ORIGINAL RESEARCH

published: 26 November 2020

doi: 10.3389/fevo.2020.602190

Identification of Aedes (Diptera:

Culicidae) Species and Arboviruses
Circulating in Arauca, Eastern
Colombia
David Martínez 1 , Carolina Hernández 1 , Marina Muñoz 1 , Yulieth Armesto 2 ,
Andres Cuervo 2 and Juan David Ramírez 1*
1
Grupo de Investigaciones Microbiológicas-UR (GIMUR), Departamento de Biología, Facultad de Ciencias Naturales,
Universidad del Rosario, Bogotá, Colombia, 2 Unidad Administrativa Especial De Salud De Arauca, Arauca, Colombia

The identification of vector species and their natural infection with arboviruses results in
important data for the control of their transmission. However, for the eastern region
of Colombia, this information is limited. Therefore, this study morphologically and
molecularly identified species of the genus Aedes and the detection of arboviruses
(Dengue, Chikungunya, Zika, and Mayaro) in female mosquitoes (individually) present in
three municipalities (Saravena, Arauquita, and Tame) by amplifying the genetic material
Edited by: using RT-PCR (reverse transcriptase polymerase chain reaction) in the department
Jader Oliveira,
of Arauca, eastern Colombia. Inconsistencies between morphological and molecular
Sao Paulo State University, Brazil
identification were detected in 13 individuals with Aedes albopictus initially determined
Reviewed by:
Jinbao Gu, as Aedes aegypti based on morphology (n = 13). Molecular identification showed the
Southern Medical University, China simultaneous presence of A. aegypti (n = 111) and A. albopictus (n = 58) in the urban
Antônio Ralph Medeiros De
Sousa,
municipalities of Saravena and Arauquita. These individuals were naturally infected with
University of São Paulo, Brazil Dengue virus type 1 (DENV-1) and Chikungunya virus (CHIKV). The most frequent
*Correspondence: arbovirus was DENV-1 with an infection rate of 40.7% (11/27) for A. aegypti and 39.7%
Juan David Ramírez
(23/58) for A. albopictus, which was followed by CHIKV with an infection rate of 1.8%
[email protected]
for A. aegypti (2/111) and 6.9% for A. albopictus (4/58). Additionally, a mixed infection
Specialty section: of DENV-1 and CHIKV was obtained in 4.5% of A. aegypti (5/111). Zika virus (ZIKV)
This article was submitted to
and Mayaro virus (MAYV) infections were not detected. This study found that barcoding
Phylogenetics, Phylogenomics,
and Systematics, (fragment gene COI) is a successful method for identifying Aedes species. Additionally,
a section of the journal we recommend the individual processing of insects as a more accurate strategy for
Frontiers in Ecology and Evolution
arboviruses detection since the infection rate is obtained and co-infection between
Received: 02 September 2020
Accepted: 04 November 2020 DENV-1 and CHIKV is also possible.
Published: 26 November 2020
Keywords: arbovirus, dengue, Zika, Chikungunya, Mayaro, Aedes
Citation:
Martínez D, Hernández C,
Muñoz M, Armesto Y, Cuervo A and
Ramírez JD (2020) Identification
INTRODUCTION
of Aedes (Diptera: Culicidae) Species
and Arboviruses Circulating in Arauca,
Arboviruses (arthropod-borne diseases) have a major impact on public health in Latin America
Eastern Colombia. (Shope and Meegan, 1997; Espinal et al., 2019). DENV, ZIKV, and CHIKV have similar
Front. Ecol. Evol. 8:602190. epidemiological cycles and result in epidemics approximately every 3 years (Villar et al., 2015).
doi: 10.3389/fevo.2020.602190 DENV has the highest incidence due to the interaction of different factors such as socioeconomic

Frontiers in Ecology and Evolution | www.frontiersin.org 1 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

conditions, arbovirus control plans and the circulation of four a pivotal need to understand infection rates not only on humans
serotypes in Latin America where Dengue virus type 1 (DENV-1) but also on the arbovirus vectors to reveal disease transmission
has the highest prevalence (Azevedo et al., 2009; de la Cruz et al., dynamics. The eastern departments of Colombia present the
2019; Liu et al., 2020). highest incidence of DENV, CHIKV, and ZIKV. Additionally,
Individuals of the Aedes genus are found in areas with high due to its close proximity to Venezuela, attempting to identify
arbovirus rates, which is why it is associated with an infection MAYV is worthwhile (Lorenz et al., 2019). Therefore, this
cycle in urban areas (Beaty et al., 2016). Within the Aedes study morphologically and molecularly identifies Aedes species
genus, there are approximately 190 species; however, Aedes circulating in three municipalities of the department of Arauca
aegypti and Aedes albopictus are important for their vector (Colombia) and obtained sequences that were used to assess the
capacity of CHIKV, DENV, ZIKV, and MAYV (Freitas, 2010; precision of the molecular test used to identify A. aegypti and
Ramasamy et al., 2011; Vega-Rúa et al., 2014; Lounibos and A. albopictus. In addition, the infection by DENV-1, CHIKV,
Kramer, 2016). The morphological identification of these two ZIKV, and MAYV was attempted.
species is complex where individuals are severely damaged,
or their external morphological characteristics are altered such
as the pattern in the scutum (mesothorax sclerite) (Patsoula MATERIALS AND METHODS
et al., 2006; Sumruayphol et al., 2016). Due to these difficulties,
different authors mention that the identification of insects Location and Capture of Insects
based on deoxyribonucleic acid (DNA) can become a more The insects were captured in the department of Arauca in
efficient technique when classifying individuals (Rolo, 2020). the municipalities of Saravena (6◦ 570 1700 N, 71◦ 520 3600 W),
For this reason, the concept of the DNA barcoding emerges Arauquita (7◦ 010 3400 N, 71◦ 250 3800 W), and Tame (6◦ 270 3000
as a new tool for species discrimination. This tool uses a N, 71◦ 440 4100 W) (Figure 1). These sites were chosen due
small fragment of DNA which functions as a specific barcode to the high incidence of arboviral cases. The collection was
for each species. In insects, this fragment corresponds to conducted in the urban area of three municipalities; however,
a sequence of ∼ 650 base pairs (bp) located at the 50 in the municipality of Saravena, individuals were also captured
end of the cytochrome c oxidase subunit I gene (COI) in rural areas, because in this municipality there is not a
(Joyce et al., 2018). Therefore, it is important to conduct defined urban area, thus in the rural area there are different
molecular identification of species using barcoding to accurately farms that have potential breeding sites. Two samplings were
identify individuals. The precise identification of A. aegypti conducted, one in 2018 and the other in 2019, and each BG-
and A. albopictus is relevant because this information defines Mosquitaire was installed for three consecutive months during
characteristics for these species such as their biology and the rainy season (April–May–June). Six traps were installed in
vector capacity. the municipality of Saravena, 5 in Tame and 4 in Arauquita.
The positive detection of arbovirus and the frequency of In each trap, only adult females of the genus Aedes were
infection in vectors is reported as the minimum infection rate chosen, and subsequently, the pools were formed using only
(MIR), which is defined as the relationship between positive individuals belonging to the same species and according to
pools and the total number per 1,000 individuals (Gu et al., their morphological identification. The insects or pools were
2004). However, there are no studies with methodologies that stored in Invitrogen RNAlater (Salehi and Najafi, 2014) in
R

