KENDRIYA VIDYALAYA SANGATHAN

SILCHAR REGION
CLASS : XII
SECOND BOARD EXAMINATION 2022-23
SUBJECT & CODE : BIOLOGY 044

MAXIMUM MARKS : 70 TIME : 3.00 HOURS

General Instructions:
(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions. All questions are compulsory.
(iii) Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2 marks each;
Section– C has 7 questions of 3 marks each; Section– D has 2 case-based questions of 4 marks each; and Section–E
has 3 questions of 5 marks each.
(iv) There is no overall choice. However, internal choices have been provided in some questions.
A student has to attempt only one of the alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.

QNo SECTION : A MARKS

1- Which of the following statements are true related to Seed X and Y? 1

(i) Seed X is dicot and endospermic or albuminous.

(ii) Seed X is dicot and non-endospermic or non-albuminous.
(iii) Seed Y is monocot and endospermic or albuminous.
(iv) Seed Y is monocot and non-endospermic or non-albuminous.

Choose the correct option with the respect to the nature of the seed
(a)(i), (iii) (b) (ii), (iii) (c) (i), (iv) (d) (ii), (iv)

2- The mode of action of the copper ions in an IUD is to 1

(a) increase the movement of sperms.
(b) decrease the movement of the sperms.
(c) make the uterus unsuitable for implantation.
(d) make the cervix hostile to the sperms.

3- What is the pattern of inheritance in the following pedigree chart? 1

(a) Autosomal dominant (b) Autosomal recessive

(c) Sex -linked dominant (d) Sex -linked recessive

4- In Antirrhinum, RR is phenotypically red flowers, rr is white and Rr is pink. Select the correct phenotypic 1
ratio in F1 generation when a cross is performed between RR X Rr:

(a)1 red: 2 Pink: 1 white (b) 2 Pink: 1 white (c) 2 Red: 2 Pink (d) All Pink
Page 1 of 8
5- Total number of nucleotide sequences of DNA that codes for a hormone is 1530. The proportion of 1
different bases in the sequence is found to be Adenine = 34%, Guanine = 19%, Cytosine = 23%, Thymine =
19%

Applying Chargaff’s rule, what conclusion can be drawn?

(a)It is a double stranded circular DNA. (b) It is a single stranded DNA.

(c) It is a double stranded linear DNA. (d) It is a single stranded DNA coiled on
Histones.

6- Match the scientists listed under column ‘I’ with ideas listed column ‘II’ 1

(a)A-i; B-iv; C-ii; D-iii (b) A-iv; B-i; C-ii; D-iii

(c) A-ii; B-iv; C-iii; D-i (d) A-iv; B-iii; C-ii; D-i

7- BOD of waste water is estimated by measuring the amount of: 1

(a) total organic matter (b) biodegradable organic matter
(c) oxygen evolution (d) oxygen consumption.

8- Which of the following statements does not hold true for restriction enzyme? 1
(a) It recognises a palindromic nucleotide sequence
(b) It is an endonuclease
(c) It is isolated from viruses
(d) It can produce the same kind of sticky ends in different DNA molecules

9- A probe which is a molecule used to locate homologous sequences in a mixture of DNA 1

or RNA molecules could be:
(a) A ssRNA (b) A ssDNA
(c) Either RNA or DNA (d) Can be ssDNA but not ssRNA

10- Golden rice is: 1

(a) A variety of rice grown along the yellow river in China
(b) Long stored rice having yellow colour tint
(c) A transgenic rice having gene for β – carotene
(d) Wild variety of rice with yellow coloured grains

11- Swathi was growing a bacterial colony in a culture flask under ideal laboratory conditions where the 1
resources are replenished. Which of the following equations will represent the growth in this case?
(Where population size is N, birth rate is b, death rate is d, unit time period is t, and carrying capacity is K).
(a) dN/dt = KN
(b) dN/dt = r N
(c) dN/dt = r N(K-N/K)
(d) dN/dt = r N(K+N/K)

12- Pyramid of numbers is: 1

(a) Always upright (b) Always inverted
(c) Ether upright or inverted (d) Neither upright nor inverted

Page 2 of 8
Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R).Answer these questions selecting the
appropriate option given below:

A. Both A and R are true and R is the correct explanation of A.

B. Both A and R are true and R is not the correct explanation of A.
C. A is true but R is false.
D. A is False but R is true.

