Annual Report

+(|-(= ||-+:+
- -- -

((t-(4 :ar+ +e((+ e-((+
=(+|t

((=+|

+(|-( = | |-+ :+

- -- -

((t-(4 :ar+ +e((+ e-((+
=(+|t

((= +|
Published by : Dr. Masood Ali, Director
Indian Institute of Pulses Research, Kanpur
Editing, layout and designing : Mr. Diwakar Upadhyaya
Hindi translation : Mr. Brahm Prakash, Mr. Diwakar Upadhyaya
& Mr. R.K. Srivastava
Photography : Mr. Rajendra Prasad and Mr. Ved Prakash
Typing assistance : Mr. Har Govind Rathore
Publication Committee : Dr. Masood Ali, Chairman
Dr. S.K. Chaturvedi
Dr. P.S. Basu
Mr. Naimuddin
Dr. M.S. Venkatesh
Mr. Diwakar Upadhyaya, Member Secretary
Correct citation : Annual Report 2008-09
Indian Institute of Pulses Research, Kanpur
Printed by : Army Printing Press, 33 Nehru Road, Sadar Cantt., Lucknow-226 002, Tel : 0522-2481164
Preface
I am delighted to present Annual Report 2008-09 of IIPR. During this period, the
Institute has made great stride in basic and applied research, generation and transfer of
improved technologies, capacity building and international collaborations.
The research programmes of the Institute were carried out under 70 institutional and
25 externally aided projects. Three new varieties of different pulse crops viz., Shubhra of
kabuli chickpea, Sweta of mungbean and IPU 02-43 of urdbean have been developed for
cultivation in different agro-ecological regions. Several promising genotypes combining
resistance to major biotic stresses with high yield potentials are at the advanced stage of
testing in AICRPs. Molecular characterization of 32 isolates of Fusarium udum collected
from different parts of the country was done. Chickpea genotypes DCP 92-3 and C 235
transformed with Cry1Ac gene confirmed the expression of transgene when subjected to
insect bioassay. Putative transformants have also been developed in fieldpea (var. HUDP
15 and IPF 99-25) using seven dsRNA gene. Four CMS based hybrids of short duration
pigeonpea have been found promising. Over 3870 germplasm accessions of different pulse
crops were evaluated and characterized.
Under conservation agriculture, crop residue management, raised bed planting and
zero tillage proved promising. New strains of PGPR (PSB 11, PS 8) have been identified.
1
HNMR, FTIR and
13
CNMR analysis of latex of calotropis indicated presence of polymer of
carbamate containing isoprene unit. GBNV was identified as causal virus of leaf curl disease
of mungbean. Presence of chlorogenic acid in roots of chickpea and peroxidise (PO) and
phenylalanime ammonia lyase (PAL) in pigeonpea showed positive correlation with tolerance
to Fusarium wilt. New machines such as vertical thresher, pigeonpea stripper and suction
winnower were designed and fabricated for efficient post-harvest management.
New research programmes on heat tolerance in chickpea, impact of climate change on
pest and diseases scenario, molecular characterization and sequences diversity of tospovirus,
scale-up production and development of cost-effective formulations of EPN based
biopesticides and marker assisted breeding in lentil, urdbean, chickpea and pigeonpea
have been initiated. The Institute has developed an international project for SAARC countries
on Shuttle Breeding of pulses and is an important partner in generation challenge
programme on chickpea. Collaborations with CG institutes like ICARDA and ICRISAT
have been strengthened which has facilitated speedy flow of ISN and exposure visit and
training of pulse scientists under NAAS.
Under National Food Security Mission, IIPR has been identified as nodal institute for
breeder seed production and capacity building. In this endeavour, the Institute in
collaboration with AICRP centres organized breeder seed production of 284.8 tonne of
different pulse crops. A large number of training programmes for extension personnel of
NFSM states were organized, besides model national training programmes and state
sponsored training programmes. Under farmers participatory programme, 164.7 tonne
quality seeds of chickpea and pigeonpea were produced which will act as a catalyst for
fast spread of improved varieties.
The Institute celebrated its Silver Jubilee on 14
th
of February 2009 and organized an
International Grain Legumes Conference in collaboration with ISPRD. On this occasion,
the Institute brought out very valuable publications like Milestones in Food Legumes
Research, 25 Years of Pulses Research at IIPR and Pulses in Cropping Systems. Six scientists
were deputed for training in the specialized fields in advanced laboratories in India as well
as abroad. A large number of technical and administrative staff were also deputed for
training in specialized areas. Twenty two post graduate students were imparted short
term training (8 to 12 weeks) in Biotechnology, Biochemistry and Microbiology.
The all round growth and development of the Institute has been possible with unstinted
encouragement, support and guidance received from Dr. Mangala Rai, Secretary, DARE
and Director General, ICAR and Dr. P.L. Gautam/ Dr. S.P.Tiwari, Deputy Director General
(Crop Science) which I acknowledge with gratitude. I am also thankful to Dr. V.D. Patil,
Assistant Director General (Oilseeds and Pulses) for standing with Institute in its research
endeavour.
I would like to place on record my appreciation to Drs. Shiv Kumar, C. Chattopadhyay,
Mohan Singh, B.L. Kushwaha, S.K. Singh, R. Ahmad and Prasoon Verma for their sincere
efforts in compiling the report of their respective divisions and sections. I am also grateful
to the members of the Publication Committee (Dr. S.K. Chaturvedi, Dr. P.S. Basu,
Mr. Naimuddin. Dr. M.S. Venkatesh and Mr. Diwakar Upadhyaya) and Technical Cell
(Dr. Sanjeev Gupta, Mr. Brahm Prakash, Mr. D.K. Sharma, Mr. B.K. Verma and Mr. H.G.
Rathore) for their efforts in bringing out the report in time.
(Masood Ali)
Director
Contents
Preface
1. i
2. Executive Summary vi
3. Introduction
About the Institute xi
Organisational Set-up xiii
Linkage and Collaborations xiv
Mandate and Major Research Programmes xv
Staff Strength xvi
Financial Statement xvii
4. Research Achievements
Crop Improvement 1
Crop Production 20
Crop Protection 26
Crop Physiology, Biochemistry and Microbiology 38
Agricultural Extension 46
Agricultural Engineering 51
Agricultural Statistics and Computer Application 53
5. All India Coordinated Research Projects
Chickpea 54
Pigeonpea 55
MULLaRP 57
6. Transfer of Technology 59
7. Publications 61
8. Human Resource Development 69
9. On-going Research Projects 70
10. Externally Funded Projects 75
11. Institute Management Committee 77
12. Institute Research Council 77
13. Research Advisory Committee 78
14. Important Committees of the Institute 79
15. Panorama 82
16. Distinguished Visitors 89
17. Personnel 90
18. Appointments, Promotions, Transfers, etc. 93
-ii - ln(l(n (i - r ~ii i -i ~nn n -i (r| i -il
( n iii lii-i i lin iii l-(n r

i -i(nin ( (ii (i| nii i ( n i(| i | : iln ~i:.|.|.
. zaazzs (i ii) l| -i( i-ni zaa l.n i.r . r i - (i -n| i-ii
n in -rii- s-n|n nii -n (i ((i i rn llrn li ni r+
( | - n |n ln| l(iii nii li ~ilni i n ~(i i| iln ~i: .|. . azs l|
-i( i-ni s l.ni.r . r i ~ii (i nl-i |i ~i i- ii - i|
- in| rn llrn li ni r+

i zz in |ii ~i:.|.|. i zaas zaaas zaas zaarr
zaars zaars zaarz zaarzc zaarsa zaars zaarsr zaars/ zaar()
zaar((|) zaars zaar zaarr zaarrz zaarr zaarrs zaarcz nii
zaarc i -i inii l(i( z ln ~(ilini (ii:+ :| i ~r zs
|i .~i.~i. /r (|..~i. s// (|.|.. (|.|.. z |.|.. ss ~i:.|.
. s ~i:.|.. a ~i:.|.|. ssrs ~i:.|.|. sscz ~i:.|.|. sscs ~i:.|.|. ssac ~i:.
|.|. ssas ~i:.|.|. ssas ~i:.|.|. s/ ~i:.|.|.. ssa .|.. ssaz ..
.. rc .|.. s .|.. .|.. s |.~i:. ss/ca |.|.:. szs nii
ini -i ln -ii| ~(ilini (ii:+
- n i |ii (-. z |.|. r (|.-. |.~i. |.~i. r |.~i.|.|. / -..
rr .|.-. ss nii -|.-. ssra) nii ( n| |ii (..|.|. ~i: .|. . s
nii ~ii( ) ( (| ln l- in ini | (ii - ~(ilini (lin
|+
~r (i |i ~i:.|.|. z nii .(|.|. az | -i| |- ln ini| i
n +
- n |i -|..~i.-. s -|..~i.-. nii i l(ii -i: ( ~i ln
ri| i n+

ini| ( ii(li ~li iin| -l(n iii li i~i - (| i - --
(i li+ - s -i r i( | i | ~i:.|.|. zaazs nii ~i: .|.|. . az ( i|
i | ~i:.|.|. zaasa ~r | ~i:.|.. zas - | ~i:.|.. sz - n | ~i: .|.-.
az nii ( | ~i:.|. . zaacaz nii ~i: .|. . azss+

i sra ~r r// (sca ~~i(li nii z/ (|ii (li) - n ra - //c nii --
zza ( (ii-i i -~i (ir il| nii nii ~iii (n| i li
ni+
i
-
~~i(li ~r |(( (ni ~iiiln i iiln ~i:.|.. as (zsa l.
ni.r.) ~i:.|.|.. zss (z/s/ l.ni.r.) ~i:.|.. a/s (zss l.ni.r) ~i:.|.. asz
(zssr l.n i.r .) l(ln l n lri iln .|... za (/r l.n i.r .) | n i -
-- (i li+ |(( ( |i |.. cs nii .. zcrzc - (ili
l(lini i| n| lri a.z i -ni n ii (ii r -- l(i l : i
( i i -i( l-n +
-
~r - (rni ~ - in r n c l( lr ~lil~n l n+
z ..~i. i in i-i | c ilni i ~il( l(l(ini l(ii
li ni+ : .|. aa nii ~i: .~i: .|.~i. sc - n- -ini i: n: + i
-i (lin |i -ili rn ii| | | sr i ii i li li ni+
~i..|.|. nii ..~i. lri i in iin l(lii ii ln -i
ini sz i(i ~il( li n| -i -ri i ~l-n-( (iii+
..~i. lri i in i - -i ~(ilini nii n irni l n (rni
i ~ li ni+ n-in ( | || zra iii -~i l (r ..
~i. lri i in li ni+
-
| i( ~(ilini rn i (|.|.|. szs nii |. zsr) nii ~r
((ri nii -... s) |i :... ar - |
(|.(|.-|.|. ) ii inln l n+ i | iln |.|.|. szs - |.|.~i. l(ii
rii i| | l-iln | l- | n:+ s l(n ii --i| nii | ii n|
~i l n |- (~ i iii - i| | l-iln | l- |+
-- | iln . .|.|. r ( ~i:.|.. sszr -ii(in inln ii in l
n+ i nln iii | | n: ~i (i in l n +

(r| i i -ilrn n r -i ~iiiln ii| (|ii| |iii -
-in r - n ii| i ( (i ~n - (ili ~r -n~ (|+
ii ~iiiln ii| (|ii| |iii - (ili i -n~ iinr - n
ii| rii in r:+ ( (i <lni - ~i(l ( in li |
ni - zs.r% ~li in r: (l i(l ( in a.r% ~li in
r : +
(r| i i -i( i (i| iili - ii--- n ii| ~lin-
i< ii ii (i li ii ( i: n: i iin r- n ii| (i( r| i|+
ii- - ii nii - ~(iii -i(lin - | -
(ii ~(iii -i(lin | ni - s.z% ~li l-|+ ~il-i (ii
| ni - ~(i i -i(lin |iii - ~i | i - n| n | (l< r:+
ii
ii- - -| r: ii | n: ( (i: -n ((i: | ni - r.s%
~li i ii l-i+ i-i nii n i in i - | ii ii( i+
- -
(ii| (ii~i - nr| ni: ii | (i i in i | (ili
nii (ili in i-ni in r:+
(i li: (i (i li in ii i | (ili in r:+
l(lii |ii - . .~i. as (ili nii i n ( li+
-ii ii| - li | ni - -i - r - ni ( | ii( ln r . in
i | .z% ~li in r : + ( lin lii | ni - ni ( | ii( nii i- -
ii ii - i | i-i in i-ni - ii (l< i: n:+
-n (i |ii - i- ( ( -n l (l< | l(lii ~(-ii~i nii l(lii
i( iini l i-i | iln |-i -i a.zr a.c% nii a.zs a.s% i: n:+
(ii| (ii~i - ( (i: /r l(i (i( z% li i| lsi( i | -i(ni - ii
(l< r:+
-
ni ( | ii( ( -nn iil (i | ra% -ii n -ln ii n-( ii| - (i
i | (ili (ssaa l.n i.r .) in r :+ l( -i( ii| ~nnn (i | -i:
in i | iln ~i..|. sss (ili (z/sa l.n i.r .) | in r:+ l(
-i( ii| - -(i |(i i nii i:- - i:- i - i| ii r~i+

|lin l n c i(i - a.z% |(ii (i| -(i - i( |..(|.
- zz% | (l< r:+ i ( |.. s nii . c rii - -i s ( % | (l< r:+ ~li |(ii
(i| - (i - i-in ii n-(i i ~(iiii i| ~li r ~i+
- -
-(i ~ i ~i(

..-.~i. .-|.~i:.~i. nii

s
|..-.~i. i in
n i (| i- i i<|i iil l(ii li ni l nin r~i l r
:i: i iln -r ii ri ni r+
-
i - ( | ( iln - |n ln| in i ii
ii ni+
..-. nii .|. | l(li- i in
(~i.-|.|.~i.) rii - n --i| -i in i - i llrn
li ni+
-
i |ii - -i n irni nii ~(i lini n i i l-n iii | i - in
~- ~iii li li ni+ |i ~i:.|.|.. zaazzs |.|. srsss
iii
~i: .|.|. zaas nii zaass -i i ni i| i n+ ~r - -i ~(ii| (ii-i
(~i:.|.|. sscs ~i: .|.|. s/ .. nii (i (i i) | l-n i -
(|.~i.) nii (|...) | i lni i| n:+

( (in r nii (nr i i - ni - l-i | i - (| |
~n - -i sz.c% nii /r.c% | -| i: n|+ (ni| ( | - zr l.n i.
l(i| i nii - ni ( | ii(r. i iii l( ii nii - (ili ( l< r:
nii - (i - ni - nii l-i | i n- i: n: +
-
ni ri|ni |iiii ( (i: n: (ii - i ssa |i -~iln l n+
: l n| -~i n| l- -i( ~n ri|ni (ini | |( i-ni in
~i nii | (i) ln~~i| l-ini nii ii ii | -i(ni (irln )
-i|n | n|+ (lii nii - iin n- ii l(ln i|i (i nii ~~i(li |
i ~i:.|.|.(|. szs .|. / |.|. z ~i: .|.|.(|. s/ ~i ln| ~il( ( ((i:
| (ii - --i iin - l(ln |ii n i |. z . .~i. as | ~ ii
~si (i li+ ln iil(n ni ri| | i ~i i - (| ~ii nii
il l( ~iii i - ~i - -i|n - ~i |iii ~ i n+
-
~r l ( ii - n- i| - (ii i lini (i | iln ~lin-
(cs.c%) r:+ (l ii i - cs.s% (i | iln r:+ +(ii i i ~r nii
~lil~n l n nii (r| i | -i: rn ~i( iii ii (i n+
-
--i (i - (r iii nii i - iil-ni~i ( (iii~i (i - (lin lni
~ - i ini ~i rii -inn ilni - ini ( |-i i i nii ii rii
n i(--iilrn (|i in i (r| i | - -i(ni i -i ii -ii ni+
iii ni ~i |l-n ~i (i li ~iii ii (r| i | -i(ni - ~l-ini (r
-i( l n |ln i ~ii( nii |- ( i n (i - (iii~i - llrn l+
((i i - ii | riilnni ii l n iii ( i i-i ii( i i
l l n ~ - ii ni l i (|.|.|. szs nii .|. sr) - (|.|..
cz nii .. nii ~r (( ~r ) | ini| ilni ~li ~s|
l(ii|ni nii ~li ii ( ii ii rii ~li ( | i r| r + -ln i i
n-( (i nii l(i | n rii |- (i | ~ii : ilni i ii rii ~li
~ii ni+ ~i:.~i:.|.~i. (i l- ~ii i n- iii( ( - -~
ii i nl-i l -~ (< i i ii ( n| r l ln -ir saaa sraa
n | ~lnln ~i ~ln | i n| r +
ni(--iin (| -i( rn ~i(i (| ii| l(i ( ilni i- ~nnn
nr ( - ~n n| ~r (.|... za) i rza l.n i. nii i (rin ( -
(|ii| ~r (( ~r ) i zzraa l.ni. ni(--iin (| -i( li ni+ (| -
iv
nr nii i (rin (i - i (|.|.|. szs ( .|. c) i zrra l.n i. (|
l(nln li ni+
( (i i - riilnni -i- -i ( - l(n ini (i r n
in i (i(i l(i ni+ iln ini - i ( - iii - i( ri -
~i| -| i| n:+
(r -i( lni l(ii ~ - -lri ii | riilnni s.sz% i: n:+
i (- n nii ~r | ni| i n| - -lri ii i ni ~i(ni -n -i
s.a z.c nii rr.r% ii ni+
- -

~li iin| -l(n ii i l ii~i ~nn n l-llin ilni l(lii liill-iln|
ii rn llrn | n:

~li iin| -l(n iii lii~i ~nn n l(lii inilnli i scz ~r
sc ~i - n ( - -- i-i nii i i| (rn i - (i l n+ i - in
ilni rii - zc% nii -n in n|| i ~i - z% | (l< r:+ ~r
- ini| ilni -inn ilni | n i - ~i n - zssz% | (l< nii zss%
~li i < ii in r~i+ -i lii ~nnn l(lii (r| i - n n|| rii
-inn <lni | ni - - zcs% nii i< ii - ss% | (l< r:+

i | s/ ilni i sss.z/ - ~r | a ilni i c. - - n | rc ilni
i //.r - ( | ilni i ss.as - - | s ilni i .cs - -- | z
ilni i ca. - nii i-i | / ilni i s./ - (| -il(n li ni+
v
-
i ~i:.|.|.. zaazzs - i
~r -|. .-|. ra - i
- - | --i (| - (i| i
- n (ni --i| ri | i
.|. . rz --i l-| - (i| i
(~~ii ( --i l-| - (i| i
(
~i: .|.. azs (lii| i

Executive Summary
New varieties
A high yielding, large seeded and white beige colour kabuli chickpea variety IPCK
2002-29 (Shubhra) with yield potential of 2040 kg/ha has been identified for cultivation
in Madhya Pradesh, northern Rajasthan, Gujarat, Maharashtra, Chhatisgarh and
Bundelkhand tracts of Uttar Pradesh.
A MYMV and powdery mildew resistant urdbean variety IPU 02-43 with yield potential
of 911 kg/ha has been identified for kharif cultivation in Andhra Pradesh, Tamilnadu,
Orissa and Karnataka states.
Potential donors
Twenty two advanced breeding lines of chickpea viz., IPC nos. 2004-3, 2004-8, 2004-
34, 2005-15, 2005-18, 2005-19, 2005-24, 2005-26, 2005-30, 2005-34 2005-35, 2005-37, 2005-
41(A), 2005-41(B), 2005-43, 2005-44, 2005-45, 2005-52, 2005-54, 2005-59, 2005-62 and
2005-64 showed resistance against race 2 of chickpea wilt pathogen. Similarly, twenty
three genotypes of pigeonpea viz., AWR 74/15, BWR 377, BDN 1 BDN 2, GPS 33 IPA
3, IPA 40, ICP 8858, ICP 8862, ICP 8863, ICP 89046, ICP 89048, ICP 89049, ICP 9174,
ICPL 93011, KPL 93012, JAWS 5-6, KPL 43, KPL 44, KPL 49, PI 397460 Sel., PDE 92-E
and Sujata showed stable resistance to wilt.
Nine genotypes of mungbean viz., M 421, GG 5, BM 4, Co 4, Co 5, CoGG 7, ML 515,
UPM 98, TM 98-50 and three genotypes of urdbean viz., USJD 111, IPU 94-1 and
Azad 1 showed resistance against CLS under artificial epiphytotic conditions. Mungbean
lines Pusa 9531 and SML 668 exhibited resistant reaction against powdery mildew.
Pigeonpea genotypes ICP 42 and JBP 102 were found promising against podfly.
Mungbean genotypes TARM 18, TARM 1 and Pusa Vishal exhibited tolerance to pre-
harvest sprouting.
Promising breeding lines
A large number of promising breeding lines have shown good performance in AICRP
trials. Some of these are: IPC 2004-29 and IPCK 02 of kabuli chickpea, IPC 2004-90 of desi
chickpea, IPA 203 of pigeonpea, IPL 312 of lentil, IPM 02-14 of mungbean and IPU 02-33
and IPU 2006-2 of urdbean.
Plant genetic resources
Total 851 germplasm accessions of chickpea, 577 of pigeonpea (360 early and 217 long
duration), 450 of mungbean, 1776 of lentil and 220 of fieldpea were evaluated and
characterized for morpho-physiological and phenological traits.
CMS based hybrids in pigeonpea
Four CMS based experimental hybrids of short duration pigeonpea viz., IPH 08-1 (2901
kg/ha), IPCH 2433 (2797 kg/ha), IPH 07-3 (2498 kg/ha) and IPH 08-2 (2335 kg/ha) have
been developed which exhibited superiority over check UPAS 120 (1754 kg/ha). CMS line
PA 163 A and restorer AK 261526 were found most divergent showing 0.412 Jaccards
similarity coefficient suggesting that cross involving these parents may result in highly
heterotic hybrid.
vi
Development of molecular markers
Total 16 genic microsatellite markers have been designed for their use in assessing
polymorphism in pigeonpea. Molecular diversity analysis was performed in 16 varieties
of rajmash using 24 SSR primers. The lowest similarity was found between EC 400401
and IIPR 96-4. In order to map genes associated with Fusarium wilt in chickpea,
phenotyping of 195 F
4
plants was performed.
Molecular characterization of 32 isolates of Fusarium udum from different states of
India using RAPD and SSR markers revealed existence of three major groups.
The parental polymorphism for wilt resistance and susceptibility in chickpea was carried
out using SSR markers and subsequently polymorphic SSR markers were used to screen
250 F
2
individuals.
Transgenics
For Helicoverpa resistance, different genotypes of chickpea (DCP 92-3 and C 235) and
pigeonpea (Bahar and MAL 13) were transformed with Cry 1Ac gene (pBTC1 in EHA105
Agrobacterium strain). PCR analysis confirmed the presence of the transgene in chickpea
cultivar cv. DCP 92-3. Insect bioassay was conducted following the leaf and pod
detachment technique with certain modifications, which confirmed the expression of
transgene in chickpea plants.
Putative transformants have been obtained in fieldpea (var. HUDP 15 and IPF 99-25)
using seven dsRNA constructs under constitutive CaMV35S promoter for integrase
and AF531160, AF531165, AF531166, AF531169, AY134444 and AF531170 for genes.
The putative transformed plants were grafted and seeds were obtained.
Cropping systems
In long-term trial on maize based cropping system involving pulses, maizewheat
mungbean system produced highest pigeonpea equivalent yield at the end of 5
th
year
of crop rotation.
In rice based long-term trial, highest chickpea equivalent yield was recorded in rice
wheatmungbean cropping system. Among fertilizer management systems, inorganic
fertilizer application gave 28.5% higher yield than control, followed by organics
treatment (19.5%).
Among diversified cropping systems involving pulses, ricefieldpeamungbean was
found most remunerative with highest net returns, which was at par with rice- wheat-
mungbean system.
In ricelentil cropping sequence, incorporation of both rice and lentil crop residues
resulted in 13.2% increase in lentil yield over removal of both crop residues. There
was three-fold increase in earthworm population in residue incorporated treatments
over its initial values.
Yield advantage of 15.3% was recorded in lentil due to raised bed sowing over
flat sowing in rice-lentil cropping sequence. Phosphorus and sulphur application
significantly increased the lentil yield.
Integrated water and nutrient management
Deep tillage with cultural mulch resulted in maximum chickpea yield as well as water
use efficiency under rainfed conditions. Chickpea genotype KWR 108 recorded the
highest water use efficiency.
vii
Pre-sowing irrigation + one irrigation + mulching recorded highest seed yield of
chickpea with maximum water use. Among various genotypes, KWR 108 recorded
highest seed yield and water use.
Farm yard manure application @ 5t/ha to maize gave 14.2% higher grain yield of
chickpea over control in maizechickpea cropping sequence. Phosphorus use efficiency
in chickpea significantly increased due to FYM and phosphate solubiliser application
as compared to the respective controls.
Critical limit of phosphorus ranged between 0.25 to 0.46% and 0.28 to 0.49% for
mungbean genotypes viz., Samrat and Narendra Mung 1, respectively at different
growth stages and for different plant parts.
Under rainfed condition with 2% urea spray at 75 DAS significantly improved
productivity of chickpea.
Production technology for organic chickpea
Integrated nutrient system consisting of FYM and 50% of recommended chemical
fertilizer showed maximum fodder sorghum production (49300 kg/ha). However after
sorghum harvest, highest yield of 2730 kg/ha was obtained with chickpea var. RSG 888
under organic production system. Organic carbon and nitrate nitrogen improved in organic
production system.
Plant growth promoting rhizobacteria
Out of 16 elite PGPR strains tested, strain PSB 11 increased grain yield by 22%, followed
by PS 8 (13%) and K 6 (11%) in soil with 0.12% carbon. The nutrient uptake, in general,
increased in soil enriched with carbon.
Chemical constituents of calotropis latex
Calotropis latex were extracted and non-polar fraction was purified and chemically
characterized using
1
HNMR, FTIR and
13
CNMR, which indicated that it may be a polymer
of carbamate containing isoprene unit.
New viruses of Vigna
Yellow mosaic disease in Vigna mungo var. silestris at Kanpur was shown to be caused
by Mungbean Yellow Mosaic India Virus.
Causal virus of leaf curl disease of mungbean was identified as GBNV by reverse
transcription-polymerase chain reaction (RT-PR) using NSm and NP gene specific
primers. NP and NSm gene sequences of GBNV isolate infecting mungbean at Kanpur
have been submitted to NCBI database under the accession nos. FJ 647037 and FJ
647036.
Biochemical basis of wilt resistance
The wilt susceptibility and resistance in chickpea genotypes has been characterized
based on chlorogenic acid in the roots of infected plants. Genotypes IPCK 2002-29, PG
95333, IPC 2004-3, 2004-93 were found resistant to wilt. The wilt resistant lines of pigeonpea
(ICP 8863, ICP 9174 , JA 4 and Banda Palera) had shown higher activity of peroxidise (PO)
and phenylalanine ammonia lyase (PAL) in infected roots.
Nematode management
Cropping sequences urdbean + sorghum-wheat and urdbean-wheat+mustard were
viii
effective in reducing the root-knot nematode population by 82.6% and 75.6%, respectively
at the end of rabi crop. In spring sown urdbean crop, application of 25 kg Neem seed
powder + 1 ton farm yard manure/ha resulted in highest biomass and grain yield and
minimum gall index and lowest soil population of root-knot and cyst nematode.
Heat tolerant chickpea lines
Total 330 chickpea genotypes were evaluated for heat tolerance under late sown
condition. Three screening techniques involving reproductive organ tolerance (pollen
viability, pollen germination and pod sets), membrane stability and quantum yield of
photosynthesis (chlorophyll fluorescence) were standardized. Early flowering and short
duration genotypes evolved from warm south and central zones of India such as ICCV
92944, JG 74, GG2, ICCV 37, Annegiri, etc., performed better under late sown condition
compared to those evolved from northern India e.g., Pant G 114, C 214, KWR 108. The
putative heat tolerant lines selected from field evaluation based on flowering , grain yield,
seed size and physiological maturity were in close conformity to the screening tests
standardized.
Post-harvest technology
Among various pre-milling treatments for pigeonpea, hot water soaking gave maximum
finished product recovery of dal (68.6%), followed by steam treatment (63.8%). Vertical
thresher, pigeonpea stripper and suction winnower were designed and fabricated with
some improvements for threshing of pulse crops. A rubbing type thresher was also designed
and first prototype was developed for non-impact threshing of pulse crops.
Transfer of technology
In the study on stake holders perception of priorities and issues in pulses research
and extension in Uttar Pradesh, extension personnel expressed that prevalence of
diseases and insect pests in old varieties and deteriorated seed used by farmers was
the main reason for poor productivity of pulses. Researchers expressed that instability
in yield of pulses was due to narrow genetic base, absence of suitable policy on pulses
production and insect pest/disease management.
Impact assessment on farmer participatory research and extension programme
conducted in Bundelkhand region showed that improved varieties of chickpea (DCP
92-3, JG 315), lentil (DPL 62, JL 1) and pigeonpea (Narendra Arhar 1) were preferred
due to more yield, better marketability and greater profitability and were adopted in
higher degree as compared to integrated nutrient management and pest management
through use of NSKE. Farmers perceived that IIPR mini dal mill was simple to operate,
easy to maintain and cheap, with an earning of additional income of Rs. 3000 3500
per month by value addition through micro-enterprise.
Under popularization and development of model seed systems for quality seed
production, total 5420 kg quality seed of early pigeonpea (UPAS 120) was produced in
Fatehpur district and 22500 kg seed of long duration pigeonpea (Narendra Arhar 1)
was produced in Kanpur Dehat district. During rabi season, the quantity of chickpea
(DCP 92-3, JG 16) seed distribution was 2550 kg in Fatehpur and Kanpur Dehat districts.
Use of Trichoderma sp. for management of wilt and root rot complex was promoted in
Bundelkhand region through participatory training and it was observed that Trichoderma
inoculated fields showed low percentage of plant mortality in chickpea and lentil.
Activity analysis of pulse cultivation showed that participation of women farmers
singly was observed to be 34.92 % in pulse production.
ix
The perceived need level of women farmers with regard to improved chickpea,
urdbean/ mungbean and pigeonpea cultivation was found to be 48.0, 42.6 and 55.5
per cent, respectively.
All India Coordinated Research Projects
Improved Varieties
Under All India Coordinated Research Projects, following varieties were identified
for different agro-climatic zones:
Frontline demonstrations
Under AICRPs, 964 demonstrations on various technologies in chickpea, 361
demonstrations in pigeonpea, and large number of FLDs in mungbean, urdbean, lentil,
rajmash and lathyrus were conducted during the year. In chickpea, the increase in the yield
was to the tune of 26% due to improved varieties, while 42% as a result of adoption of
improved package of technologies. In pigeonpea, improved varieties recorded higher mean
grain yield of 23-32% with 29-49% higher net returns than local varieties. In pulses under
MULLaRP, the yield increase ranged from 26 to 48% and net returns from 18 to 49% over
local practices.
Breeder seed production
Total 8392.69 q of breeder seed of 87 varieties of chickpea, 644.15 q of 40 varieties of
pigeonpea, 771.58 q of 56 varieties of mungbean, 380.29 q of 44 varieties of urdbean,
416.28 q of 31 varieties of lentil, 601.42 q of 24 varieties of fieldpea and 34.70 q of 7
varieties of rajmash were produced.
x
Crop Variety Zone
Kabuli Chickpea IPCK 2002-29 CZ
Lentil Maitree NEPZ
Mungbean Sweta NHZ
NDU 5-7 NWPZ
Vallabh Urd 1 NWPZ
Urdbean
IPU 02-43 SZ
Pigeonpea TJT 501 CZ

