A Dynamic DNA for Key-based Cryptography

Bahubali Akiwate Dr. Latha Parthiban

Department of Computer Science & Engineering Department of Computer Science & Engineering
K.L.E College of Engineering and Technology Pondicherry University
Chikodi,India Pondicherry,India
[email protected] [email protected]

Abstract— A dynamic DNA for key-based Cryptography that

encrypt and decrypt plain text characters, text file, image file and II. DNA CRYPTOGRAPHY
audio file using DNA sequences. Cryptography is always taken as DNA Cryptography is a field in which lots of researches are
the secure way while transforming the confidential information happened and happening and it is still expected to come up
over the network such as LAN, Internet. But over the time, the
with better solution, meeting modern era problems and issues.
traditional cryptographic approaches are been replaced with
more effective cryptographic systems such as Quantum
The technologies under DNA Cryptography which are already
Cryptography, Biometric Cryptography, Geographical accepted are PCR (Polymerize Chain Reaction), DNA
Cryptography and DNA Cryptography. This approach accepts synthesis and DNA Digital Coding [13]. Here we used DNA
the DNA sequences as the input to generate the key that going to Digital Coding technique in which encoding and decoding can
provide two stages of data security. be done with the use of binary values such as 0 and 1.DNA
Digital Coding is based on biological structure such as DNA
Keywords— DNA Cryptography, Dynamic DNA, DNA Digital (Deoxyribo Nucleic Acid) which is composed of four basic
Coding, Encryption, Decryption nucleotides such as Adenine (A), Cytosine (C), Guanine (G)
and Thymine (T). The proposed system combines the
I. INTRODUCTION traditional, currently available cryptosystems, uses DNA
Digital Coding and maps digital data into biological DNA
Cryptography is the field in which information can be
sequences and vice versa.
encrypted and transmitted over the network then it can be The proposed system may be applicable to the areas of
decrypted back to its original form. Here the encryption can be digital transactions such as credit card/debit card payments, e-
done at the sender before transferring it into network and after mail, SMS (Short Message Service) encryption where users
receiving encrypted message is decrypted at the receiver using wants to have more secure communication.
a key provided to it. Before the communication between
sender and the receiver both of these entities must agree upon III. SYSTEM DESIGN
some protocols by how they are exchanging their information,
The following figure 1 shows the system design in which
it is some kind of handshake procedure. While information is
sender is sending the information to the receiver, the sender
in transit in network, even the intruder or attacker gets the
encodes the data by using the DNA digital coding and key
information is not in understable manner. There is a need to
combination to produce the cipher text and generate the
adopt more secure and reliable encryption algorithm. The
random key used for decryption process by the receiver.
DNA Cryptography is one such secure and reliable data
security approach. Here we proposed a technique that is able
to accept various data forms as input such as text, image,
audio and video with Unicode approach to reach more users
worldwide. However existing approaches in the field of
cryptography focuses only based on ASCII character set,
ignoring non English users [1].
As we know the use of internet is increasing day by
day not only through computers but also through smart
phones, a lot of new technologies and optimized use of
resources are expected by an individual or by any Fig. 1. System Design
organization. Data load will be more on networks and at the
same time there are higher chances of capturing, stealing, The receiver is receiving the key from sender; the receiver
modifying or cracking of data can be done by an attacker or uses this key to get the original message. The cipher text is
intruder, which leads to a need of a new technology which can unreadable after the encryption; we can read the text by using
fulfill high storage, randomness nature in generating keys used the key to convert cipher text to original message. There are
in encryption as well as decryption by providing more secure two types of cryptography one is symmetric cryptography in
and reliable communication [6]. which sender and receiver share a single secret key between
them (Such as in AES algorithm). Another one is asymmetric
cryptography in which pair of keys are used; one is public key
at the sender and the private key at the receiver. Public key

978-1-5386-7709-4/18/$31.00 2018
c IEEE 223
may be known to anyone (Such as in RSA algorithm).The
results proved that symmetric cryptography is faster than
asymmetric one.
A. Activity Diagram
The following figure 2 shows the activity diagram of a
dynamic DNA for key-based Cryptography.