detect natural infection for arboviruses in single insects. In Latin jars marked with the coordinates and information regarding
America, A. aegypti has higher MIR values for CHIKV, DENV, the house and/or the collection site and transported to the
ZIKV, and MAYV compared to A. albopictus. Furthermore, microbiology laboratory of the Universidad del Rosario. Once
no CHIKV and MAYV infection has been detected in the in the laboratory, they were individually separated in Eppendorf
latter. In A. aegypti, DENV presents a higher range of MIR tubes for molecular identification of species, and in total, 169
compared to other viruses and ranges from 0.2 to 26 infected specimens were analyzed.
individuals per 1,000 individuals. Alternatively, ZIKV has a
MIR value ranging from 3 to 17 individuals and CHIKV Morphological and Molecular
ranges from 2 to 3 individuals. Finally, for MAYV, the only Identification of Aedes Species
reported value is 1.75 (Diallo et al., 2014; Guerbois et al., 2016; The morphological identification of Aedes genus individuals was
Huerta et al., 2017; Cevallos et al., 2018; Eiras et al., 2018; performed using a stereomicroscope following the taxonomic key
Garcia-Rejon et al., 2018). These data show that A. aegypti proposed by Forattini (1965) to identify insects to the genus level,
presents a higher rate of natural infection by arboviruses and the taxonomic review by Cova-Garcia et al. (1966) was used
compared to A. albopictus and this is attributed to the greater to identify species. Molecular identification of individual Aedes
presence of this species in urban areas, which indicates that species was conducted by amplifying a fragment of the COI gene
A. aegypti is the main vector of arboviruses and A. albopictus (barcoding) from the RNA of the insect. For technical reasons,
is the secondary vector in Latin America (Black et al., 2002; only the RNA of the insect could be obtained.
Paupy et al., 2009). RNA extraction was conducted with the Quick-
Focusing on both the frequency of the viral infection and RNATissue/Insect Microprep Kit (Zymo, # R2030) following the
the incriminated vector species in endemic areas is important to manufacturer’s recommended instructions, and the RNA
propose reliable prevention and control measures. Also, there is concentration was quantified in a NanoDrop (Thermo

Frontiers in Ecology and Evolution | www.frontiersin.org 2 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

FIGURE 1 | Municipalities where captures were conducted: Saravena (green), Arauquita (pink), and Tame (blue) in the department of Arauca (purple), Colombia. The
black dot indicates the urban area where the capture of individuals was made.

ScientificTM ). Subsequently, One-Step RT-PCR was conducted algorithm in the MEGA X v10.1 software (Sohpal et al., 2010).
from the RNA to generate cDNA (complementary DNA) and From the alignments, a network of haplotypes was generated
amplify the COI gene. PCR reactions were performed in a in PorpArt v1.7 software using the TCS algorithm (Clement
final volume of 20 µL containing 10 µL qScriptTM One-Step, et al., 2002), and haplotype diversity (h) was calculated in
Low ROXTM (Quantabio, Carlsbad, CA, United States), 10 µM DNAsp v6 (Librado and Rozas, 2009). A Maximum Likelihood
of each primer and 5 µL of RNA. The primers LCO1490 (ML) tree was built in the software IQtree (Nguyen et al.,
(50 -GGT CAA ATC ATA AAG ATA TTG G-3) and HCO2198 2014) using the Jukes–Cantor substitution model, and the
(50 -TAA ACT TCA GGG TGA CCA AAA AAT CA-30 ) were also support of the nodes was established from 5,000 bootstrap
used (Joyce et al., 2018). The thermal profile consisted of the replicates. The external group for the phylogenetic tree was Culex
following: one cycle at 50◦ C for reverse transcriptase activation spinosus (KM593059.1).
for 10 min followed by initial denaturation at 95◦ C for 1 min,
45 cycles of 94◦ C for 10 s, 60◦ C for 1 min and final extension at Arbovirus Detection
72◦ C for 10 min. The detection of each arbovirus (DENV-1/CHKV/ZIKV/MAYV)
The amplification of the gene fragment was conducted using was conducted on the RNA collected by qRT-PCR One Step
2.5% agarose gel electrophoresis in TBE 1x buffer and SYBR Safe R
using the corresponding primers and Taqman probes (Table 1).
(Invitrogen , Carlsbad, CA, United States) as the intercalating
R
Since Endogenous Flaviviral Elements have been identified in
agent and then visualized under UV light to observe a band of the mosquito genome (Houé et al., 2019), the chosen primers
∼650 base pairs (bp). Subsequently, the samples were sequenced have an analytical validation to avoid cross reactions. The qRT-
by the Sanger method if the band corresponding to the fragment PCR reactions for DENV-1, CHIKV, and ZIKV (per sample)
of the COI gene was observed. were performed in a final volume of 20 µL containing 10 µL
qScriptTM One-Step, Low ROXTM (Quantabio, Carlsbad, CA,
COI (Barcoding) Gene Sequence Analysis United States), 10 µM of each primer, 10 µM of the probe and
Sequence cleaning and alignment was performed in Seqman 5 µL of RNA. The protocol recommended by the WHO (World
software (Lasergene) and the nucleotide sequence was compared Health Organization [WHO], 2020) was used for the MAYV
to the Nucleotide Blast database1 ; the species were assigned detection. The thermal profile used for all arboviruses consisted
considering the percentage of identity, the coverage value of the following: one cycle for 50◦ C for reverse transcriptase
and e-value. The sequences were aligned using the MUSCLE activation for 10 min, followed by initial denaturation at 95◦ C
for 1 min, 40 cycles of 95◦ C for 15 s, 60◦ C for 1 min and
1
https://blast.ncbi.nlm.nih.gov/Blast.cgi final extension at 72◦ C for 10 min. The viral RNA from each

Frontiers in Ecology and Evolution | www.frontiersin.org 3 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