About The Institute
Pulses continue to be an important ingredient of human diet specially, for the huge
vegetarian population in the country. In the era of Green Revolution with major focus on
staple food like rice and wheat, pulses were relegated to the marginal lands with least of
inputs. This coupled with the increasing population resulted in reducing per capita
availability of pulses to the masses. To enhance the productivity of the then existing varieties
by improved production technologies, besides breeding for high yielding varieties of
different pulse crops become the prime concern. To take up the cause, All India Coordinated
Pulses Improvement Project (AICPIP) was started in 1966 at the Indian Agricultural Research
Institute (IARI), New Delhi. Later in 1978, its headquarters was shifted to the then Regional
Station of IARI at Kanpur under the name of Project Directorate (Pulses). It was further
elevated as Directorate of Pulses Research (DPR) in 1984 and became an independent entity
under the direct control of ICAR. In 1993 the DPR was upgraded and elevated to the status
of Indian Institute of Pulses Research, and simultaneously, AICPIP was trifurcated into
three coordinated projects on chickpea, pigeonpea and MULLaRP (mungbean, urdbean,
lentil, lathyrus, rajmash and pea) to provide focused attention on each crop. Since then,
the Institute is playing a key role in strengthening the nutritional security and sustenance
of soil health. Besides generating basic knowledge and material, other activities of the
Institute include development of appropriate crop production and protection technologies,
production and supply of breeder seeds of improved varieties, demonstration and transfer
of technologies, and strategic coordination of pulses research through wide network of
testing centers across the country.
The Institute is located at Kanpur, Uttar Pradesh at 26
o
27'N latitude, 80
o
14'E longitude
and 152.4 meter above the mean sea level. It is situated on Grand Trunk Road, 12 km from
Kanpur Central Railway Station towards New Delhi.
The overall climate varies from semi-arid to sub-humid. The summers are very hot
and winters are cool and dry. The monthly weather data for the year 2008-09 revealed
that the mean monthly maximum temperature varied from 23.3
o
C in January to 38.9
o
C in
May and the minimum temperature from 10.6
o
C in January to 25.9
o
C in July. The relative
humidity at 17.30 h varied from 34.5% in May to 79.7 % in August. During the year, total
1080.4 mm rainfall was received which was normal. The monsoonal rains withdrew by
the end of September. During winter season, 6.6 mm rainfall was received. Unusually high
temperatures were recorded during the months of September (32.2
o
C), October (32.0
o
C)
and November (29.3
o
C). This adversely affected the performance of all rabi pulses.
Multi-disciplinary research of both applied and basic nature is conducted under four
divisions namely, Crop Improvement, Crop Production, Crop Protection, and Crop
Physiology, Biochemistry & Microbiology, besides applied and strategic research in
Agricultural Extension, Statistics & Computer Application, Agricultural Economics and
Agricultural Engineering sections. To cater to the needs of the Institute's activities and
mandate, service units such as Farm Management, Library & Informatics, ARIS Cell, Hindi
Cell, Art & Reprography and Publication & Documentation are in place.
The Institute has a well developed 84 ha research farm. Physical Containment Facility
has been created for advancing generation of the transgenic plants and further validation
of the transformants. A post-entry quarantine complex facility is also in place to intercept
xi
seed borne virus from imported seeds. In addition, screening facilities against major
diseases of pulse crops have been developed. Rain-out shelter to screen genotypes against
drought, well-equipped laboratories of biotechnology, molecular biology, biochemistry,
physiology, pathology, bio-control, soil chemistry, medium-term germplasm storage and
weather observatory provide necessary infrastructures for R & D activities. The computer
cell provides facilities for data base management, documentation, and statistical analyses.
The library houses exhaustive literature on pulse crops besides CAB abstracting on CD
ROM. The museum depicts pulse technologies developed by the Institute. The Institute has
sanctioned strength of 82 scientists, 68 technical, 29 administrative and 70 supporting
personnel.
xii
Organizational Set-up
xiii
Linkage and Collaborations
xiv
Mandate
To act as national centre for basic and applied research on pulse crops
To monitor, guide and coordinate research on pulses in the country
To impart training to scientists and extension workers engaged in pulses
research and development
To foster national and international collaborations for exchange of views
and material
To disseminate information on latest pulses production technology
To serve as an information bank on different aspects of pulses for
strategic planning
To extend consultancy services and expertise.
Major Research Programmes
Genetic Enhancement for Yield
Biotechnological Interventions
Plant Genetic Resources : Collection, evaluation and conservation
Cropping Systems Research
Integrated Diseases & Pests Management
Integrated Nutrients Management
Physiological Studies
On-farm Research and Informatics
Post-harvest Technology
xv
Staff Strength
xvi
Financial Statement
STATEMENT OF RECEIPT AND EXPENDITURE FOR THE
FINANCIAL YEAR 2008-2009
Rs. in lakhs
A. Receipt 37.68
B. Expenditure
Non-Plan 897.34
Plan 310.49
C. Pension and other retirement benefits 44.18
D. AICRP
Chickpea
a. Coordination Unit 47.56
b. Grant-in-aid 415.36
Pigeonpea
a. Coordination Unit 33.35
b. Grant-in-aid 281.55
MULLaRP
a. Coordination Unit 40.70
b. Grant-in-aid 507.25
xvii
1
Crop Improvement
Transgenic Development
Chickpea and Pigeonpea
Genetic transformation was performed in two genotypes each of chickpea (DCP 92-3
and C 235) and pigeonpea (Bahar and MAL 13) with Cry1Ac gene (pBTC1 in EHA105
Agrobacterium strain). The regeneration using sliced embryonic axes produced upto 24
multiple shoots in chickpea (Fig. 1). In pigeonpea, average number of shoots per explants
was 3.4. The regeneration frequency in chickpea was between 0.4 to 0.84 per cent, whereas
the efficiency ranged between 1.8 to 8.5 per cent (Table 1). Average transformation frequency
was found between 3.4 to 5.3 in chickpea (Table 2). Genomic DNA was extracted from the
leaves of transformed plants of DCP 92-3 and PCR analysis using Cry1Ac primers confirmed
the presence of the transgene in the genome.
Table 1: Regeneration in chickpea (DCP 92-3)
Table 2: Differential response of different genotypes of chickpea to transformation (%)
Explants inoculation Multiple shoot initiation Shoot proliferation Shoot elongation
Fig. 1: Different stages of chickpea regeneration through direct organogenesis
Bioassay of Transgenic Lines
Insect bioassay was conducted following the leaf and pod detachment technique
(Sharma et al 2005, Journal of Economic Entomology 98(2):568-576) with certain modifications.
Fifth leaf from the terminal part of the plant and pod were kept in a sterile petriplate with
moist cotton plugged to the cut end of the petiole and a moist filter paper was placed in the
bottom of the petriplate for maintaining humidity ( Fig. 2). Single first instar and 3
rd
instar
Shoot induction medium Frequency (%) Efficiency (%)
MS+1 mg/l kinetin+ 0.1mg/l NAA +40g/l sucrose 0.40 1.8
MS +1 mg/l BAP+40 g/l sucrose 0.75 3.5
MS+B 5 vit.+0.125 mg/l IBA+2 mg/l BAP+40g/l sucrose 0.78 6.5
MS +B5 vit.+40g/l sucrose 0.80 2.3
MS +0.125 mg/l IBA+2 mg/l BAP+40g/l sucrose 0.84 8.5

Genotype No. of explants inoculated Selection on Hygromycin
(No. of plants)
%
DCP-92-3 3724 128 3.4
JKG-1 662 34 5.1
C 235 322 17 5.2
JG 315 590 20 3.3

2
larve of H. Armigera starved for three hours were released on the leaf and pod plates
respectively. The plates were kept in a BOD maintained at 25
O
C temperature and 60%
humidity. The leaves and pods were replaced after two days. Results showed that four out
of eight 1
st
instar larvae fed on leaves died after 10 days, whereas, the third instar larvae
fed with pod did not show any adverse effect.
Bt Non-Bt
Fig. 2: Insect bioassay of transgenic lines using 1
st
instar larvae of H. armigera
Isolation and Cloning of Protease Inhibitor Genes
Plant-derived protease-inhibitor genes are expected to be compatible with host genome
and should provide synergistic effect to Bt transgenic for durable resistance against pod
borer. Using ten legume protease inhibitor gene sequences, three pairs of PCR primers
were designed and two novel PCR fragments were cloned ( Fig. 3). In addition, eight new
primers were designed and these were used for PCR amplification of 24 genotypes. The
distinct amplicons from six genotypes were cloned into pTZ57R/T vector of GeneJet cloning
system (MBI Feremntas). The cloned fragments were transformed into E.coli and the isolated
plasmids when checked in agarose gel, showed presence of inserts. These fragments have
been further characterized by DNA sequencing and being cloned into binary vector for
plant transformation. These genes will supplement Bt genes and offer sustainable protection.
Lanes M: Marker DNA 100bp ladder, Lane 1-Chickpea (Radhey), Lane 2- Chickpea (Pusa 256), Lane 3- Chickpea
(Awarodhi), Lane 4- Cowpea (Pusa Komal), Lane 5- Cowpea (Gomti), Lane 6- Cowpea (Bali), Lane 7- Pigeonpea
(Narendra 1), Lane 8- Pigeonpea (Bahar), Lane 9- Pigeonpea (Paras), Lane 10- Pigeonpea (Malaviya)
Fig. 3: PCR amplication of protease inhibitor genes
Understanding Plant Nematode Interaction Using RNAi
Agrobacterium mediated transformation of two nematode susceptible genotypes of
fieldpea viz., HUDP 15 and IPF 99-25 was taken up with seven dsRNA constructs under
constitutive CaMV35S promoter for Integrase, AF531160, AF531165, AF531166, AF531169,
AY134444 and AF531170 genes. The embryonic axes slices were cocultivated with the
Agrobacterium for four days and the transformants were selected on kanamycin (50 mg/l)
3
medium, elongated plants were micro-grafted on the pre-grown shoots of the same genotype
in the physical containment facility. The grafted plants produced flowers and mature pods
and seeds were harvested (Fig. 4). Summary of transformation is given in Table 3. Primers
were synthesized for screening the established putative transformants. The putative
transformants were subject to PCR analysis using primers for CaMV 35S promoter, npt II
marker gene and integrase gene (Fig. 5).
Table 3: Differential response of different genotypes of fieldpea to transformation using
embryonic axes explant
Gene Genotype No. of
explants
inoculated
No. of explants
regenerated
No. of
shoots
grafted
No. of shoots
established
No. of PCR
+ve plants
HUDP-15 300 187 108 13 3 Integrase
IPF 99-25 300 158 83 0 --
HUDP-15 300 230 81 21 17 AF531170
IPF 99-25 300 264 90 29 21

Co-cultivation Selection with kanamycin Regeneration
Elongation Establishment Flowering Maturation
Fig. 4: Different stages in fieldpea transformation
PCR amplification using primer for npt II
marker gene Lane M: 100 bp ladder, 1: non-trans-
formed plant,2-8:transformed plants,9&10 :positive
control (Plasmid DNA).
PCR amplification using primer for CaMV 35S promoter:
Lane M: 100 bp 1-11: transformed plants, 12&13:
positive control (Plasmid DNA), 14 negative control
(non-transformed plant)
Fig. 5: PCR analysis of putative transformants
4
Genomics
Chickpea
Total 195 lines of F
4
mapping population obtained from BG 256 (wilt susceptible) x JG
315 (wilt resistant) were raised both in normal and sick plot. Phenotyping of F
4
mapping
population for characters viz., disease reaction, days to flowering, growth habit, leaflet
size, days to maturity, plant height and yield was done.
Total 15 EST-SSR were developed using SSRIT and WEBTROLL software. All primers
were picked up on the basis of at least 40% GC content. The SSR repeats were pentamer,
trimers and dimers repeated five to ten times. Eight SSR markers were validated to produce
expected size, polymorphic amplicons in chickpea genotypes (Fig. 6). Six EST sequences
show strong homology with disease resistant protein sequences and could be putative R
genes. On performing BLASTx, homology to protease inhibitor, protein kinase, disease
resistant proteins were obtained with over 60% of query coverage.
Lane M: 100 bp ladder, S: BG 256 wilt susceptible, R: JG 315 wilt resistant
Fig. 6: Amplification pattern of EST-SSR developed from chickpea
Pigeonpea
Parental Polymorphism Survey with SSR and AFLP Markers
Genomic DNA from six parental lines of pigeonpea (Asha, UPAS 120, Bahar, 67 B,
Type 7 and Dholi Dwarf) was isolated and parental polymorphism survey using 46 SSR
markers (30 from pigeonpea and 16 from chickpea) has been completed. Parental
polymorphism study between Asha and UPAS was also done separately using 30 SSR markers
from pigeonpea. A total of 576 genomic microsatellite markers were obtained from ICRISAT
under the AKI-PGI project and were screened on six pigeonpea genotypes.
Total 37 EST clones from Cajanus scarabaeoides have been sequenced and 16 genic
microsatellite markers have been designed from these sequences (Table 4). Genotyping of
F
2
mapping population of pigeonpea has begun with SSR markers (Fig. 7).
Fig. 7: SSR profile of F
2
mapping population with primer PP-11
5
Table 4: List of genic microsatellite markers developed at IIPR
The AFLP technique was standardized and total 8 AFLP primer combinations were
screened on these six parents (Fig. 8). These primers showed good amplification and
polymorphism. The PAGE protocol for separation and silver staining of AFLP products
was standardized. This technique can be further used to generate polymorphic information
and in development of linkage map. This technique can be also used to develop new set of
markers like STS in pigeonpea.

Name Motif Primer Sequence (5-3)
IPCS1 (TGTGT)2, F ATAGACGGTGTTGACCCGAG
R AAAGGATTCAAAGGGAAGGG
IPCS2 (CCCTT)2 F AGTCTGTGTTGTGTTTGCCG
R GCAGTGGTATCAACGCAGAG
IPCS3 (TTTC) 3 F GAAGCAGTGGTATCAACGCA
R CTCCCGAATCTCGAATGAAC
IPCS4 (CAAAA) 2 F GGGACAGGGCCTGACTATTA
R TCAACACCATCTTTTTCGCA
IPCS5 (AC) 5 F TGGCCAAAACAAAATGACAA
R GGATGGACCAACTCCTTCAA
IPCS6 (CGGGT) 2 F CGTCAGCACTCAACAGGGTA
R GGTGAGAATTCAAAGCCCAA
IPCS7 CCCGG) 2 F GCAGTGGTATCAACGCAGAG
R CCCTTTACCTGTTTCCCCC
IPCS8 (CTGCA) 2 F TTCCATCTGGTATCACGCAA
R GAGCCATAGCAGCTCCAAAC
IPCS9 (TCTCC) 2 F TTTCTTGGTGGCTTTGTTCC
R ATCATCCAAGCCAAAACGAG
IPCS10 (GGGGA) 2 F CTACAAAGACACGGGGGCTA
R CAGGCTGTTGTCCTCTCTCC
IPCS11 (GAACG) 2 F CAAGGGACCATGTGTGAGTG
R GGACAAGCAAAGAGACCCAC
IPCS12 (TTTG) 3 F TGATTCGAGGGAGTGTGTGA
R GCAGTGGTATCAACGCAGAG
IPCS13 (TTGCC) 2 F CTGGTGCCACCTCTGCCCCA
R TGGGCCAGGATCAGACATGC
IPCS14 (AGAGC) 2 F TGGGTACACGAAAGTGACGA
R AGACTCGCGACTATGGCAG
IPCS15 (TC) 5 F CTGTTCCTCCATCTCTCCGA
R GGCAGGGTAAATTTGGGATT
IPCS16 (AAAAC) 2 F ATATGAACCAAGCGGTGCTC
RGGCAGGGTAAATTTGGGATT
Fig. 8: AFLP profile of 6 pigeonpea parents with the primer combinations E-AAG /M-CAA and
E-AAC/ M -CAA
6
Molecular Breeding
Pigeonpea
Mapping and Tagging of Genes for Resistance to Fusarium Wilt
The parental polymorphism for wilt resistant (ICP 8863) and susceptible (Bahar) parents
was carried out using SSR markers. Subsequently these polymorphic SSR markers were
used to screen F
2
population (250 Individuals). For this, total 42 SSR primers were used,
which were derived from related legume species. Out of these, 10 primers showed
polymorphism between theses parents.
Cross Genera Marker Transferability
Paucity of polymorphic molecular markers in pigeonpea, Cajanus cajan (L.) Millsp., has
been a major limiting factor in application of molecular tools for its genetic improvement.
As the development of microsatellites markers requires considerable time, expertise and
research infrastructure, transfer of markers from other related genera offers an alternative
option to increase the number of available markers. Since microsatellite sequences are
conserved across Fabaceae taxa, transferability of 100 chickpea (Cicer arietinum L.) specific
SSR markers was studied in two genotypes each of five wild and one cultivated species of
Cajanus (Fig. 9). The results revealed significant transferability (46%) of chickpea
microsatellites to Cajanus. In cultivated pigeonpea, chickpea specific SSRs showed 38-39%
transferability, while among wild Cajanus species, it ranged from 26% in C. sericeus ICP
15760 to 40% in C. sericeus ICP 15761. The transferable primers exhibited extensive
polymorphism in Cajanus with an average number of 4.11 alleles per marker (Table 5).
High level of polymorphism exhibited by chickpea microsatellite markers indicates their
usefulness in diversity analysis, mapping agronomically important traits and marker assisted
breeding in pigeonpea.
Lanes M: 50 bp ladder 1:BG 256, 2:Radhey, 3:ICPL 87119, 4:UPAS 120, 5: C. cajanifolius (ICP 15632), 6: C. cajanifolius
(ICP 15873), 7: C. sericeus (ICP 15760), 8: C. sericeus (ICP 15761), 9: C. scarabaeoides (ICP 15697), 10: C. scarabaeoides
(ICP 15748), 11 : C. platycarpus (ICP 15666), 12: C. platycarpus (ICP 15921), 13: C. albicans (ICP 15624), 14 : C. albicans
(ICP 15622). M: 100 bp ladder
Fig. 9: SSR profile of Cajanus genotypes obtained with Cicer SSR markers
Molecular Diversity Analysis of Pulse Crops
Sixteen commonly grown varieties of common bean (Phaseolus vulgaris L.) were used
for molecular diversity analysis using 24 SSR markers. The total number of alleles obtained
was 36 with an average of 1.5 alleles/primer. All primer pairs amplified polymorphic loci
ranging between 1 to 3 per locus. The Polymorphism Information Content (PIC) values
ranged between 0.12 to 0.86. UPGMA cluster analysis of 16 genotypes showed clear
demarcation between the Indian and exotic landraces falling in separate clusters. The
similarity coefficients based on 36 alleles ranged between 0.45 to 0.96. The lowest similarity
was observed between EC 400401 and IIPR 96-4, whereas EC 400419 and PI 227648 exhibited
maximum similarity (Fig. 10).
7
Fig. 10: Clustering of genotypes derived from a UPGMA cluster analysis based on SSR markers
Table 5: Number and per cent of Cicer primer pairs that amplified PCR products in
different species of Cajanus along with unique alleles
Unique alleles Species Genotype Number of markers
amplified
Alleles/ primer
Name Size (bp)
ICPL 87119 39 2.08 STMS 23 430 Cajanus cajan
UPAS 120 38 2.16 STMS 23 430
ICP 15632 37 2.02 TA 59
TA 130
1848
134
C. cajanifolius
ICP 15873 39 1.70 AGLC 34
GAA 45
TA 21
107
619
585
ICP 15760 26 1.96 TA 140 124 C. sericeus
ICP 15761 40 2.05 STMS 14
TS 45
1452
1152
ICP 15624 27 2.30 STMS 5 525 C. albicans
ICP 15622 37 1.92 STMS 5 525
ICP 15697 35 2.09 - - C. scarabaeoides
ICP 15748 39 1.94 TR 1
TR 24
286
131
ICP 15666 37 1.32 STMS 24 464 C. platycarpus
ICP 15921 38 1.94 GA 11
TS 45
623
623

Coefficient
IIPR964
IIPR985
PDR14
IPR9831
ET8435
IC14351
EC400400
VLF101
HURG35
EC400401
ET8490
EC400419
PI227648
GPR418A
HUR15
Roxinho
0.25 0.50 0.75 1.00
8
Genetic Enhancement
Chickpea
Variety developed
Large seeded kabuli chickpea variety IPCK 2002-29 (Shubhra) has
been developed and identified for cultivation in central zone comprising
of Madhya Pradesh, North Rajasthan, Gujarat, Maharashtra, Chhatisgarh
and Bundelkhand tracts of Uttar Pradesh. The variety has moderate
resistance against wilt and large white beige colour seeds.
Performance of breeding lines in AICRP trials
Extra large seeded kabuli chickpea genotype IPCK 02 (1626 kg/ha:
58.4 g/100 seed weight) has been recommended for further evaluation in AVT 2 trial in
central (CZ) and North West Plain zone (NWPZ). Check variety KAK 2 had only 37.4 g/100
seed weight.
Similarly, large seeded kabuli chickpea genotype IPCK 2004-29 has been promoted for
further evaluation in AVT 2 trial in central zone. The genotype ranked first at AVT 1 stage.
Another desi chickpea genotype IPC 2004-90 has been promoted for evaluation in AVT 1
trial in NEPZ. Ten new IPC entries have been provided for evaluation in multi-location
trials in different trials (rainfed, normal, late sown and large seeded kabuli chickpea).
Evaluation of promising breeding lines
Under rainfed condition, 88 advance breeding lines were evaluated in three trials
replicated thrice. In the first set, genotypes viz., IPC 2006-19 (2925 kg/ha), IPC 2005-29
(2625 kg/ha), IPC 2007-69 (2595 kg/ha), IPC 2004-1 (2528 kg/ha) and IPC 2005-29 (2625 kg/
ha) out yielded the best check varieties viz., DCP 92-3 (2295 kg/ha) and JG 16 (2087 kg/ha).
These genotypes had medium size seeds (>17 g/100 seed wt.). In the other set, genotypes
viz., IPC 204-98 (2725 kg/ha) and IPC 2007-74 (2437 kg/ha) out yielded the best check DCP
92-3 (2397 kg/ha). Both the genotypes had large seeds (>24 g/100 seed wt.). An exploratory
trial comprising of 29 genotypes along with 3 checks was conducted under rainfed condition
on conserved soil moisture. In this trail, genotypes viz., IPC 2008-33 (2828 kg/ha), IPC
2008-34 (2588 kg/ha), IPC 2008-76 (2522 kg/ha) out yielded the best check (JG 16: 2463 kg/
ha). Genotype IPC 2008-37 gave 2420 kg/ha grain yield and attained 68.3 cm plant height.
Such tall and erect genotype will be amenable for mechanical harvesting and can find place
in northern India where botrytis gray mould is major problem.
Under irrigated condition, 64 advance breeding lines were evaluated in replicated
trials. In the first set, 32 tall genotypes were evaluated with two check varieties. Genotypes
viz., IPC 2007-13 (2563 kg/ha), IPC 2006-68 (2528 kg/ha), IPC 2006-122 ((2470 kg/ha), IPC
2007-02 (2362 kg/ha), IPC 2006-33 (2358 kg/ha), IPC 2005-33 (2328 kg/ha) and IPC 2006-11
(2292 kg/ha) were promising against the best check KWR 108 (2067 kg/ha). In other set, 32
dwarf breeding lines were evaluated along with HC 5 and KWR 108 in a trial replicated
thrice. Genotypes viz., IPC 2006-110 (2536 kg/ha), IPC 2007-90 (2152 kg/ha), IPC 2006-134
(2022 kg/ha), IPC 2006-16 (2000 kg/ha), IPC 2006-47 (1992 kg/ha), IPC 2007-24 (1958 kg/
ha), IPC 2007-3 (1939 kg/ha), IPC 2005-44 (1931 kg/ha) were promising against the best
check variety BG 256 (1922 kg/ha).
Under rice fallow condition, 60 advance breeding lines were evaluated in replicated
trials. In first set, 30 genotypes were evaluated with two check varieties. Genotypes viz.,
IPC 2006-06 (1792 kg/ha), IPC 2006-112 (1653 kg/ha), IPC 2007-56 (1605 kg/ha), IPC 2006-
127 (1578 kg/ha), IPC 2004-01 (1564 kg/ha), IPC 2005-29 (1494 kg/ha), IPC 2007-04 (1467
kg/ha) were promising against the best check variety BGM 547 (1333 kg/ha). In other set
of 30 genotypes, IPC 2005-28 (2189 kg/ha), IPC 2006-84 (2056 kg/ha), IPC 2006-77 (1972
9
kg/ha), IPC 2007-29 (1958 kg/ha), IPC 2007-10 (1952 kg/ha), IPC 2004-53 (1944 kg/ha), IPC
2007-28 (1806 kg/ha), IPC 2007-70 (1717 kg/ha) were promising against the best check
KWR 108 (1647 kg/ha).
In kabuli trial, 27 advance breeding lines were evaluated. The genotypes viz., GC 289
(2219 kg/ha: 33.4 g 100 seed wt.), GC 107 (2131 kg/ha: 30.7g 100 seed wt.), GC 001 (2042
kg/ha: 31.8 g 100 seed wt.)), GC 491 (2019 kg/ha: 35 g 100 seed wt.), GC 233 (1956 kg/ha:
31 g 100 seed wt.), GC 49 (1935 kg/ha: 33 g 100 seed wt.), GC 175 (1923 kg/ha) were found
promising against best check HK 94- 134 (29 g 100 seed wt. : 2258.33 kg/ha). All the entries
are of large seeded group (100 seed wt. > 30 g).
Similarly, 10 extra large seeded breeding lines were evaluated along with two check
varieties. IPCK 2008-120 (2043 kg/ha), IPCK 2008-130 (2048 kg/ha) and IPCK 2008-136
(2006 kg/ha) exhibited superiority over best check KAK 2 (1384 kg/ha) in terms of yield
and seed size. KAK 2 had only 34.6 g/100 seed wt. whereas all high yielding genotypes
had >40 g/100 seed wt. Similarly, in another trial comprising of 23 large/extra large seeded
kabuli genotypes, IPCK 2008-114 (2146 kg/ha: 60 g/100 seed wt.), IPCK 2008-109 (1938 kg/
ha: 48.8 g/100 seed wt.), IPCK 2008-106 (1719 kg/ha: 49.2 g/100 seed wt.), IPCK 2008-126
(1604 kg/ha: 65.2 g/100 seed wt.) and IPCK 2008-108 (1531 kg/ha: 61.3 g/100 seed wt.) out
yielded the best check BG 1053 (1500 kg/ha: 24 g/100 seed wt.). In preliminary yield trial,
medium seed sized kabuli genotypes IPCK 06-78 (2536 kg/ha) and IPCK 2006-56 (2445 kg/
ha) were found promising (26 g/100 seed wt).
Screening against diseases
IPC 2004-52 exhibited wilt resistance against all four races of Fusarium oxysporum f.sp.
ciceri, when screened under artificial conditions at IIPR and has been identified as wilt
resistant donor during Annual Group Meet of Rabi Pulses. The performance of other
promising entries in multilocation screening for different diseases is given below:
Wilt : IPCK 2002-29, IPC 2004-68, IPC 2005-59, IPC 2005-74
Stunt : IPC 2000-6, IPC 2003-27, IPC 97-72, IPC 2004-52
Wilt + stunt : IPC 2004-52
Wilt + dry root rot : IPC 97-72, IPC 2000-25
Total 148 advance breeding lines were screened in wilt sick plot along with JG 62 as
susceptible check. Among these, 27 lines ( IPC 2008-3, -2008-40, -2008-32, -2007-30, - 2008-
67, -2008-71, -2008-103, -2007-4, -2007-35, -2007-96, -2008-45, -2008-6, -2008-68, -2007-50, -
2007-18, -2008-77, -2008-49, -2007-31, -2008-100, -2008-10, -2007-10, -2008-38, -2008-83, -2008-
23, -2007-69, -2008-62 and IPC-2008-30) exhibited wilt resistance, whereas 47 other entries
registered moderate resistance reaction against fusarium wilt.
Generation of breeding material
Thirty five new crosses (25 crosses as cultivated x cultivated and 10 interspecific crosses
involving C. reticulatum as wild Cicer sps.) were made to enhance the genetic yield potential.
Twenty five crosses (19 desi x desi, 6 kabuli x large seeded kabuli) were grown for generation
advancement. Three interspecific crosses involving GNG 1581 as agronomic base and three
different accessions of C. reticulatum as male were also advanced.
Segregating material evaluated
Twenty eight F
1
s (396 sps), 50 F
2
s (385 sps), 33 F
3
s (304 sps), 57 F
4
s (550 sps), 24 F
5
s (405
sps), 24 F
6
s (148 sps) and 32 F
7
s (144 sps), besides 49 single plant selections from one
interspecific cross (C. arietinum x C. echinospermum) were grown for further advancement
and selection of desirable segregants and single plant progenies were made. Seeds obtained
from off-season nursery of four F
1
s viz., IPC 2002-120 x IPC 2000-25, BGM 547 x IPC 97-29,
10
Phule G 0515 x IPC 97-29 and FLIP 97-220c x Phule G 95333 were also grown and selections
were made in main season. Five new crosses (F
1
s) viz., IPC 2006-11 x IPC 2004-98, IPC 2004-
98 x IPC 2004-52, FLIP 02-59c x Phule G 0517, FLIP 97-120 x Phule G 95333 and KWR 108 x
FLIP 02 x 47c were sent for generation advancement during off-season at UAS, Bangalore.
One hundred twenty single plant progenies were bulked in desi type and 83 progeny bulks
in kabuli type were harvested.
Wild Cicer and active germplasm maintained
Twenty three accessions of wild Cicer species received from ICARDA have been
maintained. Active germplasm collection comprising of 397 desi and 45 kabuli germplasm
accessions have been maintained for distribution and utilization by various centers for
breeding programme. Large number of accessions have been distributed to different AICRP
centres for their utilization in breeding programme. Similarly, accessions of wild Cicer sps.
have been shared with 6 AICRP centres including IARI, New Delhi. Under Shuttle breeding
programme, advance breeding lines were shared with ARS Gulbarga, ARS Nandyal and
MPKV Rahuri also.
Pigeonpea
Hybrid Pigeonpea
Development of F
1
hybrids
Twenty three early duration hybrids were developed involving six early maturing
CMS lines viz., UPAS 120A, PA 163A, CoRG 990047 A, ICP 2039 A, ICP 2089 A and GT 33A
and thirteen restorers viz., 261264R, 261322R, 261354R, 261429R, 250137R, 250157R, 250159R,
250165R, 250173R, GTR 11, GTR 526, Co 1R and Co 2R.
Evaluation of short duration hybrids
Six hybrids viz., IPH 07-3, IPH 08-1, IPH 08-2, IPH 08-3, IPH 08-5 and ICPH 2433,
along with 2 checks viz., UPAS 120 and Pusa 992 were evaluated. Observations were recorded
for days to 50% flowering, days to maturity, % plant fertility, 100-seed weight and yield
(kg/ha). All the 6 hybrids were late in days to 50 % flowering in comparison with both the
checks, but three hybrids viz., IPH 07-3 (152 days), IPH 08-3 (151 days) and ICPH 08-5 (144
days) were early in maturity as compared to best check UPAS 120 (153 days). Percent plant
fertility of hybrids was quite high as it ranged between 90.58% (IPH 08-2) to 98.61% (ICPH
2433). Two hybrids viz., IPH 07-3 (7.85 g) and IPH 08-2 (7.41 g) showed higher 100 seed
weight as compared with best check Pusa 992 (7.37 g). In terms of yield, IPH 08-1 (2901.85
kg/ha), IPCH 2433 (2797.81 kg/ha), IPH 07-3 (2498.24 kg/ha), IPH 08-2 (2335.50 kg/ha),
IPH 08-3 (1929.27 kg/ha) and IPH 08-5 (1911.26 kg/ha) were superior to best check UPAS
120 (1754.15 kg/ha).
Transfer of male sterility into genetically diverse backgrounds
CMS line ICP 2089A was used as female parent for transferring its male sterility to
Pusa 992, which was used as male (recurrent) parent. Sufficient BC
1
F
1
seeds were harvested.
Beside this BC
1
F
1
seeds of GT 288A x ICP 88039 (developed last year) were sown and BC
1
F
1
generation of this cross was grown. Male parent ICP 88039 was used as recurrent parent
for developing backcross (BC
2
) with BC
1
F
1
of GT 288A x ICP 88039 to transfer the male
sterility of GT 288 A in ICP 88039.
Identification and development of new restorers
Out of 100 crosses attempted in kharif 2007 and grown in off season nursery in 2008 at
NAU, Nnavsari, two cosses viz., UPAS 120 A x ICPL 94032 and PA 163 A x NVM 46
showed 75 and 65 per cent plant fertility, respectively. Both the pollen parents ICPL 94032
11
and NVM 46 were crossed with each other to develop restorers with more restorability.
Ninety five F
1
seeds were harvested from cross ICPL 94023 x NVM 46 and sixty seven F
1
seeds were harvested from NVM 46 x ICPL 94023.
Maintenance of parental lines
Twenty one A lines of early, mid late and long duration were maintained by hand
pollination for development of hybrids. Maintainer lines of these A lines are being
maintained by selfing of single plants under nylon net. Sixty one (34 early, 16 medium and
11 long duration) restorer lines were maintained under strict selfing by covering the single
plants with nylon net.
Development of molecular based markers for A, B and R lines
CMS line PA 163 A and restorer line AK-261526 were observed as most diverse parents
showing 0.412 Jaccards similarity coefficient, which suggests that a cross combination of
PA 163 A and AK-261526 may result in highly heterotic hybrid. Testing of hybrid purity
was standardized with development of marker technology through PCR based markers.
This technology can be used for testing the purity of future hybrids to be released for
commercial cultivation.
Short Duration Pigeonpea
Generation of breeding material
For incorporation of resistance and study of inheritance of resistance to Phytophthora
stem blight 10 crosses involving UPAS 120, Pusa 992, IPAB 7-2-7, KPBR 80-2-1 and KPL 43
were attempted and seeds were harvested in all the crosses. For Incorporation of earliness
in UPAS 120 and large seed size in UPAS 120 and Pusa 992 eleven crosses involving UPAS
120 CoRG 9701(SS), ICPL 91045 (SS), DSLR 129 (SS), HDM 4-1(E), ICPL 88039(E), JA 4 (E),
ICPL 7124 (SS), and ICPL 7148 (SS) were attempted and F
1
seeds were harvested from each
cross.
F
1
generations of twenty single crosses were raised. These crosses were attempted last
year involving parents UPAS 120 and PUSA 992 as base material and KPL 43, KPBR 80-2-1,
IPAPB 7-2-1, IPAPB 7-2-1-2, ICPL 84023, ICPL 88039, EC 109873 and ICPL 94028 as donor
parents. Five plants of each F
1
were selfed to get pure F
2
seed. Single plants were selected
from the F
2
, F
3
, F
4
, F
5
and F
6
generations. These materials were procured from PAU, Ludhiana.
Long Duration Pigeonpea
Performance of breeding lines in AICRP trials
IPA 203 (Bahar x AC 314-314) has been promoted to AVT-I (Late) on the basis of more
than 5% yield advantage over the check varieties such viz., Bahar, NA 1, NA 2, and MA 6.
One genotype, IPA 7-2 was included in IVT (Late) for its evaluation.
Genotypes viz., IPA-92 and IPA-204 exhibited resistant reaction for wilt at Dholi. In
SMD nursery, entries IPA 07-1, IPA 07-2, IPA 07-3, IPA 07-6, IPA 07-7, IPA 07-8, and IPA 34
were found resistant.
Evaluation of promising breeding lines
Three station trials were conducted. Four genotypes viz., IPA 07-3, IPA 07-4, IPA 07-
5 and IPA 07-6, and six other pure lines derived from T 7 x Asha, T 7 x PI 397430, Pusa 9 x
WRP-1, and (Bahar x PI 397430) x PI 397430 gave more than 25% yield advantage over
Bahar and NA-1.
12
Generation of breeding materials
Ten crosses were attempted between early and late, medium and medium, medium
and late, and late and late types. CMS conversion (A4 Cytoplasm) programme was initiated
in long-duration pigeonpea taking Bahar, IPA 07-2, IPA 204, etc., as agronomic base. Nine
F
2
, 6 F
3
, 16 F
4
, 17 F
5
, 9 F
6
, 20 F
8
progenies, and 22 BC F
2
populations were advanced through
selfing. Besides, 41 single plant progenies from five sources viz., Kudrat-3, Virat, MAL-13,
NA 1 and Bahar were grown to assess their breeding behaviour and selections were made
for desirable plant types.
Basic genetic information
Two F
2
s, derived from IPA 209 x Bahar and IPA 06-1 x Bahar, and BC-I and BC-II,
were grown to ascertain inheritance of tolerance to low temperature. The results
indicated that tolerance is a dominant trait (within limit).
It has been concluded that emasculation is unnecessary for making crosses in pigeonpea
on the basis of two years data.
Lentil
Performance of breeding lines in AICRP trials
Five promising breeding lines viz., IPL 312 in AVT-1 (Large and extra large), IPL 214
in IVT (Small), IPL 314 and IPL 315 in IVT (Large and extra large) and IPL 526 in IVT
(Extra early) were tested in AICRP trials. The performance of these lines was as follows:
Evaluation of promising breeding lines
Two station trials with 15 entries each and one preliminary yield trial with 60 entries
were conducted. In station trial I, P 7145 derived from a single cross (KL-178 DPL-62)
gave significantly higher yield (1132 kg/ha) as compared to Sehore 74-3 (687 kg/ha) and
DPL 62 (986 kg/ha). This line flowered in 57 days as compared to 60 and 65 days in Sehore
74-3 and DPL 62, respectively. Other promising lines were P 4051 (1086 kg/ha), P 4527 and
P5413 (1088 kg/ha). In station trial II, P 6071 (1366 kg/ha) derived from a single cross (ILL
6458 DPL 62) out yielded the best checks DPL 15 (969 kg/ha) and PL406 (1012 kg/ha).
Other promising lines were P 6029 (1102 kg/ha) and P 7189 (1172 kg/ha). The preliminary
yield trial resulted in identification of eight promising lines with yield of more than 1300
kg/ha. These lines are P 8491(1769 kg/ha), P 8869(1481 kg/ha), P 8855(1481 kg/ha), P 7145
(1481 kg/ha), P 7192 (1461 kg/ha), P 8927 (1419 kg/ha), P 7169 (1419 kg/ha) and P 2039
(1350 kg/ha).
Evaluation of donors for traits imparting drought tolerance
A core collection of 118 lines was evaluated under drought condition in two replications
in dug out plot as well as in PVC tubes. Potential donors for traits imparting drought
tolerance were identified among these germplasm lines. These are ILL 7763 for earliness
(50% flowering in 43 days), EC 208355, EC 208362 and EC 520204, P 2016 and 98/193 for
Line Pedigree AICRP trial Grain yield
(kg/ha)
% gain over
check
AVT 1 (SS) NHZ 762 --- IPL 312 ILL 7618 X DPL 62
AVT 1 (LS) NWPZ 1066 ---
IPL 214 DPL 58 x ILL 7192 IVT (SS) 1099 ---
IPL 314 (ILL 5714 x JLS 1) x DPL 62 IVT (LS) 1944 12.65
IPL 315 PL 4 x DPL62 IVT (LS) 1930 11.84
IPL 526 DPL 62 x DPL 58 IVT (EE) 2305 25.35