13- Assertion (A) : Baculovirus are biocontrol agents of genus Nucleopolyhedrovirus. 1

Reason (R) : They are effective against plant pathogens.

14- Assertion (A) : Amplification of gene of a gene of interest can be done by PCR. 1

Reason (R) : It is possible to amplify DNA segement approx 1 billion times within
span day.

15- Assertion (A) : Dodo, passenger pigeon and steller’s sea cow have become extinct 1
because of over exploitation.

Reason (R) : Excessive exploition of a species , whether animal or plants reduces size of
its population so that it becomes vulerable to extinction.

16- Several decades ago, the “one gene-one enzyme” hypothesis was in vogue. It seemed straightforward that a 1
single protein gene coded for a single protein. In prokaryotic organisms (bacteria), this was easy to show.
The known bacterial genes had a defined starting and stopping place and the DNA letters in between
spelled out a discrete amino acid sequence. The eukaryotes(organisms with a nucleus; everything from
yeast, to plants, to humans) do not have a simple gene structure. Our protein genes are broken up into a
series of “exons” (the parts that code for protein) and “introns” (non-coding intervening sequences). To
make a protein, the gene is first transcribed into RNA, then the introns are spliced out, the exons are
stitched together, and the remainder is translated into protein. Even though complex, the one gene-one
enzyme hypothesis was still applied to eukaryotic protein genes.

Assertion (A) : Researchers first identified parts of genes that are spliced out of mRNA
and not included in the final protein product by observing that not all of
the original the gene hybridizes to the cognate mRNA. These regions are
called Introns.

Reason (R) : Scientists first observed that some areas of genes are removed before
mRNA translation by visualizing that not all of a gene hybridizes with its
cognate mRNA, and hence there are pieces that are spliced out and not used.

SECTION : B

17- a) ‘Saheli’ considered an effected comtraceptive for women. Give any two reasons. 2

b) State the composition and principle of the contraceptive pill ‘Saheli’.

18- A true breeding pea plant, homozygous dominant for inflated green podsis crossed with another pea plant 2
with constricted yellow pods (ffgg). With the help of punnett square show the above cross and mention the
results obtained phenotypically and genotypically in F1 generation?

Page 3 of 8
19- What do you mean by the term methanogenesis? The diagram given below is a typical biogas plant. 2
Identify A , B and C.

20- Define interference competition. Give one example that supports competitive exclusion occurring in 2
nature.

21- a) How many primary producers do you think will be needed to support six tertiary consumers in a 2
grass land ecosystem?

b) Draw a grassland pyramid to substantiate your answer.

OR
a) Draw a pyramid of numbers where a large number of insects are feeding on the leaves of a tree.
What is the shape of this pyramid?

b) Will the pyramid of energy be also of the same shape in this situation? Give reason for your
response.

SECTION : C

22- Describe with the help of three labelled diagrams of the different embryonic stages that include mature 3
embryo of dicot plants.

23- Identify A,B,C,D,E & F in the table given below- 3

Syndrome Cause Characteristics Sex male/female/both

a) Down’s Trisomy 21 A (i) (ii) B

b) C XXY Overall masculine D

c) Turner’s 45 + XO E (i) (ii) F

24- a) Identify the polarity of x to x’ in the diagram below and mention how many more amino acids 3
are expected to be added to this polypeptide chain.

b) Mention the codon and anticodon for alanine.

c) Why are some untranslated sequences of bases seen in mRNA coding for a polypeptide? Where
exactly are they present on mRNA?
Page 4 of 8
25- Observe the following figure and answer – 3

a) State the hypothesis which S.L. Miller tried to prove in the laboratory with the help of the set up
given above.

b) Name the organic compound observed by him in the liquid water at the end of his experiment.

c) A scientist simulated a similar set up and added CH4 , NH3 and water vapour at 800oC . Mention
the important component that is missing in this experiment.

26- Recognition of an antigenic protein of a pathogen or exposure to a pathogen occurs during many types 3
of immune responses, including active immunity and induced active immunity. Specify the types of
responses elicited when human beings get encountered by a pathogen.