TABLE 1 | Primers and probes specific for each arbovirus. A kappa index of 0.764 and agreement of 91.1% (n = 154) were
obtained between species identification methods (taxonomic key
Virus Primers and Probes Gen (reference)
vs. molecular) (Cook, 2005). Inconsistencies were mainly evident
CHIKV F: TCACTCCCTGTTGGACTTGATAGA NS (non-structural protein) in the identification of 13 individuals (7.7%), where they were
R: TTGACGAACAGAGTTAGGAACATACC (Lanciotti et al., 2007) initially identified through morphology as A. aegypti while the
P: [FAM]-AGGTACGCGCTTCAAGTTCGGCG molecular marker analysis indicated that they were A. albopictus.
DENV DENV-1 NS5 (non-structural protein
5) (Santiago et al., 2013)
F: CAAAAGGAAGTCGYGCAATA COI Gene Sequence Analysis
R: CTGAGTGAATTCTCTCTGCTRAAC A 338 bp fragment of the COI gene was obtained. In the
P: [FAM]-CATGTGGYTGGGAGCRCGC haplotype network constructed from the sequences of the
MAYV F: GTGGTCGCACAGTGAATCTTTC E2 (envelope protein 2) individuals of the genus Aedes, 19 haplotypes were found
R: CAAATGTCCACCAGGCGAAG (Long et al., 2011)
(Figure 3). We observed two groups that corresponded to
P:[FAM]- the species A. aegypti (Orange) and A. albopictus (Purple)
ATGGTGGTAGGCTATCCGACAGGTC-
and are differentiated by 36 bp (Figure 3A). Additionally, the
carboxytetramethylrhodamine
[TAMRA] highest number of haplotypes of the two species was found in
ZIKV F: AARTACACATACCARAACAAAGTG GT NS5 (non-structural protein the municipality of Saravena (Azul) with 8 haplotypes of the
R: TCCRCTCCCYCTYTGGTCTTG0 5) (Faye et al., 2013) species A. aegypti and 9 haplotypes of the species A. albopictus
P: [FAM]-CTYAGACCAGCTGAAR-BBQ (Figure 3B). The diversity of haplotypes found in Saravena was
h = 0.806 and in Arauquita h = 0.498, and only one haplotype was
found in Tame. Furthermore, the global diversity of haplotypes
arbovirus was used as a positive control and was provided by for all individuals captured in Arauca was h = 0.639.
the virology group of the National Institute of Health and the The topology of the phylogenetic tree obtained from the
confirmation of positive tests was performed in duplicate. Finally, COI sequence alignment revealed two well-supported clusters
the infection frequency for each arbovirus species was expressed (bootstrap ≥ 90) that correspond to A. aegypti and A. albopictus
as the infection rate (infected individual/total individuals). (Figure 3C) with a genetic distance of 0.107 between the species.
Additionally, the genus Culex (included as an outgroup) formed
Statistical Analyses an independent clade in the species of genus Aedes.
Descriptive analyses of the frequency of each species and
natural infection of each arbovirus were performed based on Geographical Distribution of A. aegypti
percentages. In addition, the kappa index was calculated to and A. albopictus
identify the percentage of agreement between the identification For the results of the geographic distribution of individuals and
of A. aegypti and A. albopictus species by taxonomic code their natural infection by arboviruses, molecular identification
and molecular marker. A logistic regression, including the of the species was considered. Table 2 shows the information
intercept, was performed to identify the statistical associations regarding the frequency of A. aegypti individuals (n = 111) and
between arbovirus infection as a composite variable (y) and the A. albopictus (n = 58) by area and the municipality of capture.
explanatory variables: vector species, municipality and collection The species A. aegypti was present in the three municipalities
area. The species variable and collection area were transformed and only in urban areas (Figure 4A) and there was a greater
into dummies (1/0) using A. albopictus and the rural area as frequency of this species in the municipality of Saravena at 64.9%
references (0). Preliminarily, a main effects model was run (72/111). However, A. albopictus, which is only present in the
to identify variables potentially associated with the established municipalities of Saravena and Arauquita in both urban and rural
outcome and a p-value < 0.2 was significant. Subsequently, a areas (Figure 4A), showed a frequency of 74.1% (43/58) in the
step-by-step, second-level interaction model was executed, which
included interactions between vector species and the collection
area or municipality.

RESULTS
Morphological and Molecular
Identification of Aedes Species
In the two sampling periods, 169 specimens of Aedes were FIGURE 2 | Percentage of A. albopictus (purple) and A. aegypti (orange)
captured with 68% (n = 115) collected in the municipality of individuals identified by morphological and molecular testing. The dotted lines
Saravena, 15.4% (n = 26) in Arauquita and 16.6% (n = 28) mark the inconsistencies where individuals were initially assigned by
morphology to a different species compared to the one detected by molecular
in Tame. Overall, differences were observed in the number of
methods, and the latter is the technique by which individuals were ultimately
individuals identified as A. aegypti and A. albopictus between assigned for subsequent sequence analysis.
molecular and morphological identification methods (Figure 2).

Frontiers in Ecology and Evolution | www.frontiersin.org 4 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

FIGURE 3 | The haplotype network based on sequences of A. aegypti and A. albopictus collected in municipalities of the department of Arauca and colored by (A)
species and by (B) collection municipality. The lines in each branch indicate the number of mutational steps between haplotypes, and the size of the circle is
proportional to the number of individuals. (C) A maximum likelihood tree based on the JC model of A. aegypti and A. albopictus indivuduals from each place where
they were collected. Black dots indicate support bootstrap ≥ 90.

municipality of Arauquita. The above results show clear evidence individuals, while 9.8% (6/61) were infected by CHIKV and
of the presence of these two species in the urban area of the none of the individuals were infected with ZIKV or MAYV.
municipality of Saravena and Arauquita. In addition, a 4.5% frequency (5/111) of mixed infection by
arboviruses DENV-1 and CHIKV was found in A. aegypti.
Natural Infection by Arboviruses Table 2 shows the arbovirus infection rates in each species,
Of the 169 individuals collected from the genus Aedes, the and there was a higher infection rate observed in individuals of
overall rate of arboviruses (DENV-1 and CHIKV) infection the species A. albopictus. In Saravena was found 18 individuals
was 36.1% (61/169). The arbovirus with the highest frequency of A. aegypti and 17 of A. albopictus infected by DENV-
was DENV-1, which was found in 82% (50/61) of infected 1, while for CHIKV one individual of A. aegypti and two
individuals of A. albopictus were found. Only 5 individuals
of A. aegypti were found coinfected by DENV-1 and CHIKV.
TABLE 2 | Number and percentage of A. aegypti and A. albopictus captured per In Arauquita were found 5 individuals of A. aegypti and 6
year, area, municipality and infected with arboviruses.
individuals of A. albopictus infected by DENV-1, while for
A. aegypti n (%) A. albopictus n (%) Total CHIKV one individual of A. aegypti and two individuals of
A. albopictus were found in Tame, only 4 individuals of A. aegypti
Capture 111 (65, 7) 58 (34, 3) 169 were found infected for DENV-1. The logistic regression results
Year showed that the municipality of Arauquita is 7 times more
2018 51 (49) 53 (51) 104 likely to find infected individuals (OR = 7; 95% CI = 1.890–
2019 60 (92.3) 5 (7.7) 65 25.932; p = 0.004) compared to Tame. However, the municipality
Zone
of Saravena was 3.6 more likely to find infected individuals
Rural 0 37 (100) 37
compared to Tame (OR = 3.6; 95% CI = 1.165–11.025; p = 0.026)
Urban 111 (84.1) 21 (15.9) 132
(Figure 4B) in the Supplementary Table 1 are shown all the
Municipality
parameters of the models.
Saravena 72 (62.6) 43 (37.4) 115
Arauquita 11 (42.3) 15 (57.7) 26
Tame 28 (100) 0 28 DISCUSSION
Rate infection with arbovirus
DENV-1 27 (54) 23 (46) 50 (29.6) The A. aegypti and A. albopictus classification of individuals
CHIKV 2 (33.3) 4 (66.7) 6 (3.5) is mainly determined by morphological identification
Mixed (DENV-1 y CHIKV) 5 (100) 5 (3) (Kraemer et al., 2015), and few reports use molecular
Uninfected 77 (71.3) 31 (28.7) 108 (63,9) identification (Zamora-Delgado et al., 2015; Atencia et al., 2018).

Frontiers in Ecology and Evolution | www.frontiersin.org 5 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

FIGURE 4 | (A) The geographic location of A. aegypti (orange) and A. albopictus (purple) collected from the municipalities of Saravena, Arauquita, and Tame. (B) The
percentage of individuals infected by the municipalities of Arauquita, Saravena, and Tame.