13
high biomass and ILL 6002 for initial fast growth ability. In addition to this, 43 out of
above 118 germplasm lines were also evaluated for root length in PVC tube at normal
moisture level. From this experiment, germplasm lines viz., 98/193 (86.2 cm), EC 542165
(85.1cm) and ILL 1814 (82.1 cm) were identified as potential donors for long root length.
Generation of breeding material
Breeding material in different segregating generations was evaluated and selections
were made on the basis of plant types, desirable traits and resistance to disease. Total 67
single plants and 16 single seed decent populations from 26 F
2
populations and 301 single
plants from 13 F
3
populations were selected.
Inter-varietal crosses
To develop better recombinants for disease resistance, drought tolerance, higher
biomass, earliness and better grain quality, 49 crosses were attempted. The genotypes
crossed with high yielding varieties (DPL 15, DPL 62, IPL 406, PL 406 and Sehore 74-3)
were ILL 6002 (disease resistance and better adaptability), ILL 7663 and 99/209 (earliness),
EC 208355, and EC520204 (better adaptability in drought) and P 2016 (higher biomass),
and FLP-9025L (seed quality). These genotypes were also crossed with other genotypes
having contrasting traits to develop the trait specific mapping population. Genotype DPL
15 was crossed with desirable genotypes viz., 99/209 and DPL 62 to decrease its flowering
time and combine its fast flowering ability.
Wide hybridization
To widen the genetic base, the F
1
s derived from crosses involving wild accessions
ILWL 228 and ILWL 148 were advanced to F
2
population.
Quality breeding
Incorporation of high contents of iron (Fe) and zinc (Zn) in good agronomic background
of lentil can help alleviate the micronutrient deficiencies widespread among 47% of the
children below 5-year age and 50% of pregnant women in India. Keeping this in mind, 31
lentil genotypes comprising of 20 exotic lines (Source: ICARDA) and 11 indigenous genotypes
were evaluated. After harvesting, three samples of seeds from each genotype were analyzed
for Fe and Zn contents using atomic absorption spectrophotometer (AAS). The results
revealed significant variation among the genotypes for both the micro-nutrients. For Zn
25L, FLIP 84-55L, Acc. 2313, FLIP 2002 56L, NEL 857 and Lenka. The estimates of Fe content
L 5, 81S15, FLIP 2002-7L, FLIP 2003-25L, FLIP 86-38L, Acc. 2313 and FLIP 95-55L. Some of
the genotypes viz., NEL 857, Acc. 2313 and FLIP 2003-25L with high contents of both the
micro-nutrients, Zn and Fe can be used in breeding programmes for bio-fortification of
lentil varieties.
Mungbean
Performance of breeding lines in AICRP trials
IPM 02-3, a derivative of a single cross between IPM 99-125 and Pusa Bold 2, stood
first in NWPZ and NHZ with grain yield of 889 and 1075 kg/ha in AVT 1. This entry out-
yielded the best checks viz.,ML 5 by 31% in NHZ and ML 818, Ganga 8 and Pusa 105 by
11%, 21% and 26% respectively, in NWPZ. This line has large seed size (3.8-4.0 g per 100
seeds) and MYMV resistance, and matures in 70 days. In spring trial also, this entry
performed well in North-West plain zone. The other promising lines under multilocation
evaluation in different seasons are as follow:
14
Evaluation of promising breeding lines
Breeding lines emanating from hybridization following pedigree selection were
evaluated in station trials during different seasons in order to assess their yield performance,
disease reaction and adaptation as compared to checks, IPM 99-125, Pusa Vishal, PDM 54,
PDM 11, HUM 12, and SML 668.
Summer season: Two yield trials comprising of 26 and 27 breeding lines were conducted.
As compared to checks, IPM 05-01-7K in station trial I and IPM 03-04-1 in station trial II
performed well. In addition, preliminary yield trial comprising of 54 breeding lines along
with 5 checks was conducted for identification of promising breeding lines for further
evaluation.
Kharif season: Five station trials comprising of 16, 15, 15, 37, and 40 breeding lines along
with 3-5 checks were conducted. Some of the promising breeding lines with high yield
(more than 1100 kg/ha), large seeds (4.00 g/100-seeds), and MYMV resistance were IPM
02-23 (EC 398885 x PDM 139), IPM 2K14-3 (EC 398885 x PDM 139), IPM 02-09-6 (PDM 139 x
Pusa Bold 2), IPM 02-09-10 (PDM 139 x Pusa Bold 2), IPM 03-06-6 (SML 48 x IPM 99-125)
and IPM 02-09-12 (PDM 139 x Pusa Bold 2).
Generation of breeding material
Inter-varietal crosses : Total 156 lines from 57 diverse crosses (F
7
and F
8
) were evaluated.
On the basis of uniformity in maturity, seed size and plant type, 25 lines were bulk harvested
for evaluation in preliminary yield trial. In addition, F
1
generation of 12 intervarietal crosses
involving MH 3-18, EC 369223, PDM 139, TMB 37, IC 296679, IPM 99-3, NSB 007, and
advanced segregants from the wide crosses, viz., IPM 03-1 x SPS 1 and IPM 03-1 x UPM 02-
17 were attempted to incorporate large seed size, synchronous maturity, earliness, and
high yield besides resistance to MYMV and powdery mildew. Thirteen F
1
and 12 F
2
populations were advanced and observations were recorded on contrasting traits such as
reactions to powdery mildew under late sown conditions, seed colour, seed size, leaf size,
pod shattering and crop duration to work out genetics of these traits. Evaluation of 7
crosses in F
2
generation, 56 crosses in F
3
generations, 14 crosses in F
5
generations and 4
crosses in F
6
generations resulted in selection of 2020 single plants with desirable traits.
Wide hybridization : To introgress tolerance to shattering and more pod clusters from
urdbean, F
3
populations of 12 single crosses involving five mungbean genotypes viz., IPM
03-1, IPM 99-125, IPM 04-1, V 3518 and PDM 139 with four urdbean genotypes viz., SPS 5,
SPS 41, UH 86-5 and NSB 007 were advanced and 269 single plant selections were made
based on podding from the first node, no. of pods per cluster, multicluster pod per node,
pod length and number of seeds per pod. Evaluation of 349 single plant progenies of two
Entry Pedigree Trial Season Zones
AVT 1 Spring NWPZ IPM 02-3 IPM 99-125 x Pusa Bold 2
IVT Summer All zones
AVT -1, UP State Kharif NWPZ IPM 02-14 PDM 139 x EC 398884
AVT-1 Spring South zone
AVT-1 Kharif NWPZ IPM 02-19 IPM 02-1 x EC 398889
IVT Summer All zones
IPM 02-17 IPM 99-107 x EC 398897 IVT, UP State Kharif, Spring All zones
IPM 05-3-6 PDM 139 x Pusa Bold 2 IVT Spring All zones
IPM 05-3-22 IPM 02-1 x EC 398889 IVT Spring All zones
IPM 02-16 IPM 02-1 x PDM 139 AVT-1 Spring South zone
IPM 05-2-8 PDM 139 x Pusa Bold 2 IVT Summer All zones
IPM 05-3-21 IPM 02-1 x EC 398884 IVT Summer All zones

15
wide crosses, namely IPM 03-1 x SPS 5 and IPM 99-125 x SPS 5 in F
4
generation and 436
single plant progenies of IPM 03-1 x SPS 5 in F
7
generations resulted in identification of
transgressive segregants for yield, pod number, pod length, number of seeds per pod in
mungbean and urdbean background.
One fixed line and 78 single plants emanating from five inter-specific crosses involving
three mungbean parents viz., Co 4, Co 5 and Co 6 with Vigna sublobata and V. trilobata were
advanced for multiplication of seeds.
Urdbean
Performance of promising lines in AICRP trials
Two high yielding and MYMV resistant lines IPU 02-33 (1047 kg/ha) and IPU 2006-02
(1038 kg/ha) were found promising with yield superiority of 21% and 19.86%, respectively.
Line IPU 07-3 (1278 kg/ha) performed well in IVT kharif trials and promoted to AVT 1
trials of central zone, North Hill zone, North -East plain zone and South zone.
Evaluation of promising breeding material
Total 75 advanced breeding lines and 30 elite lines were evaluated in separate replicated
trials. Entries IPU 08-6 (1323 kg/ha), IPU 08-16 (1233 kg/ha) and IPU 08-25 (1221 kg/ha)
out yielded the best check Shekhar 1 with yield superiority of 20.05%, 11.88% and 10.79%,
respectively.
Generation of breeding material
Eight inter-varietal viz., Junagadh local x DPU 88-31, Shekhar 2 x PGRU 95027, SPS 5 x
Junagadh local, DPU 88-31 x T 65, IPU 02-41 x PGRU 95027, IPU 06-1 x SPS 5, TPU 4 x T 9
and LBG 20 x DPU 88-31 and two interspecific crosses viz., PGRU 95027 x V. silvestris and
IPU 02-41 x V. silvestris were attempted involving donors of earliness, disease (MYMV and
CLS) resistance and pod bearing habit.
Advancing segregating material
Based on plant type, reaction to MYMV and other yield attributes, total 1724 single
plant selections and 36 line selections were made from segregating material ( 10 F
3
, 12 F
4
, 15
F
5
, 12 F
6
and 8 F
7
) derived from inter-varietal crosses. Besides, 135 progenies of a wide
cross involving MUM 2 ( Mungbean ) x SPS 5 ( Urdbean) were evaluated and advanced to
F
5
. F
2
population of six interspecific crosses ( Vigna mungo x V. mungo var. silvestris) viz.,
TPU 4 x IPU W 01, PLU 710 x IPU W 01, T 65 x IPUW 06, TPU 4 x IPUW 06, DPU 88-31 x
IPUW07 and PDU 1 x IPUW04 were also evaluated.
Fieldpea
Evaluation of promising breeding lines
Ten dwarf genotypes along with three checks were evaluated. IPFD 09-2 was the
highest yielding (2653 kg/ha) genotype, followed by IPFD 09-3 (2614 kg/ha) and IPFD 09-
1 (2460 kg/ha) as compared to the best check Prakash (2065 kg/ha).
In another station trial, ten tall genotypes were evaluated along with three checks.
The highest yielding genotype was IPF 09-11 (2426 kg/ha), followed by the best check
variety Adarsh (2394 kg/ha) and IPF 09-17 (2371 kg/ha).
Generation of breeding material
Thirty crosses were made mostly involving fieldpea types and vegetable types. Few
donors for other traits like rust resistance, more number of pods per plant and large seed
size were also used in the hybridization programme.
16
Selection from segregating generations
Thirty four crosses were raised in F
1
generation. From the segregating generations,
single plants were selected on the basis of earliness, pod length, seed size, resistance to
powdery mildew and rust diseases and yield/ plant. Total 500 single plants from 52 crosses
in F
2
, 600 single plants from the progenies of 61 crosses in F
3
and 100 single plants from the
progenies of 22 crosses in F
4
generation were selected. In F
5
generation, 40 promising lines
were bulked.
Plant Genetic Resources
Chickpea
Total 841 chickpea accessions were grown with three checks viz., DCP 92-3, K 850 and
L 550 (K). Out of which 547 accessions were grown for rejuvenating the material taken
from medium term storage. Besides this, 185 germplasm lines and genetic stock received
from Jabalpur were also grown. Data of some qualitative and quantitative characters such
as seedling vigour, plant pigmentation, stem colour, leaf size, days to 50% flowering, flower
colour, growth habit, pod size and days to maturity were recorded.
Pigeonpea
Total 360 germplasm accessions of early duration and 217 accessions of long duration
were rejuvenated. Besides this, 800 accessions of long duration and 360 accessions of early
duration were maintained. Six hundred accessions of long duration have been deposited at
NBPGR, New Delhi for long term conservation and 240 accessions of early duration have
been preserved in cold module at IIPR, Kanpur for medium term conservation.
Following donors have been identified for their utilization in breeding programme:
Donor

Trait
IPA 9F, IPA 12F, IPA 16F and IPA 8F Wilt
IPA 8F, IPA 15F and IPA 16F SMD
IPA 8F and IPA 16F Wilt +SMD

Mungbean
Total 450 accessions were maintained and evaluated and the data recorded for
important agronomic traits is given in Table 6 and 7.
Table 6 : Promising accessions for various quantitative traits in mungbean
Character Promising accessions
Plant height (< 30 cm) LM 581, ML 584, CN 8074, IC 39396, IPOI 383, BRS 2435, CN 8096
Days to flowering (< 35days) D 45-6, CN 8082, DMG 1043, DMG 1060, DMG 1105-1-2 , DMG
1111, DMG 1125, DMOI 1130-2, DRA 24, EC 319049 , DMG 1103
No. of primary branches (>3) DMG 1084, EC319049, IC 322096, LM 57, LM 137, LM 236
Pod length (> 9 cm) EC 30401, EC 470096, IC 433, IC 325823, IC 325853, K 36977, ML
403, ML 405, CN 8082, IPOI 383, LM 58, LM 109
No. of seed/pod (> 12) AKP/NP/8/9, DRA 24, AKP/NP/8/63, EC 30400, LM 1510, ML
3, IC 325823, JBT 37/150, PLM 364
Seed wt. (> 4g/100 seed wt.) EC 398886, BRS 2435, IPOI 359, GG 1990, EC 407077, GP 205, CN
8078, DMG 11043, LM 1597, CN 9039

17
Table 7: Frequency distribution of important qualitative attributes of 450 accessions of
mungbean
Fieldpea
Total 220 accessions were evaluated and the data recorded for important agronomic
traits are given in Table 8 and 9.
Table 8 : Promising accessions for quantitative attributes in 220 accessions of fieldpea
Plant descriptor Range of expression No. of accessions
Erect 386
Semi-erect 64
Growth habit
Spreading 0
Determinate 391 Plant habit
Indeterminate 59
Green 343 Stem colour
Green with purple splashes 107
Absent 446 Leaflet lobes
Present 4
Deltoid 8
Ovate 427
Cunate 5
Leaf shape (Terminal)
Lanceolate 11
Green 19
Green with purple splashes 424
Petiol colour
Purple 7
Yellow 191 Flower colour
Light yellow 259
Green 341 Pod colour (Pre-mature)
Green with pigmented sutures 109
Above canopy 252 Pod position
Intermediate 198
Brown 11 Pod colour (Mature)
Black 439
Straight 256 Pod curvature
Curved 194
Shiny 324 Seed lusture
Dull 126
Oval 353 Seed shape
Drum 97

Character Promising accessions
Early flowering (< 47 days) JP 1100, EC 398601, EC 322748, EC 324133, EC 324109, EC 324107,
EC 324113, EC 324108
Plant height (< 50 cm) KPMR 9, P 1, KPMR 13, JP 169, Pusa 10, L 118, EC 381857, EC
385245, EC 8495, S 143
No. of primary branches (> 4 ) KPMR 233, Kinnauri, KPFD 10, JP 1144, JP 1100, JP 1169, JP 67,
ET 45173
Pods per plant KPMR 84-1, KPMR 8, KPMR 7, KPMR 20, KPMR 233, KPMR 14,
JP 292175, PM 5
Pod length (> 6 cm) JP 181, JP 161, JP 333, JP 50A, JP 9, JP 628, JP 1169, Jabalpur Local
No. of seeds per pod (>6) JP 161, JP 501, JP 119, P 5, HUP 37, BHU 393, S 143, Pusa 10
Seed wt. (> 24 g/1000 seed) KPMR 222, KPMR 69, KPMR 252, KPMR 46, EC 322748

18
Table 9 : Frequency distribution of important qualitative attributes of 22 accessions of fieldpea
Accessions with
Character Range
Minimum value Maximum value
Days to 50% flowering 71 to 111 days IG-2518 IG-4157, IG-4290
Days to maturity 116 to 143 days IG-2518 IG-3112, IG-3210
Plant height 15 cm 40 cm IG-2745, IG-3231 IG-3261

The scales used for grading the accessions are:
Foliage colour : 1. Light green 2. Green 3. Dark green
Leaf axil colour : 1. Green 2. Purple
Rabbit-eared stipules : 1. Absent 2. Present
Flower colour : 1. White 2. Purple
Pod number per axil : 1. Single 2. Double 3. Multiple
Pod curvature : 1. Absent 2. Weak 3. Medium 4. Strong
Pod beak : 1. Pointed 2. Blunt
Intensity of green colour pod : 1. Light green 2. Green 3. Dark green
Seed shape : 1. Spherical 2. Cylindrical 3. Dimpled
Seed surface : 1. Smooth 2. Wrinkled
Seed cotyledon colour : 1. Creamy 2. Green 3. Yellow
Lentil
Total 1776 germplasm accessions were evaluated in augmented design with five checks
(K-75, IPL-406, DPL-62, PL-406 and JL-1). Observation were recorded on seedling vigour,
growth habit, stem pigmentation, biomass, days to first flower, days to 50% flowering,
days to maturity, seed coat colour, cotyledon colour and plant height. The range of some
quantitative traits along with representative lines is given in Table 10.
Table 10: Range of quantitative traits and representative lines in lentil germplasm
While studying the range of morphological variability, a natural putative gigas mutant
with broad leaves, thick stem and extra large seeds was isolated from IC 428727. The
leaves of the mutant was abnormally large and were very broad. The mutant having
pigmented stem was found to be late than the normal plant by twenty days for flowering
time, pod initiation and days to maturity. The mutant was highly vigorous with spreading
growth habit having trice the biomass of normal plant, it also had large seeds then the
normal plant. The spontaneous occurrence of mutant may be result of numerical or structural
Character state Character
1 2 3 4
Foliage colour 115 80 25
Leaf axil colour 200 20
Rabbit-eared stipules 80 140
Flower colour 195 25
Pod number per axil 26 194
Pod curvature 2 21 191 6
Pod beak 178 42
Intensity of green colour pod 25 192 3
Seed shape 140 30 50
Seed surface 197 23
Seed cotyledon colour 118 44 38

19
changes at the chromosomal level or it may be due to occurrence of unique allelic/ gene
interactions. The identified mutant is selected for inheritance study which will help to find
out the reasons for varied expression. Traits viz., leaf size, seed size, biomass are important
traits affecting yield in lentil, and therefore, the identified plant type may be a good source
for improving lentil varieties.
Seed Production
Nucleus seed of chickpea variety DCP 92-3 (170 kg), IPCK 2002-29 (235 kg), IPC 97-67
(23 kg) and CSG 8962 (11 kg) was produced, besides selection of single plants for further
production of nucleus seed. The total seed production of different pulse crops was
471.10 q ( Table 11).
Table 11: Seed production at IIPR
Crop Nucleus seed
(q)
Breeder seed
(q)
Truthful
labeled seed (q)
Total seed
produced (q)
Chickpea 2.1 115.86 3.08 121.04
Lentil 1.3 25.98 1.37 28.65
Fieldpea 2.0 99.50 1.20 102.7
Rajmash 0.1 2.56 0.60 3.26
Mungbean 0.8 68.65 7.50 76.95
Urdbean 1.0 21.80 0.70 23.50
Pigeonpea 3.0 106.80 5.20 115.0
Total 10.3 441.15 19.65 471.10

20
Crop Production
Long Term Effect of Pulses on Soil Health and Crop Productivity
A permanent trial was initiated in 2003 on maize and rice based cropping systems
involving pulses to study their long-term impact on crop productivity and soil quality
under intensive cropping systems.
Maize based cropping system
Four cropping sequences viz., maize-wheat, maize-wheat-mungbean, pigeonpea-wheat
and maize-wheat-maize-chickpea were evaluated with three fertilizer management systems
viz., control, organics (crop residues
+ biofertilizers viz., Rhizobium for
pulses and phosphate solubilising
bacteria for cereals + farm yard
manure @ 5t/ha) and inorganic
fertilizers (recommended dose of
N, P, K, S, Zn and B).
At the end of 5
th
year, yields
of maize, wheat, mungbean, and
pigeonpea were maximum in
inorganic treatment (2951, 3889,
1432 and 1534 kg/ha, respectively),
followed by organics treatment.
Chickpea recorded maximum yield
(2889 kg/ha) with organics. The
total productivity increased with
inclusion of pulses in the system.
Maizewheat-mungbean system
recorded highest pigeonpea equivalent yield (2953 kg/ha) as compared to other systems
(Fig. 11A). Among fertilizer management systems, inorganic fertilizer application resulted
in highest pigeonpea equivalent yield (6543kg/ha), followed by organic treatment (6087kg/
ha) which was 28.5 % and 19.5 % higher over control respectively (Fig. 11B).
Rice based cropping system
Four ri ce based cropping
sequences viz., rice-wheat, rice-
chickpea, rice-wheat-mungbean,
and rice-chickpea-rice-wheat were
evaluated wi th three fertilizer
management systems viz., control,
organics (crop residues +
biofertilizers viz., Rhizobium for
pulses and phosphate solubilising
bacteria for cereals + farm yard
manure @ 5t/ha) and inorganic
fertilizers (recommended dose of
N, P, K, S, Z and B).
On completion of 5
th
cycle, the
seed yield of wheat and rice were
highest (4164 and 3690 kg/ha,
Fig. 11A : Pigeonpea equivalent yield in maize based
cropping system
Fig. 11B: Pigeonpea equivalent yield with different
fertilizer management systems in maize
based cropping sequence
3000
2000
1000
0
Cropping System
Maize-wheat Maize-
wheat-
mungbean
Maize-
wheat-
maize-
chickpea
Pigeonpea-
wheat
1407
2953
1586
2378
Fertilizer management
7500
6000
4500
3000
1500
0
5093
6087 6543
21
respectively) with the application of inorganic fertilizers, followed by organics treatment.
Among cropping systems, rice-wheat-mungbean produced highest yield of wheat (3846
kg/ha) and rice (3167 kg/ha) with bonus yield of mungbean (1021 kg/ha) as compared
with rice-wheat system. Chickpea equivalent yield was highest in rice-wheat-mungbean
system and with inorganic fertilizer application (Fig. 12A and 12B).
Evaluation of Summer Legumes for Enhancing Nutrient Use Efficiency
and Productivity in Rice-Wheat Cropping System
Productivity and profitability of diversified cropping systems involving pulses
Field experiment was conducted to identify the most productive and profitable
diversified cropping systems involving pulses. Treatments included seven cropping systems
(pigeonpea-wheat, maize-chickpea, rice-chickpea, rice-lentil, rice-wheat-mungbean, rice-
wheat-dhaincha and rice-fieldpea-mungbean) with rice-wheat as control. Rice cv. Pant Dhan
12 (115 days duration), maize (cv Azad uttam), early pigeonpea (cv. UPAS 120) were sown
during kharif season and wheat (cv PBW 343), chickpea (cv. DCP 92-3), fieldpea (cv. Prakash)
and lentil (cv. DPL 62) were sown during rabi season. After harvest of wheat and fieldpea,
mungbean (cv. Samrat) and dhaincha were sown in summer season.
Rice productivity increased by 11.2% in rice wheat- dhaincha, 8.2% in rice fieldpea
mungbean and 7 % in rice wheat - mungbean cropping sequence in comparison to rice
wheat (4040 kg/ha) during 2
nd
year of experimentation. Among seven sequences, rice-
wheat-mungbean was found most productive system (Table 12) in terms of rice equivalent
yield (15016 kg/ha), followed by rice-fieldpea-mungbean sequence (14237 kg/ha).
Rice-fieldpea-mungbean cropping sequence was found most remunerative with highest
net return of Rs. 87018/ ha, which was at par with rice-wheat-mungbean (Rs. 86635/ ha),
followed by pigeonpea-wheat (Rs. 72325/ha). Highest benefit-cost ratio was recorded in
maize-chickpea sequence (3.94), followed by pigeonpea-wheat (3.77).
Fig.12B: Chickpea equivalent yield with
different fertilizer systems in rice
based cropping sequence
Fig. 12A : Chickpea equivalent yield in rice
based cropping system
22
Residue Management in Cropping Systems Involving Pulses
Residue incorporation in rice-lentil system
A field experiment was conducted to find out the best method of crop residue
incorporation and its effect on soil chemical and biological properties in rice lentil system.
Four methods of rice residue incorporation viz., incorporation of rice + lentil residue,
incorporation of rice residue + removal of lentil residue, removal of rice residue +
incorporation of lentil residue and removal of both crop residue in main plots and three
doses of fertilizer to lentil (0, 50
and 100 % recommended dose of
NPKS) in sub-plots were evaluated.
Rice grain yield was not
affected significantly by any
residue incorporation treatments.
But when previously grown lentil
received 100 % recommended
dose of NPKS, the succeeding rice
yielded 18.62 % higher over no
fertilizer plot.
Incorporation of crop residue
had significant effect on lentil seed
yield. Significantly higher seed
yi eld was obtained wi th
incorporation of both crop
residues and incorporation of rice + removal of lentil residue treatments by a margin of
13.2 and 9.9 % respectively, over removal of both crop residues (Fig. 13). Lentil grain yield
was significantly higher (12.3%) due to application of 100 % recommended dose of fertilizer
over no application. There was 3-fold increase in earthworm population in residue
incorporation treatments over its initial value of 1-2.
Effect of residue incorporation in rice-wheat-mungbean systems
The experiment was conducted with total 16 treatments to work out the integrated
management practices by inclusion of crop residue and nutrients in rice-wheat-mungbean
system. The main plot consisted of combination of crop residue incorporation or removal
at the time of harvest (in case of wheat it was normal harvesting and combine harvesting)
and two sub-plots with 100 and 75 % recommended dose of NPK to each crop.
Grain yield (kg/ha) Cropping sequence
Summer Kharif Rabi
Rice equivalent
yield (kg/ha)
Net return
(Rs/ha)
Benefit -
cost ratio
Rice-wheat - 4044 4658 11062 60033 2.78
Pigeonpea-wheat - 1591 4572 11567 72325 3.77
Maize-chickpea - 2312 2468 9300 59052 3.94
Rice-chickpea - 4253 2137 10539 63583 3.44
Rice-lentil - 4200 1492 10343 61921 3.37
Rice-wheat-mungbean 957 4328 4851 15016 86635 3.10
Rice-wheat-dhaincha 3537 4522 4931 11950 63574 2.67
Rice-fieldpea-mungbean 933 4374 2791 14237 87018 3.55
CD (p=0.05) - - - 558 4744 0.19

Table 12: Productivity and economics under diversified cropping systems
Fig. 13 : Effect of crop residue incorporation on seed
yield of lentil
1700
1600
1500
1400
1300
RRI+LRI RRI+LRR RRR+LRI RRR+LRR
1667
1619
1582
1482
RRI
LRI
RRR
LRR
- Rice Residue Incorporation
- Lentil Residue Incorporation
- Rice Residue Removal
- Lentil Residue Removal
23
There were no significant difference among the treatments due to incorporation of
crop residues. The yield obtained in main plot treatment (residue incorporation) varied
from 2600 to 2800 kg/ha in rice, 5100-5500 kg/ha in wheat and 700-800 kg/ha in mungbean.
But fertilizer doses brought significant difference in the seed yield of rice and wheat crop.
Treatment receiving 100 % recommended dose of fertilizers gave 16 % higher yield in rice
and 20.9 % higher yield in wheat over 75% of recommended dose of fertilizers. Mungbean
yield was at par in both the fertility levels.
Development of Efficient Water Management Practices for Higher
Productivity in Pulses
Conservation of soil moisture through tillage and mulching for higher
productivity in chickpea under rainfed condition
The field experi ment
compri sing of three til lage
practi ces viz., zero til lage,
ploughing + planking and deep
ploughing with disc plough and
combination of two varieties (JG
16 and KWR 108) and mulching
practices (no mulch, mulch with
paddy straw @ 75 q/ha) and
cultural mulch were laid out to find
out the most effective moisture
conservation technique for higher
productivity of chickpea.
Deep ploughing with disc
plough gave the highest seed yield
(1800 kg/ha) but was statistically
at par with ploughing + planking and zero tillage. The seed yield of chickpea increased due
to mulching, the highest (1876 kg/ha) being in cultural mulch which was 12.8 and 9.6 %
higher over no mulching and
mulching with paddy straw (Fig.
14). Chickpea genotype KWR 108
recorded higher seed yield (1961
kg/ha) than JG 16.
The consumptive use of water
and water use efficiency differed
considerably under varying
tillage, mulching practices and
genotypes (Fig. 15). Zero tillage
recorded the highest consumptive
use of water (108.5 mm), whereas
the water use efficiency was the
highest (18.22 kg/ha-mm) in deep
ploughing. Among mulching
practices, the highest consumptive
use of water (102.4 mm) was recorded in no mulch, whereas lowest was recorded in cultural
mulch. The water use efficiency was highest (19.0 kg/ha-mm) in cultural mulching due to
proportionate higher yield. Chickpea genotype KWR 108 recorded higher water use
efficiency (19.28 kg/ha-mm).
Fig. 14 : Chickpea seed yield as influenced by tillage,
mulching and varieties
Fig. 15: Water use efficiency as influenced by tillage,
mulching and varieties
Tillage
120
100
80
60
40
20
0
Mulching Varieties
Zero
Till age
Ploughing
+Pinking
Deep
Ploughing
No
Mulch
Paddy
Straw
Cultural
Mulch
JG 15 KWR 108
Water Use (mm) WUE (kg/ha-mm)
Tillage Mulching Varieties
2000
1500
1000
500
0
24
Identification of water use efficient genotypes in chickpea
Performance of six diverse genotypes of chickpea (RSG 888, SAKI 9516, KWR 108,
K 850, DCP 92-3 and RSG 143-1) was tested under three irrigation practices (pre-sowing
irrigation, pre-sowing irrigation +one irrigation and pre-sowing irrigation +one irrigation
+ mulching).
The three irrigation schedules affected the seed yield of chickpea significantly. The
highest seed yield of 1515 kg/ha was recorded in pre-sowing irrigation +one irrigation +
mulching which was 23.3 and 9% higher than other irrigation practices. Among the six
genotypes, KWR 108 recorded the highest seed yield (1748 kg/ha), while the lowest (1060
kg/ha) yield was recorded in RSG 888.
The highest water use of 107.5 mm was recorded in pre-sowing irrigation +one
irrigation+ mulch. The lowest water use was observed when the crop was provided with
only pre-sowing irrigation. The highest water use efficiency was recorded when crop was
sown after pre-sowing irrigation, followed by one irrigation at 70 DAS. Among the
genotypes the highest water use (110.4 mm) was observed in KWR 108, while WUE was
highest (16.82 kg/ha-mm) in RSG 143-1.
Enhancing Phosphorus Use Efficiency in Pulse Based Cropping System
Integrated phosphorus management in maize-chickpea cropping sequence
Field experiment was conducted for 2
nd
year with treatments including two levels of
FYM (0 and 5 t/ha) in main plots and 3 levels of phosphorus (0, 30 and 60 kg P
2
O
5
/ha) in
sub-plots for maize (cv. Azad uttam) during kharif season. In rabi season, two levels of
phosphorus (0 and 40 kg P
2
O
5
/ha) and two levels of phosphate solubilising bacteria (PSB)
i.e., Bacillus polymyxa (no PSB and PSB) were super imposed over kharif treatments for
chickpea (cv. DCP 92-3) in sub-sub plots.
FYM application to maize gave 14.2 and
13.6 % higher grain yield of chickpea and
chickpea equivalent yield respectively (Table
13). Phosphorus application and phosphate
solubi li ser i noculation al so significantly
increased the chickpea yi el d. Agronomic
efficiency of phosphorus (kg grain/ kg P
2
O
5
applied) increased from 3.8 to 9.2 and 6.5 to 7.6
due to application of FYM and PSB, respectively
(Fig. 16).
Treatment Chickpea
yield
(kg/ha)
Chickpea
equivalent
yield
(kg/ha)
Maize
No FYM 2615.2 4018.4
FYM @ 5t/ha 2987.8 4565.1
CD (P=0.05) 159.4 167.4
No P 2690.4 3976.2
30 kg P2O5/ha 2798.3 4301.9
60 kg P2O5/ha 2916.2 4597.0
CD (P=0.05) 44.8 29.3
Chickpea
No P, No PSB 2612.3 4049.4
Only PSB 2716.0 4170.5
40 kg P2O5/ha 2879.4 4414.6
40 kg P2O5/ha
+ PSB
2998.6 4532.4
CD (P=0.05) 72.5 76.6

