ANMOL SHARMA LIVE

• Nucleic acids (DNA & RNA) are the building blocks of genetic material.
• DNA is the genetic material in most of the organisms.
• RNA is the genetic material in some viruses. RNA mostly functions as messengers.

THE DNA
STRUCTURE OF POLYNUCLEOTIDE CHAIN DNA is made of 2 polynucleotide chains coiled in a right-
Polynucleotides are the polymer of nucleotides. DNA & handed fashion. Its backbone is formed of sugar &
RNA are polynucleotides. A nucleotide has 3 components: phosphates. The bases project inside.
1. A nitrogenous base. The 2 chains have anti-parallel polarity, i.e. one chain has
2. A pentose sugar (ribose in RNA & deoxyribose in DNA). the polarity 5’→3’ and the other has 3’→5’.
3. A phosphate group. The bases in 2 strands are paired through H-bonds forming
Nitrogen bases are 2 types: base pairs (bp).
Purines: It includes Adenine (A) and Guanine (G). A=T (2 hydrogen bonds) C≡G (3 hydrogen bonds)
Pyrimidines: It includes Cytosine (C), Thymine (T) & Purine comes opposite to a pyrimidine. This generates
Uracil (U). Thymine (5-methyl Uracil) present only in uniform distance between the 2 strands.
DNA and Uracil only in RNA. Erwin Chargaff’s rule: In DNA, the proportion of A is
A nitrogenous base is linked to the OH of 1' C pentose sugar equal to T and the proportion of G is equal to C.
through an N-glycosidic linkage to form nucleoside. ∴ [A] + [G] = [T] + [C]
Nucleosides in RNA Nucleosides in DNA or [A] + [G] / [T] + [C] =1
Adenosine Deoxyadenosine
Guanosine Deoxyguanosine v Ф 174 (a bacteriophage) has 5386 nucleotides.
Cytidine Deoxycytidine v Bacteriophage lambda has 48502 base pairs (bp).
Uridine Deoxythymidine v E. coli has 4.6x106 bp.
A phosphate group is linked to OH of 5' C of a nucleoside v Haploid content of human DNA is 3.3x109 bp.
through phosphoester linkage to form nucleotide (or Length of DNA = number of base pairs X distance between
deoxynucleotide). two adjacent base pairs.
In RNA, each nucleotide has an additional –OH group at 2' C Number of base pairs in human = 6.6 x 109
of the ribose (2’- OH). Hence, the length of DNA = 6.6 x109 x 0.34x 10-9
2 nucleotides are linked through 3’-5’ phosphodiester bond
= 2.2 m
to form dinucleotide.
When more nucleotides are linked, it forms polynucleotide. In E. coli, length of DNA =1.36 mm (1.36 x 10-3 m)
1.36X10−3
STRUCTURE OF THE DNA ∴ The number of base pairs =
0.34 X 10−9
Friedrich Meischer (1869): Identified DNA and named it
= 4 x 106 bp
as ‘Nuclein’.
James Watson & Francis Crick (1953) proposed double PACKAGING OF DNA HELIX
helix model of DNA. It was based on X-ray diffraction data § In prokaryotes (E.g. E. coli), the DNA is not scattered
produced by Maurice Wilkins & Rosalind Franklin. throughout the cell. DNA is negatively charged. So it is held
with some positively charged proteins to form nucleoid.
§ In eukaryotes, there is a set of positively charged, basic
proteins called histones.
§ Histones are rich in
positively charged basic
amino acid residues lysines
and arginines.
§ 8 histones form histone
octamer.
§ Negatively charged DNA is
wrapped around histone octamer to give nucleosome.
§ A typical nucleosome contains 200 bp.
Therefore, total number of nucleosomes in human =
6.6x109bp
= 3.3x107
200
§ Nucleosomes constitute the repeating unit to form
chromatin. Chromatin is the thread-like stained bodies.
pg. 1
ANMOL SHARMA LIVE

§ Nucleosomes in chromatin = ‘beads-on-string’. § Chromatin has 2 forms:

§ Chromatin is packaged → chromatin fibres → coiled and • Euchromatin: Loosely packed and transcriptionally
condensed at metaphase stage → chromosomes. active region of chromatin. It stains light.
§ Higher level packaging of chromatin requires non-histone • Heterochromatin: Densely packed and inactive region
chromosomal (NHC) proteins. of chromatin. It stains dark.