Fig. 3. Sequence Diagram

IV. IMPLEMENTATION
Here we implemented the code for DNA algorithm in
NetBeans IDE environment, which encrypts and decrypts the
characters, text file, image file and audio file by using Java
language through following steps:
1. Select the text/file which contain data
2. Convert data into ASCII equivalent and then into
Unicode characters
3. Convert Unicode to hexadecimal
4. Convert hexadecimal to binary
5. Convert binary to DNA digital code
6. Check the file content which contain DNA
Fig. 2. Activity Diagram
amplified data (Generated Message)
7. Get DNA amplified data to original text
The above figure 2 shows the workflow of the software (Decryption)
on the original message selected to encode i.e start of A. Encryption Module
encryption process, DNA digital coding is used to encode the The following figure 4 shows the actual encryption process in
message, after the encryption the random key is generated, which the original message is converted to the ASCII later
and cipher text is made ready to send. In decryption side the into Unicode characters then converted to hexadecimal. After
amplified message is received, started to decrypt by using the hexadecimal it is converted into binary. After the binary
DNA digital coding and finally entering the key to get the conversion, the message is divided into four parts of message
original message. then using DNA digital coding and key combination the
message was generated and transferred over the network.
B. Sequence Diagram
The figure 3 shows a sequence diagram of dynamic DNA for
key-based Cryptography approach.It shows an interaction
between components such as Sender,Encryption Module,
Decryption Module, Receiver. Initially a sender sends an
original message and converts it into ciphertext by using DNA
Cryptographic algorithm (Encryption Module) which is also
able to generate a random key communicated with
Receiver.When the receiver receives a ciphertext it applies the
random key communicated by sender over ciphertext to
collect back the original message by using DNA
Cryptographic algorithm (Decryption Module).The arrow
labelled with ‘communication’ indicates the handshaking
where parties will be agreed upon some protocols such as in
case of Advanced Encryption standard (AES),Diffie-
Hellman(DH).The decryption process is reversed process of
encryption using DNA Digital Coding.

Fig. 4. Encryption Process

224 2018 International Conference on Computational Techniques, Electronics and Mechanical Systems (CTEMS)
B. Decryption Module From the table II, Here we are able to generate total of 72 bit
The following Figure 5 shows the decryption process in which keys that is 64 bits key value from key combination adding
the receiver uses the key combination and DNA digital coding along with 8 bits of ATGC. The initial key in the form of
along with key to decode amplified message into original ATGC will be used to produce a random key at the sender will
message. be submitted to receiver. In this system, every time we can
generate key at sender with particular value will be randomly
changed for different communication or transaction [1].

TABLE II. KEY COMBINATION

Key Combination Patterns Values

AA 0101 5
AT 0011 3
AG 0001 1
AC 0010 2
TA 0110 6
TT 1111 15
TG 0111 7
TC 1001 9
GA 1010 10
GT 0100 4
GG 1000 8
GC 1100 12
CA 1110 14
CT 1011 11
CG 0000 0
CC 1101 13
Fig. 5. Decryption Process

After the message is divided into four parts the message is To understand the scenario of encryption process flow chart
converted to the binary form to hexadecimal form and then we consider one example. In this example the plaintext is
ASCII to original Message. ‘cryptography’ and performing encryption operation.

C. DNA Digital Coding Encryption Process:

DNA digital coding is required in which we are considering Plaintext: cryptography
DNA basic nucleotides assigned with binary values. The We can convert the plaintext to Unicode format to get the
binary values use two state levels such as combinations of 0 cipher text.
and 1.As the DNA digital coding uses four nucleotides (A, T,
G, and C) can be initialized and assigned with binary values as Unicode:
shown in table I [1]. \u0e0\u0aa\u02020\u0e0\u0aa\u0b6\u0e0\u0aa\u0bf\u0e0\u0a\
u0b7
TABLE I. DNA DIGITAL CODING
After Unicode is converted into hexadecimal value.
Binary Value DNA Digital Coding
00 A
Hexadecimal value:
01 T
10 G 5c753065305c753061615c7530323032305c753065305c7530
11 C 61615c753062365c753065305c753061615c753062665c7530
65305c753061615c75306237

D. Key Combination The hexadecimal value is then converted into the binary form
Using ATGC as an initial key, every base have 2 bits by using the key combination. Every bit has the 2 bits.
like A=00, T=01, G=10, and C=11.We are going to combine Suppose if the hexadecimal value is 5 then its binary value
one base with all other bases i.e key combination and later will be 0101.
assigning of random values can be made respectively with
their equivalent pattern values in the form of binary is as
shown in table II. By using this key combination table we can
convert the hexadecimal value to binary form and later into
DNA digital code and finally into the amplified message.

