CDS_CSR_LYO_2004_11/en/

32 MEGAscript® Kit User Guide

 Bibliography

Aziz RB and Soreq H (1990) Improving poor in vitro transcription from GC-rich genes.
Nucl. Acids Res. 18: 3418.
Browning KS (1989) Transcription and translation of mRNA from polymerase chain
reaction-generated DNA. Amplifications 3: 14–15.
Krieg PA and Melton DA (1987) In vitro RNA synthesis with SP6 RNA polymerase.
Meth. Enzymol. 155: 397–415.
Krieg PA (1990) Improved Synthesis of Full-Length RNA Probes at Reduced
Incubation Temperatures. Nucl. Acids Res. 18: 6463.
Milligan JF, Groebe DR, Witherell GW, and Uhlenbeck OC (1987) Oligoribonucleotide
synthesis using T7 RNA polymerase and synthetic DNA template. Nucl. Acids Res. 15:
8783–8798.
Molecular Cloning, A Laboratory Manual, 2nd edition. (1989) editor C Nolan, Cold
Spring Harbor Laboratory Press.
Mullis KB, and Faloona F (1987) Specific synthesis of DNA in vitro via a polymerase
catalyzed chain reaction. Meth. Enzymol. 155: 335–350.
Schenborn ET and Mierindorf RC (1985) A novel transcription property of SP6 and T7
RNA polymerases: dependence on template structure. Nucl. Acids Res. 13: 6223–6236.
Stoflet ES, Koeberl DD, Sarkar G, and Sommer SS (1988) Genomic amplification with
transcript sequencing. Science 239: 491–494.

MEGAscript® Kit User Guide 33

Bibliography

34 MEGAscript® Kit User Guide

 Documentation and Support

Obtaining SDSs
Safety Data d PRoduSheets (SDSs) are available from www.lifetechnologies.com/
support.
Note: For the SDSs of chemicals not distributed by Life Technologies, contact the
chemical manufacturer.

Obtaining support
For the latest services and support information for all locations, go to:
www.lifetechnologies.com/support
At the website, you can:
• Access worldwide telephone and fax numbers to contact Technical Support and
Sales facilities
• Search through frequently asked questions (FAQs)
• Submit a question directly to Technical Support
• Search for user documents, SDSs, vector maps and sequences, application notes,
formulations, handbooks, certificates of analysis, citations, and other product
support documents
• Obtain information about customer training
• Download software updates and patches

Limited product warranty

Life Technologies Corporation and/or its affiliate(s) warrant their products as set forth
in the Life Technologies' General Terms and Conditions of Sale found on Life
Technologies' website at www.lifetechnologies.com/termsandconditions. If you have
any questions, please contact Life Technologies at www.lifetechnologies.com/support.

MEGAscript® Kit User Guide 35

Headquarters
5791 Van Allen Way | Carlsbad, CA 92008 USA | Phone +1 760 603 7200 | Toll Free in USA 800 955 6288
For support visit lifetechnologies.com/support
lifetechnologies.com
14 September 2012