THE SEARCH FOR GENETIC MATERIAL

Griffith’s Transforming Principle experiment (1928) 3. Hershey-Chase Experiment (Blender
Frederick Griffith used mice & Streptococcus pneumoniae. Experiment)-1952
Streptococcus pneumoniae has 2 strains: - Hershey & Chase grew some bacteriophage viruses on a
◦ Smooth (S) strain (Virulent): Has polysaccharide medium containing radioactive phosphorus (P32) and some
mucus coat. Cause pneumonia. others on medium containing radioactive sulphur (S35).
◦ Rough (R) strain (Non-virulent): No mucus coat. Do - Viruses grown in P32 got radioactive DNA because only
not cause Pneumonia. DNA contains phosphorus. Viruses grown in S35 got
Experiment: radioactive protein because protein contains sulphur.
• S-strain → Inject into mice → Mice die - These preparations were used separately to infect E. coli.
• R-strain → Inject into mice → Mice live - After infection, the E. coli cells were gently agitated in a
• S-strain (Heat killed) → Inject into mice → Mice live blender to remove the virus particles from the bacteria.
• S-strain (Hk) + R-strain (live) → Inject into mice → Mice die - Then the culture was centrifuged to separate lighter virus
He concluded that some ‘transforming principle’ particles from heavier bacterial cells.
transferred from heat-killed S-strain to R-strain. It enabled R- - Bacteria infected with viruses having radioactive DNA
strain to synthesize smooth polysaccharide coat and become were radioactive. i.e., DNA had passed from the virus to
virulent. This must be due to the transfer of genetic material. bacteria. Bacteria infected with viruses having radioactive
proteins were not radioactive. i.e., proteins did not enter the
2. Biochemical characterization of bacteria from the viruses. This proves that DNA is the
transforming principle (1933-44) genetic material.
- Oswald Avery, Colin MacLeod & Maclyn McCarty
worked to determine the biochemical nature of
‘transforming principle’ in Griffith’s experiment.
- They purified biochemicals (proteins, DNA, RNA etc.)
from heat killed S cells using suitable enzymes.
- They discovered that
ú Digestion of protein and RNA (using Proteases and
RNases) did not affect transformation. It means that the
transforming substance was not a protein or RNA.
ú Digestion of DNA with DNase inhibited transformation.
It means that DNA caused transformation of R cells to S
cells. It proves that DNA was the transforming principle.

PROPERTIES OF GENETIC MATERIAL (DNA v/s RNA)

A genetic material must have the following properties: experiment, some properties of DNA of the heat killed
• Ability to generate its replica (Replication). bacteria did not destroy. It indicates the stability of DNA.
• Chemical and structural stability. - For the storage of genetic information, DNA is better due
• Provide the mutations that are required for evolution. to its stability. But for the transmission of genetic
• Ability to express as Mendelian Characters. information, RNA is better.
- RNA can directly code for the protein synthesis, hence can
Reasons for stability Reasons for mutability
easily express the characters. DNA is dependent on RNA
(less reactivity) of DNA (high reactivity) of RNA
for protein synthesis.
Double stranded Single stranded
Presence of thymine Presence of Uracil RNA WORLD
Absence of 2’-OH in sugar Presence of 2’-OH in sugar RNA was the first genetic material.
- RNA is unstable. So, RNA viruses (E.g. Q.B bacteriophage, It acts as genetic material and catalyst.
Tobacco Mosaic Virus etc.) mutate and evolve faster. Essential life processes (metabolism, translation, splicing
- DNA strands are complementary. On heating, they separate. etc.) evolved around RNA.
In appropriate conditions, they come together. In Griffith’s DNA evolved from RNA for stability.