Although, morphological identification is the most widely used According to the kappa index obtained in this study
classification technique, it has different limitations. During between the identification methods (k = 0.7643) (Cook, 2005),
the transport of individuals, they are susceptible to damage a deficiency in identification through morphology can occur
and modifications in their external parts, which can generate (Figure 2). This could be an indicator of an overestimate of
confusion during the classification of individuals (Sumruayphol A. aegypti by traditional morphology-based techniques. The
et al., 2016). Taking this into account, it is necessary to use main characteristic that permits differentiation between these
complementary tools that allow a correct identification of two species is the pattern in the scutum (mesothorax sclerite).
individuals. Among these tools it is recommended to use These patterns are described as susceptible to blurring during
molecular techniques such as DNA barcoding (Cook et al., insect storage processing (Patsoula et al., 2006). Therefore, there
2005; Anoopkumar et al., 2019). In this study was described may be a risk of incorrect morphological identification and any
the precision of taxonomic keys and DNA barcoding to classify error in this process has a negative effect on studies that make
individuals of the genus Aedes. conclusions on the biology and vector capacity of each of these
Regarding the analysis of the COI sequences, a global diversity insect species. In this scenario, molecular identification may
of haplotypes value of 0.639 was evident for species A. aegypti become more accurate (Chan et al., 2014). However, molecular
and A. albopictus. This value is similar to that reported by techniques are too expensive for routine use and especially in
Caldera et al. (2019) for individuals captured in Colombia and areas with high vector infestation. Therefore, we propose to use
Joyce et al. (2018) for El Salvador; these values are relatively this complementary tool mainly in three situations; (i) generate
high. This high haplotype diversity may be due to adaptation a baseline on the proportions of individuals per species in areas
processes for different environmental conditions and ecosystems where this information is not available, (ii) as a quality control
where the insect is exposed due to its cosmopolitan distribution. of morphological identification, choosing a random percentage
Accordingly, the high number and diversity of haplotypes of individuals to be confirmed by DNA barcoding and (iii)
present in Saravena (h = 0.806, Figure 3B) may be due to when individuals are damaged and morphological identification
evolutionary pressures that generate genetic changes in these cannot be performed.
dipteran species such as the use of insecticides. Between the Studies focusing on the distribution of A. aegypti and
two species, 36 mutations (Figure 3A) and a genetic distance A. albopictus conclude that their presence is due to the interaction
of 0.107 were found. According to Hoyos-Lopez et al. (2015), of different biotic and abiotic factors (Lozano-Fuentes et al.,
this value is found for inter-species ranges (0.022–0.2565) that 2012; Liang et al., 2019). This interaction is shown in the models
were previously reported in individuals of the Culicidae family. that show an association between land use and the presence of
The tree topology (Figure 3C) is consistent with these results A. aegypti and A. albopictus and the prevalence of arboviruses.
since it is evident that the individuals constitute two clusters The main aspects at risk are human settlements, horticulture and
grouped by species. Considering the groups formed by species livestock (Cheong et al., 2014), and this is mainly because these
in the haplotype network (Figure 3A) and the clustering by activities generate micro-habitats that favor the reproduction of
species in the phylogenetic tree (Figure 3C), it is possible to the vector (Sarfraz et al., 2012). In accordance with the above,
determine the precision of molecular tests to identify A. aegypti there is a coexistence of A. aegypti and A. albopictus in urban
and A. albopictus. areas of the Saravena and Arauquita municipalities (Figure 4A).

Frontiers in Ecology and Evolution | www.frontiersin.org 6 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

Countries, such as Brazil and Panama, show evidence of this (Boletín Epidemiológico Semanal (BES) Semana Epidemiológica
observation (Li et al., 2014; Whiteman et al., 2019). Therefore, 22, 24 al 30 de mayo, 2020). Furthermore, there is a need
the coexistence of these two species in the same area generates to conduct complementary entomo-virological surveillance to
a public health risk since they are two vectors contributing to actively search for human cases and to have a complete
the transmission of arboviruses in the same urban area. Future overview of the urban transmission of arboviruses. Nevertheless,
studies should consider evaluating the transmission dynamics of future studies should consider the detection of the other 3
arboviruses in this region by examining the plausible biological DENV serotypes in vectors to complement the understanding
competition of the two species. of transmission dynamics in this endemic region and due to
However, in the municipality of Arauquita the species that its proximity to Venezuelan states that are highly endemic for
is found in higher frequency is A. albopictus (Table 2). This DENV-4 (Grillet et al., 2019).
may be due to the different land uses in each municipality. For The results in this study show a higher infection rate by
example, in Arauquita, there is a high availability of natural DENV-1 and CHIKV in A. albopictus (Table 2) compared
water due to the presence of the Arauca river in the northern to A. aegypti. This does not agree with the values previously
part of the municipality. The above benefits the reproduction reported since the MIR values in A. aegypti are higher (Guerbois
of A. albopictus since this species has preferences for these et al., 2016; Huerta et al., 2017; Garcia-Rejon et al., 2018).
bodies of water compared to A. aegypti (Claeys et al., 2016). However, it was experimentally shown that A. albopictus is a
In this study we do not report data about immature collections vector more susceptible to infection than A. aegypti because the
to identify their most common breeding sites, however, this arbovirus dissemination rates were higher in nearly all strains
phenomenon has been previously reported in Vietnam and Brazil of A. albopictus tested (Turell et al., 1992). The dissemination
(Higa et al., 2010; Barbosa et al., 2020), and in Brazil, a spatial rate is associated with the CHIKV genotype, where A. albopictus
analysis was conducted that determined an association between is more susceptible to infection of the Asian genotype and
the presence of vectors, depending on the type of water body this genotype is reported more frequently than the African
(Lozano-Fuentes et al., 2012; Liang et al., 2019). Considering the genotype in Colombia (Camacho Burgos, 2019). The lack of
aforementioned, it is possible that other factors are interacting natural ZIKV infection is due to the low number of cases
in the municipalities that influence the geographical distribution reported in humans in the department of Arauca over the
of these species and subsequently the transmission dynamics of last 2 years (Boletín Epidemiológico Semanal (BES) Semana
the arboviruses. Epidemiológica 22, 24 al 30 de mayo, 2020). This confirms that
The logistic regression results show that in the municipality this arbovirus is not circulating in the urban cycle of the three
of Arauquita there is a higher risk of finding individuals sampled municipalities.
infected with arboviruses (Figure 4B). In accordance with However, the absence of individuals infected by MAYV may
our results, different models (Barmak et al., 2016; Massaro be because the insects processed in this study are part of the
et al., 2019; Zhu et al., 2019) show that human mobility is an urban cycle and no studies demonstrate the efficiency of viral
important factor for the increase in the incidence of DENV transmission in this cycle. However, the study by Pereira et al.
even over short distances, i.e., between cities. Considering the (2020) shows that under laboratory conditions, A. aegypti and
aforementioned, the municipality of Arauquita is in a border A. albopictus have the ability to become infected and the potential
area with Venezuela, and therefore, there is a high movement to transmit MAYV genotype D. Likewise, it is possible to infect
of humans that may maintain the virus in these areas. In mosquitoes with the virus from the saliva of individuals who
accordance with the aforementioned, Lizarazo et al. (2019) initially tested negative. This indicates that for the infection to
showed that DENV-1 strains isolated in Venezuela were closely occur, a low viral load is necessary, which cannot be detected
related to previously published sequences of this serotype in by PCR, and this is reflected in the MIR values of 0.4 (95%
Colombia. This corroborates the influence that the movement CI = 0.0–1.4) that are reported for this species (Maia et al.,
of people between these two countries has on the prevalence of 2019). This is why different studies propose viral enrichment
infection in insects. techniques that allow the viral sequences to increase, which is
DENV-1 was the arbovirus with the highest frequency in the corroborated by next generation sequencing (NGS) (Hall et al.,
population of infected individuals at 82% (50/61) and the overall 2014). Therefore, it is important that future studies implement
infection rate in A. aegypti and A. albopictus was 29.6% (50/169) viral enrichment techniques that allow virus detection even at
(Table 2). The DENV-1 serotype has also been detected more low concentrations.
frequently than other arboviruses in Indonesia, Mexico, Cuba, Natural coinfection between DENV-2 and CHIKV has been
Brazil, and Colombia (Velandia-Romero et al., 2017; Eiras et al., previously reported in A. albopictus, where an association with
2018; Garcia-Rejon et al., 2018; Gutiérrez-Bugallo et al., 2018; simultaneous circulation of these two arboviruses during a
Rahayu et al., 2019). The high frequency of this arbovirus may dengue outbreak in Central Africa is possible (Caron et al.,
be because the transmission in the urban cycle of DENV is 2012). In this study, a mixed DENV-1 and CHIKV coinfection
provided by the level of viremia of the hosts (humans) since rate of 4.5% (5/111) was found in A. aegypti. This shows a
individuals at the beginning of infection have high rates of simultaneous circulation of these two arboviruses within one
viremia (Duong et al., 2015; Martínez-Vega et al., 2015). This specimen, which can lead to coinfection in humans, where
agrees with the results obtained in this study, given that DENV- an increase in coinfection cases would lead to rapid genetic
1 is the most prevalent arbovirus in the department of Arauca evolution of the virus (Caron et al., 2012). There are two methods