2018 International Conference on Computational Techniques, Electronics and Mechanical Systems (CTEMS) 225
Binary value: 11101001111100100101011100110111001111111110100111
11001001010111000101110111111111101001111100100101
01011100011101010011000001100101001100000101110001
01111111001001011111111010011111001001010111001101
11010100110000011000010110000101011100011101010011
1100111111111010011111001001010111000100101001
00000011001000110000001100100011000001011100011101
01001100000110010100110000010111000111010100110000
Now after receiving the amplified message it is converted to
01100001011000010101110001110101001100000110001000
the DNA digital coding using ATGC key and key
11011001011100011101010011000001100101001100000101
combination, to retrieve original message.
10001110101001100000110000101100001010111000111010
10011000001100010011001100101110001110101001100000
DNA Digital coding:
1100101001100000101110001110101001100000110000101
1000010101110001110101001100000110001000110111 TTCATCTTACAATGTTACAATTCATCTTACAATGATT
GATTTCATCTTACAAACAGACAAACAGACAATTCAT
After the binary value it can be now converted to DNA digital CTTACAATGTTACAATTCATCTTACAATGATTGATTT
coding format. CATCTTACAATGAGACTGTTCATCTTACAATGTTACA
ATTCATCTTACAATGATTGATTTCATCTTACAATGAG
DNA Digital coding: TGTGTTCATCTTACAATGTTACAATTCATCTTACAAT
GATTGATTTCATCTTACAATGAGACTC
From table I, we can write
TTCATCTTACAATGTTACAATTCATCTTACAATGATT From the table I of DNA digital coding now we can generate
GATTTCATCTTACAAACAGACAAACAGACAATTCAT the binary form. Suppose if TT is DNA digital code we can
CTTACAATGTTACAATTCATCTTACAATGATTGATTT convert to binary form 0101.
CATCTTACAATGAGACTGTTCATCTTACAATGTTACA
ATTCATCTTACAATGATTGATTTCATCTTACAATGAG Binary value:
TGTGTTCATCTTACAATGTTACAATTCATCTTACAAT
01011100011101010011000001100101001100000101110001
GATTGATTTCATCTTACAATGAGACTC
11010100110000011000010110000101011100011101010011
00000011001000110000001100100011000001011100011101
Now from table II, by using the DNA digital coding and the
01001100000110010100110000010111000111010100110000
key combination we can generate amplified message that can
01100001011000010101110001110101001100000110001000
be transferred over the network as shown below.
11011001011100011101010011000001100101001100000101
11000111010100110000011000010110000101011100011101
Amplified Message:
01001100000110001001100110010111000111010100110000
11111110100111110010010101111111001001011111111010 01100101001100000101110001110101001100000110000101
01111100100101011100110111001111111101001111100100 1000010101110001110101001100000110001000110111
10100110001001001010010000100100101111111110100111
11001001010111111100100101111111101001111100100101 Now we can convert binary form to hexadecimal value.
01110011011100111111111010011111001001010111000100 Suppose if binary value is 0101 then we get the hexadecimal
10011111111110100111110010010101111111001001011111 value as 5.
11101001111100100101011100110111001111111110100111 Hexadecimal value:
10010010101110001011101111111111010011111001001010
5c753065305c753061615c7530323032305c753065305c7530
1111111001001011111111010011111001001010111001101
61615c753062365c753065305c753061615c753062665c7530
1100111111111010011111001001010111000100101001
65305c753061615c75306237
The hexadecimal value is then converted to the Unicode value
Decryption Process:
to get original message.
Now at receiver side, the receiver receives the amplified
message and uses ATGC key for decryption purpose.
Unicode:
\u0e0\u0aa\u02020\u0e0\u0aa\u0b6\u0e0\u0aa\u0bf\u0e0\u0a
Amplified Message: a\u0b7
11111110100111110010010101111111001001011111111010 Finally the Unicode value is converted to the original message
01111100100101011100110111001111111101001111100100 as below.
10100110001001001010010000100100101111111110100111
11001001010111111100100101111111101001111100100101 Plaintext: cryptography
01110011011100111111111010011111001001010111000100 The table III shows the time and space analysis in
10011111111110100111110010010101111111001001011111 milliseconds (ms) and in Kilo Bytes (KB) respectively, for
encryption and decryption processes along with input size on
disk.