pg. 2
ANMOL SHARMA LIVE

CENTRAL DOGMA OF MOLECULAR BIOLOGY

• It is proposed by Francis Crick. It states that the genetic Taylor & colleagues (1958) performed similar experiments
information flows from DNA → RNA → Protein. on Vicia faba (faba beans) using radioactive thymidine to
detect distribution of newly synthesized DNA in the
chromosomes. It proved that the DNA in chromosomes also
replicate semi-conservatively.
Central dogma The Machinery and Enzymes for Replication
• In some viruses, flow of information is in reverse direction • DNA replication starts at a point called origin (ori).
(from RNA to DNA). It is called reverse transcription. • A unit of replication with one origin is called a replicon.
• During replication, the 2 strands unwind and separate by
DNA REPLICATION breaking H-bonds in presence of an enzyme, Helicase.
• Replication is the copying of DNA from parental DNA. • Unwinding of the DNA
• Watson & Crick proposed Semi-conservative model of molecule at a point
replication. It suggests that the parental DNA strands act as forms a ‘Y’-shaped
template for the synthesis of new complementary strands. structure called
After replication, each DNA molecule would have one replication fork.
parental and one new strand. • The separated strands act
• Matthew Messelson & Franklin Stahl (1958) as templates for the
experimentally proved Semi-conservative model. synthesis of new strands.
Messelson & Stahl’s Experiment • DNA replicates in the
They grew E. coli in 15NH4Cl medium (15N = heavy 5’→3’ direction.
isotope of nitrogen) as the only nitrogen source. As a result, • Deoxyribonucleoside triphosphates (dATP, dGTP, dCTP
15
N was incorporated into newly synthesised DNA (heavy & dTTP) act as substrate and provide energy for
DNA or 15N DNA). polymerization.
Heavy DNA can be distinguished from normal DNA (light • Firstly, a small RNA primer is synthesized in presence of
DNA or 14N DNA) by centrifugation in a cesium chloride an enzyme, primase.
(CsCl) density gradient. • In presence of an enzyme, DNA dependent DNA polymerase,
E. coli cells from 15N medium were transferred to 14NH4Cl many nucleotides join with one another to primer strand
medium. After one generation (i.e. after 20 minutes), they and form a polynucleotide chain (new strand).
isolated and centrifuged the DNA. Its density was • During replication, one strand is formed as a continuous
intermediate (hybrid) between 15N DNA and 14N DNA. stretch in 5’→ 3’ direction (Continuous synthesis). This
This shows that in newly formed DNA, one strand is old strand is called leading strand.
(15N type) and one strand is new (14N type). This confirms • The other strand is formed in small stretches (Okazaki
semi-conservative replication. fragments) in 5’→ 3’ direction (Discontinuous synthesis).
After II generation (i.e. after 40 minutes), there was equal • The Okazaki fragments are then joined together to form a
amounts of hybrid DNA and light DNA. new strand by an enzyme, DNA ligase. This new strand is
called lagging strand.
• If a wrong base is introduced in the new strand, DNA
polymerase can do proof reading.
• E. coli completes replication within 18 minutes. i.e. 2000
bp per second.
• In eukaryotes, the replication of DNA takes place at S-
phase of the cell cycle. Failure in cell division after DNA
replication results in polyploidy.