Frontiers in Ecology and Evolution | www.frontiersin.org 7 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

to estimate the infection rate from detection by pools: MIR us a greater capture of individuals and a more general view of
(Minimum Infection Rate) and MLE (Maximum Likelihood the behavior of the infection of arboviruses in A. aegypti and
Estimate). However, to produce a correct estimate, it is necessary A. albopictus. Lastly, the non-sequencing of the positive samples
to obtain a sampling ≥ 1,000 individuals and sizes of small pools. for DENV1 and CHIKV and their comparison with sequences
Processing individually allows us to naturally observe mixed available on GenBank. In the future, studies on this region must
infections in vectors including the option to conduct molecular be also conducted to depict the molecular epidemiology of this
discrimination of Aedes species (Walter et al., 1980; Gu et al., arboviral agents for high resolution epidemiological surveillance.
2004). Therefore, the importance of conducting surveillance of
arboviruses in the individual vector in areas where there is no
information on natural infection in the vectors is important. This DATA AVAILABILITY STATEMENT
generates a baseline and avoids erroneous data regarding natural
arbovirus infection in each of the vectors. In places where such The datasets generated for this study can be found in online
a baseline exists and there are large samplings, the processing of repositories. The names of the repository/repositories and
insects by pools is possible. Future studies should compare the accession number(s) can be found in the article/Supplementary
most reliable method for expressing infection rates in arboviral Material.
diseases in terms of sensitivity and cost-effectiveness.

AUTHOR CONTRIBUTIONS
CONCLUSION
YA and AC designed the protocol and carried out the capture
This study reports on the natural CHIKV infection of A. aegypti of the individuals. DM, CH, and JR performed the processing of
and A. albopictus in Colombia, and a higher infection rate was the samples in the laboratory. MM carried out the statistical and
found in the latter species. This shows the susceptibility of this phylogenetic analysis of the results obtained. DM, CH, MM, and
species to infection by arboviruses. In addition, DENV-1 was the JR wrote the manuscript. All authors read and approved the final
arbovirus with the highest frequency in the collected individuals, version of the manuscript.
which may be associated with different factors such as the
transovarian transmission of the vector and human infected with
high viremias that can maintain constant transmission of the FUNDING
arbovirus. Expression of the natural infection data using infection
rates to obtain a value per individual on arbovirus infection is We would like to thank the Dirección de Investigación e
proposed which increased the infection rate and the finding of Innovación from Universidad del Rosario for funding this study
viral co-infections. Lastly, we demonstrated the coexistence of and providing the editing English service of ENAGO and cover
A. aegypti and A. albopictus in urban areas of Saravena and the publication fees.
Arauquita. This coexistence can be explained by the different
land uses in the municipalities and the availability of water bodies
that allow correct reproduction and development of the vectors. SUPPLEMENTARY MATERIAL
Our findings could become valuable to improve national control
The Supplementary Material for this article can be found
programs for arbovirosis. However, it is important to highlight
online at: https://www.frontiersin.org/articles/10.3389/fevo.2020.
some limitations of the study, among them the lack of detection
602190/full#supplementary-material
of the DENV-2 – 4 serotypes as well as the measurement of other
meteorological variables that would allow us to carry out a more Supplementary Table 1 | Logistic regression. The parameters of Main effects
robust analysis. Likewise, a longer sampling time that could allow model and Second level interaction model.

REFERENCES endemic arbovirus area by sympatric populations of Aedes aegypti and Aedes
albopictus in Brazil. Mem. Instit. Oswaldo Cruz 115: e190437. doi: 10.1590/
Anoopkumar, A. N., Puthur, S., Rebello, S., and Aneesh, E. M. (2019). Molecular 0074-02760190437
characterization of Aedes, Culex, Anopheles, and Armigeres vector mosquitoes Barmak, D. H., Dorso, C. O., and Otero, M. (2016). Modelling dengue epidemic
inferred by mitochondrial cytochrome oxidase I gene sequence analysis. spreading with human mobility. Phys. A Statist. Mech. Appl. 447, 129–140.
Biologia 74, 1125–1138. doi: 10.2478/s11756-019-00231-0 doi: 10.1016/j.physa.2015.12.015
Atencia, M. C., Pérez, M. D. J., Caldera, S. M., Jaramillo, M. C., and Bejarano, Beaty, B. J., Black, W. C., Eisen, L., Flores, A. E., García-Rejón, J. E., Loroño-Pino,
E. E. (2018). Genetic variability of Aedes aegypti in the department of sucre, M., and Saavedra-Rodriguez, K. (2016). “The intensifying storm: Domestication
colombia, by analysis of the nucleotide sequence of the mitochondrial ND4 of Aedes aegypti, urbanization of arboviruses, and emerging insecticide
gene. Biomédica 38, 267–276. doi: 10.7705/biomedica.v38i0.3728 resistance,” in Proceedings of the Global Health Im-pacts of Vector-Borne
Azevedo, R. S., Silva, E. V., Carvalho, V. L., Rodrigues, S. G., Neto, J. P. N., Diseases: Workshop Summary (Washington, DC: National Academies Press).
Monteiro, H. A., et al. (2009). Mayaro fever virus, Brazilian amazon. Emerg. Black, W. C. IV., Bennett, K. E., Gorrochótegui-Escalante, N., Barillas-Mury,
Infect. Dis. 15:1830. doi: 10.3201/eid1511.090461 C. V., Fernández-Salas, I., de Lourdes Muñoz, M., et al. (2002). Flavivirus
Barbosa, R. M. R., Melo-Santos, M. A. V. D., Silveira, Jr, J. C., Silva-Filha, susceptibility in Aedes aegypti. Arch. Med. Res. 33, 379–388. doi: 10.1016/
M. H. N. L., Souza, W. V., Oliveira, C. M. F. D., et al. (2020). Infestation of an S0188-4409(02)00373-9