Table 13 : Effect of FYM, P levels and PSB
on chickpea yield and system productivity
in maize-chickpea croppings systems
Fig.16: Effect of integrated phosphorus
management on phosphorus use
efficiency in chickpea
25
Establishing Critical Level of Nutrients in Pulses
Critical level of phosphorus in mungbean genotypes
A pot experiment was conducted using P deficient sandy loam soil of IIPR farm to
determine the critical level of phosphorus in mungbean genotypes (cv. Samrat and NM 1).
Graded levels of phosphorus were applied to soil @ 0, 10, 20, 30, 40, 50, 75, 100 ppm. Dry
matter yield was recorded at 30, 45, 60 DAS and at maturity by destructive sampling.
Polynomial regression equations were computed using dry matter yield and P content at
different growth stages and critical limit of P was worked out for different plant parts at
different stages. Critical limit of phosphorus ranged between 0.25 to 0.46% for Samrat and
0.28 to 0.49% for NM 1 genotypes at different stages.
Foliar nutrition in chickpea under rainfed condition
A field experiment was
carried out to study the effect of
foliar application of urea and DAP
at different stages under rainfed
condition. Treatments evaluated
were control, water spray, urea
(2%) spray at 75 DAS, DAP (2%)
spray at 75 DAS, urea at 105 DAS
and DAP at 105 DAS. Highest grain
yield (2437 kg/ha) and yield
parameters were recorded with
urea spray at 75 DAS, followed by
2% DAP at 75 DAS (Fig. 17). Spray
application of urea / DAP at 75
DAS was better than spray at 105
DAS.
Efficient Input Management in Rice-Lentil Production System for
Diversification of Rice-Wheat Cropping System
Raised bed planting and P and S nutrition in lentil under rice-lentil cropping system
A field experiment was conducted with 16 treatment combinations consisting of two
rice planting techniques (direct
sown and transplanted) in main
plots, two lentil planting systems
(raised bed and flat bed) in sub
plots and combi nati ons of two
levels of phosphorus (25 and 50 kg
P
2
O
5
/ha) and sulphur (20 and 40 kg
S/ha) in sub-sub plots. There was
15.3% yield advantage in lentil due
to raised bed sowing over flat bed
sowing (874 kg/ha). Grain yield of
lentil also increased significantly
(Fig. 18) with i ncrease in
phosphorus level from 25 (859 kg/
ha) to 50 kg/ha (1023 kg/ha) and
sulphur from 20 (882 kg/ha) to 40
kg/ha (1001 kg/ha).
Fig. 17: Effect of foliar spray of nutrients on yield and yield
parameters of chickpea
Fig. 18: Effect of rai sed bed sowing, P and S
nutrition on grain yield of lentil
45
40
35
30
25
20
15
10
5
0
Grain yield (kg/ha) No. of pods/plant Test weight (g)
1050
1000
950
900
850
800
750
FB RB P 25 P 50 S 20 S 40
P and S levels
Planting
method
FB = Flat bed
RB = Raised bed
26
Crop Protection
DISEASES
Wilt
Chickpea
Total 926 breeding and germplasm lines were screened against Kanpur race (race 2) in
wilt-sick plot. Thirteen lines including BG 112, H 82-2, MPJG 89-9023, DCP 92-3, JG 74, BCP
91, MPJG 2002-108, IPC 2004-52 were found resistant (< 10% wilt) and two lines viz., MPJG
89-11551, JG 2000-14 were moderately resistant (10 to 20%). BCP 17 and Chaffa were
susceptible. Stable sources of resistance (for four years) are: IPC nos. 2004-3, 2004-8,
2004-34, 2005-15, 2005-18, 2005-19, 2005-24, 2005-26, 2005-30, 2005-34, 2005-35, 2005-37, 2005-
41(A), 2005-41(B), 2005-43, 2005-44, 2005-45, 2005-52, 2005-54, 2005-59, 2005-62 and 2005-
64.
Screening of 277 lines under AICRP on chickpea against Kanpur race (race 2) in wilt-
sick plot showed following reaction:
Trial No. of entries
tested
No. of entries
resistant
No. of entries
moderately resistant
No. of entries
susceptible
IVT (Desi) 26 4 8 14
AVT 1 (Desi) 8 Nil 1 7
IVT (Kabuli) 55 12 8 35
AVT 1 (Kabuli) 20 Nil Nil 20
Donors 11 2 6 3
National wilt nursery 136 15 35 86
Confirmation of
resistance
21 3 Nil 18

Reaction of differentials against Kanpur race (race 2)
Above reactions revealed that all differentials matched in their reaction to Fusarium
oxysporum f. sp. ciceri reference race 2 of Haware and Nene (1982) except the reaction of BG
212, which has shown resistant reaction instead of susceptible.
In ICRISAT wilt nursery, three lines (ICC 14386, ICCV 96818, ICCV 05528) showed
resistant reaction, seven lines (ICC 2072, ICC 11322, ICC 14364, ICCV 96851, ICCV 04108,
ICCV 04312, ICCV 06106) were moderately resistant, while others were susceptible.
Twenty one extra-large seeded kabuli lines were screened. K 00-9 showed resistant
reaction, while K 00-2 and K 04 were moderately resistant. Entries which showed tolerance
are K00-8, K00-3, K-05, AP 3, KAK 2, PG 516, IPCK 02 and AP 4, with remaining 10 lines
being highly susceptible.
Race-specific resistance: Twenty three chickpea lines were screened against representative
isolates of Fusarium oxysporum f. sp. ciceri race 1, 2, 3 and 4. Reaction of lines against the
races is given below:
Differentials JG 62 C 104 JG 74 CPS 1 BG 212 JG 315 Annegeri Chaffa L 550 K 850
100.0 100.0 24.6 45.0 6.7 17.7 41.7 77.4 65.0 36.0
% Wilt
(S) (S) (MS) (MS) (R) (R) (MS) (S) (S) (MS)

27
Pigeonpea
Molecular characterization of Fusarium udum isolates
Studies on 32 F. udum isolates from U.P., Bihar, West Bengal, Karnataka, Tamil Nadu
and Andhra Pradesh with 20 RAPD primers, differentiated these isolates into three major
groups. Fifteen isolates (thirteen from U.P. and two from Karnataka) were in group I.
Nine isolates (three from Karnataka, three from Bihar, two from Andhra Pradesh and
one from Tamil Nadu) fell in group II, whereas remaining 8 isolates (six from Bihar and
one each from West Bengal and U.P.) formed grouped III. Group I isolates were further
categorized in sub-group (a) with 14 isolates and sub-group (b) with one isolate from U.P.
clustering distinctly from others. Similarly, one isolate from Karnataka clustered separately
in major group II (Table 14). Thus, the 32 isolates studied through RAPD markers could be
differentiated in to 5 groups indicating prevalence of 3-5 variants of F. udum (Fig 19a).
DNA amplifications through SSR markers also confirmed a similar pattern (Fig. 19b).
Table 14 : Categorisation of F. udum isolates based on DNA finger printing using RAPD
primers K 4 and K 6
Race Resistant (<10%) Mod. Resistant (11-20%) Susceptible (>20%)
1 BG 212, K 850, IPC 2004-52, C-
104, DCP 92-3, BCP 17, H 82-2,
L 550, BG 112
KWR 108, JG 74, IPC 97-29,
IPC 2000-52, JG 315
CPS-1, Chaffa, GPF-
2, Annegiri, MPJG
89-9023, BCP 91,
MPJG 2002-108, JG
2000-14, MPJG 89-
11551
2 IPC 97-29, K 850, IPC 2004-52,
BG 212, KWR 108, GPF 2, JG
315, MPJG 89-9023, H 82-2,
MPJG 89-11551, BCP 91, JG
2004-14, MPJG 2002-108, BG
112, BCP 17
IPC 2000-52, Chaffa, JG 74,
DCP 92-3
Annegiri, C-104,
CPS 1, L 550
3 BG 212, GPF-2, IPC 2004-52,
DCP 92-3, BCP 91, MPJG 89-
11551, BCP 17, BG 112, H 82-2
L 550, KWR 108, IPC 97-29,
IPC 2000-52, Annegiri, JG
2000-14, MPJG 2002-108, JG
74, MPJG 89-9023
CPS-1, K 850,
Chaffa, JG 315, C
104
4 JG 74, DCP 92-3, Annegiri, IPC
2004-52, CPS-1, GPF-2, KWR
108, MPJG 2002-108, MPJG 89-
9023, MPJG 89-11551, BCP 91,
BG 112, H 82-2, BCP 17
BG 212, L 550, K 850,
JG 2000-14
IPC 97-29, JG 315,
IPC 2000-52, Chaffa,
C-104

Group No. of
isolates
Isolates with geographical areas
1a 14 Fud 1, Fud 2, Fud 3, Fud 4 (IIPR Kanpur, UP); Fud 14 (Amethi, UP),
Fud 18 (Sultanpur, UP), Fud 25 (Jaunpur, UP), Fud 27 (Fatehpur,
UP), Fud 29 (Banda, UP), Fud 35 (Mirzapur, UP), Fud 36 (Varanasi,
UP), Fud 38 (Kanpur, UP); Fud 40, Fud 41 (Karnataka)
1b 01 Fud 26 (Gonda)
2a 08 Fud 42, Fud 43 (Karnataka); Fud 45, Fud 47 (Andhra Pradesh); Fud 46
(Tamil Nadu); Fud 48, Fud 49, Fud 50 (Bihar)
2b 01 Fud 44 (Karnataka)
3 08 Fud37, Fud 51, Fud 52, Fud 53, Fud 54, Fud 56 (Bihar); Fud 57 (West
Bengal); Fud 11 (IIPR Kanpur, UP)
Total: 5 32 --

28
Fig. 19a: Dendrogram showing inter-relationships among 32 isolates of F. udum using RAPD primers
Fig. 19b : Dendrogram showing inter-relationships among F. udum isolates using SSR primers
Stability of wilt resistance
Twenty seven wilt resistant donors identified at IIPR were evaluated for their stability
in wilt-sick plot predominantly infested with variant 2 of F. udum. Among these, 23 donors
viz., AWR 74/15, BWR 377, BDN 1, BDN 2, GPS 33, IPA 38, IPA 40, ICP 8858, ICP 8862, ICP
8863, ICP 89046, ICP 89048, ICP 89049, ICP 9174, ICPL 93011, KPL 93012, JAWS 5-6, KPL 43,
KPL 44, KPL 49, PI 397460 Sel., PDE 92-E and Sujata showed stable resistance to wilt.
Wilt resistant lines
Two breeding lines viz., IPA 7-2 and IPA 7-3; cultivar Kudrat; and one CMS based
hybrid (SKNCH 6-20) were found resistant to wilt in sick plot. Among promising selections,
lines IPA 38, DPPA 85-3, 85-7, 85-11, 85-5 were resistant to wilt in sick plot. In national
nursery of elite lines only ICP 8863 was resistant. Under multi-location evaluation of
Coefficient
0.00 0.50 0.75 1.00 0.25
1
5
3
2
9
10
4
6
11
13
12
8
15
14
7
16
17
19
20
18
21
23
22
24
25
26
27
28
29
30
31
32
Coefficient
0.00 0.25 0.50 0.75 1.00
1
2
3
4
5
6
7
9
10
11
12
8
13
14
15
16
18
17
19
20
21
22
24
23
25
26
27
28
29
31
32
30
29
promising entries, BDN 2001-09, 2004-1, BDN 2010, BDN 2029, BSMR 571, BSMR 846, IPA
234 and NTL 30 were resistant.
Lentil
Development of wilt-sick plot
Mass culture of Fusarium oxysporum f. sp. lentis was prepared and added to the plot for
developing lentil wilt-sick plot. The wilt incidence in the developing wilt-sick plot was
38.3%.
Phytophthora Blight in Pigeonpea
Host plant resistance
One hundred six promising lines, 8 breeding lines and 28 AICRP entries were screened
at high disease pressure. Only 18 lines (IPA-PB 8-1-1, IPA PB 8-1-14, IPA-PB 55-2, ICP 8859,
BDN 2, IPA 3-2, KAWR 2-1, VKS/SSC 10/23, JKM 209, ICP 11290, MAL 16, KAWR 45, VKS
12/12, KAWR 158, Sharan 1, PH 1062, JKM 205 and KPBR 80-2-1) showed moderate
resistance (< 30% blight). Seven wild species were screened under artificially inoculated
pot conditions. Cajanus platycarpus, C. suaveolens and Rhyncosia bracteata showed <10% disease
incidence, followed by R. rana (11%) and R. rothii (18%) against 100% in checks (ICP 7119
and Bahar).
Cercospora Leaf Spot and Powdery Mildew of Mungbean and Urdbean
Host plant resistance
Among 35 mungbean genotypes tested by artificial inoculation with the conidial
suspension of Cercospora canescens in plant growth chamber, nine genotypes viz., M 421, GG
45, BM 4, Co 4, Co 5, CoGG 7, ML 515, UPM 98 and TM 98-50 exhibited resistant reaction
and five viz., V 3518, LM 237, Wagholt, AAU 34 and SG 1 showed moderately resistant
reaction. Out of 24 urdbean lines screened against CLS (C. canescens) under artificial
epiphytotic conditions, none was found resistant. However, five lines viz., PLU 707, NP
19, IPU 98/136, and IPU 99-219 and 15 /7 exhibited moderate resistance.
One hundred sixty mungbean genotypes were evaluated against Cercospora leaf spot
under field conditions. Two lines of each test entry were alternated by infector-cum-
spreader row of Kopergaon. Adequate humidity was maintained in the nursery by sprinkler
irrigation. Disease pressure was quite high in the nursery as the infector developed severity
of 8 grade in a 1-9 disease scale. Seven genotypes viz., Maigao, Co 4, CoGG 7, BM 4, ML
515, TM 98-50 and UPM 98 exhibited resistant reaction and six viz., V 111, V 461, V 3518,
Wagholt, AAU 34 and SG 1 were found moderately resistant. Out of 43 urdbean genotypes
screened against Cercospora leaf spot under natural infestation conditions, three genotypes
viz., USJD 111, IPU 94-1 and Azad 1 were resistant and six viz., IPU 95-5, KU 99, KU 99-1,
KU 300, Mash 1-1 and USJD 102 exhibited moderate resistance.
Among 18 elite lines of mungbean evaluated against Cercospora leaf spot under delayed
planting (last week of August) by infector-cum-spreader row technique, none exhibited
resistant reaction. Out of 10 urdbean lines screened against Cercospora leaf spot under late
(last week of August) sown condition, none was found resistant. However, Uttara and
DPU 88-31 exhibited MR reaction.
Eighteen elite lines of mungbean and 10 lines of urdbean were evaluated against
powdery mildew (Erysiphe polygoni) under delayed planting (last week of August) by
infector-cum-spreader row technique. In mungbean, only two lines, Pusa 9531 and SML
668 exhibited resistant reaction and Pant M 4 was moderately resistant. Incidence of powdery
mildew was low on urdbean lines.
30
Effect of cultural practices and chemical treatment on incidence of CLS in mungbean
Studies on the effect of cultural practices and chemical treatment on incidence of CLS
in mungbean revealed that two hand weedings (HW) at 25 and 40 days after sowing +
seed treatment with carbendazim + one foliar application of carbendazim at appearance of
disease was highly effective and significantly superior in reducing disease incidence (15.9
PDI), as compared to other treatments viz., HW + seed treatment with carbendazim (36.34%),
no weeding (49.88%), pre-emergence application of pendimethalin (55.42%) and hand
weeding treatment (76.62%). Highest yield (468 kg/ha) was obtained in the treatment
where both seed treatment and foliar application of carbendazim were applied, followed
by seed treatment with carbendazim, hand weeding, pre-emergence application of
pendimethalin as compared to no weeding (236 kg/ha). Statistically, significant differences
were observed in yield among the treatments.
Urdbean Leaf Crinkle
Host plant resistance
Two hundred fifteen genotypes of urdbean and 62 genotypes of mungbean were
screened against urdbean leaf crinkle in disease nursery. The disease nursery was raised
using infector row technique with IPU 94-1 as an infector-cum-spreader row after every
two rows of test entries. In urdbean, 34 genotypes were free from crinkle disease, eighty
genotypes showed incidence of crinkle between 0.1 10 %, ninety five between 10.1 30 %
and six between 30-50 %. In mungbean, 42 genotypes were free from crinkle disease and
18 had crinkle severity of 0.1 10%. Only two genotypes showed more than 10% incidence
of leaf crinkle.
Transmission studies
The causal agent of urdbean leaf crinkle disease (ULCD) was mechanically transmitted
using sap inoculations from field-infected urdbean (cv. T 9) to urdbean (T 9) and mungbean
(Samrat). The inoculum was prepared by macerating the infected leaves in chilled 0.1M
phosphate buffer at neutral pH with 0.1 % thioglycollic acid (1:1 w/v). Leaves of inoculated
plants developed leaf crinkling and clustering of floral buds. No fruit setting occurred on
the plants of urdbean as well as mungbean infected through sap inoculations. Such plants
remained green for a longer period than the healthy plants. Attempt to transmit the urdbean
leaf crinkle virus by (Aphis craccivora) was unsuccessful. Fifty seeds collected from ULCD
affected urdbean plants of varieties T9 and Uttara were sown in pots maintained in green
house. None of the plants showed crinkle symptoms till 60 days after sowing.
Mungbean and Urdbean Leaf Curl
Incidence of leaf curl disease was recorded on 78 genotypes of mungbean and 50
genotypes of urdbean. In mungbean, none was free from leaf curl disease with incidence
ranging between 4.1 and 43.6% in mungbean and 027.3% in urdbean. Incidence of leaf curl
disease was more in mungbean than in urdbean during kharif (rainy season). In mungbean
varieties Samrat and Meha, the disease incidence was 15% and 13%, respectively; whereas
in urdbean varieities Uttara and Shekhar-1 it was 7% and 5%, respectively. The causal
virus (Groundnut bud necrosis virus) was detected by reverse transcription-polymerase chain
reaction (RT-PCR) using NSm and NP genes specific primers. NP and NSm gene sequences
of GBNV isolate infecting mungbean at Kanpur have been submitted to NCBI data base
(Accession number FJ 647037 and FJ 647036).
MYMV in Mungbean and Urdbean
Primer pair (NM1-5GTA TTT GCA (GT)CA (AT)GT TCA AGA3/NM2- 5AGG
(AGT)GT CAT TAG CTT AGC3) were designed for the amplification of coat protein gene
31
of Mungbean Yellow Mosaic India Virus (MYMIV) known to infect mungbean and urdbean in
North India. Using these primers in PCR tests, MYMIV was detected in yellow mosaic
affected mungbean, urdbean, rajmash and pigeonpea at Kanpur. Analysis of coat protein
gene sequence of isolates from five mungbean and five urdbean varieties also revealed
that all the isolates were similar and belonged to Mungbean Yellow Mosaic India Virus indicating
that at a given place in a given time same strain of MYMIV existed. The causal agent of
yellow mosaic disease of Vigna mungo var. silvestris, a wild relative of urdbean was also
characterized on the basis of AV1 gene sequence analysis and found to be an isolate of
MYMIV. The coat protein gene sequence of MYMIV infecting Vigna mungo var. silvestris has
been submitted to GenBank Data Base under the accession no. FJ663015.
INSECT PESTS
Pod borer (Helicoverpa armigera) in Chickpea
Bio-agent against H. armigera
Bracon (Habrobracon) hebetor Say is one of the potential larval parasites of Helicoverpa
armigera. It was reported for the first time from the larvae of H. armigera in chickpea eco-
system at New Research Farm of IIPR, Kanpur during April, 2008. Since then it is being
multiplied in the laboratory on the larvae of H. armigera, Corcyra cephalonica and Galleria sp.
and fifty five laboratory multiplication generations have been completed.
For laboratory multiplication of the parasite, different lepidopteran larvae were tried.
The parasite accepted the larvae of Corcyra cephalonica, Galleria sp. and Maruca sp. with total
parasitization in all the cases. But in case of Maruca sp., all the larvae were paralysed and
dried. Only 2 cocoons of the parasite were formed per larva in 25 cases. It may be due to its
small size, insufficient food availability for development of the parasite or some biochemical
reaction. Maximum no. of cocoons were formed in case of Galleria sp. (16-38), followed by
Corcyra sp. (10-26). The findings indicate suitability of C. cephalonica for laboratory rearing
of Bracon (Habrobracon) hebetor Say.
Artificial diets
To know the influence of diets on the longevity of adult parasitoid, seven adult diets
(25% honey, 50% honey, 100% honey, 25% glucose, 25% sucrose, 25% jaggery and distilled
water) were tested. Feeding solutions were changed once in two days to obviate
fermentation and its consequent detrimental effect on the insect. Highest longevity of 34.7
days and 22.0 days was recorded in case of females and males, respectively, when fed with
50% honey solution (Table 15). This indicated that female parasitoid needed more energy
for the egg laying and its longevity was more.
Table 15. Effect of diet on the longevity of adult parasitoid
Longevity of Bracon hebetor (days)
Adult diet
Female Male
100% honey 33.3 20.3
50% honey 34.7 22.0
25% honey 25.0 16.0
25% sucrose 23.3 19.3
25% glucose 15.7 12.7
25% jaggery 9.0 6.3
Distilled water 8.7 5.0
CD (P < 0.05) 2.4 1.7

32
Succession of parasitoids
A field experiment was conducted during rabi (post-rainy season) to study the
occurrence of potential bio-agents against H. armigera in chickpea ecosystem. Larvae of H.
armigera were collected from chickpea fields at weekly intervals and reared individually
on semi-synthetic diet. The emergence of parasitoids was observed. The incidence of H.
armigera and the parasitisation of Campoletis chlorideae started in the 2
nd
standard week (SW)
and continued up to 11
th
SW. The extent of parasitisation due to C. chlorideae ranged between
0.3 to 22.9% and the peak parasitisation occurred during 4
th
SW. The ectoparasitoid, Bracon
hebetor parasitisation started in the 11
th
SW and continued up to maturity of the crop (15
th
SW). It even parasitized H. armigera larvae inside the pod (Fig. 20) and its immature stages
remained protected from abiotic (such as temperature, humidity, sun shine etc.,) and as
well biotic factors (parasite, predator and pathogen). The extent of parasitisation due to B.
hebetor ranged 5.3-12.3% and the peak parasitisation occurred during 13
th
SW . The adult B.
hebetor parasitoids were also observed in the field in the same period and up to 32 female
parasitoids were collected during 13
th
SW. Temperature and relative humidity were found
to play important role in the build up of parasitoid population. Lower temperature and
higher relative humidity during January-March favoured parasitisation of C. chlorideae. After
the 10
th
SW, higher temperature and reduced relative humidity favoured the multiplication
and parasitisation of B. hebetor.
Fig. 20 : Bracon hebetor larvae feeding on the host H. armigera larvae inside chickpea pods
Temporal and spatial variations in population of H. armigera
Survey and collection of chickpea pod borer, H. armigera was made from chickpea
ecosystem of Pantnagar, New
Delhi, Ludhi ana, Haridwar
and Kanpur. Morphometri c
characterization of five geographic
popul ati ons of H. armigera
occurring in North Indian chickpea
ecosystems was done at larval,
pupal and adult stages. Traits viz.,
length and weight of larvae, pre-
pupa, pupa, length and width of
the wing, ovipositional period,
larval, pupal period and adult
longevity (Fig. 21) were measured.
Populations differed significantly
for most of the traits studied. It is
Fig. 21: Developmental periods of life stages of
H. armigera vis--vis locations
Pantnagar New Delhi Ludhiana Haridwar Kanpur
0
4
8
12
16
Oviposition Larva Pupa Male adult Female adult
Developmental stages
33
evident that populations from Ludhiana recorded higher phenotypic attributes as compared
to other populations of H. armigera, including Kanpur, which showed lower phenotypic
traits. This study presents the first documented evidence of morphometric variation in
geographic populations of chickpea pod borer. Information on population structure and
differences based on morphometry will be useful in better understanding of population
dynamics and management of this pest in different crops including chickpea.
Bio-ecology of pod borer, Maruca vitrata (Geyer) in short-duration pigeonpea
Survey conducted at NRF of
IIPR, Kanpur revealed 4.2% field
parasitization of Maruca vitrata
(Geyer) by ecto-parasitoid, Bracon
hebetor. Amongst 143 various instars
of Maruca larvae collected from
short-duration pigeonpea crop field
and reared in laboratory, six late
instar larvae were found parasitized
by B. hebetor. B. hebetor formed five
to nine cocoons per larvae of M.
vitrata and the total life-cycle was
completed within 8-10 days. Female
to male ratio was 1:2.
Pod fly (Melanagromyza obtusa Malloch) in Pigeonpea
Oviposition preference
The oviposition behaviour of
M. obtusa in pigeonpea pods was
premeditated on late maturing
pigeonpea cultivars. The
aggregation of the flies was noticed
preferably hovering on red-
flowered pigeonpea like Kudrat-3,
Ranchi Local and Ajitmal Local. Its
female laid freshly shimmering
white, smooth eggs (6.0 to 10.0/
pod), tapering posteriorly in to the
developing pods by puncturing
through its ovipositor. The eggs
were pragmatic on ventral surface
of the pod wall (Fig. 22). The
middle locules of pod exposed its
preference than basal and apical
locules. Brown colour small size pods having deep constrictions between the locules
registered minimal podfly damage, while its smash up was considerably added in green
and striped pods. Indeterminate plant type viz., Amar, Azad, Bahar, MAL 13, NDA 1, DA
11, Type 7, MA 3 and MA 6 harboured podfly for prolonged period in the crop, which
completed its two overlapping generations from January to mid-March.
Fig. 22 : Oviposition site- preference of podfly on pigeonpea
pods

7.5
0
3.5
0
1
2
3
4
5
6
7
8
Ventral Dorsal Lateral
Site of oviposition
34
Pod maturity vis-a- vis egg distribution of M. obtusa
The atmospheric temperature appears to influence the growth and development in
temporal and spatial patterns, which eventually determine the pod age for podfly
oviposition. For the oviposition by M obtusa, pod age varied from 21 to 35 days in January,
12 to 29 days in February, 15 to 29 days in March, 2009. This pest preferred matured pods
for the oviposition in comparisons to either fully matured or very tender pods.
Host plant resistance
Total 52 pigeonpea genotypes were screened against podfly. The pod fly immature
stages (larvae and pupae) varied from 1-3 individuals/pod of pigeonpea. The relative
resistance ratings based on grain damage, considering the check (Bahar), revealed that
ICP 4542 and JBP 102 showed resistance, and MA 2, NDA 99-7, PDA 93-1E, ICPL 129880
(B), ICP 88022-1, PDA 92-3, KWR 92-02, PDA 92-2E, PDA 93-2E, Amar, DA 11, MA 3, ICP
12980, JBP 001B, ICPL 13673, Bahar 1, JBP 18, MA 4 and IPA 1F reflected moderate resistance.
The pest susceptibility rating (PSR) are highly and positively correlated with grain damage
(%), pod damage (%) and per cent oviposition inflicted due to podfly. As the pod infestation
increased grain damage increased accordingly.
Efficacy of Bollcure against podfly
The plant product Bollcure {Formulation (Fr) and crude (Cr)} were tested including
NSKE 5% against podfly in pigeonpea variety Bahar. There were nine treatments viz., Fr
of Bollcure @ 10 ml (T 1), Bollcure @ 21.5 ml (T 2), Bollcure @ 31.5 ml (T 3), Bollcure @ 42 ml
(T 4), Bollcure @ 5 g (T 5), Bollcure Cr. @ 10 g (T 6), Bollcure Cr @ 15 g/l water (T 7), NSKE
5% and control (water spray). Maximum pest suppression was recorded in formulation
(Fr) @ 42 ml dose, followed by its crude @ 15 g dose which was at par with lower dose (31.5
ml). All the treatments of Bollcure were found superior over NSKE 5%. The grain yield of
pigeonpea was recorded highest (2711 kg/ha) with Bollcure Fr @ 42 ml, followed by
Bollcure Fr @ 31.5 ml (2490 kg/ha). NSKE recorded 1980 kg/ha yield. The minimum yield
was recorded in control (1603 kg/ha).
Development of forecasting module for pod fly
The periodical observations of
pod fly with its initiation and
infestation till the crop harvest was
correl ated with corresponding
week abiotic and biotic factors
prevail ing at three locations
(Varanasi, Faizabad and Kanpur)
by computing the forecasting
model against the pest in space and
ti me. At all the locations
temperature (Max) exhibited a
signi ficant positive role on
population of podfly. The podfly
initiated at 5
th
standard week (SW)
in Varanasi, followed by Kanpur
in 7
th
SW and in Faizabad in 9
th
SW.
No podfly was seen 11
th
SW in
Varanasi, 14
th
SW in Kanpur and Faizabad (Fig. 23).
Fig. 23 :Podfly dynamics on pigeonpea at different
locations in Uttar Pradesh
Kanpur Faizabad Varanasi
35
Bruchids (Collsobruchus spp.)
Chickpea
Identification of source(s) of resistance in stored chickpea
Year round bruchid culture was maintained in the laboratory. Four chickpea varieties
viz., DCP 92-3, JG 315, BG 1003 and BG 372 exhibited promise against bruchid in free-
choice test, wherein DCP 92-3 and JG 315 were found resistant in no-choice test as well. To
confirm the results, seeds of all the four varieties were multiplied in the field and were
placed in five different groups for observations on bruchid emergence. There was no
symptom of bruchid emergence in any of the sets of four varieties of chickpea.
Mungbean and Urdbean
Screening for resistance
Fifty one mungbean accessions were screened by free-choice test for their comparative
resistance to bruchid, Callosobruchus chinensis under laboratory conditions. The oviposition,
adult emergence, mean developmental period, percentage survival and index of suitability
differed in different accessions. On the basis of index of suitability, two accessions viz.,
PLM 156 and V 1123 were categorized as moderately resistant (suitability index: 0.052 and
0.055, respectively). Three accessions viz., V 1133, V 143 and V 1138 were categorized as
susceptible (suitability index: 0.075, 0.077 and 0.078, respectively) and 46 accessions were
categorized as highly susceptible [suitability index: 0.082 (LM 781) - 0.101 (ML 552 and LM
1377)]. The accessions (PLM 156, V 1123) which had low index of suitability in the free
choice test were evaluated under no-choice test and it was compared with the highly
susceptible accession (ML 552). The percent adult emergence exhibited noticeable differences
with V 1123 and PLM 156 registering lesser survival (39.0 and 78.4%, respectively) as
compared to susceptible check (ML 552), which showed a survival of 90.2%. Similarly, the
loss in grain weight was least in V 1123 and PLM 156 (28.15% and 52.24%, respectively) as
compared to 61.9 % in susceptible check.
To know the field infestation and relative susceptibility of cultivars, a field experiment
was conducted with five varieties of mungbean (Samrat, Meha, PDM 54, HUM 2 and
NDM 1) and two varieties of urdbean (Uttara and Shekhar 1) without any insecticidal
spray. Percent infestation was assessed on the basis of presence of hole on pod/seed and
adult of bruchids from the field-collected pod samples at the time of maturity (Fig. 24).
Field infestation of bruchids (Callosobruchus spp.) on different varieties of mungbean ranged
between 0.75% (Samrat) to 4.2% (PDM 54 ) with an average of 2.4% on pod basis. The
grain infestation of bruchids on different varieties of mungbean ranged between 0.2%
(Samrat) to 0.6% (PDM 54 and Meha) with an average of 0.4%. Among the urdbean varieties,
the infestation of bruchids ranged between 0.2% (Uttara) to 1.6% (Shekhar 1) with an
average of 0.9% on pod basis and between 0.1% (Uttara) to 0.3% (Shekhar 1) with an
average of 0.2% on grain basis.
Fig. 24. Damage and emergence holes of bruchids from the field collected pods of mungbean and
urdbean
36
NEMATODES
Root-knot Nematode (M. javanica)
Management of root-knot nematode population through cropping systems approach
Based on three-year study on the cropping sequences under micro-plots, two cropping
sequences urdbean + sorghum (3:1) wheat and urdbean wheat + mustard (8:1) were
found effective in reducing root-knot nematode population. These cropping sequences were
evaluated for effectiveness i n
reducing root-knot nematode
population in bigger plots. The
initial population was 443
juveniles/100 cc soil. Two cropping
sequences were followed in two
plots along with urdbean
chickpea for comparison. At the
harvest of kharif crops, there was
30.3% reduction in the root-knot
nematode population in urdbean +
sorghum, whereas the population
increased by 80% at the harvest of
sole urdbean. During rabi wheat,
wheat + mustard and chickpea
crops were grown in the respective
cropping sequences. At the harvest
of rabi crops, highest reduction in
root-knot nematode population (82.6%) was observed in urdbean +sorghum wheat,
followed by 75.6% reduction in urdbean wheat + mustard. When urdbean was followed
by chickpea crop, root-knot nematode population increased by 138.2% (Fig. 25).
Survival of root-knot nematode during summer months
To assess the survival of root knot nematode during host-less summer months,
collection of sample during March to July showed that the active root-knot nematode
population gradually decreased from March to April and became nil during May-June at
all the depths of sampled soil. The soil collected from different depths during May and
June was filled in earthen pots and seeds of urdbean were sown as trap crop in these pots
and observation on the root-knot infection on the root was recorded by staining the roots
in acid fucshin lactophenol. In soil collected during May and June at a depth of 16-30 cm, 30
and 20 juveniles were recorded in the roots per plant, respectively (Fig. 26). Population
Fig. 26 : Root-knot nematode population at different soil depths during summer months
Fig. 25 : Effect of cropping sequence on the population of
root-knot nematode