TRANSCRIPTION
- It is the process of copying genetic information from one - During transcription, both strands are not copied because
strand of the DNA into RNA. ◦ The code for proteins is different in both strands. This
- Here, adenine pairs with uracil instead of thymine. complicates the translation.
- The DNA- dependent RNA polymerase catalyzes the ◦ If 2 RNA molecules are produced simultaneously, this
polymerization only in 5’→3’direction. would be complimentary to each other. It forms a
- 3’→5’ acts as template strand. RNA is built from this. double stranded RNA and prevents translation.
- 5’→3’ acts as coding strand. This is copied to RNA. Transcription Unit
3’-ATGCATGCATGCATGCATGCATGC-5’ template strand.
5’-TACGTACGTACGTACGTACGTACG-3’ coding strand. - It is the segment of DNA between the sites of initiation and
termination of transcription. It consists of 3 regions:

pg. 3
ANMOL SHARMA LIVE

◦ A promoter: Binding site for RNA polymerase. Located Elongation: RNA chain is synthesized in 5’-3’ direction. In
towards 5'-end (upstream). this process, activated ribonucleoside triphosphates (ATP,
◦ Structural gene: The region between promoter and GTP, UTP & CTP) are added. This is complementary to the
terminator where transcription takes place. base sequence in the DNA template.
◦ A terminator: The site where transcription stops. Termination: A termination factor (ρ factor) binds to the
Located towards 3'-end (downstream). RNA polymerase and terminates the transcription.
In bacteria, transcription and translation can be coupled
(translation begins before mRNA is fully transcribed) because
• mRNA requires no processing to become active.
• Transcription and translation take place in the same
Transcription unit and gene compartment (no separation of cytosol and nucleus).
Gene is a functional unit of inheritance. It is the DNA Transcription in eukaryotes
sequence coding for an RNA (mRNA, rRNA or tRNA).
In eukaryotes, there are 2 additional complexities:
Cistron is a segment of DNA coding for a polypeptide 1. There are 3 RNA polymerases:
during protein synthesis. It is the largest element of a gene. • RNA polymerase I: Transcribes rRNAs (28S, 18S & 5.8S).
Structural gene in a transcription unit is 2 types: • RNA polymerase II: Transcribes the heterogeneous
Monocistronic structural genes (split genes): It is seen in nuclear RNA (hnRNA). It is the precursor of mRNA.
eukaryotes. Here, coding sequences (exons or expressed • RNA polymerase III: Transcribes tRNA, 5S rRNA and
sequences) are interrupted by introns (intervening sequences). snRNAs (small nuclear RNAs).
Exons appear in processed mRNA. 2. The primary transcripts (hnRNA) contain exons and
Introns do not appear in processed mRNA. introns and are non-functional. Hence introns must be
Polycistronic structural genes: It is seen in prokaryotes. removed. For this, it undergoes the following processes:
Here, there are no split genes. • Splicing: From hnRNA, introns are removed (by the
Transcription in prokaryotes spliceosome) and exons are spliced (joined) together.
In bacteria (Prokaryotes), synthesis of all types of RNA are • Capping: Here, a nucleotide methyl guanosine

catalysed by a single RNA polymerase. It has 3 steps: triphosphate (cap) is added to the 5’ end of hnRNA.
• Tailing (Polyadenylation): Here, adenylate residues
Initiation: Here, the enzyme RNA polymerase binds at the
promoter site of DNA. This causes the local unwinding of (200-300) are added at 3’-end.
the DNA double helix. An initiation factor (σ factor) present Now, it is the fully processed hnRNA, called mRNA.
in RNA polymerase initiates the RNA synthesis.