OR

Explain the Life cycle of Plasmodium starting from its entry in the body of female Anopheles till the
completion of its life cycle in humans. Explain the cause of periodic recurrence of chill and high fever
during malarial attack in humans.

27- a) Mention the cause of ADA deficiency in humans. 3

b) How is gene theraphy carried out to treat the patients suffering from this disease also state the
possibility of a permanent cure of this disease.

28- a) ‘The Evil Quartet’ describes the rates of species extinction due to human activities. Explain how 3
the population of organisms is affected by fragmentation the habitats.

b) Introduction of alien species has led to environmental damage and decline of indigenous species.
Give any one example of how it has affected the indigenous species?

c) Could the extinction of Steller’s sea cow and passenger pigeon be saved by man? Give reasons
to support your answer.

Page 5 of 8
 SECTION : D
Q.No 29 and 30 are case based questions. Each question has subparts with internal choice in one
subpart.
29 Gametogenesis is the production of gametes from haploid precursor cells. In animals & higher plants, two 4
morphologically distinct types of gametes are produced (male and female) via distinct differentiation
programs. Animals produce a tissue that is dedicated
to forming gametes, called the germ line.

(a) (b)
With reference to the above schematic diagram of (a)Spermatogenesis and (b) Oogenesis answer the
following questions –

a) About 300 million spermatozoa may be present in a human male ejaculation at one time.Calculate how
many spermatocytes will be involved to produce this number of spermatozoa.
b) How many spermatids will be formed?
c) How many chromatids are found during Oogenesis in Primary oocytes and First polar body in a human
female?
OR
Meiotic division during oogenesis is different from that in spermatogenesis. Justify

30 Meselson and Stahl incorporated non-radioactive isotopes of nitrogen with different weights into the DNA 4
of E. coli. As DNA contains a large amount of nitrogen, so long as the bacteria grew in a medium
containing nitrogen of a specified isotope, the bacteria would use that nitrogen to build DNA.

a) Name the molecule (s) that 15 N got incorporated into.

b) How did they distinguish between 15 N labelled molecules from 14 N ones?
c) Write the observations made by them from the samples taken at the end of 20 and 30 minutes respectively.
Write the conclusion drawn after their experiment.
OR
Why did they allow the synthesis of the light & heavy DNA molecules in a n organism? Give two reasons.

Page 6 of 8
 SECTION : E

31- The following figure shows a foetus within the uterus. On the basis of the given figure, answer the 5
questions that follow:

In the above figure, choose and name the correct part (A, B, C or D) that act as a temporary endocrine
gland and substantiate your answer. Why is it also called the functional junction? Mention the role of A in
the development of the embryo.

OR

a) Explain the menstrual phase in a human female.

b) State the levels of ovarian and pituitary hormones during this phase.
c) Why follicular phase of menstrual cycle is referred as proliferative phase?
d) Trace the change that occur in a Graafian follicle at time of luteal phase.
e) Draw the diagram of Graafian follicle and label antrum.

32- a) What do you mean by ‘Withdrawal syndrome’? List any two symptoms it is characterised by. 5
b) The outline structure of a drug is given below

(i) Which group of drugs does this represent?

(ii) What are the modes of consumption of these drugs?
(iii) Name the organ of the body which is affected by consumption of these drugs.

OR
Identify and name the disease in which the patient’s cells lose the property of contact inhibition. State its
possible causes and explain any three methods to accurately detect
the pathological and physiological changes that take place due to the disease in living tissues.

33- a) Explain how the gene of interest is introduced into a vector. 5

b) You are given the DNA shown below.

5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the
sequence of these double-stranded DNA fragments with their respective polarity.

c) A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its
impact on the recombinant plamids? Give a possible way by which you could differentiate non
recombinant to recombinant plasmids.

Page 7 of 8
 OR

a) What do you mean by ‘Gel electrophoresis’? Why agarose gel is used in it?

b) Carefully observe the given picture. A mixture of DNA with fragments ranging from 200 base
pairs to 2500 base pairs was electrophoresed on agarose gel with the following arrangement.  

(i) What result will be obtained on staining with ethidium bromide?Explain with reason. 

(ii) The above set-up was modified and a band with 250 base pairs was obtained at X.

What change(s) were made to the previous design to obtain a band at

X? Why did the band appear at the position X?

Page 8 of 8