Active population during summer months
0
200
400
600
800
1000
1200
1400
20.3.07 20.4.07 20.5.07 20.6.07 20.7.07
Sampling dates
0-15
16-30
31- 45
46-60
Juveniles found in the root of trap crop urdbean
Sampling date
0-15
16-30
31- 45
46-60
0
200
400
600
800
1000
1200
Initial population Post-kharif Post-rabi
Nematode sampling time
Urd+sorghum-wheat Urd-wheat+mustard Urd-chickpea
37
Fig. 27: Effect of three egg parasitic fungi on the root
knot nematode multiplication
was less in upper and deeper depths. The infection of roots of urdbean indicated the survival
of the nematode. This indicated that some population during summer months entered into
quiescent stage to over summer. On getting water and roots for infestation the nematodes
became active and infected the urdbean roots.
Management of root-knot nematode during summer months
Efficacy of soil amendment with neem seed powder (NSP), farm yard manure and
seed treatment with Calotropis latex, carbosulfan was studied for control of root-knot
nematodes in urdbean. One month after germination, galls were recorded on the root
system. At the time of harvest of the crop, observations were recorded on biomass, grain
yield, gall index, juvenile population of cyst and root-knot nematode and also cyst population
in soil. Highest biomass (1803 kg/ha), yield (408 kg/ha), minimum gall index and lowest
soil population of root-knot and cyst nematode was recorded in the treatment involving
application of 25 kg NSP + 1 ton FYM/ha, followed by treatment involving 12.5 kg NSP +
seed coating with 3% latex. Hundred seed weight was highest (4.53 g) in treatment where
seed was treated with latex 3% as compared to 3.38 g in check.
Biological control of nematodes
Three egg parasitic fungi isolated from the egg masses of root-knot nematode were
evaluated against the nematode in
chickpea. Three fungi were named as
fungi A, B and C. These were cultured
on the maize meal sand medium and
mixed in soil @ 5, 10 and 15 g/kg soil
and filled in earthen pots. The nematode
culture was mixed @ 1000 2
nd
juveniles
(J2) /kg soil. To see the effect of the
medium, only medium without any
fungus was added to the soi l.
Observations recorded on the effect of
fungi on nematode multiplication after
45 days of sowing are presented in Fig.
27. Fungus C was found to reduce egg
masses, J2 and egg hatch more as
compared to other two fungi. Root
growth was reduced when fungus A
and fungus B were added to the soil. Fungus C did not reduce the root growth. This
indicated that the fungus C was more promising to be exploited as bio-control agent of
root-knot nematode than the two other fungi.
Entomopathogenic Nematode
Survey, collection and identification of new species
To explore for new species of entomopathogenic nematodes (EPN), a survey was
carried out in 17 districts of Uttar Pradesh. Eighty one samples were collected from different
pulses growing regions and processed for isolation of EPN. One species of Steinernema,
two species of Acrobeloides and three species of Oscheius were recovered. From cross
hybridization studies and morphometric analysis, it was confirmed that one species belongs
to Steinernema which is already known (S. masoodi). Both the species of Acrobeloides and
three species of the genus Oscheius are new ones. These new species were established by
morphometric analysis. Mass production and multiplication of all these new species was
done in the laboratory. Oscheius spp. were very infective to H. armigera, Corcyra cephalonica,
Galleria mellonella and hence have immense potential for use as entomopathogenic nematode.
Their bioefficacy was found promising on insect pest, H. armigera. Multiplication of the
new species was found excellent on artificial IIPR media. These new species can be developed
as biopesticides against pests of pulses and utilized in integrated pest management of
pulses and other crops.
38
Crop Physiology, Biochemistry and Microbiology
Development of Screening Techniques and Physiological Characterization
for Heat Tolerance in Chickpea
A collection of 330 chickpea germplasm including 160 ICRISAT minicore, advanced
breeding lines and released varieties were assessed for heat tolerance. Two lines of each
genotype with 5 meter length were sown under normal ( 15
th
November) and late (15
th
January) conditions in order to create two different temperature regimes. During normal
sown condition, crop was naturally exposed to cool temperature, while warmer to high
temperature prevailed for crop sown at later date in the month of January. Observations
pertaining to the phenology, biomass accumulation, harvest index , pod and seed number
etc., were taken at regular intervals. About 80% of the chickpea population failed to set
pods when temperature suddenly increased to 41
0
C during March. Few of them could set
pods with normal seed size, however, majority of genotypes had reduced, shriveled or
deformed grains at high temperatures exceeding 35
0
C.
Based on pod setting ability, seed size, biomass, foliar resistance quantified through
electrolyte leakage , chlorophyll fluorescence and grain yield, genotypes were tentatively
classified as high, moderately resistant or sensitive to heat stress. The critical temperature
range for damage of reproductive organs was found somewhere in between 35-40
0
C. The
reproductive parts showed variability in degree of heat tolerance and were damaged
irreversibly depending upon the sensitivity of the genotypes.
Development of screening techniques for heat tolerance
The leaves collected from field were pretreated at 46
0
C in deionized water for 30 min.
The conductivity (EC) was measured and thereafter leaves in the same deionized water in
a test tube were autoclaved and again EC was measured. The relative stability of the
membrane was calculated using the values obtained from EC
46
and after autoclaving. The
genetic variability in the membrane stability was significant.
To evaluate the functional ability of the leaves at high temperature (46
0
C), the quantum
yield (the ratio between variable fluorescence to maximum fluorescence, Fv/Fm) of each
genotype was measured by modulated chlorophyll fluorescence system after pretreatment
at 46
0
C. A highly significant variation in the quantum yield was observed among the
genotypes. The regression line (R
2
=0.7) is shown in the Fig. 28 depicting the relationship
between membrane injury and quantum yield (Fv/Fm) of photosynthesis. The membrane
stability was found to be well correlated with the quantum yield values.
The screening based on the pollen viability and germination was initiated for evaluating
the thermotolerance in selected lines. The tolerant lines ICCV 92944 (check) showed large
number of pollen tubes when pollens were incubated at 40
0
C for 1 hour. The selected lines
were taken for preliminary studies (Fig. 29).
The harvest index and seed size invariably decreased at high temperature under late
sown condition. Based on the harvest index , seed size and pod numbers genotypes were
categorized into tolerant, medium tolerant or sensitive to high temperature.
Heat tolerant genotypes : ICCV 92944, ICCV 37, ICC 67, JKG 1, GCP 101, ICC 3761, RSG
991, RSG 963, ICC 3781, Annegiri and PG 2
Moderate heat tolerant : ICC 3776, ICC 708, BGD 72, ICC 1230, ICC 1356, RS 10, ICC 283,
ICC 2580, GNG 663, ICC 3946 and ICC 1923
Sensitive : KWR 108, ICC 1194, ICC 1510, ICC 2990, ICC 2263, JGG 1, Pant G 114, BGM
39
408, ICC 2720, ICC 2072 and ICC
1164.
Three screening techniques
were standardized at preliminary
stage such as ; (i) membrane stability);
(ii) quantum yield Fv/Fm
chlorophyll fl uorescence and
(iii) pollen viability. Field tolerance
was well correlated with the
laboratory screening as indicated
above. However, screening
techniques is required to be validated
in large number of genotypes.
Plant Growth Promoting Rhizobacteria for Chickpea and Pigeonpea
Interaction of PGPR with different varieties of pigeonpea
Five PGPR strains (PS 7, K 3, P 66, P 59 and K 6) were tested for their growth promoting
activity in varieties viz., UPAS 120, Narendra 1, Bahar and Kudrat of pigeonpea. Inoculation
of UPAS 120 with all the PGPR strains increased total biomass by 27-47% over uninoculated
control . However, growth
response of other varieties was
highly variable and even reduction
in biomass with PGPR strains was
observed. PGPR strain K 3
decreased growth of Narendra 1
by 10%, whereas strain K 6 and
PS 7 decreased growth of Kudrat
and Bahar by 3 and 11%,
respectively. This clearly showed
a strong host genotype dependent
interaction of PGPR strains in
pigeonpea. This differential
response could be due to difference
in quantity and quality of root
exudates (Fig. 30).
Heat tolerant with germinating
pollen tubes (ICCV 92944)
Heat sensitive ( no pollen tubes)
ICC 1164
Fig. 29 : Pollen viability at high temperature > 40
0
C
Fig. 28: Relationship of foliar membrane stability and
photochemical efficiency (quantum yield (Fv/Fm)
y = 0.0173x - 0.9011
R
2
= 0.6962
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
45.0 60.0 75.0 90.0
Percent membrane stability
Fig. 30: Interaction of PGPR with different varieties of
pigeonpea
-20
0
20
40
60
80
100
Pigeonpea varieties
PS 7 K 3 P 66 P 59 K 6
UPAS 120 Narendra 1 Bahar Kudrat
40
Evaluation of PGPR at different soil fertility status in chickpea
Sixteen eli te PGPR strains
were evaluated for their growth
promoting activity in chickpea
under integrated (0.21% organic
carbon) and chemical (0.12%
organic carbon) management
systems. In general, inoculation
with PGPR strai ns i ncreased
nutrient uptake and grain yield in
both types of soi l. Maximum
increase in N (79%) and P (59%)
uptake was observed with PSB 11
in soil with organi c carbon of
0.12%, followed by CP 11, K 6 and
PS 8 at 60 DAS. Under soil with
organic carbon of 0.21%, PS 8 recorded an increase of 38% and 33% of N and P respectively
followed by J 7 and CP 11. These differences in nutrient uptake due to inoculation in soils
having different organic carbon content resulted in variable yield response under field
conditions. Strain PSB 11 increased grain yield by 22%, followed by PS 8 (13%) and K 6
(11%) in soil with 0.12% carbon, whereas strain CP 11 showed 15% yield increase followed
by J 7 (12%) in soil with organic carbon of 0.21% (Fig. 31).
Increasing nodulation and nitrogen fixation in chickpea under moisture stress
For isolation of effective and efficient chickpea Rhizobium strains tolerant to low
moisture, soil and nodule samples were collected from farmers fields of drought prone
areas of Hyderabad, Guntur, Nandyal, Gulbarga, Kota, Durgapura, Banasthali, Hamirpur
and Kanpur. Chickpea Rhizobium (33 strains) from nodule sample were isolated, purified
and subjected for biochemical characterization which revealed that these strains belong to
Rhizobium species.
Development of Production Technology for Organic Lentil and Kabuli
Chickpea
Compost quality was improved by amendment of sulphur (5% w/w) and rock
phosphate (20% w/w). Enriched compost with nitrogen content of 1.5%, sulphur, 5%; and
phosphorus as P
2
O
5
, 3.0% was utilized for nutrient supply under organic production systems.
Sorghum and chickpea were grown under chemical, integrated and organic production
systems. Fodder sorghum production was maximum under integrated nutrient supply system
with fodder yield of 49300 kg/ha, followed by 38000 kg/ha under organic and 23000 kg/
ha under chemical production system (Table 16). After sorghum harvest, seven chickpea
varieties viz., DCP 92-3, KWR 108, RSG 888, JKG 1, BG 1053, BG 256 and IPCK-02 were
grown under different production systems.
Table 16 : Fodder sorghum and chickpea yield under different production systems
Chickpea grain yield (kg/ha) Production
system
Fodder
sorghum
yield
(kg/ha)
DCP 92-3 KWR 108 RSG 888 JKG 1 BG 1053 BG 256 IPCK 02
Chemical 23000 2090 2262 2698 1111 1492 1940 1288
Integrated 49300 2160 2189 2609 1651 1651 220 1666
Organic 38000 2190 2313 2730 1550 1015 1840 937

Fig 31: Effect of PGPR inoculation on grain yield of
chickpea
0
5
10
15
20
25
K 6 PS 8 J 7 CP 11 PSB 11
PGPR strains
OC 0.21% OC 0.12%
41
Grain yield of chickpea varieties under different production systems ranged between
1000 to 2700 kg/ha, with lower yields of kabuli type chickpea (Table 16). Highest yield of
2730 kg/ha was obtained with variety RSG 888 under organic, followed by chemical and
integrated production systems. Kabuli type JKG 1 and IPCK 02 produced grain yield of 937
to 1666 kg/ha. In general grain yield of kabuli type chickpea was highest under integrated
production system.
Table 17 : Soil organic carbon and nitrate nitrogen level in soil before sowing chickpea
under different production systems
Chemical and biological parameters showed significant improvements in organic carbon
content and nitrate nitrogen level in soil (Table 17). Soil under organic management contains
levels. However, high nitrate nitrogen level in soil under organic production system
decreased specific nodule weight in most of the varieties except RSG 888 at 45 dyas after
growth (Table 18).
Table 18 : Nodulation in chickpea varieties under different management systems
Production system Organic C (%) KMnO4 oxidizable C

NO3-N

Organic 0.34 516.5 49.0
Integrated 0.21 413.0 20.7
Chemical 0.12 376.0 12.6

Isolation and Screening of Efficient Arbuscular Mycorrhizal (AM) Fungi
for Lentil and Chickpea
Survey and collection of rhizosphere soil samples from the homologous host was
undertaken to find out comparative efficient AM fungi associated with chickpea and lentil,
occurring in the fields which are expected to be habitual of tolerating the stresses like
adverse soil temperature (high and low), adverse soil moisture (wet and dry), soil pH,
intensive crop cultivation and cultural/ tillage operations, etc. Total forty samples of
chickpea/ lentil rhizosphere soils were collected from the representative locations of North
West Plain Zone, Central Zone and South Central Zone. From the soil samples, AM fungal
spores were extracted and it was observed that Glomus genera of AM fungi predominantly
occurred in all locations. Physiochemical property of these soil samples was also studied.
To select strains of AM fungi from different location infection bait technique was adopted
by using maize as host crop.
An exploratory study was undertaken for better understanding of crop and AM
association in chickpea by raising fifteen genotypes belonging to prominent four groups of
plant ideotypes (based on morphological and physiological characters) of chickpea in micro
plots. Natural AM colonization, nodulation and plant biomass were recorded at early
vegetative and late vegetative/ flowering phase of the genotypes and it was observed that
AM colonization was not well prominent at 20 DAS, only mycelia infection was noticed
and the infectivity ranged between 6% to 12%. On 75 DAS, dense mycorrhizal colonization
was observed in all the chickpea genotypes studied and the infectivity ranged between 32
to 48 per cent with dense arbuscules and vesicles. Increasing trend of colonization was
noticed during the growth of all genotypes (early vegetative phase to flowering phase).
Nodule specific weight (mg/nodule)
Production system
DCP 92-3 KWR 108 RSG 888 JKG1 BG 1053 BG 256 IPCK-02
Chemical 22.1 10.9 5.8 17.6 14.0 12.5 14.1
Integrated 18.8 10.5 6.8 13.0 21.2 16.6 17.4
Organic 6.0 8.3 7.5 10.5 8.6 8.7 5.5

42
Group III ideotypes recorded higher AM colonization (45.3%), followed by Group IV
ideotypes (41.5%).
There was an increasing trend in nodule number in all the genotypes studied except
the genotypes belonging to Group IV and nodule- specific weight also increased in the
genotypes except the Group I, from the early vegetative phase (45 DAS) and flowering
phase (75 DAS) of the genotypes.
Biochemical Basis of Wilt Resistance in Chickpea
Chickpea lines viz., PG 95333,
IPCK 2002-29, IPC 2004-3, IPC
2004-93, IPC 2005-48, IPC 2005-52
and IPC 2005-67 were tested for
chlorogenic acid content in root
under inoculated conditions. It
was revealed that IPCK 2002-29,
PG 95333, IPC 2004-3 and IPC 2004-
93 were resistant, whereas IPC
2005-48, IPC 2005-52 and IPC 2005-
67 were found susceptible when
compared with resistant lines
(KWR 108, DCP 92-3, JG 74 and
Saki 9516) and susceptible line JG
62 (Fig. 32).
Biochemical Basis and Mechanism of Wilt Resistance in Pigeonpea
Four wilt resistant genotypes viz., Banda Palera, ICP 8863, ICP 9174 and JA 4, and
four wilt susceptible genotypes viz., Bahar, Type 7, ICP 2376 and UPAS 120 of pigeonpea
were raised in pots under inoculated as well as un-inoculated conditions. Plant samples
were collected at pre- and post-infection stages of wilting. The activity of Peroxidese (PO),
Polyphenvol oxidese (PPO) and Phenylalanine ammonia lyase (PAL) was measured in
root of resistant and susceptible genotypes at pre- and post-wilting stages under inoculated
and un-inoculated conditions.
The wilting of plant increased the PO activity in the root of susceptible genotypes.
UPAS 120 had the highest activity of PO in unwilted as well as wilted plants, whereas ICP
2376 and Bahar had the lowest activity. Genotype Type 7 showed moderate activity of
PO. The resistant genotype ICP 8863 had the highest activity of PO, whereas JA 4 showed
the least activity. Banda Palera and ICP 9174 showed moderate activity under un-inoculated
as well as inoculated conditions.
The PPO activity was higher in roots of wilted plants as compared to unwilted plants
of susceptible genotypes. Type 7 and Bahar had higher activity than ICP 2376 and UPAS
120. The resistant genotypes showed lower activity than susceptible genotypes under un-
inoculated as well as inoculated conditions. Banda Palera and ICP 9174 showed relatively
higher activity than ICP 8863 and JA 4 under un-inoculated as well as inoculated conditions.
Resistant genotypes had lowest activity for PPO than susceptible genotypes.
Wilting increased the PAL activity in the susceptible genotypes. Type 7, UPAS 120
and ICP 2376 showed enhanced activity of PAL in roots of wilted plants as compared to
unwilted plants. The resistant genotypes had higher activity of PAL as compared to
susceptible genotypes. JA 4 and ICP 9174 had higher activity than Banda Palera and ICP
8863 under un-inoculated as well as inoculated conditions.
Physiological Traits of Lentil as Influenced by Soil Moisture Stress
Total 130 genotypes of lentil were subjected to field trial under irrigated and rain fed
lines
IPCK 2002-29 IPC 2004-3 IPC 2004-93 PG 95333 KWR 108 JG 74
DCP 92-3 Saki 9516 IPC 2005-48 IPC 2005-52 IPC 2005-67 JG 62
43
conditions. The trial was sown on 7 November for rainfed condition and for irrigated
condition the seeds were sown on 17 November. Observations were made on phenological
and morpho-physiological traits. The variability within the genotypes for days to flowering
under irrigated condition was somewhat narrower (between 70 to 98 days) as compared
to rain fed condition (between 40 to 100 days). For easy understanding and interpretation
of the data, the genotypes were grouped in accordance to their days to flowering.
Lentil genotypes exhibited genotypic differences towards their response for soil
moisture deficit. Soil moisture percentage and leaf relative water content (RWC) are highly
related. RWC increased upto 14% moisture content in soil under irrigated and 10.1%
under rainfed condition. Phenological days of the genotypes changed under rainfed as
compared to irrigated condition. Genotypes differed in their leaf RWC under irrigated
and rainfed condition. Lentils total dry matter yield has definite relationship (second
order polynomial) with RWC. Leaf area at podding had greater association with lentil
seed yield than leaf area at flowering.
Bioefficacy of Sorghum and Linseed Root Exudates and Biocidal
Compounds of Calotropis Latex against Soil Borne Diseases and Nematodes
Chemical structure of biocidal compound of calotropis latex
Major compound of non-polar fraction of latex were extracted and purified to the
maximum possible extent by repeatedly fractional crystallization. Absolute purity in
extracted compound was achieved by various chromatographic techniques, such as FTIR,
1
HNMR and
13
CNMR to elucidate its chemical structure (Fig. 33). Instrumental analysis
Fig. 33 : FTIR,
1
HNMR and
13
CNMR spectrum of purified compound
44
confirmed the extracted compound to be a polymer of carbamate containing isoprene units
in that at least ten or twelve units of carbamate group containing isoprene polymerizes to
form the molecule. After getting clue from instrumental analysis the presence of isoprene
units were also detected by two common characteristic color reactions i.e., decolorization
of bromine in carbon tetrachloride without evolution of hydrogen bromide and
decolorization of cold neutral dilute permanganate. Decolorization test reactions and the
tentative structure of extracted compound is represented in Fig. 34.
Screening of Fieldpea Genotypes against Heat Stress and Morpho-
physiological Traits Associated with Heat Tolerance
Sixty fieldpea (Pisum sativum) genotypes were planted under two dates of sowing
viz., 6 November and 6 December under irrigated condition to evaluate their tolerance to
high temperature. Crop was monitored for various phenological days, plant height, dry
matter accumulation in different plant parts at various growth stages viz., vegetative stage
(at 26 days after seeding), flowering, podding and at maturity. Flourescence reading was
observed at flowering with the help of Flourescence meter. Estimates for SPAD values and
RWC were made at all the crop growth stage. Genotypes were grouped on the basis of
days to flowering.
Pea genotypes expressed different responses towards the temperature changes under
normal and late seeding. Both maximum and minimum temperature during seed filling
period had definite relation with yield differences. Yield differences are mainly due to the
differences in pod weight and harvest index under late seeding as compared to normal
seeding. Relative water content (RWC) in leaves, chlorophyll fluorescence and SPAD values
also supported the yield differences under different temperature regimes.
Yield of high yielding genotypes viz., JP 868, IPFD98-4, KPMR 602, IPFD 5-8 IPF 4-9,
HUDP 16, IPF 99-26, IPF 99-25, KPMRD 443, IPFD5-3, IPF 1-22, KPMR 400 and Pant P 5 was
reduced under late seeding. Out of 60, only 5 genotypes viz., IPF 4-26, KPMR 11-1, IPF 27,
KPF 103, and Pant P 5 were minimum effected by temperature.
Fig. 34 : Tentative structure of extracted compound
CH C CH CH
2 2


O

C = O
N
H C CH
2 2

HC CH
C C
H C CH H C CH
3 3 3 3

n = minimum ten units in cyclic manner
45
Physiological Studies on Pre-harvest Sprouting in Mungbean
Six selected mungbean genotypes viz., TARM 18, Pusa 9072, TARM 1, Ganga Mung,
Pusa Vishal and Kopergaon (control) were screened for pre-mature germination by soaking
10 pods under 3, 6 and 24 hours. TARM 18, TARM 1 and Pusa Vishal exhibited tolerance
to pre- harvest sprouting based on the frequency of pod germination. Under field conditions
five plants of above mentioned genotypes were selected and pods of these genotypes were
sprayed with the help of hand sprinkler for two hours but none of them sprouted.
In another set of experiment, pods were soaked in water for three hours and then
kept under moist condition. Different genotypes showed variable levels of germination
viz., TARM 18 (0.0%), TARM 1 (1.21%), Pusa Vishal (18.18%), Pusa 9072 (28.00%), Ganga
Mung (50.00%) and Kopergaon (68.57%).
46
Agricultural Extension
Stakeholders Perception of Priorities and Issues in Pulses Research and
Extension in Uttar Pradesh
Survey was conducted among 65 extension personnel, 40 research personnel, 20
agribusiness houses, 33 KVK functionaries and other associated stakeholders like marketing
functionaries from Uttar Pradesh to identify the major issues in the pulses production in
the state. Their influence and impact were also ascertained.
Poor productivity of pulses, more competition with the cereals, seed and technology
delivery system were some of the issues equally felt important by the researchers,
extensionists and KVK professionals. It was found that agribusiness houses gave preferences
to selling the seeds of the crops like wheat, paddy, maize and jowar/bajra. Selling pulses
seed was accorded least priority by them. The prominent reasons felt by them included
farmers more dependence on their own saved seeds of pulses than purchasing the same
from market (80%), non-availability of quality seed adequately from different institutions
(70%) and relatively greater risk involved in storing the pulses seeds for selling (45%).
Most of the extension personnel (65%) expressed that prevalence of diseases and insect-
pest in old and deteriorated seed used by the farmers was the main reason for poor
productivity. This was followed by the other reasons like poor availability of quality
seeds to the farmers (60%), socio-religious taboo associated with the non-killing the blue
bull (51%) and non-availability of suitable pulses varieties (37%) and lack of technical
know-how among the farmers (28%). Researchers expressed the problems like instability
in pulses yield because of narrow genetic base, absence of suitable policy on pulses
production and insect pest /disease management .
The influence of researchers and extension personnel were found only in terms of
evolving the improved technologies and their popularization by way of demonstration
and training to the farmers. Still, they felt that their impact could be more effective, if there
is more focus on developing and testing the location specific pulses varieties. Extension
personnel and KVK professionals felt the need of popularizing the on-farm informal seed
production, and standardization and popularization of seed plot technique for ensuring
the availability of quality seed at village level.
The extent of functional linkages between research and extension was found poor.
Most of the researchers (90%) expressed their interaction with extension personnel as rare
to never. Further the functional linkages between KVKs, input agencies and market agencies
with the research and extension system was found absent to weak in most of the cases.
There was lesser involvement of farmers and extension personnel in understanding the
farm problem jointly and also planning the solution together in participatory manner.
Impact Assessment of Farmer Participatory Research and Extension
Programme on Pulses in Bundelkhand Region
A study was conducted among the farmers of the villages Vidokhar, Helapur,
Amirta and Kalauli Tir to ascertain the impact of the projects like TAR-IVLP and IFAD-
TAG implemented during 2000-2006.
Results revealed that even after termination of project, farmers are continuing with
the validated varieties of chickpea (JG 315 and DCP 92-3) and lentil (JL 1 and DPL 62).
These varieties have replaced farmers local varieties to the extent of 90%. Farmers also
expressed that DPL 62 was preferred more in the situation where soil moisture could be
retained for longer duration. This variety has larger canopy giving farmers more production
47
of straw also. However, DPL 62 did not replace JL 1 because the later was the best fit in
rainfed mono-cropping situation where desi lentil suffers most because of wilt susceptibility.
However, because of larger grain size, DPL 62 has better marketability and offers greater
profitability. Therefore, DPL 62 has covered almost 100% area under clay loam -Mar soil
low land situation and JL 1 has covered 100% area under loam -Parwa and sloppy land
situation.
It was found that the varietal replacement was more pronounced in case of lentil (DPL
62 and JL 1 : 95%) than chickpea (JG 315 and DCP 92-3: 60%). However, because of their
suitability in prevalent situation (DCP 92-3 best for loam -Parwa soil; JG 315 best for clay
loam-Mar soil) and better market price, these two varieties have covered almost 50% of the
total area under chickpea. Other varieties like Pusa 256 and Radhey have the share of
about 30% and 10% respectively of total chickpea area. Thus, the improved varieties of
chickpea were grown mostly because of more yield, better marketability and greater
profitability. In pigeonpea, varietal replacement by Narendra Arhar 1 was found only to
the extent of 40-50%.
The technological components like integrated nutrient management and use of plant
protection chemical were observed partially adopted. Discussion with farmers revealed
that chemical fertilizers were preferred more for their application in wheat crop as compared
to pulses because of lesser risk involved and ensured return of input use in former than
pulses. The impact of project in term of sustained use of NSKE was observed among the
small farmers who were using it for management of pod borer in chickpea. However, use
of HaNPV could not sustain because of relatively more complexity involved (80% farmers)
in its preparation. The mode of its application and efficacy was found satisfactory (60%
farmers).
The impact of IIPR mini dal mill was also impressive. Farmers group was processing
3-5 q, 5-7 q and 2.5- 4 q per month of chickpea, pigeonpea and lentil, respectively. The
active phase for processing was for three months only (AprilJune). This way, they are
earning an additional income of Rs. 3000-3500 per month by value addition through micro-
enterprise. Farmers perceived this machine simple to operate, easy to maintain and less
costly as it could be operated by single phase domestic power supply.
Documentation of Indigenous Technical Knowledge with Regard to Pulse
Production, Protection and Post-harvest Handling in Uttar Pradesh
The project is being implemented in ten districts of three zones including five districts
of Bundelkhand region. In the current year data collection on indigenous technical
knowledge has been completed from Banda, Jhansi and Mahoba districts of Uttar Pradesh.
Besides medicinal values of chickpea dry leaves and pigeonpea leaves, storage of pulse
grains indigenously is common. For safe storage of fieldpea about one kg onions are
added to one quintal of fieldpea and stored in gunny bags. For safe storage of pigeonpea,
seeds are thoroughly mixed with kerosene oil and charcoal ash and stored in earthen pots.
Development and Popularization of Model Seed System(s) for Quality Seed
Production of Major Legumes to Ensure Seed Sufficiency at Village Level
To meet the demand of quality seeds at village level for economic empowerment and
nutritional security, the project is being implemented in two districts viz., Fatehpur and
Kanpur Dehat of Uttar Pradesh.
Pigeonpea
Participatory seed production of pigeonpea (short duration UPAS 120) was carried
out in 6 ha area at 30 farmers fields in Alipur and Pahur villages of Fatehpur district
48
during rainy season. Registration of farmers participating in seed production was done
through U.P. Seed Certification Agency, Allahabad. Monitoring of all seed production
plots of early pigeonpea was done jointly by IIPR scientists and NSC personnel. Farmers
obtained 800 to 1400 kg/ ha yield at seed production plots. Total 5420 kg quality seed of
early pigeonpea was produced and out of which 1500 kg was procured by National Seed
Corporation (Area office) Kanpur @ Rs 3400/ q. 1100 kg seed will be utilized with in and
neighboring villages as seed in coming kharif season.
Heavy and continuous rains during I
st
fortnight of June to I
st
week of Sep, 08 (983.2
mm in Fatehpur and 655.0 mm in Kanpur Dehat) resulted in very poor coverage of seed
production of long duration pigeonpea (Narendra Arhar 1) in Fatehpur. Seed production
of Narendra Arhar 1 could be undertaken in 15 ha area of 58 farmers fields of Sariyapur,
Kuit Kheda and Barahpur villages of Kanpur Dehat during kharif 2008. Total 22500 kg
seed was produced in Kanpur Dehat district. National Seed Corporation procured 5600 kg
@ Rs 4600 /q. Farmers obtained Rs 1100/ q additional profit in comparison to grain cost
prevailing in nearby market. Farmers showed positive attitude towards seed production
of pigeonpea and also desired to go for pigeonpea cultivation in a big way in the next kharif
season. The economics of seed production for long duration pigeonpea is given in Table 19.
Table 19 : Economics of seed production for long duration pigeonpea (Kanpur Dehat)
Variety Indicator
Local Narendra Arhar 1
Average seed yield (q /ha) 10.15 22.25
Increase in yield over control (%) - 51.46
Cost of cultivation(Rs./ ha) 10110 14764
Gross income(Rs./ha) 3525 91225
Net income (Rs./ha) 25415 76 461
B:C ratio 2.51 5.18
Seed rate (Rs./ha) 3500* 4100

* Prevailing market grain price.
Chickpea
During rabi 2007-08, farmers had identified two chickpea varieties DCP 92-3 and JG 16
as most preferred for seed production in Kanpur Dehat and Fatehpur districts. Participatory
seed production of chickpea was undertaken on contributory basis in Fatehpur district.
Farmers contributions were collected in those villages where project period had completed
two years. The total quantity of seed distribution was 2550 kg. Partner farmers contributed
Rs. 1500 /q towards the seed cost and remaining Rs. 3600 /q was borne by the project. In
addition, farmers also paid Rs. 1000/ q towards registration charges. Village wise seed
distribution and contribution is given in Table 20.
Table 20 : Village- wise seed distribution and contribution in Fatehpur district

Village
Area
(ha)
Seed
(q)
Cost of seed
(Rs. /q)
Total cost
of seed (Rs.)
Instt. share
(Rs. 3600/ q)
Farmers
contribution
(Rs. 1500/ q)
Mauhar 5.0 3.75 5100 19125 13450 5675
Alipur 5.0 3.75 5100 19125 13450 5675
Pahur and Harsinghpur 5.0 3.75 5100 19125 13450 5675
Godharauli 5.0 3.75 5100 19125 13450 5675
Sai 5.0 3.75 5100 19125 13450 5675
Total 25.0 18.75 95625 67250 28395