Transcription
in Bacteria

Transcription
& Processing
in Eukaryotes

GENETIC CODE
§ It is the sequence of nucleotides (nitrogen bases) in mRNA § Severo Ochoa (polynucleotide phosphorylase) enzyme is
that contains information for protein synthesis (translation). used to polymerize RNA with defined sequences in a
§ The sequence of 3 bases determining a single amino acid is template independent manner.
called codon. 20 types of amino acids involved in translation
§ George Gamow suggested that for coding 20 amino acids, 1. Alanine (Ala) 11. Leucine (Leu)
the code should be made up of 3 nucleotides. Thus, there 2. Arginine (Arg) 12. Lysine (Lys)
are 64 codons (43= 4 x 4 x 4). 3. Asparagine (Asn) 13. Methionine (Met)
4. Aspartic acid (Asp) 14. Phenyl alanine (Phe)
§ Har Gobind Khorana developed the chemical method in
5. Cystein (Cys) 15. Proline (Pro)
synthesizing RNA molecules with defined combinations of 6. Glutamine (Gln) 16. Serine (Ser)
bases (homopolymers & copolymers). 7. Glutamic acid (Glu) 17. Threonine (Thr)
§ Marshall Nirenberg developed cell-free system for 8. Glycine (Gly) 18. Tryptophan (Trp)
9. Histidine (His) 19. Tyrosine (Tyr)
protein synthesis.
10. Isoleucine (Ile) 20. Valine (Val)

pg. 4
ANMOL SHARMA LIVE

The codons for various amino acids - Insertion or deletion of one or two bases changes the
reading frame from the point of insertion or deletion. It is
called frame-shift insertion or deletion mutations.
- Insertion/ deletion of three or its multiple bases insert or
delete one or multiple codon. The reading frame remains
unaltered from that point onwards. Hence one or multiple
amino acids are inserted /deleted.
- It proves that codon is a triplet and is read contiguously.
TYPES OF RNA
• mRNA (messenger RNA): Provide template for translation
(protein synthesis).
• rRNA (ribosomal RNA): Structural & catalytic role during
Salient features of genetic code
translation. E.g. 23S rRNA in bacteria acts as ribozyme.
• Codon is triplet (three-letter code).
• tRNA (transfer RNA or sRNA or soluble RNA): Brings
• 61 codons code for amino acids. 3 codons (UAA, UAG &
amino acids for protein synthesis and reads the genetic code.
UGA) do not code for any amino acids. They act as stop
codons (Termination codons or non-sense codons). Francis Crick postulated presence of an adapter molecule
• Genetic code is universal. E.g. From bacteria to human that can read the code and to link with amino acids.
UUU codes for Phenylalanine. Some exceptions are found tRNA is called adapter molecule because it has
in mitochondrial codons, and in some protozoans. • An Anticodon (NODOC) loop that has bases
• No punctuations b/w adjacent codons (comma less code). complementary to the codon.
The codon is read in mRNA in a contiguous fashion. • An amino acid acceptor end to which amino acid binds.
• Genetic code is non-overlapping. • Ribosome binding loop.
• An amino acid is coded by more than one codon (except • Enzyme binding loop.
AUG for methionine & UGG for tryptophan). Such codons
are called degenerate codons.
• Genetic code is unambiguous and specific. i.e. one codon
specifies only one amino acid.
• AUG has dual functions. It codes for Methionine and acts
as initiator codon. In eukaryotes, methionine is the first
amino acid and formyl methionine in prokaryotes.
Mutations and Genetic Code - For initiation, there is another tRNA called initiator tRNA.
- Relationship between genes & DNA are best understood by - There are no tRNAs for stop codons.
mutation studies. Deletions & rearrangements in a DNA - Secondary (2-D) structure of tRNA looks like a clover-
may cause loss or gain of a gene and so a function. leaf. 3-D structure looks like inverted ‘L’.