Frontiers in Ecology and Evolution | www.frontiersin.org 8 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

Boletín Epidemiológico Semanal (BES) Semana Epidemiológica 22, 24 al 30 de Freitas, R. M. D. (2010). A review on the ecological determinants of Aedes aegypti
mayo (2020). Obtenido de. Available at : https://www.ins.gov.co/buscador- (Diptera: Culicidae) vectorial capacity. Oecol. Austr. 14:726–736 doi: 10.4257/
eventos/BoletinEpidemiologico/2020_Bolet%C3%ADn_epidemiológico_ oeco.2010.1403.08
semana%2022.pdf (accessed July 20, 2020). Garcia-Rejon, J. E., Ulloa-Garcia, A., Cigarroa-Toledo, N., Pech-May, A., Machain-
Caldera, S. M., Jaramillo, M. C., Cochero, S., Pérez Doria, A., and Bejarano, E. E. Williams, C., Cetina-Trejo, R. C., et al. (2018). Study of Aedes aegypti
(2019). Diferencias genéticas entre poblaciones de Aedes aegypti de municipios population with emphasis on the gonotrophic cycle length and identification
del norte de Colombia, con baja y alta incidencia de dengue. Revista 33, doi: of arboviruses: implications for vector management in cemeteries. Rev. Instit.
10.7705/biomedica.v33i0.1573 Med. Trop. São Paul. 60:e44 doi: 10.1590/s1678-9946201860044
Camacho Burgos, E. Y. (2019). Caracterización filogenética de los virus dengue, Grillet, M. E., Hernández-Villena, J. V., Llewellyn, M. S., Paniz-Mondolfi, A. E.,
Chikungunya y Zika circulantes en el departamento de Sucre durante el periodo Tami, A., Vincenti-Gonzalez, M. F., et al. (2019). Venezuela’s humanitarian
2013–2015, Colombia: Universidad de Sucre. crisis, resurgence of vector-borne diseases, and implications for spillover in the
Caron, M., Paupy, C., Grard, G., Becquart, P., Mombo, I., Nso, B. B. B., et al. region. Lancet Infect. Dis. 19, e149-e161. doi: 10.1016/S1473-3099(18)30757-6
(2012). Recent introduction and rapid dissemination of Chikungunya virus and Gu, W., Lampman, R., and Novak, R. J. (2004). Assessment of arbovirus vector
Dengue virus serotype 2 associated with human and mosquito coinfections infection rates using variable size pooling. Med. Vet. Entomol. 18, 200-204
in Gabon, central Africa. Clin. Infect. Dis. 55, e45-e53. doi: 10.1093/cid/ doi: 10.1111/j.0269-283X.2004.00482.x
cis530 Guerbois, M., Fernandez-Salas, I., Azar, S. R., Danis-Lozano, R., Alpuche-Aranda,
Cevallos, V., Ponce, P., Waggoner, J. J., Pinsky, B. A., Coloma, J., Quiroga, C., C. M., Leal, G., et al. (2016). Outbreak of Zika virus infection, Chiapas State,
et al. (2018). Zika and Chikungunya virus detection in naturally infected Aedes Mexico, 2015, and first confirmed transmission by Aedes aegypti mosquitoes in
aegypti in Ecuador. Acta Trop. 177, 74–80. doi: 10.1016/j.actatropica.2017. the Americas. J. Infect. Dis. 214, 1349–1356. doi: 10.1093/infdis/jiw302
09.029 Gutiérrez-Bugallo, G., Rodríguez-Roche, R., Díaz, G., Pérez, M., Mendizábal, M. E.,
Chan, A., Chiang, L. P., Hapuarachchi, H. C., Tan, C. H., Pang, S. C., Lee, R., Peraza, I., et al. (2018). Spatio-temporal distribution of vertically transmitted
et al. (2014). DNA barcoding: complementing morphological identification of dengue viruses by Aedes aegypti (Diptera: Culicidae) from Arroyo Naranjo,
mosquito species in Singapore. Paras. Vect. 7, 1–12. doi: 10.1186/s13071-014- Havana, Cuba. Trop. Med. Int. Health 23, 1342–1349. doi: 10.1111/tmi.13162
0569-4 Hall, R. J., Wang, J., Todd, A. K., Bissielo, A. B., Yen, S., Strydom, H., et al.
Cheong, Y. L., Leitão, P. J., and Lakes, T. (2014). Assessment of land use factors (2014). Evaluation of rapid and simple techniques for the enrichment of viruses
associated with dengue cases in Malaysia using boosted regression trees. Spatial prior to metagenomic virus discovery. J. Virol. Methods 195, 194–204. doi:
Spatio Temp. Epidemiol. 10, 75–84. doi: 10.1016/j.sste.2014.05.002 10.1016/j.jviromet.2013.08.035
Claeys, C., Robles, C., Bertaudiere-Montes, V., Deschamps-Cottin, M., Megnifo, Higa, Y., Yen, N. T., Kawada, H., Son, T. H., Hoa, N. T., and Takagi, M. (2010).
H. T., Pelagie-Moutenda, R., et al. (2016). Socio-ecological factors contributing Geographic distribution of Aedes aegypti and Aedes albopictus collected from
to the exposure of human populations to mosquito bites that transmit used tires in Vietnam. J. Am. Mosq. Control Assoc. 26, 1–9. doi: 10.2987/09-
dengue fever, chikungunya and zika viruses: a comparison between 5945.1
mainland France and the French Antilles. Environ. Risques Santé 15, Houé, V., Bonizzoni, M., and Failloux, A. B. (2019). Endogenous non-retroviral
318–325. elements in genomes of Aedes mosquitoes and vector competence. Emerg.