49
As per farmers preference
and demand for seed of chickpea,
two varieties viz., DCP 92-3 and
JG 16 were used in 40 ha area of
192 farmers in nine villages in
Fatehpur during rabi 2008-09. Total
area of 27.1 ha belonging to 123
farmers of six villages in Kanpur
Dehat was covered under quality
seed production of chickpea. The
economics of seed production of
Kanpur Dehat and Fatehpur is
depicted in Fig. 35.
To develop synergy among
formal, semi-formal and informal seed
system, a functional Model of Seed
System (s) has been identified (Fig. 36).
Fig. 35: Economics of seed production vis--vis grain in
Kanpur Dehat and Fatehpur districts (2008-09)
Fig. 36: Functional model for implementation of Model Seed System(s) project in Uttar Pradesh
Designing Intervention Strategy for Technological Empowerment of Pulse
Growing Women Farmers of Uttar Pradesh
To develop a need based intervention strategy for technological empowerment of
women farmers total 180 farm women from 6 villages of two districts of Uttar Pradesh
were identified. Women farmers were surveyed for assessment of their participation, their
knowledge level and need level with regard to improved pulse production technologies.
Appropriate participatory rural appraisal techniques like matrix ranking, daily routine
analysis, seasonal workload analysis, Venn diagram, historical transect were also utilized
to assess the situation and accordingly the intervention strategy with regard to scientific
pulse production, protection and post-harvest handling was formulated.
Activity analysis of pulse cultivation
Participation of women farmers singly was observed to be 34.92% in pulse production,
while their involvement in decision making was 15.63%. Activities like cleaning of fields,
INPUT PROCESS OUTPUT
- Breeders Seed
Supply
- Regular Training
to farmers
- Field Visits
- Farmers
Meetings
- Continuous
Linkages with
village based
project staff
- Exposure Visit
- Arranging the
equipment
- Monitoring &
Impact assessment
BY IIPR,
Kanpur
TECHNOLOGICAL
SUPPORT
- Village Panchayat
- Farmers
Associations
- SHGs
- Local Traders
- CSOs
LOCAL BODIES
PARTNER FARMERS
(FPVS, Seed production, Seed
Growers Association)
- KVK
- RRS
- State Agril. Deptt.
- Credit institution
For Contingency
Technological Support
Supporting
Institutions
- National Seed
Corporation
- State Seed Farm
Corporation
- UP State Seed
Certification
- UP State Seed
Corporation
For Seed Certification,
Quality Control, Seed
Procurement & Seed
Distribution in the
same and neighbouring
districts
Farmers
Empowerment
and Seed
Sufficiency
50
seed cleaning, sowing of seed, weeding, harvesting, bundling and transportation of the
produce, threshing, winnowing, drying, cleaning and sorting of grains, processing, value
addition were observed to be primarily performed by women in majority of the households,
whereas activities like fertilizer application, construction and repair of irrigation channels,
spraying insecticides, marketing were performed by male farmers. Storage was found to
be done jointly in majority of the sampled households.
The knowledge level of women farmers was found to be 19.39, 10.92 and 20.34 per
cent in relation to improved chickpea, urd/mung and pigeonpea cultivation practices,
respectively.
Perceived needs of women farmers
The perceived need level of women farmers with regard to improved chickpea, urd/
mung and pigeonpea cultivation was found to be 47.97, 42.63 and 55.45 per cent,
respectively. An in-depth analysis of the needs related to improved chickpea production
revealed that urgent need was felt by majority of the respondents.
In pigeonpea production practices, selected farm women sought information related
to recommended post -harvest handling practices (40%), improved storage techniques (37%)
and drudgery reduction (22%). Information on critical stages of the irrigation was the least
needed item by majority of the respondents in the pooled sample.
Constraints perceived by women farmers
Limited availability of quality seeds, pest damage during storage and lack of
information on improved varieties were the major constraints perceived by 148, 142 and
121 respondents, respectively in the pooled sample related to production of pulses. The
constraints related to spurious plant protection chemicals and timely availability of fertilizers
was perceived by least number of respondents. Problem of insect pest, tedious job of
threshing, problem of blue bulls and lack of information on disease identification and
management were also the constraints experienced by significant number of respondents.
Promoting the Use of Trichoderma sp.An Eco-friendly Approach for
Management of Wilt and Root-rot Complex in Major Pulse Crops in
Bundelkhand Region
To promote the use of Trichoderma sp. three villages viz.,Baank, Baanki and Bilahari
were selected in Hamirpur district of Bundlekhand. The area under chickpea, lentil and
pigeonpea was 343, 95 and 373 ha, respectively in 2007-08. The yield loss due to wilt/ root
rot diseases in lentil and chickpea in adopted villages were 25-40 and 20-35 per cent,
respectively. Majority (95%) of the farmers were not aware of Trichoderma technology. The
peak stage of losses from wilt in lentil and chickpea was between flowering and podding
(80%).
Efficient strains of Trichoderma harzianum were used to make a formulation (6.8-7.2 x
10
9
CFU/g). The formulation was used at farmers fields for seed and soil inoculation @ 6.0
g/kg seed and 1.0 kg per/acre, respectively. To enhance the farmers knowledge and
skills on the application of the Trichoderma, seven participatory trainings were organised
with participation of 600 farmers. Crops viz., lentil and chickpea were chosen for
demonstration programme. Total 60 ha (20 ha under lentil and 40 ha under chickpea) area
involving 120 farmers was covered. The self help group (SHGs) were initiated to empower
the farmers.
It was observed that inoculated fields with Trichoderma had higher plant height, better
root growth, dark leaf colour, higher and healthy nodulation and more plant vigour in
chickpea. The occurrence of root-rot under Trichoderma inoculated lentil fields was found
low. Majority of farmers were satisfied with the effect of Trichoderma on decreases in
percentage plant mortality due to root-rot/wilt and increase in yield of lentil and chickpea.
51
Agricultural Engineering
Standardization of Milling Procedure for Estimation of Dal Recovery from
Pulses
Recovery of dal depends on basic seed characters such as husk, germ and cotyledon
contents, which vary significantly within the pulse cultivars. A dry weight method has
been developed to determine germ, husk and cotyledon content of pulse seeds in which
grains are subjected to water soaking for loosening of seed coat. This facilitates removal of
husk and germ from cotyledons. After separation, each fraction is bone dried and weighed
to calculate fraction percentage.
Pre-milling treatments play a crucial role in dehusking behaviour of pigeonpea.
Different pre-treatments were evaluated for finished product (gota + dal) recovery in
tangential abrasive dehusking type mill for pigeonpea cultivar ICPL 88039. Pigeonpea grains
were milled at standardized machine parameters for different pre-milling treatments viz.,
normal, and hot water soaking, oil treatment, sodium bi-carbonate treatment, thermal
treatment and steam treatment alongwith untreated grains. Hot water soaking gave
maximum milling recovery (68.56%), followed by steam treatment which yielded 63.82%
finished product (Table 21).
Table 21 : Effect of pre-milling treatments in pigeonpea
* FPR = Finished product recovery
Development of Efficient Machines for Pulse Production System
Pulse threshers
A vertical thresher has been designed and fabricated, wherein crop feeding system
was modified into central feeding instead of radial feeding. To accommodate fed material
into the threshing chamber, height of beater cage was lowered. At the outlet of thresher
two tier sieving system has been attached. To improve suction, perforated base has been
provided to the thresher. Choppers have been provided at the feeding end to reduce
sturdy pulse crops into smaller pieces. The average capacity of thresher with different
chopper and beater configuration gave the thresher capacity of 250 kg/h.
In commonly used impact type threshers about 2% grains get damaged. Bruising of
grains adversely affects the germination, if used for seed purpose. Therefore, a rubbing
type thresher has been designed and first prototype was developed. Dried plants of crop
are fed between the horizontally mounted belts, moving in same direction at differential
speed. The gap between the belts is adjustable. Provision has also been made to tilt the belt
mechanism to increase residence time of the crop for proper threshing. The rubbing thresher
is being developed for non-impact threshing of crops for seed purpose.
Treatment Procedure *FPR
( %)
Standard
deviation
Untreated No treatment 50.06 5.83
Heat treatment 60
0
C, 2h 51.24 3.49
NaHCO3 treatment 10% Soln., 1:25 Grain- soln. ratio + Sun drying 55.94 1.32
Oil treatment 0.7%+ 6h tempering + Sun drying 56.76 3.60
Water soaking 2h soaking + Sun drying 59.45 5.86
Steam treatment Steaming 10 min + Tempering 6 h + Sun Drying 63.82 2.79
Hot water soaking 2h at 60
0
C + Sun drying 68.56 1.37

52
Stripper
Results of stripping with pigeonpea stripper were revalidated. The stripper yielded
capacity of 200 kg/h against manual pounding capacity of 107 kg/h on single operator
basis. Stripping with the machine gave 2.03% more recovery of seeds in comparison to
manual pounding, as it results into shattering of seeds. When this seed loss is taken into
account, cost of manual pounding was found to be higher than that with stripper.
Winnower
To reduce dust hazard to the workers involved in winnowing of threshed crops, a
suction winnower has been designed and fabricated. Several improvements viz., variable
blower speed, increase in fall height, provision for double fall, increase in hopper capacity
and perforated lower plate with provision for suction controlled were made.
Capacity of suction winnower :
Procedure Capacity (kg/h)
Manual winnowing 15.91
Suction winnowing 128.10

53
Agricultural Statistics and Computer Application
Development of Prototype Expert System for Identification and Control
of Insect-Pests/Diseases in Chickpea and Pigeonpea
Disease/insect-pest diagnosis knowledge base was created through an automatic
knowledge acquisition system where data was fed by domain expert/knowledge engineer.
The structure of the knowledge base was designed after consulting a variety of literature
surveys, different domain experts, extension workers and farmers. The identification of
various possible symptoms, diagnostic rules and constraints was done with the help of a
team of domain experts (i.e., pathologists, entomologists and plant breeders). For crop
disease/insect-pests diagnostic domain, four major parameters were identified viz., crop
parameters, field parameters, symptom parameters and visible pictorial parameters
describing all the plant damage symptoms that may occur in the crop/plant at different
stages. Based on the identified parameters, a logical, clear and easy-to-answer crop-wise
questionnaire was designed for chickpea and pigeonpea. These questionnaires were
distributed among domain experts to get more subjective and pictorial information needed
during the pulse disease/insect-pest diagnosis process.
Modelling and Forecasting of Pulse Production
To study Auto Regressive Integrated Moving Average (ARIMA) time series modeling
technique, area and production data from 1980-81 to till date of total pulses for India have
been collected and compiled. Chickpea area and production data of India as well as of
different states have been collected. District-wise data of area, production and productivity
(1980-81 to till date) of chickpea for major pulse growing states like Uttar Pradesh, Maharastra,
Rajasthan and Madhya Pradesh have been compiled. These data would also be required to
forecast pulse production / yield based on weather parameters using Artificial Neural
Network (ANN). Progress has been made to purchase very comprehensive and effective
statistical software, STATISTICA DATA MINER to train, test and validate the data set.
Development of Efficient Estimation Procedures
Procedure for estimation of compound growth was thoroughly studied and deficiencies
of the existing procedure for estimation of compound growth rate have been identified.
Chickpea production data of India as well as different states have been collected. District-
wise data of area, production and productivity from 1980-81 to till date of chickpea for
major pulse growing states like Uttar Pradesh, Maharastra, Rajasthan and Madhya Pradesh
have been collected and compiled.
Stability Analysis of Some Promising Lines of Chickpea
A set of 26 varieties of chickpea released during last four and half decade (1960-2004)
were evaluated for assessing genotype and environment (G x E) interaction at 22 different
location of the country in association with AICRP chickpea. The analyzed data revealed
significant G x E interaction and the varieties were classified and grouped into mega-
environments (Table 22).
Table 22: Grouping of varieties
Parameter Varieties
High stability and high performance
environment
BG 372, DCP 92-3, HC 5, ICCV 10, ICCV 2, JG 11,
Radhey, RSG 888
High stability and low performance environment Avrodhi, Digvijay, GNG 469, HC 1, HC 3, JG 315, JKG
1, L 550, Pant G 186, RSG 931, SAKI 9516, Virat, Vishal
Low stability and high performance environment D-Yellow, JG 74, Vijay,
Low stability and low performance environment BG 256, KWR 108

54
All India Coordinated Research Projects
Chickpea
Variety Identified
A kabuli chickpea variety IPCK 2002-29 of extra large seed size (33.8g/1100 seed) with
yield potential of 2482 kg/ha has been identified for release for cultivation in central
zone comprising of Madhya Pradesh, Bundelkhand region of UP, southern Rajasthan,
Maharashtra, Chattisgarh and Gujarat states.
Promising Entries
Under different trials, entries viz., CSJ 140, GJG 0505, GNG 1759, CSJ 479, GJG 0505 ,
JSC 45, NDG 7-702, BGM 562, GJG 0107, GL 22013, H 04-99, IPC 2004-90, JSC 48, GL
23094, GPBC 2, Phule G 9409-1, WCGK 2000-16, CSJK 24, HK 04-178, GLK 25104, BG
2083, CSJK 24, WCGK 2000-16, CSJK 1, HK 04-178, BGM 1564, WCGK 2000-16, BG 2083,
GLK 25104, CSJK 1, IPCK 2002-29, IPCK 2004-29, GLK 23008, Phule G 95333 and Phule G
9933-1 out yielded the best check of respective zones by more than 5%.
Germplasm
Total 4879 germplasm accessions were evaluated for qualitative and quantitative traits
at 11 centres.
Breeder Seed Production
Total 8392.69 q of breeder seed of 87 varieties was produced against DAC indent of
7446.45 q and allocation of 8202.00 q.
Technology Developed
In NWPZ, delay in planting of chickpea beyond 01 December to 10-20

December
caused overall mean reduction in yield to the tune of 26.7 and 41.9 per cent, respectively.
Extra bold seeded varieties like Phule G 9533, BG 1053 should be sown with a plant
population of 33 plants/sqm (30 cm x 10 cm) and fertilized with 30 kg N, 24 kg P
2
O
5
, 30
kg K
2
O and 20 kg S/ha for obtaining maximum yield.
Seeds priming proved more beneficial under rainfed conditions with 16% increase in
grain yield over control (no seed priming).
Sowing of seeds at 10 cm depth gave significantly higher grain yield than 7.5 cm in
central zone, whereas 7.5 cm depth of sowing proved better in NWPZ and South
zone. Maximum increase in yield due to 10 cm deep sowing was observed at
Sriganganagar (24.7%), followed by Kota (23.5%).
Flat bed planting on light textured and raised bed planting on heavy textured soil
was found to improve the grain yield of kabuli chickpea.
Foliar application of 2% urea at flowering + 10 days thereafter gave maximum grain
yield under rainfed conditions.
Recommended dose of fertilizer with or without addition of sulphur/zinc sulphate/
ammonium molybdate/borox gave significantly higher grain yield of desi chickpea
than without fertilizer application.
55
Under severe drought condition with a decline in the soil moisture nearly to wilting
point (2.75%) during late podding stage, four chickpea varieties viz., RSG 991, Phule
G 96006, KWR 108 and BGD 72 have been identified as relatively drought tolerant
genotypes.
Genotypes GCP 105, GNG 146 and ICC 2000-33 were selected as heat tolerant.
Genotypes viz., PBG 1 and IPC 98-51 were found cold tolerant.
Rhizobium strains JGSR 114, JGSR 112, LGR 21143, LGR 24089 and LGR 1370 were
more efficient.
Highest nodulation and grain yield was obtained with strain UASB 701 (16.6%),
followed by CP 741 (15.2%).
Inoculation with microbial inoculants (Rhizobium +PGPR+PSB) increased the grain yield
upto 13.2%.
Dual inoculation of Rhizobium and VA mycorthiza enhanced seed yield by 16.6%.
Entries viz., GJG 0505, H 04-31, WCG 2000-12, H 04-87, Phule G 9621-8, GNG 1778,
GJG 0506, IPC 2005-64, IPC 2006-13, H 82-2, BCP 91, JSC 35, MPJG 2001-04, GJG 02-05,
GJG 03-12, JG 2000-14 and JG 2003-14-16 were found resistant/moderately resistant
to wilt.
Five entries viz., GJG 0419, GJG 0505, H 04-31, GJG 0107 and GJG 0315 were found
resistant to moderately resistant against dry root-rot.
Entries viz., H 03-45, CSJ 479, BDG 7-602, GNG 1778, GNG 1488 and GG 1362 were
found resistant to moderately resistant to Ascochyta blight.
Maximum mortality of larvae of H. armigera was found in chickpea + coriander.
Genotypes CSJD 125 and BSH 02-113 were found tolerant to root-knot nematode, M.
javanica. CSJD 125 was found tolerant to both the species of root-knot nematodes, M.
javanica and M. incognita.
Front Line Demonstrations
Nine hundred sixty four demonstrations were conducted on high yielding genotypes.
The overall mean grain yield of high yielding varieties was 1558 kg/ha against 1236 kg/
ha of local old varieties grown by the farmers. The per cent increase in grain yield was
26.1. One hundred seventy eight demonstrations conducted with improved package of
technologies gave 1166 kg/ha of grain yield, which was 42.1% higher than the yield obtained
by farmers practices (821 kg/ha).
Pigeonpea
Promising Entries
Genotypes Pusa 2008-2, PT 0012 and PT 04-31 were found promising entries. IPA 203,
IPA 8-2 and IPAA 8-1 were found promising in long duration pigeonpea.
Breeder Seed Production
Total 644.15 q. breeder seed was produced against the DAC indent of 332.49 q.
Genetic Resources
Few lines were identified for seed boldness (Gosakote local, CM hllli local, BRG 1,
BRG 2, ICP 7035, HY. 3c, Chikkananall local, Poornapadu, Giddanahalli local); earliness
56
and resistance to disease (Chapple, Bennur local, Jamadar local, Rudrawati local); for
dwarfness (JS 3, JS 5, JS 6); for wilt resistance (NDA 3-03, NDA 05-14, NDAW 1003-18);
for tolerance to excess moisture (Bahar, M 14, WL 3, WL 5, WL 6, WL19); for high yield
(NDA GC 8, 32,NDA 5-14, NDAS 2008-1 and NDA 2008-3); for late blight (NDA 99-6)
and sterility mosaic (IPA 15 F, IPA 16 and IPA 8F).
Technology Developed
Pigeonpea (WRG 27) + mungbean at 60 cm row spacing and pigeonpea (LRG 41) +
groundnut were remunerative intercropping in South Zone. Pigeonpea (BSMR 736) +
soybean, GT 101 + groundnut, Asha + groundnut were remunerative in Central
Zone.
Pigeonpea + mungbean (1:1) and pigeonpea + urdbean systems were found promising.
Application of recommended dose of fertilizer along with FYM (5t/ha) and seed
inoculation with PSB gave higher PEY in pigeonpea based intercropping system.
Application of 100% RDF with FYM (5t/ha) and seed inoculation with Rhizobium + PSB
+PGPR was found promising for maximizing pigeonpea productivity.
Soil application of lime @ 200 kg/ha and seed inoculation with molybdenum @ 4g/kg
seed was found promising to enhance the productivity.
Pre-emergence application of Pendimethalin (0.75 kg/ha), followed by one hand
weeding at 50 DAS was found to give higher weed control efficiency.
ZnSO
4
@ 1% spray during flowering, followed by another spray 15 days after the
first spray increased the seed yield.
Seed inoculation with PSB-3 (Bacillus megarterium) and Rhizobium enhanced the grain
yield.
Combined inoculation with PSB, PGPR and Rhizobium increased the grain yield.
Genotype AL-1495 was found promising against pod borer as well as pod fly.
Genotypes SKNP 224 and LRG 41were found promising against pod borer. SKNP 224
has shown some resistance against pod fly also.
Among the newer insecticides tested, Syn A-15397 ZC @37.5g a.i./ha and spinosad 45
SC @73 g a.i./ha gave better control of pod borer complex.
TS 3-R was most promising showing resistance to wilt. MA 3, Phule T 0012, BDN
2004-1, BDN 2029, BSMR 571, BSMR 846, BWR 133 and Phule T03-142 were also found
promising against wilt.
Entry BDN 2004-2 showed R to MR reaction, while IPA 15 F, IPA 16 F and NDA 98-6
showed promise against sterility mosaic.
AL 1685 and MA 3 showed moderate resistance against Phytophthora blight.
BDN 2004-2, Phule T 0012 and Bahar showed resistance against Macrophomina stem
canker.
MA 6 and ICP 8862 were found to be most promising against SMD.
Two entries viz., H 2001-22 and SKMP 0514 were found resistant against root-knot
nematode Meloidogyne incognita.
Entry ASJ 123 was tolerant to both M. incognita and M. Javanica.
Three entries viz., SKMP 0212, SKMP 0633 and Phule T-04-31 were found moderately
resistant to Heterodera cajani and Rotylenchulus reniformis.
57
Neem cake @ ton/ha was found best for the control of M. incognita and neem cake @
0.25 t/ha+ carbosulfan seed treatment @ 3% (W/W) was best for the control of H.
cajani.
Seed soaking in 0.1% carbosulfan was more effective in reducing nematodes as
compared to seed soaking in 0.1% Imidacloprid.
Front Line Demonstrations
Total 361 demonstrations were organized to demonstrate the production potential of
high yielding genotypes. Improved varieties recorded higher mean grain yield of 22.86%,
23.0% and 32.29 with 49.08%, 28.9% and 33.37% higher net returns than local varieties in
early, medium and late duration pigeonpea. Application of 20 kg sulphur along with 100 kg
DAP/ha enhanced the productivity by 18.06% and recorded 18.76% higher net returns
than 100 kg DAP alone in 162 demonstrations. Insect management recorded 24.6% higher
grain yield with 41.35% higher net return in 141 demonstrations. Inoculation with Rhizobium
culture increased the grain yield by 10.68% with 13.51% higher net returns in 96
demonstrations. Planting on ridges recorded 20.4% higher grain yield than flat sowing in
33 demonstrations. Integration of all components of production technology enhanced the
productivity of pigeonpea by 25.8% with 39.9% higher net returns in 362 demonstrations.
MULLaRP
Varieties Identified/Released
Maitree : This small seeded lentil variety has been developed from the cross ILL 7723 x
BLX 84176 which has yielded 1588 kg/ha in North East Plain Zone. It yielded 22% more
than the check PL 406 and possesses resistance to rust. It has been released for cultivation
in eastern U.P., Bihar, Jharkhand, West Bengal and Assam.
Sweta : This mungbean variety has been developed from the cross Samrat x PDM 54. It
gave an average yield of 903 kg/ha in North Hill Zone with yield superiority of 24% over
the best check ML 5. It is resistant to MYMV disease. The variety has been released for
cultivation in NHZ.
NDU 5-7 : This urdbean variety developed from the cross (NP 21 x UL 2) x NDU 1
yielded 1116 kg/ha in North West Plain Zone with yield superiority of 20% over the check
Uttara and possess resistance to MYMV. It has been identified for cultivation in the states
of Punjab, Haryana, Delhi and western U.P.
Vallabh Urd 1 : This urdbean variety is a mutant of Pant Urd 19. It gave average yield of
1069 kg/ha in North West Plain Zone and with yield superiority of about 16% over the
check Uttara. It has resistance to MYMV and has been identified for cultivation in Punjab,
Haryana, Delhi and western U.P.
Technology Developed
Mungbean
Application of PSB + 40 kg P
2
O
5
/ha to mungbean saved 30 kg P
2
O
5
/ha for succeeding
ragi in mungbean (768 kg/ha) Ragi (2821 kg/ha) sequence.
Under high temperature, Rhizobium strains DM 2 and DM 4 gave highest nodules dry
weight and grain yield.
KM 2241, CoGG 923 and ML 1299 showed resistance against MYMV.
MH 2-16 and CoGG 934 showed multiple disease resistance.
58
RMG 976 and ML 1299 recorded resistant to both the species of root knot nematode,
Meloidogyne incognita and M. javanica.
Urdbean
Mixed spray of 2% KCl + 0.1 ppm boron and 2% urea maximized the yield under
drought.
DU 1 was found resistant to powdery mildew.
KUG 216 showed multiple resistance to MYMV, stem necrosis, cercospora leaf spot
and anthracnose.
Lentil
Sowing of sprouted seeds increased the yield under rice utera system.
PGPR strain RB 2 in combination with Rhizobium increased grain yield by 4.7% and
17.9% over Rhizobium alone and uninoculated control, respectively.
L 4688, L 4691, L 4147, L 4583, VL 133, RLG 73, IPL 315 and HUL 57 showed
multilocational resistance to rust.
LL 1020, PL 406, VL 516 and L 4695 were found tolerant to M. javanica.
Fieldpea
Raised bed sowing increased the yield by 20.8% (2517 kg/ha) over flat bed.
Rhizobium strain HUPR 74 was found to be the most efficient strain.
Pant P 108, Pant P 74, Pant P 25, Pant P 86, TRCP 8, RFP 29 and Pant P 107 showed
multilocation resistance against rust and powdery mildew.
Rajmash
Three sprays of 2% urea (preflowering + pod initiation + pod development) maximized
the yield (2087 kg/ha).
Breeder Seed Production
Breeder seed 771.58 q of mungbean (56 varieties), 380.29 q of urdbean (44 varieties),
416.28 q of lentil (31 varieties), 601.42 q of fieldpea (24 varieties) and 34.70 q of rajmash (7
varieties) was produced against the DAC indent of 574.25 q, 326.42 q, 293.12 q, 593.09 q
and 16 q, respectively.
Front Line Demonstrations
Under front line demonstrations, significant increase in grain yield and in net returns
were recorded through use of package technologies in different pulse crops. Results are
given below:
Crop % increase in grain yield
over local practices
Increase in net return (%) over local
practices
Mungbean 32.76 23.15
Urdbean 26.56 17.80
Lentil 46.75 60.99
Fieldpea 37.84 55.31
Rajmash 37.27 46.71
Lathyrus 48.81 49.39