TRANSLATION (PROTEIN SYNTHESIS)

- It is the process of polymerisation of amino acids to form • Now large subunit binds to small subunit to form initiation
a polypeptide based on the sequence of codons in mRNA. complex.
- It takes place in ribosomes. Ribosome consists of structural • Large subunit consists of aminoacyl tRNA binding site (A
RNAs and about 80 types of proteins. site) and peptidyl site (P site).
- Ribosome also acts as a catalyst (23S rRNA in bacteria is • The initiator tRNA (which carries methionine) binds on P
the enzyme- ribozyme) for the formation of peptide bond site. Its anticodon (UAC) recognises start codon AUG.
(peptidyl transferase enzyme in large subunit of ribosome).
- Translation includes 4 steps:
1. Charging of tRNA 2. Initiation
3. Elongation 4. Termination
1. Charging (aminoacylation) of tRNA
• Formation of peptide bond needs energy obtained from ATP.
• For this, amino acids are activated (amino acid + ATP) and
linked to their cognate tRNA in presence of aminoacyl tRNA
synthetase. Thus, the tRNA becomes charged.
2. Initiation 3. Elongation
• In this, small subunit of ribosome binds to mRNA at the • Second aminoacyl tRNA binds to the A site of ribosome.
start codon (AUG). Its anticodon binds to the second codon on the mRNA and
pg. 5
ANMOL SHARMA LIVE

a peptide bond is formed between first and second amino terminates.

acids in presence of peptidyl transferase. • The polypeptide and tRNA are released from the ribosomes.
• First amino acid and its tRNA are broken. This tRNA is • The ribosome dissociates into large and small subunits.
removed from P site and second tRNA from A site is pulled to A group of ribosomes associated with a single mRNA for
P site along with mRNA. This is called translocation. translation is called a polyribosome (polysomes).
• These processes are repeated for other codons in mRNA.
An mRNA has additional sequences that are not translated
• During translation, ribosome moves from codon to codon.
(untranslated regions or UTR). UTRs are present at both
4. Termination 5’-end (before start codon) and 3’-end (after stop codon).
• When a release factor binds to stop codon, the translation They are required for efficient translation process.

REGULATION OF GENE EXPRESSION

In eukaryotes, gene expression occurs by following levels: It consists of
1. Transcriptional level (formation of primary transcript). a) A regulatory or inhibitor (i) gene: Codes for repressor
2. Processing level (splicing, capping etc.). protein.
3. Transport of mRNA from nucleus to the cytoplasm. b) 3 structural genes:
4. Translational level (formation of a polypeptide). i. z gene: Codes for b galactosidase. It hydrolyses
The metabolic, physiological and environmental conditions lactose to galactose and glucose.
regulate gene expression. E.g. ii. y gene: Codes for permease. It increases
ú In E. coli, the beta-galactosidase enzyme hydrolyses permeability of the cell to b-galactosides (lactose).
lactose into galactose & glucose. In the absence of lactose, iii. a gene: Codes for a transacetylase.
the synthesis of beta-galactosidase stops. - Genes in the operon function together in the same or related
ú The development and differentiation of embryo into adult metabolic pathway.
are a result of the expression of several set of genes. - If there is no lactose (inducer), lac operon remains
switched off. The regulator gene synthesizes mRNA to
If a substrate is added to growth medium of bacteria, a set of
produce repressor protein. This protein binds to the
genes is switched on to metabolize it. It is called induction.
operator region and blocks RNA polymerase movement.
When a metabolite (product) is added, the genes to produce it
So the structural genes are not expressed.
are turned off. This is called repression.
- If lactose or allolactose is provided in the growth medium,
OPERON CONCEPT it is transported into E. coli cells by the action of permease.
§ “Each metabolic reaction is controlled by a set of genes” Lactose (inducer) binds with repressor protein. So repressor
§ All the genes regulating a metabolic reaction constitute an protein cannot bind to operator region. The operator region
Operon. E.g. lac operon, trp operon, ara operon, his becomes free and induces the RNA polymerase to bind with
operon, val operon etc. promoter. Then transcription starts.
Lac Operon in E. coli - Regulation of lac operon by repressor is called negative
regulation.
- The operon controlling lactose metabolism.
- It is proposed by Francois Jacob & Jacque Monod.