Clement, M., Snell, Q., Walker, P., Posada, D., and Crandall, K. (2002). TCS: Microb. Infect. 8, 542–555. doi: 10.1080/22221751.2019.1599302
estimating gene genealogies. Parall. Distrib. Process. Symp. Int. 2:0184. doi: Hoyos-Lopez, R., Roman Pardo, S., CASTAÑO, J. C., and GALLEGO-GÓMEZ,
10.1109/IPDPS.2002.1016585 J. C. (2015). DNA barcode for typing of immature mosquitoes from Armenia
Cook, R. J. (2005). Kappa. Encyclop. Biostatist. 4. doi: 10.1002/0470011815. and Circasia (Quindío, Colombia). Rev. Colomb. Entomol. 41, 218-227
b2a04023 Huerta, H., González-Roldán, J. F., Sánchez-Tejeda, G., Correa-Morales, F.,
Cook, S., Diallo, M., Sall, A. A., Cooper, A., and Holmes, E. C. (2005). Romero-Contreras, F. E., Cárdenas-Flores, R., et al. (2017). Detection of Zika
Mitochondrial markers for molecular identification of Aedes mosquitoes virus in Aedes mosquitoes from Mexico. Trans. Royal Soc. Trop. Med. Hygiene
(Diptera: Culicidae) involved in transmission of arboviral disease in West 111, 328–331. doi: 10.1093/trstmh/trx056
Africa. J. Med. Entomol. 42, 19–28. doi: 10.1603/0022-2585(2005)042[0019: Joyce, A. L., Torres, M. M., Torres, R., and Moreno, M. (2018). Genetic variability
mmfmio]2.0.co;2 of the Aedes aegypti (Diptera: Culicidae) mosquito in El Salvador, vector of
Cova-Garcia, P., Sutil, E., and Rausseo, J. A. (1966). Mosquitos (Culicinos) de dengue, yellow fever, chikungunya and Zika. Paras. Vect. 11:637. doi: 10.1186/
Venezuela: Tomo I and Tomo II. Caracas: Ministerio de Sanidad y Asistencia s13071-018-3226-5
Social. Kraemer, M. U., Sinka, M. E., Duda, K. A., Mylne, A. Q., Shearer, F. M., Barker,
de la Cruz, C. H., Martinez, S. L. A., Failoc-Rojas, V. E., and Aguilar-Gamboa, F. R. C. M., et al. (2015). The global distribution of the arbovirus vectors Aedes
(2019). Momento de considerar otras arbovirosis luego del virus mayaro. Rev. aegypti and Ae. albopictus. eLife 4:e08347. doi: 10.7554/eLife.08347
Cubana Med. Gen. Integ. 35. Lanciotti, R. S., Kosoy, O. L., Laven, J. J., Panella, A. J., Velez, J. O., Lambert, A. J.,
Diallo, D., Sall, A. A., Diagne, C. T., Faye, O., Faye, O., Ba, Y., et al. (2014). Zika virus et al. (2007). Chikungunya virus in US travelers returning from India, 2006.
emergence in mosquitoes in southeastern Senegal, 2011. PLoS One 9:e109442. Emerg. Infect. Dis. 13, 764–767. doi: 10.3201/eid1305.070015
doi: 10.1371/journal.pone.0109442 Li, Y., Kamara, F., Zhou, G., Puthiyakunnon, S., Li, C., Liu, Y., et al.
Duong, V., Lambrechts, L., Paul, R. E., Ly, S., Lay, R. S., Long, K. C., et al. (2015). (2014). Urbanization increases Aedes albopictus larval habitats and accelerates
Asymptomatic humans transmit dengue virus to mosquitoes. Proc. Natl. Acad. mosquito development and survivorship. PLoS Negl. Trop. Dis. 8:e3301. doi:
Sci. U.S.A. 112, 14688–14693. doi: 10.1073/pnas.1508114112 10.1371/journal.pntd.0003301
Eiras, A. E., Pires, S. F., Staunton, K. M., Paixão, K. S., Resende, M. C., Silva, Liang, L., Jia, P., Tan, X., Chen, J., and Chen, X. (2019). Potential effects of heat
H. A., et al. (2018). A high-risk Zika and dengue transmission hub: virus waves on the population dynamics of the dengue mosquito Aedes albopictus.
detections in mosquitoes at a Brazilian university campus. Paras. Vect. 11:359. PLoS Neglect. Trop. Dis. 13:e0007528. doi: 10.1371/journal.pntd.0007528
doi: 10.1186/s13071-018-2883-8 Librado, P., and Rozas, J. (2009). DnaSP v5: a software for comprehensive analysis
Espinal, M. A., Andrus, J. K., Jauregui, B., Hull Waterman, S., Morens, D. M., of DNA polymorphism data. Bioinformatics 25, 1451–1452. doi: 10.1093/
Santos, J. I., et al. (2019). Arbovirosis emergentes y reemergentes transmitidas bioinformatics/btp187
por Aedes en la Región de las Américas: implicaciones en materia de políticas Liu, Y., Lillepold, K., Semenza, J. C., Tozan, Y., Quam, M. B., and Rocklöv, J.
de salud. Rev. Panam. Salud. Publ. 43. (2020). Reviewing estimates of the basic reproduction number for dengue,
Faye, O., Diallo, D., Diallo, M., Weidmann, M., and Sall, A. A. (2013). Quantitative Zika and chikungunya across global climate zones. Environ. Res. 182:109114.
real-time PCR detection of Zika virus and evaluation with field-caught doi: 10.1016/j.envres.2020.109114
mosquitoes. Virol. J. 10:311. doi: 10.1186/1743-422x-10-311 Lizarazo, E., Vincenti-Gonzalez, M., Grillet, M. E., Bethencourt, S., Diaz, O., Ojeda,
Forattini, O. P. (1965). Entomologia médica: culicini: culex, Aedes e Psorophora, Vol. N., et al. (2019). Spatial dynamics of Chikungunya virus, Venezuela, 2014.
2. São Paulo: Faculdade de Higiene e Saúde Pública, Depto. de Parasitología. Emerg. Infect. Dis. 25:672. doi: 10.3201/eid2504.172121