59
Transfer of Technology
Training on Improved Production Technology of Rabi Pulses
A national training programme on improved production technology of rabi pulses was
organized at the Institute on
16-18 September, 2008, under
National Food Security
Mission - Pulse component.
Total 42 extension offi cers
from twelve states identifies
under NFSM-P participated in
the training. The methodology
adopted for the training was
interactive sessions of trainees
with the resource persons,
fol lowed by hands-on
demonstration of the
technology with a purpose of
greater understanding and
skill development. Supporting
literature in form of training
manual and other relevant
literature were provided to the participants.
Training on Improved Production Technology of Kharif Pulses
A three-day national training programme on improved production technology for
kharif pulses under NFSM-P was organised at the Institute on 16-18 March, 2009. Extension
officers from four states viz., Orissa, Haryana, Madhya Pradesh and Andhra Pradesh
participated in the training. The aspects covered in the training included region specific
improved varieties of kharif pulses and their characteristics, agronomic management,
integrated nutrient management, management of pests and diseases and use of bio-
fertilizers. In addition, processing aspects of pulses were also covered in the training. Two
field visits were also organised to provide practical exposure.
National Training on Protection Technologies of Pulse Crops
A three-day national training programme on protection technologies of pulse crops
was organized under National Food Security Mission on 15-17 December, 2008. The training
was attended by 23 extension officers from seven states viz., Uttar Pradesh, Madhya Pradesh,
Andhra Pradesh, Bihar, Chhatisgarh, Haryana and Orissa.
State Level Training under NFSM-P
A two-day training on improved production technology for spring/summer pulses
was organized for state level official of Uttar Pradesh on 30-31 December, 2008. This
training was organised with the financial assistance from Directorate of Agriculture,
Government of U.P., under National Food Security Mission-Pulses (NFSM-P)
component. Joint Directors (Agriculture), Deputy Directors of districts of U.P., District
Agriculture Officers and State/Divisional/ District level consultants participated in
this training programme.
60
A two-day state level training was organized on 24-25 September, 2008 on improved
production technology for rabi pulses. The training was attended by 48 consultants
(district, regional and state level) and senior level officers from 19 districts identified
under NFSM-P in Uttar Pradesh.
Model Training on Production Technology for Pulse Crops
A Model Trai ning was
organized on 18-25 November
2008 at IIPR for state l evel
extension officers on production
technology for pulse crops. Total
26 officers representing the states
of U.P., Punjab, Kerala, Gujarat,
Rajasthan and Orrissa participated
in the training programme. The
programme was designed to
provide the participants exposure
to the improved varieties of rabi,
kharif and spring/summer pulses,
improved agronomic practices,
improved protection technologies
like integrated disease and insect
pest management, improved post-
harvest technologies including
processing aspects.
61
Publications
Research Papers
Ali, S.S., Ravi Kumar, Naimuddin and Singh, B. (2008). Management of plant parasitic
nematodes infesting chickpea through intercropping with non-leguminous crops. Trends
in Biosciences 1: 8-12
Chaudhary, R.G. and Shukla, Neetu (2008). Prevalence of Trichoderma sp. in crop niches
with variable water need and their tolerance to high temperature. Journal of Food Legumes
21: 256-258.
Chaudhary, R.G. and Singh, R.K. (2008). Effect of culture media on growth and pigmentation
of Fusarium oxysporum f.sp. lentis isolates. Journal of Food Legumes 21: 259-261.
Chaudhary, R.G., Vishwa Dhar, Saxena, Hem and Prajapati, R.K. (2008). Evaluation and
validation of IPM module against wilt, phytophthora blight, pod borer and podfly in
pigeonpea. Journal of Food Legumes 21: 58-60.
Chaudhary, R.G., Vishwa Dhar, Singh, R.K. and Shukla, Neetu (2008). Pathogenesis of
non-pathogenic Fusarium oxysporum from banana on pulses. Journal of Food Legumes 21:
73.
Chaudhary, R.G. and Vishwa Dhar (2008). Resistant sources against Phytophthora blight in
pigeonpea. Indian Phytopathology 61: 359.
Chaudhary, R.G., Vishwa Dhar and Singh, R. K. (2009). Association of fungi with wilt
complex of perstile at different crop stages and moisture regimes. Archives of
Phytopathology and Plant Protection 42: 340-343.
Choudhary, P.R., Singh, I.P., Verma, S., Singh, N.P. and Kumar, S. (2008). RAPD markers
for identification of cytoplasmic male sterile, maintainer and restorer lines of pigeonpea.
Journal of Food Legumes 21(4): 218-221.
Duraimurugan, P. and A. Regupathy (2008). Synergistic effect of nucleopolyhedro virus
with synthetic pyrethroids against Helicoverpa armigera (Hbner). Pesticide Research Journal
20: 83-86.
F. Singh, P. K. Katiyar, I. P. Singh and N. D. Majumder (2008). Effect of selfing methods on
pod formation in early duration pigeonpea (Cajanus cajan). Indian J. Agric. Sci. 78(11):991-
993 .
Gopinath, K.A., Narendra Kumar, Mina, B.L., Srivastva, A.K. and Gupta, H.S. (2009).
Evaluation of mulching, stale seedbed, hand weeding and hoeing for weed control in
organic garden pea (Pisum Sativum Sub Sp. Hortens L.). Archives of Agronomy and Soil
Science 55(1): 115-123.
I. P. Singh, B.B. Singh, Iqrar Ali and Shiv Kumar (2009). Diversification and evaluation of
cytoplasmic nuclear male sterility system in pigeonpea (Cajanus cajan L. Millsp.) Indian
J. Agric. Sci. 79(4): 291-294.
Kumar, H., Kumar, S. and Shiv Sewak (2008). Factor analysis for determining selection
criteria for seed yield in chickpea. Journal of Food Legumes 21(3): 202-203.
Mina, B. L., Saha, S., Narendra Kumar, Srivastva, A.K. and Gupta , H.S. (2008). Changes in
soil nutrient content and enzymatic activity under conventional and zero-tillage practices
in Indian sandy clay loam. Nutrient Cycling in Agroecosystems 82: 273-281.
Mohapatra, S.D. and Srivastava, C.P. (2008). Toxicity of biorational insecticides against
spotted pod borer, Maruca vitrata (Geyer) in short duration pigeonpea. Indian Journal
of Entomology 70: 61-63.
Narendra Kumar, Gopinath, K.A., Srivastva, A.K. and Mahajan, V. (2008). Performance of
62
pigeonpea (Cajanus cajan L. Millsp.) at different sowing dates in mid-hills of Indian
Himalaya. Archives of Agronomy and Soil Science 54 (5): 507-514.
Narendra Kumar, Ved Prakash, Meena, B.L., Gopinath, K.A. and Srivastva, A.K. (2008).
Evaluation of toria (Brassica compestris) and lentil (Lens culinaris) varieties in intercropping
system with wheat (Triticum aestivum) under rainfed conditions. Indian Journal of
Agronomy 53 (1): 47-50.
P. Ray Choudhury, I.P. Singh, B. George, A.K. Verma and N.P. Singh (2008). Assessment of
genetic diversity of pigeonpea cultivars using RAPD analysis. Biologia Plantarum 52
(4): 648-653.
Rekha Singh, N.P.Singh, Subhojit Datta, Indu Singh Yadav and A.P.Singh (2009).
Agrobacterium mediated transformation of chickpea embryonic axes. Indian Journal of
Biotechnology 8:78-84.
Roy Burman, R., Singh, S.K., Singh, and Singh, A.K. (2008). Sustainability of pulse based
cropping system in Uttar Pradesh. Journal of Food Legumes 21 (2): 140-142.
Roy Burman, R., Singh, S.K., Singh, Lakhan and Singh, A.K. (2008). Extension strategies for
increasing pulse production for evergreen revolution. Indian Research Journal Extension
Education 8 (1): 5-8.
Singh, A. K., Kumar, Shantanu, Sah, Uma and Singh, S.K. (2008). Research extension interface:
Conceptual paradigm. International Journal of Extension Education 4: 52-59.
Singh, K.K., Ch. Srinivasarao and Ali, M. (2008). Phosphorus and mungbean residue
incorporation improve soil fertility and crop productivity in sorghum and mungbean-
lentil cropping system. Journal of Plant Nutrition 31 (3): 459-471.
Singh, S. K., Kumar, Shantanu, Singh, S.K. and Sah, Uma (2008). Sustainable development
in pulses productivity in Hamirpur district of U. P. : An approach of farmer participatory
varietal evaluation. Indian Research Journal Extension Education 8 (2&3): 32-37.
Singh, S.K. and Yadav, K. (2009). Life table of Helicoverpa armigera (Hubner) in chickpea
pods. Annals Pl. Protec. Sci. 17 (1).
Subhanjana Singh, K.N. Singh, Rama Kant, Sahil Mahfooz and S. Datta (2008). Assesment of
genetic diversity among pigeonpea genotypes using SSR markers. Indian Journal of
Genetics and Plant Breeding 68(3): 255-260.
Vishwa Dhar, Singh S.K., Trivedi T.P., Dhandapani,A., Chaudhary R.G. and Kumar, M.(2008).
Forecasting of Helicoverpa armigera infestation on long duration pigeonpea in central
Uttar Pradesh. Journal of Food Legumes 21(3):189-192.
Papers Presented in Seminars/Symposia
Paper presented in International Conference on Grain Legumes: Quality
Improvement, Value Addition and Trade held at IIPR, Kanpur on February,
14-16, 2009
Aditya Pratap, Priya Rani, P. Nandeesha and Shiv Kumar (2009). Haploid embryogenesis
in pigeonpea (Cajanus cajan L.) through anther culture.
Agrawal P.K., S.K. Chaturvedi, A.K. Choudhary and Sanjeev Gupta (2009). Molecular
diversity among the major pulse crops of India and ways to broaden it.
Ali M., K.K. Singh and Omar Ali (2009). Grain legumes for crop diversification and system
productivity.
Azad, B.S., Singh, S.K., Srivastava, S.P. and Tandon, P. (2009). Relationships of abiotic and
biotic factors on quantitative and qualitative losses of different food grain legumes. p
: 327.
63
B.R. Patil, Subhojit Datta, Benjanin Rosen, M.V. Channabyregowda, P.M. Salimath and
Douglaus R. Cook (2009). Resistance gene based markers in mungbean and urdbean.
Bansa Singh, Shamee Kausar, Indu Yadav and P. Nandeesha (2009). Assessment of different
genotypes of fieldpea for resistance against root-knot nematode, Meloidogyne javanica.
p : 264.
Basu, P.S. and Chaturvedi, S.K. (2009). Adaptation of grain legumes in relation to climate
change.
Ch. Srinivasrao, A.N. Ganeshamurthy and K.K. Singh (2009). Improving quality of grain
legumes through plant nutrient management.
Chaudhary R.G., Gurha S.N., Trivedi, S., Dubey, S.C. and Gupta, Om (2009). Efficacy of
native isolates of Trichoderma spp. against chickpea wilt pathogen. p : 310.
Chaudhary, R.G., Gurha, S.N., Trivedi, S., Dubey, S.C. and Gupta, Om (2009). Variability
in the isolates of Fusarium oxysporum f.sp. ciceri from India. pp : 315-316.
Chaudhary, R.G., Vishwa Dhar and Gharti, D.B. (2009). Integrated management of soil
borne pathogens in grain legumes. pp : 20-21
Choudhary, A.K. (2009). IPA 234 A promising pigeonpea genotype for resistance to sterility
mosaic disease.
Devraj and Renu Jain (2009). Development of an expert system for identification and control
of diseases in pulses.
Devraj, M.A. Iquebal and Sarika (2009). Growth and variability analysis of chickpea
production in Rajasthan.
F. Singh, P.K. Katiyar, I.P. Singh, N.D. Majumder and B.B. Singh (2009). Genetic divergence
and interrelationship among yield parameters in short duration pigeonpea.
I.P. Singh, Iqrar Ali, K.B. Wanjari and Shiv Kumar (2009). Inheritance of fertility restoration
in cytoplasmic-nuclear male-sterile lines of pigeonpea [Cajanus cajan (L.) Millsp.].
Indu Singh Yadav, Subhojit Datta and N.P. Singh (2009). Agrobactetiummediated
transformation of chickpea.
K.B. Saxena, S. Kumar, S. Acharya, R.K. Srivastava, R.V. Kumar and I.P. Singh (2009). Hybrid
technology for increased productivity and nutrition in grain legumes.
Kanaujia V.K., Purushottam, Singh A.K. and Saxena, A. (2009). Organized approach for
pulses technology dissemination in Bundelkhand. p : 244
Kaul J., Shiv Kumar, A.K. Choudhary and R.P. Dua. (2009). Planting dates and genotype
effects on kabuli chickpea yields and seed size.
Kaur, L., Pande, S., Gupta, Om, Vishwa Dhar and Chaudhary, R.G. (2009). Multirace wilt
resistance in chickpea (Cicer arietinum L.). pp : 312-313.
Khelaram Soren, J.C. Padaria and Aqbal Singh (2009). Studies on the symbiotic properties
of Tn 5 induced auxotrophic Rhizobium mutants in chickpea.
Kumar, Ravi (2009). Effect of food legumes as break crop in rice-wheat system. p : 240.
Kumar, S., Singh, S.K. and Sah, U. (2009). Sustaining the micro-enterprises for value addition
of pulses: Farmers based experiences. pp : 68.
Kushwaha, B.L., Venkatesh, M.S., Singh, Bansa, Naimuddin and Duraimurugan, P. (2009).
Effect of pulses in maize based cropping system on crop productivity and soil health.
p : 217.
Mohapatra, S.D. and Srivastava, C.P. (2009). Potential of naturally occurring bio-agents of
spotted pod borer, Maruca vitrata (Geyer) infesting pigeonpea.
64
N.D. Majumder, M. Byre Gowda, Farindra Singh and Deshraj (2009). Grain quality in
vegetable pigeonpea.
Naimuddin, Mohd. Akram and P. Duraimurugan (2009). Detection of a tospovirus associated
with leaf curl disease of mungbean at Kanpur.
Naimuddin, Mohd. Akram and Sanjiv Gupta (2009). Molecular characterization of a
begomovirus infecting Vigna silvestris L.
Nandeesha, P., Indu Singh Yadav, Shamee Kausar and Bansa Singh (2009). Genetic
transformation of fieldpea (Pisum sativum L.) with dsRNAi constructs for nematode
resistance. p : 161.
Narendra Kumar, B.L. Mina, S. Saha, S. Chandra and A.K. Srivastva (2009). Productivity of
lentil-fingermillet cropping system under different tillage management in rainfed
conditions. p : 236.
Paulraj, S., Vineeta and Bhavana Kushwaha (2009). In-vitro zinc solubilization of zinc
solubilizing bacteria and their plant growth promoting effect in legumes. pp : 182-183
Purushottam, Chaudhary R.G., Swarnalakshmi, K. and Iqubal Singh (2009), Dissemination
of Trichoderma a bio-agent in chickpea and lentil under rainfed condition of
Bundelkhand. p: 218
S.K. Chaturvedi, Masood Ali, Priyanka Vyas and P. K. Singh (2009). Promising extra large
seeded and high yielding kabuli chickpea genotypes developed for central India.
Saxena, Hem and Duraimurugan, P. (2009). Bracon (Habrobracon) hebetor Say (Hymenoptera:
Braconidae) a promising parasite of Helicoverpa armigera in chickpea. p : 258.
Shiv Kumar, Sanjeev Gupta, Hena, Bansa Singh and B.B. Singh (2009). Functional male
stelity and its inheritance in black gram (Vigan mungo L. Hepper). p : 138.
Shukla, Neetu and Chaudhary, R.G. (2009). Biological control of pigeonpea wilt pathogen
Fusarium udum (Butler) with Trichoderma spp. pp : 316-317.
Shulabhi Verma, R.K. Solanki and I.P. Singh (2009). Diversity analysis among stable
cytoplasmic genetic male sterile and restorer lines of pigeonpea (Cajanus Cajan (L.)
Millsp.).
Singh S.K., Abul Hasan and Chaudhary R.G. (2009). Variability in Fusarium oxysporum f.sp.
ciceri causing vascular wilt in chickpea. p : 323.
Singh, Dharmendra and A.K. Choudhary (2009). Screening of pigeonpea genotypes for
tolerance to aluminium toxicity.
Singh, K.K., Singh, S.K., Bansa Singh, Naimuddin and K. Swarnalakshmi (2009). Effect of
integrated nutrient and crop residue management on direct seeded rice-lentil system.
p : 185.
Singh, K.K., Singh, S.K., Singh, B., Naimuddin and Swarnalakshmi, K. (2009). Integrated
management of crop residue and fertilizer on productivity in rice-wheat-mungbean
system. p : 214.
Singh, R.A., Kumar, S. and Gupta, S. (2009). Search for sources of resistance to cercospora
leaf spot in mungbean. p : 266.
Singh, S.K. and Rai, A.B. (2009). Biodemography of Helicoverpa armigera Hubner (Lepidoptera:
Noctuidae) in early and late maturing pigeonpea. p : 319.
Spurthi Nayan, Nicy Varghese, T Nepolean, Varma Penmesta, Gudipati Srivani, Ruth
Jungmann, Hongyan Zhu, Andrew Farmer, Subhojit Datta, Guenter Kahl, Pooran M.
Gaur, Polavarpu Kavi Kishore, Dave Hoisington, May Greg, Peter Winter, Douglas
Cook and Rajeev Varshney (2009). A high density genetic map of chickpea.
Subhojit Datta, Lubna Faruqui, Jyoti Mishra and Nandeesha, P. (2009). Genetic
65
transformation of pigeonpea (Cajanus cajan L. Millspaugh) with Cry1Ac gene for
resistance to Helicoverpa armigera (Hubner).
Subhojit Datta, Mayank Kaashyap, Prasoonpal Gupta and Shiv Kumar (2009). Genetic
mapping of resistance to Fusarium wilt in chickpea (Cicer arietinum L.) .
Subhojit Datta, Sahil Mahfooz, Pallavi Singh and A.K. Chaudhary (2009). Development of
expressed sequence tags based microsatellite markers in pigeonpea (Cajanus cajan L.
Millspaugh).
Swarnalakshmi, K., Mohan Singh, Shruti Bhadauria and Archana Mishra (2009). Genotype
and soil dependent variations in growth response of pigeonpea to inoculation with
plant growth promoting rhizobacteria. p : 225.
Swarnalaxmi K., Singh, Mohan and Chaudhary, R.G. (2009). Field evalvation of compatibility
of Rhizobium with fungicides and effect of storage period on the performance of
inoculated seeds in black gram. pp : 246-247.
Tyagi, V.P., Brahm Prakash and Sharma, D.K. (2009). Effect of market arrivals on prices of
pigeonpea in Uttar Pradesh. pp. 65-66.
Tyagi, V.P., Brahm Prakash and Sharma, D.K. (2009). Regional variation in the performance
of chickpea across the states of India. pp : 66-67.
Varma Penmesta, Ben Rosen, Andrew Farmer, Garcia Carrasquilla, Gao Noelia, Jinliang,
Jimmy Woodward, Bullo Mamo, Birinchi Sarma, HongKyuAllie Choi Albedika,
BaekJong Min, Jamal Buzayan, Rakesh Chahota, Brian Chan, Jennifer Clarke, Subhojit
Datta, Foo Cheung, GarzonLuz, Bhuwneshwar Patil, Nadia Tarzhagi, Christopher
Town, Sally Vail, Mei Yuan, Wejian Zhuang, Goes Da silva Francisco, Steiner Steve,
Esperanza Martinez, Rhonda Foely, Karam Singh, Rajeev Varshney, Greg May, Guohao
He, George Bruening and Douglas Cook (2009). Using genomics to deduce the evolution
of papilinoid genomes and develop tools for applied genomics in legumes.
Venkatesh, M.S. and Pramanik, S.C. (2009). Integrated phosphorus management for maize-
chickpea cropping sequence in Inceptisol of Kanpur. p : 251.
Verma, Prasoon and Garg, S.K. (2009). Storage of pulses in form of dal.
Vishwa Dhar, Chaudhary, R.G. and Gharti, D.B. (2009). Integrated management of soil
borne pathogens in grain legumes.
Papers presented in National Symposium on New Paradigms in Agronomic
Research, held on November, 19-21 at Navasari, Gujarat
Kumar, Ravi (2008). Management of pulse residues in rice-wheat system. pp : 25-26.
Kushwaha, B.L., Venkatesh, M.S., Bansa Singh, Naimuddin and Duraimurugan, P. (2008).
Effect of pulses in rice (Oryza sativa) based system on crop productivity and soil health.
p : 420.
Singh, K.K., Singh, S.K., Singh, Bansa, Naimuddin and K. Swarnalakshmi (2008). Residue
incorporation in rice-chickpea system improves crop productivity and soil fertility.
pp: 241-242.
Others
Chaturvedi, S.K. (2009). Genetic options for enhancing crop productivity under acidic soils.
National Seminar on Sustainable Management of Acidic Soils, held at CAU, Pashighat,
Arunachal Pradesh on 22-24 September, 2008.
Devraj and Renu Jain (2008). GRAMBUG: An expert system for chickpea (Gram) insect-
pest management. 62
nd
Annual Conference of the Indian Society of Agricultural Statistics,
held on November 24-26, 2008 at S.V. Agricultural College, Tirupati.
66
Dubey, S.K., S.K. Singh, Uma Sah and A.K. Singh (2009). Improving livelihood security
through farmer participatory pulse-based intervention: Experiences from Bundelkhand
region of India. National Seminar on Innovative Extension Strategies for Agricultural
Development and Rural Prosperity, held at CSAUA&T, Kanpur on 5-7 March 2009. p
: 21.
Kumar, S., Sah, U., Singh, S.K. and Singh, A.K. (2009). Impact of appropriate technological
components of chickpea and lentil in Bundelkhand region of Uttar Pradesh. 5
th
National
Extension Education Congress-2009, held at CSAUA&T, Kanpur on 5-7 March, 2009.
p : 161.
Penmetsa, R. Varma, Farmer, Andrew D., Carrasquilla, Garcia, Noelia Sarma, Birinchi, K.,
Woodward, Jimmy, Datta, Subhojit, Vail, Sally L, May, Gregory D, Bruening, George
E, Cook, Douglas, R. (2009). Gene-based orthologous markers for comparative genomics
in crop. IV
th
International Conference on Legume Genomics and Genetics, held on 7-
12 December, 2008 at Puerto Vallarta, Mexico.
Pramanik, S.C., Singh, N.B., Verma, Prasoon, Singh, K.K. (2008). Raised bed planting- An
innovation in water conservation technology. National Symposium for Resource Starved
Farmers in Global Perspective, held at CSAUA&T, Kanpur on April 28-30, 2008.
Purushottam, Chaudhary, R.G., Swarnalakshmi, K. and Iqubal Singh (2009). Constraints in
pulses production in Bundelkhand. 5
th
National Extension Education Congress, held
on 5-7 March, 2009 at CSAUA&T, Kanpur. p : 106.
Roy Burman, R. and Singh, S. K. (2009). Validation and refinement of location specific
technologies through farmer participatory research. 4
th
Worl d Congress on
Conservation of Agriculture, held on 4-7, February, 2009 at New Delhi. p: 381.
Sah, U., Kumar, S., Singh, S.K., Shyam, Radhe and Awasthi, D. (2009). Perceived technological
needs of women farmers with regard to production of mungbean and urdbean: A
study of Fatehpur district (UP). 5
th
National Extension Education Congress-2009, held
at CSAUA&T, Kanpur on 5-7 March, 2009. p : 67.
Sah, U., S.K. Singh and Shantanu Kumar (2009). Gender mainstreaming for transfer of
pulses technologies: Status and initiatives (2009). National Seminar on Innovative
Extension Strategies for Agricultural Development and Rural Prosperity, held at
CSAUA&T, Kanpur on 5-7 March 2009, p :199.
Saxena, Hem (2008). Biocontrol: Present scenario and future strategies. National Symposium
on Eco-friendly Insect Pest Management, held at Entomological Research Institute,
Loyola College, Chennai on February, 7-8, 2008. pp : 18 -19.
Saxena, Hem and Duraimurugan, P. (2008). Present scenario of integrated pest management
in pulses. National Conference on Pest Management Strategies for Food Security, held
at IGKV, Raipur on 2-3 May, 2008. p : 9.
Shiv Kumar, Subhojit Datta, Masood Ali (2009). Molecular marker assisted backcrossing
(MAB) for pyramiding of wilt resistance genes in chickpea. 5
th
International Crop
Science Congress, held on 13 to 18 April 2008 at Jeju, Korea.
Singh, A. K., Shantanu Kumar, Uma Sah and S. K. Singh (2008). Assessment of policy reform
in extension and agriculture by conceptualizing the agricultural extension management
for rural development. National Seminar on Innovative Extension Strategies for
Agricultural Development and Rural Prosperity, held at CSAUA&T, Kanpur on 5-7
March 2009, pp: 12-13.
Singh, S.K., Shantanu Kumar, Nigam, S.N. and A.K. Singh (2008). Farmers driven
participatory pulses seed production for ensuring seed sufficiency at the village level.
National Seminar on Innovative Extension Strategies for Agricultural Development
and Rural Prosperity, held at CSAUA&T, Kanpur on 5-7 March 2009, pp : 19-20.
67
Singh, S.K., Kumar, S., Sah, U., Singh, A.K., Yadav, S. and Yadav, A. (2009). Economics of
on-farm seed production of major pulses in Uttar Pradesh. 5
th
National Extension
Education Congress-2009 held at CSAUA&T, Kanpur, on 5-7 March, 2009. p : 109.
Srivastava, G.K., Brahm Prakash and Sharma, D.K. (2008). Water pollution in India : Causes
and remedies. 67
th
Annual Conference of Indian Society of Agricultural Economics,
held at School of Economics, Andhra University, Vishakhapatnam, on November 28-
30, 2008.
Srivastava, S.P., Singh, S.K., Azad, B.S. and Tandon, Pankaj (2008). Evaluation of faunal
diversity of sodic soil in district Etah (India). National Conference on Scientific and
Legal Challenges of Global Warming, held at Brahmanand College, Kanpur, on
February 25-26, 2008. p: 52.
Srivastava, S.P., Singh, S.K., Azad, B.S.and Tandon, Pankaj (2008). Evaluation of faunal
diversity of sodic soil in district Raebareli (India). National Seminar on Environment
and Sustainable Development, held at D.A.V.College, Kanpur, on February 25-26, 2008.
p : 19.
Subhojit Datta, N.P. Singh, Shiv Kumar and Masood Ali (2009). Development of pod borer
(Helicoverpa armigera Hubner) resistant transgenics in chickpea and pigeonpea using
Cry1Ac gene. 5
th
International Crop Science Congress, held on 13 to 18 April 2008 at
Jeju, Korea.
Vasishtha, H. and Srivastava, R.P. (2008). Variability in cholesterol lowering and cancer
preventing compounds of desi and kabuli type chickpeas. 33
rd
FEBS Congress, held at
Athens, Greece, during June 28-July 3, 2008.
Venkatesh, M.S., Singh, N.B. and Basu, P.S. (2008). Effect of foliar application of urea on
chickpea under rainfed conditions. National Seminar on Developments in Soil Science,
held at UAS, Bangalore on 27-30, November 2008.
Vishwa Dhar, Chaudhary, R.G., Datta, S., Mishra, S., Prajapati, R. K. and Md. Shamim.
(2008). Variability in Fusarium udum, the pigeonpea wilt pathogen in India. 9
th
International Congress of Plant Pathology (ICPP 2008), held at Torino, Italy on August
24-29, 2008.
Popular Articles
Ali, M. and Kumar, S. (2008). Increasing of pulses production for ensuring food security.
Intensive Agriculture 47 (1): 51-54.
Ali, M. and Kumar, S. (2008). Indian strengths in pulses production and export. The Hindu
Survey of Indian Agriculture 2008. pp. 39-41.
Ali, M. and Venkatesh, M.S. (2009). Pulses in improving soil health. Indian Farming 58 (11):
18-22.
Ali, Masood and Singh, S.K. (2008). Dalhan Utpadan Badhane Ki Chunauti. Kheti 4: 21-25.
Brahm Prakash and Om Prakash (2008). Chana Ki Unnat Kheti. Kisan Jyoti 1(2) : 48-53.
Chaturvedi, S.K. and Ali, Masood (2008). Reserach efforts in chickpea paid divedends.
Indian Farming 58(8): 4-6.
Kumar, S., Venkatesh, M.S., Solanki, R.K., Sarkaer, A. and Ali, M. (2008). Lentil heritable
genetic variants for Fe and Zn. ICAR News 14(4) : 2.
Pramanik, Subhash Chandra, Singh, Narendra Bahadur and Brahm Prakash (2008). Na ho
kam, jal ki kalkal. Kheti 61(2) : 29-33.
Purushottam, Rao, D.U.M. and Lakhan Singh (2008). Dietary model of farming system
diversification. Agriculture Today 11(4): 43-45.
68
Shiv Kumar, Venkatesh, M.S., Solanki, R.K., Sarkar, A. and Ali, M. (2008). Lentil heritable
genetic variants for Fe and Zn. ICAR News 14: 2
Singh, S. K., Dubey, Shantanu Kumar, Sah, Uma and Sandeep Singh (2008). Dalhanee Phasloan
Ka Bhagidaree Beej Utpadan. Kisan Jayoti 2: 28-31.
Book Chapter
Ali, M. and Kumar, S. (2009). Major technological advances in pulses: Indian scenario. In:
Milestones in Food Legumes Research (M. Ali and S. Kumar eds.). Indian Institute of
Pulses Research, Kanpur. pp : 1-20.
Kumar, S. and Singh B.B. (2009). Crop Improvement: Mungbean. In: 25 Years of Pulses
Research at IIPR. Indian Institute of Pulses Research, Kanpur. pp : 37-42.
Kumar, S. and Solanki, R.K. (2009). Crop Improvement: Lentil. In: 25 Years of Pulses Research
at IIPR. Indian Institute of Pulses Research, Kanpur. pp : 14-21.
Rahman, M.M., Sarker, A., Kumar, S., Asghar Ali, Yadav, N.K. and Rahman, M.L. (2009).
Breeding for Short Season Environments. In : The Lentil: Botany, Production and Use
(W. Erskine, F. J. Muehlbauer, A. Sarker and B. Sharma eds.), CABI, UK. pp : 150-165.
S. Datta and R.K. Varsheny (2009). Genomics Enabled Crop Improvement in Food Legumes.
In: Milestones in Food Legume Rsesearch. (Eds., Masood Ali and Shiv Kumar). Indian
Institute of Pulses Research, Kanpur. pp. 249-289.
Saxena, Hem (2009). Biocontrol: Present Scenario and Future Strategies. In: Ecofriendly
Insect Pest Management (S. Ignacimuthu, and B.V. David eds.), Elite Publishing House
Pvt. Ltd., New Delhi. pp : 81 88.
Singh, R.A. and Naimuddin (2009). Mungbean and Urdbean Diseases. In : 25 Years of
Pulses Research at IIPR. Indian Institute of Pulses Research, Kanpur pp : 110-116.
Singh, S.K. and Shantanu Kumar Dubey (2009). Agricultural Extension. In: 25 Years of
Pulses Research at IIPR. Indian Institute of Pulses Research, Kanpur.
Institute Publications
1. Allelochemicals and Their Role in Agriculture
2. Catalogue on Pigeonpea Germplasm
3. Pulses in Cropping Systems
4. Report of Quinquennial Review on Pulses
5. 25 Years of Pulses Research at IIPR
6. Milestones in Food Legumes Research
7. Improved Varieties of Chickpea in India
8. Arhar Beej Utpadan Takneek
9. Unnat Takneekon Ka Vikas- Safalta Ki Gatha
10. Annual Report 2007-08
11. Dalhan Alok 2008
12. Pulses Newsletter Vol. 19 Nos. 2 - 4 & Vol. 20 No. 1.
13. Dalhan Samachar Vol. 2 Nos. 1-2.
69
Human Resource Development
Dr. Vishwa Dhar attended Workshop on leadership for innovation in agriculture, held on
November 17-21, 2008 at National Institute of Agriculture Extension Management,
Hyderabad.
Dr. S. Datta was deputed to the University of California, Davis, USA, to work on legume
genomics under the BOYSCAST fellowship of Department of Science and Technology
from May 6 to August 5, 2008.
Dr. K R Soren attended 21 days training on Physiological and molecular basis of plant
adaptation to draught held at University of Agricultural Sciences, Bangalore, on March
2-22, 2009.
Dr. Prakash G. Patil attended 21 days training on Molecular marker applications in crop
genetics and breeding held at ICRISAT, Patancheru on October 6-24, 2008.
Dr. A.K. Choudhary attended training on Molecular markers applications in crop genetics
and breeding held at at ICRISAT, Hyderabad on 6-24 October, 2008.
Dr. A.K. Choudhary attended training on IP and technology management: Geographical
indications held at NBFGR, Lucknow on 18-20 December, 2008.
Dr. J. Kumar attended training on Marker assisted selection: Theory, practice and
application held at ICARDA, Syria from February 22 to March 5, 2009.
Dr. R.K. Solanki attended training on Marker assisted selection: Theory, practice and
application held during February 22 to March 5, 2009 at ICARDA, Syria.
Mr. P. Nandeesha attended training on Prioritization, monitoring and evaluation (PNE)
support to consortia based research projects in agriculture held on October 21-25,
2008 at NAARM, Hyderabad.
Mr. P. Nandeesha attended state level workshop on Management and monitoring of field
trials of genetically engineered crops held on December 20, 2008 at NDUA&T,
Kumarganj, Faizabad.
Mr. K.R. Soren attended state level workshop on Management and monitoring of field
trials of genetically engineered crops held on December 20, 2008 at NDUA&T,
Kumarganj, Faizabad.
70
On-going Research Projects
CROP IMPROVEMENT
S.
No.
Title of the Project Principal
Investigator
Associate
1. Management of genetic resources of
chickpea: Collection, evaluation and
conservation
Dr. Shiv Sewak Dr. S.K. Chaturvedi
2. Management of genetic resources of
pigeonpea: Collection, evaluation and
Conservation
Dr. Farinder Singh Dr. A.K. Choudhary
Dr. Vishwa Dhar
3. Genetic resource management of
urdbean: Collection, evaluation and
Conservation
Dr. Sanjeev Gupta Dr. R.A. Singh
Mr. Naimuddin
Dr. Bansa Singh
4. Management of genetic resources of
lentil: Collection, evaluation and
conservation
Dr. R. K. Solanki Dr. Sanjeev Gupta
Mr. Naimuddin
5. Management of genetic resources of
fieldpea: Collection, evaluation and
conservation
Dr. P.K. Katiyar Dr. G.P. Dixit
6. Management of genetic resources of
mungbean: Collection, evaluation and
conservation
Dr. P.K. Katiyar Dr. B.B. Singh
Dr. G.P. Dixit
7. Genetic enhancement of desi chickpea
for improved plant type and multiple
disease resistance
Dr. S.K. Chaturvedi Dr. R.G. Chaudhary

8. Genetic enhancement of kabuli
chickpea for improved plant type and
multiple disease resistance
Dr. S.K. Chaturvedi Dr. Shiv Sewak
Dr. R.G. Chaudhary
9. Genetic enhancement of lentil for
improved plant type and multiple
disease resistance
Dr. Shiv Kumar Dr. R. K. Solanki
Mr. Naimuddin
10. Genetic enhancement of fieldpea for
improved plant type and multiple
disease resistance
Dr. G.P. Dixit Dr. P.K. Katiyar
11. Genetic enhancement of long duration
pigeonpea for improved plant type
and multiple disease resistance
Dr. A.K. Choudhary Dr. Vishwa Dhar
Dr. I.P. Singh

12. Genetic enhancement of short
duration pigeonpea for improved
plant type and multiple disease
resistance
Dr. I.P. Singh

13. Development of suitable plant type of
mungbean for different seasons
Dr. Shiv Kumar Dr. B.B. Singh
Dr. R.A. Singh
Dr. Aditya Pratap
14. Genetic enhancement of urdbean for
improved plant type and multiple
disease resistance
Dr. Sanjeev Gupta Mr. Naimuddin
Dr. Bansa Singh
Dr. P. Duraimurugan
15. Isolation of protease inhibitor genes
against Helicoverpa pod borer
Dr. S. Datta Dr. P. Nandeesha

71
CROP PRODUCTION
S.
No.
Title of the Project Principal
Investigator
Associate
16. Identification of donors and QTL
associated with traits imparting drought
tolerance in lentil
Dr. Jitendra Kumar Dr. R.K. Solanki
Dr. P.S. Basu
Dr. K.R. Soren
17. Genetic improvement of pulses through
distant hybridization
Dr. Aditya Pratap Dr. S.K. Chaturvedi
Mr. P. Nandeesha
Dr. I.P. Singh
Dr. Jitendra Kumar
18. Breeding for quality traits in lentil Dr. R.K. Solanki Dr. M.S. Vekatesh

S.
No
Title of the Project Principal Investigator Associate
1. Evaluation of summer legumes for
enhancing nutrient efficiency and
productivity in ricewheat cropping
system
Dr. Ravi Kumar Dr. N.B. Singh
Dr. M.S.Venkatesh
2. Agronomic management of pre rabi
mungbean for introduction in rice
wheat cropping system
Dr. N.B. Singh Dr. K.K. Singh
3. Development of efficient water
management practices for higher
productivity in pulses
Dr. J.P. Mishra Dr. K.K. Singh
Dr. M.S.Venkatesh Er.
Prasoon Verma
4. Residue management in cropping
systems involving pulses


Dr. K.K. Singh Dr. S.K. Singh
Dr. Bansa Singh
Mr. Naimuddin
Dr. K. Swarnlakshmi
5. Long term effect of pulses in
cropping systems on soil health and
crop productivity

Dr. B.L. Kushwaha

Dr. M.S.Venkatesh
Dr. Bansa Singh
Mr.Naimuddin
Dr. P. Duraimurugan
Mr. S. Paulraj
6. Efficient input management in
rice lentil production system for
diversification of rice- wheat
cropping system
Dr. N.B. Singh/
Dr. Narendra Kumar

Dr. M.S.Venkatesh
Dr. R.G. Chaudhary
7. Studies on post-emergence
herbicides in pulse based
cropping systems
Dr. Narendra Kumar -
8. Establishing critical level of nutrients
in pulse crops
Dr. M.S. Venkatesh Dr. P.S.Basu
Dr. N.B. Singh
9. Enhancing phosphorus use efficiency
in pulse based cropping system
Dr. M.S. Venkatesh
10. Soil test and crop response
studies for site specific nutrient
management in maize-lentil
cropping system
Dr. M.S. Venkatesh Dr. K.K. Singh
11. Resource conservation
technology in pulse based
cropping system
Dr. Narendra Kumar Dr. K.K. Singh
Dr. M.S. Venkatesh
Mr. S. Paulraj

72
CROP PROTECTION
S.
No.
Title of the Project Principal Investigator Associate
1. Development of detection system for
variants of Fusarium udum and
identification of variant specific and
multivariant resistant donors in
pigeonpea
Dr. Vishwa Dhar Dr. R.G. Chaudhary
Dr. S. Datta
2. Identification of resistant donors in
mungbean and urdbean against
Cercospora leaf spots and its
management
Dr. R.A. Singh Mr. Naimuddin
3. Studies on variability in Rhizoctonia
bataticola and identification of race
specific and multi-race donors for wilt
and dry root rot resistance in chickpea
Dr. R.G. Chaudhary Dr. Vishwa Dhar
Dr. S.K. Chaturvedi
4. Identification of resistant donors against
Phytophthora blight in pigeonpea

Dr. R.G. Chaudhary Dr. Vishwa Dhar

5. Variability in MYMV isolates infecting
mungbean and urdbean in different
agro-ecological zones
Mr. Naimuddin Dr. Mohd. Akram
6.
Investigations on urdbean leaf crinkle
disease - An emerging threat to urdbean
Mr. Naimuddin Dr. P. Duraimurugan
Dr. Sanjeev Gupta
Dr. Mohd. Akram
7. Sources of resistance against wilt and
root rot in lentil and their molecular
characterization
Mr. Naimuddin Dr. R.G. Chaudhary
Dr. Shiv Kumar
8. Identification of donors for resistance
against H. armigera in chickpea
Dr. R. Ahmad Dr. S.K. Singh
Dr. P. Duraimurugan
9. Evaluation of potential bioagents
against H. armigera in chickpea and
pigeonpea
Dr. (Mrs.) Hem Saxena Dr. R.G. Chaudhary
Dr. P. Duraimurugan
10. Bio-ecology of Callosobruchus spp. and
identification of resistance in stored
chickpea
Dr. S.K. Singh -
11. Identification of source (s) of resistance
to pod fly Melanagromyza obtusa Malloch
and its management in late pigeonpea
Dr. S.K. Singh Dr. I.P. Singh
12. Development of forecasting module for
pod fly M. obtusa Malloch in late
pigeonpea
Dr. S.K. Singh Ms. Ranjana Agrawal
Mr. Amrendara Kumar
Mr. Hemant Kumar
Mr. Dinesh Singh
Dr. C.P. Srivastava, BHU
13. Bio-efficacy, scale up production and
formulation of entomopathogenic
nematodes (EPN) for management of
pod borer of chickpea
Dr. S.S. Ali/
Dr. R. Ahmad

Dr. P. Duraimurugan
Dr. Lalit Kumar

73
CROP PHYSIOLOGY, BIOCHEMISTRY AND MICROBIOLOGY
S.
No.
Title of the Project Principal Investigator Associate
14. Current status of plant parasitic nematodes
infecting pules in Bundelkhand
Dr. Bansa Singh
15. Identification of sources of
resistance/tolerance against root-knot
nematode in pulses
Dr. Bansa Singh
16. Identification of sources of resistance to
bructids in mungbean and urdbean
Dr. P. Duraimurugan
17. Bio-ecology of legume pod borer Maruca
vitrata (Geyer) in short duration
pigeonpea and its management
Dr. S.D. Mohapatra Dr. Farindra Singh
Dr. S.K. Singh
18. Temporal and spatial variation in
population of H. armigera (Hubner)
Dr. S.D. Mohapatra Dr. R. Ahmad
Dr. P. Duraimurgan
19. Identification of sources of resistance to
bruchids in mungbean and Urdbean
Dr P. Duraimurugan
20. Basic and molecular characterization of
virus (es) associated with leaf curl necrosis
of urdbean and mungbean
Dr. Mohd. Akram Mr. Naimuddin
Dr. P. Duraimurugan

S.No. Title of the Project Principal Investigator Associate
1. Development of screening techniques and
physiological characterization of heat
tolerance in chickpea
Dr. P.S. Basu Dr. S.K. Chaturvedi
2. Screening of lentil genotypes against heat
stress and evaluating the physiological
and biochemical properties associated
with heat tolerance
Dr. A. Bhattacharya Dr. (Mrs.) Vijaya Laxmi
3. Screening of fieldpea genotypes against
heat stress and finding
morphophysiological traits associated
with heat tolerance
Dr. (Mrs.) Vijay Laxmi Dr. G.P. Dixit
4. Physiological studies on pre-harvest
sprouting in mungbean
Dr. (Mrs.) Vijay Laxmi Dr. Sanjeev Gupta
5. Biochemical basis and mechanism of wilt
resistance in pigeonpea
Dr. R.P. Srivastava -
6. Increasing nodulation and N2 fixation in
chickpea under moisture stress
condition
Dr. K. Swarnalakshmi Dr. Mohan Singh
7. Development of production technology
for organic production system for lentil
and kabuli chickpea
Dr. Mohan Singh -
8. Isolation and screening of efficient A.M.
fungi for lentil and chickpea under
drought
Mr. S. Paulraj -
9. Isolation and characterization of active
alleo-molecules of sorghum, linseed and
bioactive molecule of calotropis latex
Dr. Lalit Kumar Dr. R.G. Chaudhary
Dr. Bansa Singh

74
AGRICULTURAL EXTENSION, ENGINEERING & STATISTICS
S.No. Title of the Project Principal Investigator Associate
1. Popularization of mungbean in
spring/summer season for
sustainability and income
generation in Kannauj district
Dr. Purushottam Dr. K.K. Singh
2. Socio-economic impact
assessment of farmer
participatory research and
extension programme on pulses
in Bundelkhand region
Dr. S. K. Dubey Dr. S.K. Singh
Dr. (Mrs.) Uma Sha
Mr. Hemant Kumar
3. Stakeholders perception of
priorities and issues in pulses
research and extension in Uttar
Pradesh
Dr. S. K. Dubey Dr. (Mrs.) Uma Sah
Dr. S.K. Singh
4. Consumption pattern of pulses
among farm families of central
part of Uttar Pradesh
Dr. (Mrs.) Uma Sah Dr. Purshottam
Dr. S. K. Dubey
5. Documentation of indigenous
technical knowledge with regard
to pulse production, protection
and post-harvest handling in
Uttar Pradesh
Dr. Uma Sah Dr. S. K. Dubey
Dr. Hem Saxena
6. Development of efficient
machines for pulse production
system : Pulse threshers
Mr. Prasoon Verma
7. Value addition to the by-product
of pulse milling industry
Development of dal analog
Mr. Prasoon Verma Dr. R.P. Srivasatava
Mr. S. Paulraj
8. Development of prototype
expert system for identification
and control of insect
pest/diseases in chickpea and
pigeonpea
Mr. Devraj Dr. R. Ahmad
Dr. Vishwa Dhar
Dr. R.G. Chaudhary
9. Stability analysis of some
promising lines of chickpea
Mr. Hemant Kumar Dr. Shiv Kumar
Dr. Shiv Sewak
10. Classification of mungbean and
urdbean germplasm by
multivariate analysis
Mr. Hemant Kumar
11. Development of efficient
estimation procedures for
computation of compound
growth rates in pulses
Dr. M.A. Iquebal
12. Modeling and forecasting of pulse
production using ARIMA and
Artificial Neural Network
methodology
Dr. Sarika

75
Externally Funded Projects
S.No. Title of the Project Funded by Principal Investigator
1. Management of pests in stored seeds/grain of
cereals and pulses through EPN
DBT Dr. S.S. Ali/
Dr. R.Ahmad
2. Mapping and tagging of resistance genes against
Fusarium wilt in lentil
DBT Dr. Shiv Kumar
3. Taxonomy, distribution and biology of
entomopathogenic nematodes infesting insect
pests of pulses in Uttar Pradesh
DST Dr. Azra Shaheen
4. Enhancing yield potential and stability of
pigeonpea through heterosis breeding
DAC Dr. I.P. Singh
5. Development and popularization of model seed
system for quality seed production of major
legumes to ensure seed sufficiency at village
level.
DAC Dr. S.K. Singh
6. DUS testing of chickpea DAC Dr. N.P. Singh
7. DUS testing of pigeonpea DAC Dr. N.D. Majumder
8. DUS testing of MULLaRP DAC Dr. B. B. Singh
9. Plant growth promoting rhizobacteria (PGPR) for
chickpea and pigeonpea
ICAR Dr. K. Swarnalakshmi
10. Pigeonpea genomics initiatives Indo-US AKI Dr. S. Datta
11. Seed production in agricultural crops and
fisheries
DAC Dr. B.B. Singh/
Dr. S.K. Chaturvedi
12. Improving tropical legumes productivity in
marginal environments in sub-Sahara Africa and
South Asia
Bill and
Melinda
Gates
Foundation
Dr. Masood Ali
13. Construction of a linkage map and tagging of
genes resistance to MYMV and powdery mildew
in urdbean (Vigna mungo (L.) Hepper)
DBT Dr. Sanjeev Gupta
14. Molecular characterization and sequences
diversity of tospovirus associated with Fabaceous
and Solanaceous crops
ICAR Dr. Mohd. Akram
15. Strengthening of breeder seed production NFSM/DAC Dr. S.K. Chaturvedi
16. Promoting use of Trichoderma sp. An
ecofriendly approach for the management of wilt
and root rot complex in major pulse crops in
Bundelkhand region
DST Dr. Purushottam

76
S.No. Title of the Project Funded by Principal Investigator
17. Understanding plant nematode-interactions
using RNAi
ICAR/NAIP Dr. S.S. Ali/
Dr. P. Nandeesha
18. Scale-up production and development of cost
effective formulations of entomopathogenic
nematode based biopesticide for pod borer of
chickpea
CSIR Dr. S.S. Ali
19. Outreach project on Phytophthora, Fusarium and
Ralstonia diseases of horticultural and field
crops- Fusarium wilt of pigeonpea and chickpea
ICAR Dr. Vishwa Dhar
20. Use of EPNs as a tool of biological control for
lepidopteran borer complex infesting early
pigeonpea
DBT Dr. S.S. Ali
21. Network project on transgenics in chickpea and
pigeonpea for pod borer resistance
ICAR Dr. S. Datta
22. Network project on functional genomics of
chickpea (Fusarim wilt)
ICAR Dr. S. Datta
23. Development of extra large seeded kabuli
chickpea varieties for crop diversification
DAC Dr. S.K. Chaturvedi
24. Molecular mapping and tagging of genes
resistant of Fusarium wilt of pigeonpea
ICAR Dr. I.P. Singh
25. Technological empowerment of pulse growing
women farmers of Uttar Pradesh
DST Dr. (Mrs) Uma Sah

77
Institute Management Committee
As on 31.3.2009
Dr. Masood Ali
Director
IIPR, Kanpur
Chairman
Dr. P.K. Agarwal
Principal Scientist
VPKAS, Almora
Member
Dr. S.K. Mishra
Head, Division of Germplasm Evaluation
NBPGR, New Delhi
Member
Dr. C.S. Rao
Principal Scientist, CRIDA
Hyderabad
Member
Dr. O.P. Sharma,
Principal Scientist
NRC on IPM, LBS Building
Pusa Campus, New Delhi
Member
Administrative Officer
IIPR, Kanpur
Member Secretary

Dr. Masood Ali
Director, IIPR
Kanpur


Chairman
Dr. V.D. Patil
Assistant Director General (O & P)
ICAR, Krishi Bhavan
New Delhi


Member

All scientists of the Institute


Member

Dr. Mohan Singh
Principal Scientist
IIPR, Kanpur

Member Secretary

Institute Research Council
As on 31.3.2009
78
Research Advisory Committee
As on 31.3.2009

Dr. S.C. Modgal
Former Vice-Chancellor, GBPUA&T
6, Rajdeep Enclave, Phase-II, 100 ft Road, Dayalbagh, Agra

Chairman
Dr. Shanker Lal
Ex. Director, IIPR
G-648, Avas Vikas No.1, Kalyanpur, Kanpur

Member
Dr. M.N. Khare
Ex. Dean, JNKVV
24, Ravindra Nagar, Adhartal, Jabalpur (M.P.)