In the In the
absence presence
of of
inducer inducer

HUMAN GENOME PROJECT (HGP)

• The entire DNA in the haploid set of chromosomes of an Goals of HGP
organism is called a Genome. a. Identify all the estimated genes in human DNA.
• In Human genome, DNA is packed in 23 chromosomes. b. Sequencing of 3 billion chemical base pairs of human DNA.
• Human genome contains about 3x109 bp. c. Store this information in databases.
• Human Genome Project (1990-2003) was the first mega d. Improve tools for data analysis.
project for the sequencing of nucleotides and mapping of e. Transfer related technologies to other sectors.
all the genes in human genome. f. Address the ethical, legal and social issues (ELSI) that
• HGP was coordinated by U.S. Department of Energy and may arise from the project.
the National Institute of Health.

pg. 6
ANMOL SHARMA LIVE

Methodologies of HGP: 2 major approaches. • DNA sequencing also have been done in bacteria, yeast,
ú Expressed Sequence Tags (ESTs): Focused on Caenorhabditis elegans (a free living non-pathogenic
identifying all the genes that are expressed as RNA. nematode), Drosophila, plants (rice & Arabidopsis), etc.
ú Sequence annotation: Sequencing whole set of genome
Salient features of Human Genome
containing all the coding & non-coding sequence and later
a. Human genome contains 3164.7 million nucleotide bases.
assigning different regions in the sequence with functions.
b. Total number of genes= about 30,000.
Procedure of sequencing: c. Average gene consists of 3000 bases, but sizes vary.
Isolate DNA from a cell → Convert into random fragments Largest known human gene (dystrophin on X-
→ Clone in a host (bacteria & yeast) using vectors (e.g. BAC chromosome) contains 2.4 million bases.
& YAC) for amplification → Sequencing of fragments using d. 99.9% nucleotide bases are same in all people. Only 0.1%
Automated DNA sequencers (Frederick Sanger method) → (3x106 bp) difference makes every individual unique.
Arrange the sequences based on overlapping regions→ e. Functions of over 50% of discovered genes are unknown.
Alignment of sequences using computer programs. f. Chromosome I has most genes (2968) and Y has the
BAC= Bacterial Artificial Chromosomes fewest (231).
YAC= Yeast Artificial Chromosomes g. Less than 2% of the genome codes for proteins.
• Sanger has also developed method for sequencing of h. Very large portion of human genome is made of Repeated
amino acids in proteins. (repetitive) sequences. These are stretches of DNA
sequences that are repeated many times. They have no
• DNA is converted to fragments as there are technical
direct coding functions. They shed light on chromosome
limitations in sequencing very long pieces of DNA.
structure, dynamics and evolution.
• HGP was closely associated with Bioinformatics. i. About 1.4 million locations have single-base DNA
Bioinformatics: Application of computer science and differences. They are called SNPs (Single nucleotide
information technology to the field of biology & medicine. polymorphism or ‘snips’). This helps to find
• Of the 24 chromosomes (22 autosomes and X & Y), the chromosomal locations for disease-associated sequences
last sequenced one is chromosome 1 (May 2006). and tracing human history.

DNA FINGERPRINTING (DNA PROFILING)