226 2018 International Conference on Computational Techniques, Electronics and Mechanical Systems (CTEMS)
 TABLE III. TIME AND SPACE ANALYSIS [3] M R Saranya,Arun K Mohan and K.Anusudha, “Algorithm for
Enhanced Image Security Using DNA and Genetic Algorithm”, IEEE,
Input Size on Disk Time Taken Time Taken April 2015.
for for [4] Ajit Singh and Reena Singh, “Information Hiding Techniques Based on
Encryption Decryption DNA Inconsistency: An Overview”, IEEE, May 2015.
Plain Text 5 letter 8325.816ms 5.346728ms [5] Deepak Singh Chouhan,R.P.Mahajan, “An Architectural Framework for
Text File 10KB 5529.8784ms 4.54851ms Encryption & Generation of Digital Signature Using DNA
Cryptography”, IEEE,pp. 743-748, June 2014.
Image 90KB 7397.661ms 5223.019ms
[6] Tushar Mandge and Vijay Choudhary, “A DNA Encryption Technique
Audio 490KB 14580.631ms 2243.8176ms Based on Matrix Manipulation and Secure key Generation
Scheme”,IEEE, 2013.
[7] Anchal Jain, “Adaptive Key Length Based Encryption Algorithm using
DNA Approach”, IEEE ,2013.
[8] Zhang Yunpeng, Zhu Yu, Wang Zhong and Richard O.Sinnott, “Index-
Based Symmetric DNA Encryption Algorithm”,IEEE,pp. 2290-
2294,2011.
[9] G. Cui, L. Qin , Y. Wang , X. Zhang, “An Encryption Scheme Using
DNA Technology”, IEEE, 2008.
[10] Hamza Hammami, Hanen Brahmi, Sadok Ben Yahia “Secured
Outsourcing Towards a Cloud Computing Environment Based on DNA
Cryptography”,IEEE page no. 31-36,2018
Fig. 6. Performance Analysis [11] S.V.Keerthana Priya, S.J.Saritha , “A Robust Technique to Generate
Unique Code DNA Sequence”,IEEE, page no.3815-3820,2017
The above figure 6 shows the performance analysis in [12] Mona Sabry, Mohamed Hashem, Taymoor Nazmy, Mohamed Essam
terms of time taken for the encryption process and decryption Khalifa , “Design of DNA-based Advanced Encryption Standard
process in milliseconds for different inputs such as plain text, (AES)”,IEEE, pp. 390-397,2015.
text file, image, audio. Note that the decryption time taken will [13] Deepak Kumar and Shailendra Singh ,“Secret Data Writing Using DNA
be less compared to encryption time taken with various data. Sequences”,IEEE,pp. 402-405,2011.
Hence proposed approach is energy efficient. [14] Guangzhao Cui , Limin Qin, Yanfeng Wang and Xuncai Zhang, “An
Encryption Scheme Using DNA Technology”,IEEE,pp. 37-41,2008.
[15] Vikas Sagar and Krishan Kumar, “A Symmetric Key Cryptography
CONCLUSION using Genetic Algorithm and Error Back Propagation Neural
Network”,IEEE, pp. 1396-1391,2015.
The proposed approach a Dynamic DNA for key
[16] Nisha Kumari, Akhil Kaushik, “A Three Dimensional Model for Image
based approach is able to accept various forms of data such as Based Information Security”, International Conference on
characters, text file, image and audio. Random key will be Computational Intelligence and Communication Networks, 2014.
generated at the sender every time will be used for decrypting [17] Sudesh, Akhil Kaushik, Satvika Kaushik. “A two stage hybrid model for
the ciphertext at the receiver makes the approach very strong image encryption and compression to enhance security and efficiency”,
against various attacks. The proposed approach is difficult to International Conference on Advances in Engineering & Technology
Research (ICAETR – 2014).
break by a common cryptanalysis techniques.This approach
provides two-stage security, improved reliability and better
time and computational complexities.
ACKNOWLEDGMENT
Gratitude is the noblest gesture of one towards another.
Any endeavor undertaken is incomplete without expressing
gratitude to the people who made it possible. I take this
opportunity to express my profound gratefulness and regards to
my guide and mentor Dr. Latha Parthiban for her exemplary
and constant encouragement. I am greatly indebted to her for
valuable timely inputs and rigorous reviews and suggestions.
I extend thankfulness to Dr. Veena Desai, Prof., Dept. of
E&C, GIT, Belagavi for her timely suggestions and motivation.

REFERENCES
[1] Prajapati Ashishkumar B and Prajapati Barkha, “Implementation Of
DNA Cryptography In Cloud Computing and Using Socket
Programming”, IEEE, January 2016.
[2] Naveen Jarold, P Karthigaikumar, N M Sivamangai, Sandhya R, Sruthi
B Ashok, “Hardware Implementation of DNA based Cryptography”,
Conference on Information and Communication Technologies, IEEE,
pp. 696-700,2013.

2018 International Conference on Computational Techniques, Electronics and Mechanical Systems (CTEMS) 227