Frontiers in Ecology and Evolution | www.frontiersin.org 9 November 2020 | Volume 8 | Article 602190
Martínez et al. Molecular Epidemiology of Arboviruses in Eastern Colombia

Long, K. C., Ziegler, S. A., Thangamani, S., Hausser, N. L., Kochel, T. J., Higgs, S., Sarfraz, M. S., Tripathi, N. K., Tipdecho, T., Thongbu, T., Kerdthong, P., and
et al. (2011). Experimental transmission of Mayaro virus by Aedes aegypti. Am. Souris, M. (2012). Analyzing the spatio-temporal relationship between dengue
J. Trop. Med. Hyg. 85, 750–757. doi: 10.4269/ajtmh.2011.11-0359 vector larval density and land-use using factor analysis and spatial ring
Lorenz, C., Ribeiro, A. F., and Chiaravalloti-Neto, F. (2019). Mayaro virus mapping. BMC Publ. Health 12:853. doi: 10.1186/1471-2458-12-853
distribution in South America. Acta tropica 198:105093. doi: 10.1016/j. Shope, R. E., and Meegan, J. M. (1997). Arboviruses in Viral Infections of Humans.
actatropica.2019.105093 Boston, MA: Springer, 151–183. doi: 10.1007/978-1-4899-0036-4_6
Lounibos, L. P., and Kramer, L. D. (2016). Invasiveness of Aedes aegypti and Sohpal, V. K., Dey, A., and Singh, A. (2010). MEGA biocentric software for
Aedes albopictus and vectorial capacity for chikungunya virus. J. Infect. Dis. sequence and phylogenetic analysis: a review. Int. J. Bioinform. Res. Appl. 6,
214(suppl_5), S453-S458. doi: 10.1093/infdis/jiw285 230–240. doi: 10.1504/ijbra.2010.034072
Lozano-Fuentes, S., Hayden, M. H., Welsh-Rodriguez, C., Ochoa-Martinez, C., Sumruayphol, S., Apiwathnasorn, C., Ruangsittichai, J., Sriwichai, P., Attrapadung,
Tapia-Santos, B., Kobylinski, K. C., et al. (2012). The dengue virus mosquito S., Samung, Y., et al. (2016). DNA barcoding and wing morphometrics to
vector Aedes aegypti at high elevation in Mexico. Am. J. Trop. Med. Hyg. 87, distinguish three Aedes vectors in Thailand. Acta Trop. 159, 1–10. doi: 10.1016/
902-909. doi: 10.4269/ajtmh.2012.12-0244 j.actatropica.2016.03.010
Maia, L. M. S., Bezerra, M. C. F., Costa, M. C. S., Souza, E. M., Oliveira, M. E. B., Turell, M. J., Beaman, J. R., and Tammariello, R. F. (1992). Susceptibility of
Ribeiro, A. L. M., et al. (2019). Natural vertical infection by dengue virus selected strains of Aedes aegypti and Aedes albopictus (Diptera: Culicidae)
serotype 4, Zika virus and Mayaro virus in Aedes (Stegomyia) aegypti and Aedes to chikungunya virus. J. Med. Entomol. 29, 49–53. doi: 10.1093/jmedent/
(Stegomyia) albopictus. Med. Vet. Entomol. 33, 437–442. doi: 10.1111/mve. 29.1.49
12369 Vega-Rúa, A., Zouache, K., Girod, R., Failloux, A. B., and Lourenço-de-Oliveira, R.
Martínez-Vega, R. A., Danis-Lozano, R., Díaz-Quijano, F. A., Velasco-Hernández, (2014). High level of vector competence of Aedes aegypti and Aedes albopictus
J., Santos-Luna, R., Román-Pérez, S., et al. (2015). Peridomestic infection as a from ten American countries as a crucial factor in the spread of Chikungunya
determining factor of dengue transmission. PLoS Neglect. Trop. Dis. 9:e0004296. virus. J. Virol. 88, 6294–6306. doi: 10.1128/jvi.00370-14
doi: 10.1371/journal.pntd.0004296 Velandia-Romero, M. L., Olano, V. A., Coronel-Ruiz, C., Cabezas, L., Calderón-
Massaro, E., Kondor, D., and Ratti, C. (2019). Assessing the interplay between Peláez, M. A., Castellanos, J. E., et al. (2017). Detección del virus del dengue
human mobility and mosquito borne diseases in urban environments. Sci. Rep. en larvas y pupas de Aedes aegypti recolectadas en áreas rurales del municipio
9, 1–13 doi: 10.1038/s41598-019-53127-z de Anapoima, Cundinamarca, Colombia. Biomédica 37, 193–200. doi: 10.7705/
Nguyen, LT, Schmidt, HA, von Haeseler, A, Minh, BQ. (2014). IQ-TREE: a fast and biomedica.v37i0.3584
effective stochastic algorithm for estimating maximum-likelihood phylogenies. Villar, L. A., Rojas, D. P., Besada-Lombana, S., and Sarti, E. (2015). Epidemiological
Mol. Biol. Evol. 32, 268–274. doi: 10.1093/molbev/msu300 trends of dengue disease in Colombia (2000-2011): a systematic review. PLoS
Patsoula, E., Samanidou-Voyadjoglou, A., Spanakos, G., Kremastinou, J., Negl. Trop. Dis. 9: e0003499. doi: 10.1371/journal.pntd.0003499
Nasioulas, G., and Vakalis, N. C. (2006). Molecular and morphological Walter, SD, Hildreth, SWY and Beaty, BJ. (1980). Estimación de las tasas de
characterization of Aedes albopictus in northwestern Greece and differentiation infección en poblaciones de organismos utilizando grupos de tamaño variable.
from Aedes cretinus and Aedes aegypti. J. Med. Entomol. 43, 40–54. doi: Am. J. Epidemiol. 112, 124–128. doi: 10.1093/oxfordjournals.aje.a112961
10.1603/0022-2585(2006)043[0040:mamcoa]2.0.co;2 Whiteman, A., Gomez, C., Rovira, J., Chen, G., McMillan, W. O., and
Paupy, C., Delatte, H., Bagny, L., Corbel, V., and Fontenille, D. (2009). Aedes Loaiza, J. (2019). Aedes mosquito infestation in socioeconomically contrasting
albopictus, an arbovirus vector: from the darkness to the light. Microbes Infect. neighborhoods of panama city. EcoHealth 16, 210–221. doi: 10.1007/s10393-
11, 1177–1185. doi: 10.1016/j.micinf.2009.05.005 019-01417-3
Pereira, T. N., Carvalho, F. D., De Mendonça, S. F., Rocha, M. N., and Moreira, World Health Organization [WHO] (2020). Real-Time RT-PCR (TaqManTM)
L. A. (2020). Vector competence of Aedes aegypti, Aedes albopictus, and protocol – Mayaro virus (MAYV). Geneve: WHO.
Culex quinquefasciatus mosquitoes for Mayaro virus. PLoS Negl. Trop. Dis. Zamora-Delgado, J., Castaño, J. C., and Hoyos-López, R. (2015). DNA barcode
14:e0007518. doi: 10.1371/journal.pntd.0007518 sequences used to identify Aedes (Stegomyia) albopictus (Diptera: Culicidae)
Rahayu, A., Saraswati, U., Supriyati, E., Kumalawati, D. A., Hermantara, R., Rovik, in La Tebaida (Quindío, Colombia). Rev. Colomb. Entomol. 41, 212-217
A., et al. (2019). Prevalence and distribution of dengue virus in Aedes aegypti in Zhu, G., Liu, T., Xiao, J., Zhang, B., Song, T., Zhang, Y., et al. (2019). Effects
yogyakarta city before deployment of Wolbachia infected Aedes aegypti. Int. J. of human mobility, temperature and mosquito control on the spatiotemporal
Environ. Res. Public Health 16:1742. doi: 10.3390/ijerph16101742 transmission of dengue. Sci. Total Environ. 651, 969–978. doi: 10.1016/j.
Ramasamy, R., Surendran, S. N., Jude, P. J., Dharshini, S., and Vinobaba, M. scitotenv.2018.09.182
(2011). Larval development of Aedes aegypti and Aedes albopictus in peri-
urban brackish water and its implications for transmission of arboviral diseases. Conflict of Interest: The authors declare that the research was conducted in the
PLoS Negl. Trop. Dis. 5:e1369. doi: 10.1371/journal.pntd.0001369 absence of any commercial or financial relationships that could be construed as a
Rolo, E. S. A. (2020). DNA Barcoding and Forensic Entomology: A potential conflict of interest.
Molecular Approach for Diptera Species’ Identification. Doctoral
dissertation, University of Cape Town. Copyright © 2020 Martínez, Hernández, Muñoz, Armesto, Cuervo and Ramírez.
Salehi, Z, Najafi, M. (2014). RNA preservation and stabilizaton. Biochem. Physiol. This is an open-access article distributed under the terms of the Creative Commons
Open Access. 3, 1–4. Attribution License (CC BY). The use, distribution or reproduction in other forums
Santiago, G. A., Vergne, E., Quiles, Y., Cosme, J., Vazquez, J., Medina, J. F., et al. is permitted, provided the original author(s) and the copyright owner(s) are credited
(2013). Analytical and clinical performance of the CDC real time RT-PCR and that the original publication in this journal is cited, in accordance with accepted
assay for detection and typing of dengue virus. PLoS Negl. Trop. Dis. 7:e2311. academic practice. No use, distribution or reproduction is permitted which does not
doi: 10.1371/journal.pntd.0002311 comply with these terms.

Frontiers in Ecology and Evolution | www.frontiersin.org 10 November 2020 | Volume 8 | Article 602190