Member
Dr. O.P. Dubey
Ex. ADG (O & P), ICAR
B-9, Greenview Apartments, Sector-9, Rohini, Delhi

Member
Dr. V.S. Tomer
Vice-Chancellor
Rajmata Vijayaraje Scindia Agricultural University
Gwalior

Member
Dr. Masood Ali
Director, IIPR
Kanpur

Member
Dr. V.D. Patil
ADG (O&P), ICAR
Krishi Bhawan, New Delhi

Member
Dr. Shiv Kumar
Head, Division of Crop Improvement
IIPR, Kanpur
Member Secretary

79
Important Committees of the Institute
As on 31.3.2009
1. Monthly Review Committee
Dr. Masood Ali, Chairman
All Scientists
Farm Manager
Mr. Diwakar Upadhyaya
Mr. G.S. Pandey
Finance & Accounts Officer
Administrative Officer
Asstt. Administrative Officer
(Administration)
Asstt. Administrative Officer (Stores)
Chairmen of various committees
Mr. D.N. Awasthi
Caretaker, Guest House
Secretary, IJSC
Dr. Mohan Singh, Member Secretary
2. Farm Advisory Committee
Dr. B.B. Singh, Chairman
Dr. C. Chattopadhyay
Dr. Mohan Singh
Dr. Shiv Kumar
Mr. Prasoon Verma
Farm Manager
Dr. S.K. Chaturvedi., Member Secretary
3. Farm Produce Price Fixation
Committee
Dr. B.L. Kushwaha, Chairman
Dr. S.K. Chaturvedi
Dr. P.K. Katiyar
Dr. (Mrs.) Vijay Laxmi
Administrative Officer
Mr. R.P. Singh, Member Secretary
4. Stores Purchase Committee
Dr. N.P. Singh, Chairman
Dr. R.G. Chaudhary, Co-chairman
Dr. Bansa Singh
Administrative Officer
Finance & Accounts Officer
Mr. A.K. Saxena, Member Secretary
5. Resource Generation Committee
Dr. Vishwa Dhar, Chairman
Dr. Mohan Singh
Dr. R. Ahmad
Dr. Shiv Kumar
Mr. Lallan Yadav
Finance & Accounts Officer
Administrative Officer, Member Secretary
6. Director's Technical Cell
Dr. Shiv Kumar, In-charge
Dr. P.S. Basu
Mr. Naimuddin
Mr. Diwakar Upadhyaya
Mr. Brahm Prakash
Mr. H.G. Rathore
7. Library and ARIS Committee
Dr. Masood Ali, Chairman
Dr. N.P. Singh
Dr. Vishwa Dhar
Dr. Mohan Singh
Dr. Shiv Kumar
Dr. R. Ahmad
Dr. R.P. Srivastava
Dr. A. Bhattacharya, Member Secretary
8. Publication Committee
Dr. Masood Ali, Chairman
Dr. Shiv Kumar
Dr. M.S. Venkatesh
Dr. P.S. Basu
Mr. Naimuddin
Mr. Diwakar Upadhyaya, Member
Secretary
80
9. Newsletter Committee
Dr. Masood Ali, Chairman
Dr. Shiv Kumar
Dr. M.S. Venkatesh
Mr. Naimuddin
Mr. Diwakar Upadhyaya, Member
Secretary
10. Women's Cell
Dr. (Mrs.) Hem Saxena
Dr. (Ms.) K. Swarnalakshmi
Mrs. Meenakshi Varshney
Mr. R.K.P. Sinha
11. Institute Joint Staff Council
Dr. Masood Ali, Chairman
Dr. R.A. Singh
Dr. G.P. Dixit
Dr. (Mrs. ) Vijay Laxmi
Administrative Officer
Finance & Accounts Officer
Mr. Yashwant, Secretary (Staff side)
Mr. G.S. Pandey
Mr. Rajesh Kumar
Mr. Ramayan Prasad
Mr. Kailash
Mr. Harbans
12. Grievance Cell
Dr. R.G. Chaudhary, Chairman
Dr. Ravi Kumar
Mr, Brahm Prakash
Mr. Ramesh Chandra
Mrs. Meenakshi Varshney
Mr. Ram Kishan Shukla
Secretary, IJSCl
Mr. Rajendra Singh, Member Secretary
13. Rajbhasha Implementation
Committee
Dr. Masood Ali, Chairman
Dr. B.B. Singh
Dr. Vishwa Dhar
Dr. Mohan Singh
Dr. Shiv Kumar
Dr. Hem Saxena
Dr. S.K. Singh
Dr. Sanjeev Gupta
Mr. Diwakar Upadhyaya
Administrative Officer
Finance & Accounts Officer
Dr. R.K. Srivastava, Member Secretary
14. Academic Committee
Dr. Shiv Kumar, Chairman
Dr. R.G. Chaudhary
Dr. R.P. Srivastava
Dr. S. Datta, Member Secretary
17. Computer Committee
Dr. R. Ahmad, Chairman
Dr. P.S. Basu
Dr. Bansa Singh
Mr. Prasoon Verma
Mr. Devraj, Member Secretary
18. Guest House Management
Committee
Dr. Shiv Kumar, Chairman
Dr. Shiv Sewak
Dr. (Ms.) K. Swarnalakshmi
Mr. Anil Kumar Saxena
Mr. Rajendra Singh, Member Secretary
19. Gardening and Sanitation
Committee
Dr. Naimuddin, Chairman
Dr. Shiva Kant Singh
Dr. (Ms.) K. Swarnalakshmi
Mr. M.P. Singh, Member Secretary
20. Works Committee
Dr. Mohan Singh, Chairman
Dr. R.A. Singh
Dr. Shiva Kant Singh
Dr. Sushil Kumar Singh
Dr. Prasoon Verma
Admn. Officer
Mr. D.N. Awasthi, Member Secretary
81
21. Sexual Harassment Committee
Dr. (Mrs.) Hem Saxena, Chairperson
Dr. (Mrs.) Uma Sah
Dr. (Ms.) K. Swarnalakshmi
Dr. G.P. Dixit
Dr. Subhojit Datta
Mrs. A. Abraham
22. HRD Committee
Dr. Vishwa Dhar, Chairman
Dr. S.K. Chaturvedi
Dr. M.S. Venkatesh
Dr. S. Datta
Mr. Devraj
23. Electrical Works Maintenance
Committee
Dr. Mohan Singh, Chairman
Dr. K.K. Singh
Dr. Aditya Pratap
Mr. Prasoon Verma
Mr. S.K. Garg, Member Secretary
24. Sports Committee
Dr. A. Bhattacharya, Chairman
Dr. Bansa Singh
Dr. (Mrs.) Vijay Laxmi
Mr. Prasoon Verma
Dr. S. K. Dubey
Dr. A.S. Sachan
Mr. A.K. Saxena, Member Secretary
25. Germplasm Identification
Committee
Dr. B.B. Singh, Chairman
Dr. Sanjeev Gupta
Dr. Shiva Kant Singh
Mr. Naimuddin
Dr. Shiv Kumar, Member Secretary
26. Institute biosafety committee
Dr. Masood Ali, Chairman
Dr. N.P. Singh
Dr. Shiv Kumar
Dr. R. Ahmad
Dr. S.K. Goyal (ITRI, Lucknow)
Dr. P.K. Singh (GSVM Medical Collage,
Kanpur)
Dr. S. Datta, Member Secretary
27. Others
Dr. S.K.Chaturvedi, I/c Farms
Dr. Shiv Kumar, Nodal Scientist IPR
Dr. Sanjeev Gupta, Convenor Seminar
Dr. S.K. Singh, I/c Photography
Mr. B.K. Verma, I/c Vehicles
Mr. D.N. Awasthi, I/c Building,
Construction & Maintenance
Dr. M.P. Singh, I/c Security
82
Panorama
Institute Celebrated Foundation Day
The 16
th
Foundation Day of the Institute was celebrated on 5
th
September, 2008 with
great fervour and gaiety. Dr. G.B. Singh, former Director General of U.P. Council of
Agricultural Research was the
Chief Guest and Sh. Subhash
Bapu Rao Patil, a progressive
farmer of Maharashtra and
Member of Institute
Management Committee was
the Guest of Honour. While
inaugurating the function, the
Chief Guest expressed his
concern over malnutrition and
gradually reducing per capita
availability of pulses, which is
adversely affecting the protein
requirements, particularly of the
vegetarian population. He said
that the 30 per cent yield gap
between demonstration plots
and farmers field can be reduced by timely availability of quality seeds of improved
varieties and matching crop production technologies.
In his address, Sh. Patil called for developing programmes with farmers participation
so that the research results are visible at farmers fields. He appreciated the programme
taken by the Institute in Fatehpur and Kanpur districts. Dr. Masood Ali, Director of the
Institute presented a detailed resume of research programmes, activities and achievements
made during 2007-08. He stressed upon the need for in-depth basic and strategic research.
He commended the progress made in hybrid programme, transgenic research and
developing multiple resistance against major diseases. He informed the house that short
and medium duration pigeonpea hybrids and extra large seeded kabuli chickpea varieties
with 55 g/100 seed weight will be commercialized soon. Govt. of India has allocated Rs.
10 crores for establishing training centre, HRD and breeder seed production under National
Food Security Mission. This will create high profile infrastructure for training and seed
production.
On this occasion, over 200 farmers from Kanpur and neighbouring districts participated
in the Scientists-Farmers Interaction programme and skill oriented on-hand training on
different aspects of crop production, crop protection and post-harvest technology. Two
Institute publications viz., Allelochemicals and Their Role in Agriculture and Catalogue
on Pigeonpea Germplasm were released.
On this occasion, Dr. Shiv Kumar, Head, Division of Crop Improvement was given the
Best Scientist Award 2007. Mr. Diwaker Upadhyay and Mr. D.N. Awasthi were conferred
with Best Worker Award in technical category and Smt. A. Abraham in administrative
category.
83
International Conference on Grain Legumes
To commemorate the Silver Jubilee of IIPR, a three-day International Conference on
Grain Legumes : Quality Improvement, Value Addition and Trade (ICGL 2009) was
organised at the Institute on 14-16 February, 2009. The Conference was inaugurated on
February 14, 2009 by Bharat Ratna Dr. A.P.J. Abdul Kalam, Former President of India. The
conference was jointly organized by Indian Society of Pulses Research and Development
(ISPRD) and Indian Institute of Pulses
Research.
In his inaugural address, Dr.
Kalam congratulated the scientists for
the strides made in enhancing food
production and ensuring nutritional
security. He advocated for a separate
mission on pulses. Dr. Kalam
expressed concern on the declining
per capita availability of pulses and
exhorted the scientists to increase the
productivity by tailoring varieties
and technologies for different agro-
ecological regions for production of
pulses as well as to ensure the quality
enhancement and value addition.
Stressing upon the need f or
promoting organic farming, integrated nutrient management, technology development for
resistance to abiotic and biotic stresses, post-harvest management and value addition to
end products, Dr. Kalam called upon the scientist for adopting a synergistic approach
towards developing such technologies which go hand in hand with the nature and the
stakeholders. He also stressed upon creation of cooperatives and inclusion of pulses in
PDS.
The inaugural session was presided by Dr. Mangala Rai, Secretary, DARE and Director
General, ICAR. In his presidential address, he underlined the need for an integral approach
combining conventional and non-conventional methods for breeding high yielding varieties
insulated against major biotic and abiotic stresses. Dr. Rai emphasized that development of
transgenics and molecular breeding for improvement of traits in pulses have tremendous
scope for revolutionizing the agricultural production and farmers income. Dr. S.P. Tiwari,
Deputy Director General (CS & Edn.) specifically highlighted programmes on transgenic
development, wilt management, development of hybrid pigeonpea and extra-large seeded
kabuli chickpea. Dr. Masood Ali, Executive Chairman of the Organizing Committee and
Director of the Institute, while welcoming the dignitaries and participants, highlighted the
efforts made by the Institute in developing technologies for increasing pulse production.
The Chief Guest released publications of the Institute such as 25 Years of Pulses Research
at IIPR and Milestones in Food Legume Research on this occasion.
Over 400 scientists across the country and abroad (USA, Canada, Australia, Germany,
Netherlands, South Africa, Denmark, Syria, Nepal and Bangladesh) attended the
Conference. During the conference, scientific deliberations were held in eight sessions
viz., nutritional security and human health, climate change, genomics, biodiversity and
genetic enhancement, integrated crop management, post harvest management and value
addition, etc. Plenary and invited lectures were delivered by the eminent scientists, besides
250 poster presentations.
84
Eminent Pulse Scientists Honoured
The Indian Society of Pulses Research and Development (ISPRD) Awards 2009 were
given to eminent pulse scientists on the auspicious occasion of International Conference on
Grain Legumes held at Indian Institute of Pulses Research, Kanpur on February 14-16,
2009. These awards were presented
to 10 eminent sci enti sts i n
recognition of the excellent and
outstanding contributions in pulses
research and development. The
ISPRD Li fe Ti me Achievement
Award was given to Dr. Mahmoud
Bachir El- Solh, Director General,
International Centre for
Agricultural Research in the Dry
Areas (ICARDA), Syria and Dr.
William D. Dar, Director General,
International Crops Research
Institute for the Semi-Arid Tropics
(ICRISAT), Patancheru. Prof.
K.H.M. Siddique, University of
Western Austral ia, Dr. R.S.
Malhotra, ICARDA and Dr. S.B.
Sharma, University of Western
Australia were presented
ISPRD Gold Medals for their
contributions in Crop
Production, Crop Improvement
and Crop Protection,
respectively. These Awards
were presented by Dr. A.P.J.
Abdul Kalam, Former President
of Indi a duri ng Inaugural
Function of the Conference.
Dr. Willi am Erskine,
Director, Centre for Legumes
in Mediterranean Agriculture
(CLIMA), Australia presented
the ISPRD Recognition Awards
to Dr. B.B. Singh, IIPR, Dr. J.S.
Sandhu, PAU, Dr. Guri qbal
Singh, PAU, Dr. Suresh Pande,
ICRISAT and Dr. R.G.
Chaudhary, IIPR.
85
New Infrastructure at IIPR
IIPR has been identified as nodal centre under National Food Security Mission for
capacity building and breeder seed production and has been provided Rs. 5.0 and
10.0 crores, respecti vely, during 11
th
Fi ve Year Plan. Under this programme, a
Communication and
Trai ning Centre and
Advance Seed
Technology Laboratory
shall be created.
Dr. Mangala Rai,
Secretary, DARE and
Director General, ICAR
laid foundation stone of
these buil dings on
February 14, 2009 in
presence of Dr. S.P.
Tiwari, Deputy Director
General (CS & Edn.). The
Communication and
Trai ning Centre will
have a large training hall, an audio and exhibition hall, four mini group discussion rooms
and training hostels.
Institute Management Committee Meeting
The 28
th


meeting of Institute Management Committee was held on September 5,
2008 under the chairmanship of Dr. Masood Ali, Director. The meeting was attended by
Dr. R.P. Katiyar,
Director (Research),
CSAUA&T, Kanpur;
Dr. R.P. Dua, Project
Coordinator, AICRP
on Under Utilized
Crops, NBPGR, New
Delhi, Dr. S.N. Sinha,
Head, IARI Regional
Stati on, Karnal, Dr.
D. L.N. Rao, Project
Coordinator, Indian
Institute of Soil Science, Bhopal and Sh. S.B. Patil along with different Project Coordinators
and Heads of the Divisions and Incharge of the Sections, Administrative Officer and Finance
& Accounts Officer. The Committee reviewed the progress of the Institute and applauded
the achievements in R&D.
86
Launch Meeting of NFSM on Enhancing
Seed Production in Pulses
The launch meeting of NFSM project was held at IIPR, Kanpur on June 30, 2008. The
meeting was chaired by Dr. M. Ali, Director, IIPR. Nodal officers of the respective centers
and concerned crop breeders attended the meeting. While welcoming the delegates, Dr.
B.B. Singh, Nodal officer of
NFSM project gave brief
account of the progress made
by centers, especially
GBPUA&T, Pantnagar, IGKV,
Raipur and BAU, Ranchi for
their efforts in initiating the
programme in spring/summer
2008 itself. Dr. M. Ali,
Director, IIPR thanked the
Vice-Chancellors of various
participating universities for
coll aborati ng in this
programme. He also expressed his concern about chronic shortage of quality seed of pulses,
a major stumbling block in containing the productivity. He called upon the scientists to
achieve the target of doubling the breeder seed of appropriate varieties. Nodal officers of
different centers made presentations on the progress of work during the current year and
future planning. After thorough discussion on center-wise presentations, variety-wise
targets of breeder seed production for the year 2008-09 were fixed for each centre.
Training-cum-Awareness on Quality Seed Production and
Safe Storage of Pulses
IIPR organized a skill oriented training on Quality seed production and storage of
pulses with collaboration of National Seeds Corporation on 21.6.2008. Dr. B.B. Patnaik,
Chairman and Managing Director
of NSC was the Chief Guest. Sri
Patnaik appealed to private seed
companies to share the
responsi bility of transferring
quality seed production of pulses.
The NSC distributed Seed Storage
Containers (Steel made) to 60 seed
growers from Kanpur Dehat and
Fatehpur district selected under
ISOPOM f unded Model Seed
System(s) project. On this occasion,
Dr. Masood Ali, Director, IIPR
highlighted upon the active
participation of stakeholders in
seed production of pulse crops.
General Manager (Marketing) and
Regional Manager, NSC were also present in this programme. Farmers' friendly literature
published by IIPR were distributed to the participants/farmers.
87
Pulses Group Meet
The Annual Group Meet on rabi pulses was held at MPUA&T, Udaipur on 7-9
September, 2008. About 250 delegates from cooperating centres, ICAR, SAUs and State
Department of Agriculture participated in this Group Meet. While inaugurating the meet,
Dr. S.L. Mehta, Vice
Chancellor of MPUA&T,
Udaipur emphasized the
importance of pulses and
pioneered various issues
so that required
progress in desired
direction can be made.
He suggested that
focused programmes on
specific problems of
pulses need to be
initiated as long term
strategies.
The Chief Guest, Dr. V.D. Patil, ADG (O&P), ICAR expressed his concern about
increasing import bill on pulses and oilseeds. Dr. Patil suggested that efforts are needed to
solve the problem of poor productivity and shortage of pulses. He emphasized upon the
importance of genetic resources and its utilization.
Dr. Masood Ali, Director, IIPR said that for the first time we have crossed the mark of
15 million tonnes of pulses production. He informed about the priorities set by ICAR for
pulses research such as marker assisted breeding, wide hybridization, development of
CMS based hybrids and input use efficiency during XI Plan. Dr. N.P. Singh, Project
Coordinator (Chickpea) and Dr. B.B. Singh, Project Coordinator (MULLaRP) presented
the salient research achievements made during 2007-08. The progress in research programmes
was reviewed and technical programmes for the year 2008-09 were finalized. Two varieties
viz., Shubhra (IPCK 2002-29) of chickpea and WBL 77 of lentil were identified during the
workshop.
On the occasion, the significant contribution made in pulses research by Crop
Improvement Division of IIPR Kanpur and Agricultural Research Station, Durgapura were
acknowledged and applauded by presenting a memento.
The Annual Group Meet of AICRPs on kharif pulses was held at SK Nagar on May
2-5, 2008. Dr. V.D. Patil, ADG (O&P) in his inaugural address called upon the scientists to
enhance the productivity of pulses by developing CMS based hybrids in pigeonpea and
infusing new variability in breeding programme Dr. R.C. Maheshwari, Vice- Chancellor,
SDAU, called upon the centers to adopt innovation, global vision and promptness in delivery
of technologies to end users. Dr. N.D. Jambhale, ADG (Seeds), ICAR called upon the
scientists to participate in popularization of new varieties in their areas of jurisdiction. Dr.
Masood Ali, Director IIPR congratulated the pulse team of SDAU for developing the
worlds first CMS based hybrid GTH 1 in pigeonpea and called upon the scientists to take
periodical observations on crops under changing climatic conditions and come out with
technologies which can cope up with such changes.
Dr. B.B. Singh, Project Coordinator (MULLaRP) and Dr. N.D. Majumder, Project
Coordinator (Pigeonpea) presented the achievements of their respective programmes made
during 2007. The results of kharif 2007 were discussed and the technical progamme for 2008
and finalized.
88
29 2008
89
Distinguished Visitors
Date Name Affiliation
21.6.2008 Mr. B.B. Pattanaik Chairman-cum-Managing Director,
National Seeds Corporation, New Delhi
22.8.2008 Dr. Robert J. Bir Kenholz The Ohio State University, USA
22.8.2008 Dr. YA Susi Whittyti The Ohio State University, USA
16.2.2009 Douglas Cook University of California, Davis
16.2.2009 Scott Jackson Purdue University, Indiana
16.2.2009 Rajeev Varshnay ICRISAT, India
6.3.2009 Dr. R.C. Srivastava Director, CARI, Port Blair
26.3.2009 Neil C. Turner CLIMA, University of Western Australia,
Perth, Australia

90
Personnel
As on 31.3.2009
A. Research Management
1. Dr. Masood Ali Director
B. Scientific
Crop Improvement
2. Dr. Shiv Kumar Plant Breeding Head of Division
3. Dr. S.K. Chaturvedi Plant Breeding Principal Scientist
4. Dr. Sanjeev Gupta Plant Breeding Principal Scientist
5. Dr. I.P. Singh Plant Breeding Senior Scientist
6. Dr. A.K. Choudhary Plant Breeding Senior Scientist
7. Dr. S. Datta Biotechnology Senior Scientist
8. Dr. Aditya Pratap Plant Breeding Senior Scientist
9. Dr. Jitendra Kumar Plant Breeding Senior Scientist
10. Mr. P. Nandeesha Biotechnology Scientist
11. Dr. R.K. Solanki Plant Breeding Scientist
12. Dr. (Mrs.) Nirupma Singh Plant Breeding Scientist (Upto 29.11.2008)
13. Mr. Prakash G. Patil Biotechnology Scientist
14. Dr. Khela Ram Soren Biotechnology Scientist
Crop Production
15. Dr. N.B. Singh Agronomy Head of Division (Upto 31.12.2008)
16. Dr. B.L. Kushwaha Agronomy Principal Scientist
17. Dr. Ravi Kumar Agronomy Principal Scientist
18. Dr. S.C. Pramanik Agronomy Principal Scientist (Upto 18.1.2009)
19. Dr. K.K. Singh Agronomy Senior Scientist
20. Dr. M.S. Venkatesh Soil Science Senior Scientist
21. Dr. J.P. Mishra Agronomy Senior Scientist
22. Dr. Narendra Kumar Agronomy Senior Scientist
Crop Protection
23. Dr. C. Chattopadhyay Plant Pathology Head of Division
24. Dr. Vishwa Dhar Plant Pathology Principal Scientist
25. Dr. R.A. Singh Plant Pathology Principal Scientist
26. Dr. S.S. Ali Nematology Principal Scientist (Upto 31.7.2008)
27. Dr. R.G. Chaudhary Plant Pathology Principal Scientist
91
28. Dr. R. Ahmad Entomology Principal Scientist
29. Dr. (Mrs.) Hem Saxena Entomology Principal Scientist
30. Dr. Bansa Singh Nematology Principal Scientist
31. Dr. Shiva Kant Singh Entomology Senior Scientist
32. Dr. Mohd. Akram Entomology Senior Scientist
33. Dr. S.D. Mohapatra Plant Pathology Senior Scientist
34. Mr. Naimuddin Plant Pathology Scientist (SG)
35. Dr. P. Duraimurugan Entomology Scientist
Physiology, Biochemistry & Microbiology
36. Dr. Mohan Singh Microbiology Principal Scientist &
Acting Head of Division
37. Dr. R.P. Srivastava Biochemistry Principal Scientist
38. Dr. A. Bhattacharya Plant Physiology Principal Scientist
39. Dr. P.S. Basu Plant Physiology Principal Scientist
40. Dr. (Mrs.) Vijay Laxmi Plant Physiology Senior Scientist
41. Dr. Lalit Kumar Agril. Chemistry Scientist (Sr. Scale)
42. Dr.(Ms.)K. Swarnalakshmi Microbiology Scientist
43. Mr. S. Paulraj Microbiology Scientist
Agricultural Extension
44. Dr. S.K. Singh Agril. Extension Principal Scientist
45. Dr. Shantanu K. Dubey Agril. Extension Scientist (Sr. Scale)
46. Dr. (Mrs.) Uma Sah Agril. Extension Scientist (Sr. Scale)
47. Dr. Purushottam Agril. Extension Scientist (Sr. Scale)
Agricultural Statistics and Computer Application
48. Mr. Devraj Computer Application Scientist (Sr. Scale)
49. Mr. Hemant Kumar Agril. Statistics Scientist (Sr. Scale)
50. Dr. Sarika Agril. Statistics Scientist
Agricultural Economics
51. Dr. I.P.S. Yadav Agril. Economics Principal Scientist
(Upto 31.7.2008)
Agricultural Engineering
52. Mr. Prasoon Verma Agril. Engineering Scientist (SG)
C. AICRP on Pigeonpea
53. Dr. N.D. Majumder Project Coordinator
54. Dr. Farindra Singh Senior Scientist
92
D. AICRP on Chickpea
55. Dr. N.P. Singh Project Coordinator
56. Dr. Shiv Sewak Senior Scientist
57. Dr. Mir Asif Iquebal Scientist
E. AICRP on MULLaRP
58. Dr. B.B. Singh Project Coordinator
59. Dr. G.P. Dixit Senior Scientist
60. Dr. P.K. Katiyar Senior Scientist
F. Technical
61. Mr. Diwakar Upadhyaya Editor (T-9)
62. Mr. D.N. Awasthi Architect (T-7/8)
63. Dr. T.N. Tiwari Technical Officer (T-7/8)
64. Mr. Lallan Yadav Technical Officer (T-7/8)
65. Mr. M.R. Tripathi Technical Officer (T-7/8)
66. Mr. Desh Raj Technical Officer (T-7/8)
67. Mr. D.K. Sharma Technical Officer (T-7/8)
68. Mr. Brahm Prakash Technical Officer (T-7/8)
69. Dr. M.P. Singh Technical Officer (T-7/8)
70. Dr. A.S. Sachan Technical Officer (T-6)
71. Mr. Jokhu Ram Technical Officer (T-6)
72. Dr. Aditya Prakash Technical Officer (T-6)
73. Dr. G.K. Srivastava Technical Officer (T-6)
74. Mr. Vijendra Singh Technical Officer (T-6)
75. Mr. A.B. Singh Technical Officer (T-6)
76. Dr. Ved Ram Technical Officer (T-6)
77. Mr. R.S. Mathur Technical Officer (T-6)
78. Mr. Radha Krishan Technical Officer (T-6)
79. Mr. Omkar Nath Technical Officer (T-6)
80. Mr. Ramesh Chandra Technical Officer (T-5)
81. Mr. S.K. Garg Technical Officer (T-5)
82. Mr. Govind Ram Technical Officer (T-5)
83. Mr. Ved Prakash Technical Officer (T-5)
84. Mr. Rajendra Prasad Technical Officer (T-5)
85. Mr. A.P. Singh Technical Officer (T-5)
G. Administrative
86. Mr. P.R. Sharma Finance & Audit Officer
87. Mr. Rajendra Singh Assistant Administrative Officer (Acting A.O.)
88. Mr. A.K. Saxena Assistant Administrative Officer
89. Mr. B.K.Verma P.S. to Director
93
Sl. No. Name Promoted to w.e.f.
1. Dr. N.P. Singh Principal Scientist 07.3.2006
2. Dr. Shiv Sewak Principal Scientist 25.12.2005
3. Dr. Purushottam Scientist (SS) 30.7.2002
4. Dr. K. Swarnalaxmi Scientist (SS) 29.11.2007
5. Mr. Brahm Prakash T-7/8 01.7.2007
6. Dr. M.P. Singh T-7/8 01.7.2008
7. Mr. Chandra Pal SSG IV 31.10.2008
8. Mr. Jhinku SSG III 31.10.2008
9. Smt. Angoori SSG III 31.10.2008

Appointments, Promotions, Transfers, etc.
Appointment
Promotion
Transfer
Retirement
Obituary
Dr. S.C. Pramanik, Principal Scientist, Crop Production left for his heavenly abode on
18.1.2009. May his soul rest in Peace.
Name Post held Date of retirement
Dr. S.S. Ali Principal Scientist 31.7.2008
Dr. I.P.S. Yadav Principal Scientist 31.7.2008
Dr. N.B. Singh Head, Division of Crop Production 31.12.2008

Sl.
No.
Name Post Date of joining
1. Dr. Mir Asif Iquebal Scientist (Agril. Statistics) 16.05.2008
2. Dr. Sarika Scientist (Agril. Statistics) 16.05.2008
3. Mr. Prakash G. Patil Scientist (Biotechnology) 16.05.2008
4. Dr. Narendra Kumar Senior Scientist (Agronomy) 12.8.2008
5. Dr. Jitendra Kumar Senior Scientist (Plant Breeding) 30.8.2008
6. Dr. Aditya Pratap Senior Scientist (Plant Breeding) 30.8.2008
7. Dr. S.D. Mohapatra Senior Scientist (Entomology) 01.11.2008
8. Dr. Khela Ram Soren Scientist (Biotechnology) 03.11.2008
9. Dr. Mohd. Akram Senior Scientist, Plant Pathology 15.11.2008
10. Dr. S. Datta Sr. Scientist (Biotechnology) 06.11.2008
11. Dr. C. Chattopadhyay Head, Division of Crop Protection 12.1.2009
12. Dr. Shiv Kumar Head, Division of Crop Improvement 13.1.2009

Name Designation From To w.e.f.
Dr. (Mrs.) Nirupma Singh Scientist IIPR, Kanpur DMR, New Delhi 29.11.2008
Dr. J.P. Mishra Sr. Scientist DAC, New Delhi IIPR, Kanpur 20.3.2009

- -- -

- -