• It is the technique to identify the similarities and Steps of DNA fingerprinting
differences of the DNA fragments of 2 individuals. (Southern Blotting Technique)
• It is developed by Alec Jeffreys (1985).
a. Isolation of DNA (from any cells or blood stains, semen
Basis of DNA fingerprinting stains, saliva, hair roots, bone, skin etc.).
• DNA carries some non-coding repetitive sequences. b. Digestion of DNA by restriction endonucleases.
• Repetitive DNA can be separated from bulk genomic DNA c. Separation of DNA fragments by gel electrophoresis.
as different peaks during density gradient centrifugation. d. Transferring (blotting) DNA fragments to synthetic
• The bulk DNA forms a major peak and the small peaks membranes such as nitrocellulose or nylon.
are called satellite DNA. e. Hybridization using radioactive labelled VNTR probe.
• Satellite DNA is classified as micro-satellites, mini- f. Detection of hybridized DNA by autoradiography.
satellites etc. based on base composition (A:T rich or G:C The autoradiogram gives an image in the form of dark & light
rich), length of segment and number of repetitive units. bands. It is called DNA fingerprint.
• A DNA sequence which is tandemly repeated in many
copy numbers is called variable number tandem repeats
(VNTR). It belongs to mini-satellite DNA.
• In a person, copy number varies in each chromosome.
• The two alleles (paternal and maternal) of a chromosome
also contain different copy numbers of VNTR.
• VNTR is specific from person to person.
• The size of VNTR varies from 0.1 to 20 kb.
• Any difference in the nucleotide sequence (inheritable
mutation) observed in a population is called DNA
polymorphism (variation at genetic level).
• Polymorphism is higher in non-coding DNA sequence
because mutations in these sequences may not affect an
individual’s reproductive ability. These mutations
accumulate generation to generation causing polymorphism.
• Polymorphisms have great role in evolution & speciation.

pg. 7
 ANMOL SHARMA LIVE

DNA fingerprint differs in everyone except in monozygotic Application of DNA fingerprinting

(identical) twins. • Forensic tool to solve paternity, rape, murder etc.
The sensitivity of the technique can be increased by use of • For the diagnosis of genetic diseases.
polymerase chain reaction (PCR). Therefore, DNA from a • To determine phylogenetic status of animals.
single cell is enough for DNA fingerprinting. • To determine population and genetic diversities.

MODEL QUESTIONS
1. Note the relationship between first two words and fill up the fourth place.
a. DNA: Thymine & cytosine RNA: ………………… b. UGG: Tryptophan AUG: …………………
2. The percentage of adenosine phosphate in DNA isolated from human liver is observed to be 30.7%. What is the
expected percentage of four nitrogen bases?
3. Schematically represent Griffith’s experiment.
4. Analyze the following diagram
a. Identify and copy the diagram.
b. Label A, B & C.
c. Mention the advantage of this arrangement.

5. Analyse the below flowchart which represent the central dogma of molecular biology and answer the following.
A B
DNA RNA Proteins
a. Mention the processes represented by the letters A and B
b. How the central dogma is modified with discovery of reverse transcriptase?
6. Observe the diagram given below:

a. Label a, b, c, d in the figure.

b. During transcription, both DNA strands are not
copied. Explain the reason.

7. Find the odd one and give reason: UAA, AUG, UAG, UGA
8. The sequence of template strand of a gene is given below. Construct the base sequence of mRNA transcribed from this.
3’ CACGTGGACTGAGGACTCCTC 5’
9. Given below is the DNA sequence, representing a part of the gene. Analyse this and answer the following questions.
5’ ATGGGGGTGCTCAATATATGCCCCCGTAGTTAA 3’
3’ TACCC CCACGAGTTATATACGGGGGCATCAATT 5’
a. Construct the mRNA molecule which will be transcribed from this DNA sequence.
b. Make a processed mRNA (assume that all the codons containing a C represent the intron DNA).
c. How many amino acid residues will make up the polypeptide corresponding to this processed mRNA?
10. “Protein synthesis will fail in the absence of tRNA molecule”. Justify this statement.
11. The coding region of a gene is estimated to consist of 450 nucleotide base pairs. Avoiding stop codons & introns, how
many amino acids would the corresponding polypeptide chain contain? Justify your answer.
12. Observe the diagrammatic representation of the lac operon given below and answer the questions.


a. What is the inducer in lac operon?
b. How does it ensure the “switching-on” of genes?
c. Mention the structural genes in lac operon.
d. What is the role of b-galactosidase & permease?


13. Expand these abbreviations:
a. NHC b. UTRs c. HGP d. ESTs e. SNPs f. VNTR g. BAC h. YAC
14. Draw a flowchart of steps involved in DNA fingerprinting.

pg. 8